run_metadata
495 rows where experiment.library_layout = "SINGLE", experiment.library_source = "TRANSCRIPTOMIC" and technology = "generic-scrnaseq-only"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 30691 | 30691 | SRR28270998 | SRX23880961 | SRS20704477 | SRP494117 | PRJNA1085662 | Roxithromycin exposure induces motoneuron malformation and behavioral deficits of zebrafish by interfering with the differentiation of motor neuron progenitor cells | PRJNA1085662 | Other | Roxithromycin ROX a commonly used macrolide antibiotic is extensively employed in human medicine and livestock industries. Due to its structural stability and resistance to biological degradation ROX persists as a resilient environmental contaminant detectable in aquatic ecosystems and food products. However our understanding of the potential health risks to humans from continuous ROX exposure remains limited. In this study we used the zebrafish as a vertebrate model to explore the potential developmental toxicity of early ROX exposure particularly focusing on its effects on locomotor functionality and motoneuron development. Early exposure to ROX induces marked developmental toxicity in zebrafish embryos significantly reducing hatch rates body lengths and increased malformation rates. Moreover ROX exposure adversely affected the locomotive capacity of zebrafish embryos and observations in transgenic zebrafish Tghb9:eGFP revealed axonal loss in motor neurons evident through reduced or irregular axonal lengths. Concurrently abnormal apoptosis in ROX exposed zebrafish embryos intensified alongside the upregulation of apoptosis related genes bax bcl2 caspase 3a. Single cell sequencing further disclosed substantial effects of ROX on genes involved in the differentiation of motor neuron progenitor cells ngn1 olig2 axon development cd82a mbpa plp1b sema5a and neuroimmunity aplnrb aplnra in zebrafish larvae. Furthermore the motor neuron defects induced by ROX can be rescued by administering ngn1 agonist. In summary ROX exposure leads to early life abnormalities in zebrafish motor neurons and locomotor behavior by hindering the differentiation of motor neuron progenitor cells and inducing abnormal apoptosis. | WT | strain:not provided|isolate:not provided|breed:not provided|cultivar:not provided|ecotype:not provided|age:not provided|dev stage:not provided|collection date:not provided|geo loc name:not provided|sex:not provided|tissue:Cerebrum|BioSampleModel:Model organism or animal | Roxithromycin exposure induces mot1uron malformation and behavioral deficits of zebrafish by interfering with the differentiation of motor neuron progenitor cells | DANIO | DANIO | Illumina Second Generation Sequencing | RNA-Seq | TRANSCRIPTOMIC | cDNA_oligo_dT | SINGLE | BGISEQ | BGISEQ-500 | SRP494117 | WT_S1_L001_I1_001.fastq.gz | fastq | 7991376264.0 | 998922033.0 | WT S1 L001 I1 001.fastq.gz | 0:8 | A:2573734851;C:1426474966;G:1492966198;T:2498173074;N:27175 | 8 | 2573734851 | 1426474966 | 1492966198 | 2498173074 | 27175 | SRX23880961 | SRS20704477 | SRA1820072 | shantou university|Neurobiology Center | shantou university | 1 | 0.0 | 0.0 | 1.0 | 8 | T | under 1.2% mapping rate | bgi | bgi | unknown | poly_a | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | China | 2024-03-11 | Undetermined | Multi-stage | Brain | Nervous System | |||||||||||||||||||||||||||||
| 40701 | 40701 | SRR3231363 | SRX1637111 | SRS1342926 | SRP071849 | PRJNA315400 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq] | GSE79161 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction. | parent bioproject:PRJNA315403 | pubmed:30086300 | Input 3 | GSM2087141 | tissue:Zebrafish Zygotes|fraction:Input | Input 3 | Reads were mapped to Zv9 using tophat trapnell et al 2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al 2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name. | Zebrafish Zygotes | mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. | Zebrafish were maintained under standard conditions. | fraction:Input | GSM2087141 | GSM2087141: Input 3; Danio rerio; RIP Seq | GSM2087141 | 1 | mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. | GEO Accession:GSM2087141 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP071849 | WT_Input_3.fastq.gz | fastq | 1902296226.0 | 37299926.0 | GSM2087141 r1 | 0:51 | A:466290166;C:465344039;G:486942278;T:483240280;N:479463 | 51 | 466290166 | 465344039 | 486942278 | 483240280 | 479463 | SRX1637111 | SRS1342926 | SRA385813 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.85793 | 0.14814 | 0.79941 | 0.55214 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2016-03-13 | Zygote | Embryo | Oocyte | Reproductive System | |||||||||||||||||
| 40702 | 40702 | SRR3231362 | SRX1637110 | SRS1342927 | SRP071849 | PRJNA315400 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq] | GSE79161 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction. | parent bioproject:PRJNA315403 | pubmed:30086300 | Input 2 | GSM2087140 | tissue:Zebrafish Zygotes|fraction:Input | Input 2 | Reads were mapped to Zv9 using tophat trapnell et al 2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al 2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name. | Zebrafish Zygotes | mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. | Zebrafish were maintained under standard conditions. | fraction:Input | GSM2087140 | GSM2087140: Input 2; Danio rerio; RIP Seq | GSM2087140 | 1 | mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. | GEO Accession:GSM2087140 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP071849 | WT_Input_2.fastq.gz | fastq | 1540737999.0 | 30210549.0 | GSM2087140 r1 | 0:51 | A:380481772;C:379741192;G:395453141;T:384675313;N:386581 | 51 | 380481772 | 379741192 | 395453141 | 384675313 | 386581 | SRX1637110 | SRS1342927 | SRA385813 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.8787 | 0.14935 | 0.79202 | 0.54381 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2016-03-13 | Zygote | Embryo | Oocyte | Reproductive System | |||||||||||||||||
| 40703 | 40703 | SRR3231361 | SRX1637109 | SRS1342928 | SRP071849 | PRJNA315400 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq] | GSE79161 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction. | parent bioproject:PRJNA315403 | pubmed:30086300 | Input 1 | GSM2087139 | tissue:Zebrafish Zygotes|fraction:Input | Input 1 | Reads were mapped to Zv9 using tophat trapnell et al 2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al 2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name. | Zebrafish Zygotes | mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. | Zebrafish were maintained under standard conditions. | fraction:Input | GSM2087139 | GSM2087139: Input 1; Danio rerio; RIP Seq | GSM2087139 | 1 | mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. | GEO Accession:GSM2087139 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP071849 | WT_Input_1.fastq.gz | fastq | 1109818905.0 | 21761155.0 | GSM2087139 r1 | SRX1637109 | SRS1342928 | SRA385813 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.87467 | 0.18794 | 0.79411 | 0.63378 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2016-03-13 | Zygote | Embryo | Oocyte | Reproductive System | |||||||||||||||||||||||||
| 40704 | 40704 | SRR3231360 | SRX1637108 | SRS1342929 | SRP071849 | PRJNA315400 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq] | GSE79161 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction. | parent bioproject:PRJNA315403 | pubmed:30086300 | Tdrd6a IP 3 | GSM2087138 | tissue:Zebrafish Zygotes|fraction:Tdrd6a IP | Tdrd6a IP 3 | Reads were mapped to Zv9 using tophat trapnell et al 2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al 2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name. | Zebrafish Zygotes | mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. | Zebrafish were maintained under standard conditions. | fraction:Tdrd6a IP | GSM2087138 | GSM2087138: Tdrd6a IP 3; Danio rerio; RIP Seq | GSM2087138 | 1 | mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. | GEO Accession:GSM2087138 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP071849 | WT_Tdrd6a_IP_3.fastq.gz | fastq | 843641439.0 | 16541989.0 | GSM2087138 r1 | 0:51 | A:216465581;C:196892096;G:207722567;T:222361382;N:199813 | 51 | 216465581 | 196892096 | 207722567 | 222361382 | 199813 | SRX1637108 | SRS1342929 | SRA385813 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.84615 | 0.08957 | 0.78768 | 0.50612 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2016-03-13 | Zygote | Embryo | Oocyte | Reproductive System | |||||||||||||||||
| 40705 | 40705 | SRR3231359 | SRX1637107 | SRS1342930 | SRP071849 | PRJNA315400 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq] | GSE79161 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction. | parent bioproject:PRJNA315403 | pubmed:30086300 | Tdrd6a IP 2 | GSM2087137 | tissue:Zebrafish Zygotes|fraction:Tdrd6a IP | Tdrd6a IP 2 | Reads were mapped to Zv9 using tophat trapnell et al 2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al 2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name. | Zebrafish Zygotes | mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. | Zebrafish were maintained under standard conditions. | fraction:Tdrd6a IP | GSM2087137 | GSM2087137: Tdrd6a IP 2; Danio rerio; RIP Seq | GSM2087137 | 1 | mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. | GEO Accession:GSM2087137 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP071849 | WT_Tdrd6a_IP_2.fastq.gz | fastq | 391198050.0 | 7670550.0 | GSM2087137 r1 | 0:51 | A:99015594;C:91525929;G:97155710;T:103371571;N:129246 | 51 | 99015594 | 91525929 | 97155710 | 103371571 | 129246 | SRX1637107 | SRS1342930 | SRA385813 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.85778 | 0.12015 | 0.80515 | 0.47541 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2016-03-13 | Zygote | Embryo | Oocyte | Reproductive System | |||||||||||||||||
| 40706 | 40706 | SRR3231358 | SRX1637106 | SRS1342931 | SRP071849 | PRJNA315400 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq] | GSE79161 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction. | parent bioproject:PRJNA315403 | pubmed:30086300 | Tdrd6a IP 1 | GSM2087136 | tissue:Zebrafish Zygotes|fraction:Tdrd6a IP | Tdrd6a IP 1 | Reads were mapped to Zv9 using tophat trapnell et al 2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al 2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name. | Zebrafish Zygotes | mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. | Zebrafish were maintained under standard conditions. | fraction:Tdrd6a IP | GSM2087136 | GSM2087136: Tdrd6a IP 1; Danio rerio; RIP Seq | GSM2087136 | 1 | mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing. | GEO Accession:GSM2087136 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP071849 | WT_Tdrd6a_IP_1.fastq.gz | fastq | 1927415052.0 | 37792452.0 | GSM2087136 r1 | 0:51 | A:498125298;C:444860381;G:468826607;T:515142356;N:460410 | 51 | 498125298 | 444860381 | 468826607 | 515142356 | 460410 | SRX1637106 | SRS1342931 | SRA385813 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.86194 | 0.09753 | 0.80146 | 0.47808 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2016-03-13 | Zygote | Embryo | Oocyte | Reproductive System | |||||||||||||||||
| 41355 | 41355 | SRR4342171 | SRX2209226 | SRS1726586 | SRP090801 | PRJNA345325 | Comparison of tbx5 positive ventricular cardiomyoctes with the rest of ventricular cardiomyocytes from adult zebrafish hearts | GSE87596 | Transcriptome Analysis | In vertebrates the heart has two main layers of cardiac muscle a peripheral compact layer and an internal trabecular layer. Little is known on the differerences in gene expression between both layers. In zebrafish the outer layer is named cortical layer and the internal also trabecular layer. Here we used a double transgenic line labelling with GFP tbx5 positive cells and cardiomyoctes with nuclear DsRed nucDsRed to distinguish cortical from trabecular myocardium. Then we compared the transcriptome of trabecular and cortical myocardium in the adult zebrafish. We describe that Tbx5a is a good marker of trabecular myocardium. Overall design: Four paired biological replicates consisting on Tbx5 positive and Tbx5 negative adult zebrafish ventricular cardiomyocytes were analysed by RNA seq to compare their transcriptomic profiles. | pubmed:29382818 | tbx5 9pos | GSM2334964 | source name:Heart|age:Adult|tissue:Heart|cell type:Tbx5 positive ventricular cardiomyocytes|pair:9 | tbx5 9pos | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.3. Genome build: Ensembl genebuild 75 Danio rerio assembly Zv9. Supplementary files format and content: matrix table.xls file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | GFP/nucDsRed and nucDsRed cells were isolated using FAC sorting from Tgtbx5:GFP/myl7:nucDsRed double transgenic adult zebrafish cardiac ventricles. Cells were sorted using SONY Synergy sy3200. | RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions. 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. 4 biological replicates consisting of 5 pooled hearts were used per sample. | All experiments were conducted with adult zebrafish between 6 month and 9 month of age raised at a density of 3 fish/l. | age:Adult|tissue:Heart|cell type:Tbx5 positive ventricular cardiomyocytes|pair:9 | GSM2334964 | GSM2334964: tbx5 9pos; Danio rerio; RNA Seq | GSM2334964 | 1 | RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions. 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. 4 biological replicates consisting of 5 pooled hearts were used per sample. | GEO Accession:GSM2334964 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP090801 | tbx5_9pos__HectorSanchez_RNA_Seq_OvationSC_ACCTCA_L002_R1_001.fastq.gz | fastq | 783131298.0 | 12838218.0 | GSM2334964 r1 | 0:61 | A:231794213;C:152686156;G:196289761;T:202337851;N:23317 | 61 | 231794213 | 152686156 | 196289761 | 202337851 | 23317 | SRX2209226 | SRS1726586 | SRA481772 | GEO | Bioinformatics Unit, CNIC | 1 | 0.91274 | 0.14772 | 0.85084 | 0.58033 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2016-10-04 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 41356 | 41356 | SRR4342170 | SRX2209225 | SRS1726587 | SRP090801 | PRJNA345325 | Comparison of tbx5 positive ventricular cardiomyoctes with the rest of ventricular cardiomyocytes from adult zebrafish hearts | GSE87596 | Transcriptome Analysis | In vertebrates the heart has two main layers of cardiac muscle a peripheral compact layer and an internal trabecular layer. Little is known on the differerences in gene expression between both layers. In zebrafish the outer layer is named cortical layer and the internal also trabecular layer. Here we used a double transgenic line labelling with GFP tbx5 positive cells and cardiomyoctes with nuclear DsRed nucDsRed to distinguish cortical from trabecular myocardium. Then we compared the transcriptome of trabecular and cortical myocardium in the adult zebrafish. We describe that Tbx5a is a good marker of trabecular myocardium. Overall design: Four paired biological replicates consisting on Tbx5 positive and Tbx5 negative adult zebrafish ventricular cardiomyocytes were analysed by RNA seq to compare their transcriptomic profiles. | pubmed:29382818 | tbx5 9neg | GSM2334963 | source name:Heart|age:Adult|tissue:Heart|cell type:Tbx5 negative ventricular cardiomyocytes|pair:9 | tbx5 9neg | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.3. Genome build: Ensembl genebuild 75 Danio rerio assembly Zv9. Supplementary files format and content: matrix table.xls file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | GFP/nucDsRed and nucDsRed cells were isolated using FAC sorting from Tgtbx5:GFP/myl7:nucDsRed double transgenic adult zebrafish cardiac ventricles. Cells were sorted using SONY Synergy sy3200. | RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions. 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. 4 biological replicates consisting of 5 pooled hearts were used per sample. | All experiments were conducted with adult zebrafish between 6 month and 9 month of age raised at a density of 3 fish/l. | age:Adult|tissue:Heart|cell type:Tbx5 negative ventricular cardiomyocytes|pair:9 | GSM2334963 | GSM2334963: tbx5 9neg; Danio rerio; RNA Seq | GSM2334963 | 1 | RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions. 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. 4 biological replicates consisting of 5 pooled hearts were used per sample. | GEO Accession:GSM2334963 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP090801 | tbx5_9neg__HectorSanchez_RNA_Seq_OvationSC_GTGCTT_L002_R1_001.fastq.gz | fastq | 597229833.0 | 9790653.0 | GSM2334963 r1 | 0:61 | A:182072130;C:116058906;G:143260521;T:155820528;N:17748 | 61 | 182072130 | 116058906 | 143260521 | 155820528 | 17748 | SRX2209225 | SRS1726587 | SRA481772 | GEO | Bioinformatics Unit, CNIC | 1 | 0.8964 | 0.14551 | 0.85612 | 0.54858 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2016-10-04 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 41357 | 41357 | SRR4342169 | SRX2209224 | SRS1726585 | SRP090801 | PRJNA345325 | Comparison of tbx5 positive ventricular cardiomyoctes with the rest of ventricular cardiomyocytes from adult zebrafish hearts | GSE87596 | Transcriptome Analysis | In vertebrates the heart has two main layers of cardiac muscle a peripheral compact layer and an internal trabecular layer. Little is known on the differerences in gene expression between both layers. In zebrafish the outer layer is named cortical layer and the internal also trabecular layer. Here we used a double transgenic line labelling with GFP tbx5 positive cells and cardiomyoctes with nuclear DsRed nucDsRed to distinguish cortical from trabecular myocardium. Then we compared the transcriptome of trabecular and cortical myocardium in the adult zebrafish. We describe that Tbx5a is a good marker of trabecular myocardium. Overall design: Four paired biological replicates consisting on Tbx5 positive and Tbx5 negative adult zebrafish ventricular cardiomyocytes were analysed by RNA seq to compare their transcriptomic profiles. | pubmed:29382818 | tbx5 8pos | GSM2334962 | source name:Heart|age:Adult|tissue:Heart|cell type:Tbx5 positive ventricular cardiomyocytes|pair:8 | tbx5 8pos | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.3. Genome build: Ensembl genebuild 75 Danio rerio assembly Zv9. Supplementary files format and content: matrix table.xls file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | GFP/nucDsRed and nucDsRed cells were isolated using FAC sorting from Tgtbx5:GFP/myl7:nucDsRed double transgenic adult zebrafish cardiac ventricles. Cells were sorted using SONY Synergy sy3200. | RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions. 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. 4 biological replicates consisting of 5 pooled hearts were used per sample. | All experiments were conducted with adult zebrafish between 6 month and 9 month of age raised at a density of 3 fish/l. | age:Adult|tissue:Heart|cell type:Tbx5 positive ventricular cardiomyocytes|pair:8 | GSM2334962 | GSM2334962: tbx5 8pos; Danio rerio; RNA Seq | GSM2334962 | 1 | RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions. 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. 4 biological replicates consisting of 5 pooled hearts were used per sample. | GEO Accession:GSM2334962 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP090801 | tbx5_8pos__HectorSanchez_RNA_Seq_OvationSC_AGTGAG_L001_R1_001.fastq.gz | fastq | 749298746.0 | 12283586.0 | GSM2334962 r1 | 0:61 | A:223933431;C:143222641;G:189173448;T:192959794;N:9432 | 61 | 223933431 | 143222641 | 189173448 | 192959794 | 9432 | SRX2209224 | SRS1726585 | SRA481772 | GEO | Bioinformatics Unit, CNIC | 1 | 0.91034 | 0.13718 | 0.85192 | 0.56656 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2016-10-04 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 41358 | 41358 | SRR4342168 | SRX2209223 | SRS1726584 | SRP090801 | PRJNA345325 | Comparison of tbx5 positive ventricular cardiomyoctes with the rest of ventricular cardiomyocytes from adult zebrafish hearts | GSE87596 | Transcriptome Analysis | In vertebrates the heart has two main layers of cardiac muscle a peripheral compact layer and an internal trabecular layer. Little is known on the differerences in gene expression between both layers. In zebrafish the outer layer is named cortical layer and the internal also trabecular layer. Here we used a double transgenic line labelling with GFP tbx5 positive cells and cardiomyoctes with nuclear DsRed nucDsRed to distinguish cortical from trabecular myocardium. Then we compared the transcriptome of trabecular and cortical myocardium in the adult zebrafish. We describe that Tbx5a is a good marker of trabecular myocardium. Overall design: Four paired biological replicates consisting on Tbx5 positive and Tbx5 negative adult zebrafish ventricular cardiomyocytes were analysed by RNA seq to compare their transcriptomic profiles. | pubmed:29382818 | tbx5 8neg | GSM2334961 | source name:Heart|age:Adult|tissue:Heart|cell type:Tbx5 negative ventricular cardiomyocytes|pair:8 | tbx5 8neg | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.3. Genome build: Ensembl genebuild 75 Danio rerio assembly Zv9. Supplementary files format and content: matrix table.xls file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | GFP/nucDsRed and nucDsRed cells were isolated using FAC sorting from Tgtbx5:GFP/myl7:nucDsRed double transgenic adult zebrafish cardiac ventricles. Cells were sorted using SONY Synergy sy3200. | RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions. 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. 4 biological replicates consisting of 5 pooled hearts were used per sample. | All experiments were conducted with adult zebrafish between 6 month and 9 month of age raised at a density of 3 fish/l. | age:Adult|tissue:Heart|cell type:Tbx5 negative ventricular cardiomyocytes|pair:8 | GSM2334961 | GSM2334961: tbx5 8neg; Danio rerio; RNA Seq | GSM2334961 | 1 | RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions. 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. 4 biological replicates consisting of 5 pooled hearts were used per sample. | GEO Accession:GSM2334961 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP090801 | tbx5_8neg__HectorSanchez_RNA_Seq_OvationSC_GCACTA_L001_R1_001.fastq.gz | fastq | 671219417.0 | 11003597.0 | GSM2334961 r1 | 0:61 | A:200873049;C:127618001;G:167285388;T:175434453;N:8526 | 61 | 200873049 | 127618001 | 167285388 | 175434453 | 8526 | SRX2209223 | SRS1726584 | SRA481772 | GEO | Bioinformatics Unit, CNIC | 1 | 0.89809 | 0.15716 | 0.84634 | 0.55363 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2016-10-04 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 41359 | 41359 | SRR4342167 | SRX2209222 | SRS1726583 | SRP090801 | PRJNA345325 | Comparison of tbx5 positive ventricular cardiomyoctes with the rest of ventricular cardiomyocytes from adult zebrafish hearts | GSE87596 | Transcriptome Analysis | In vertebrates the heart has two main layers of cardiac muscle a peripheral compact layer and an internal trabecular layer. Little is known on the differerences in gene expression between both layers. In zebrafish the outer layer is named cortical layer and the internal also trabecular layer. Here we used a double transgenic line labelling with GFP tbx5 positive cells and cardiomyoctes with nuclear DsRed nucDsRed to distinguish cortical from trabecular myocardium. Then we compared the transcriptome of trabecular and cortical myocardium in the adult zebrafish. We describe that Tbx5a is a good marker of trabecular myocardium. Overall design: Four paired biological replicates consisting on Tbx5 positive and Tbx5 negative adult zebrafish ventricular cardiomyocytes were analysed by RNA seq to compare their transcriptomic profiles. | pubmed:29382818 | tbx5 2pos | GSM2334960 | source name:Heart|age:Adult|tissue:Heart|cell type:Tbx5 positive ventricular cardiomyocytes|pair:2 | tbx5 2pos | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.3. Genome build: Ensembl genebuild 75 Danio rerio assembly Zv9. Supplementary files format and content: matrix table.xls file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | GFP/nucDsRed and nucDsRed cells were isolated using FAC sorting from Tgtbx5:GFP/myl7:nucDsRed double transgenic adult zebrafish cardiac ventricles. Cells were sorted using SONY Synergy sy3200. | RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions. 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. 4 biological replicates consisting of 5 pooled hearts were used per sample. | All experiments were conducted with adult zebrafish between 6 month and 9 month of age raised at a density of 3 fish/l. | age:Adult|tissue:Heart|cell type:Tbx5 positive ventricular cardiomyocytes|pair:2 | GSM2334960 | GSM2334960: tbx5 2pos; Danio rerio; RNA Seq | GSM2334960 | 1 | RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions. 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. 4 biological replicates consisting of 5 pooled hearts were used per sample. | GEO Accession:GSM2334960 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP090801 | tbx5_2pos__HectorSanchez_RNA_Seq_OvationSC_AACCAG_L001_R1_001.fastq.gz | fastq | 721753525.0 | 11832025.0 | GSM2334960 r1 | 0:61 | A:210172867;C:139636671;G:184046654;T:187888215;N:9118 | 61 | 210172867 | 139636671 | 184046654 | 187888215 | 9118 | SRX2209222 | SRS1726583 | SRA481772 | GEO | Bioinformatics Unit, CNIC | 1 | 0.88264 | 0.17411 | 0.85027 | 0.50468 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2016-10-04 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 41360 | 41360 | SRR4342166 | SRX2209221 | SRS1726581 | SRP090801 | PRJNA345325 | Comparison of tbx5 positive ventricular cardiomyoctes with the rest of ventricular cardiomyocytes from adult zebrafish hearts | GSE87596 | Transcriptome Analysis | In vertebrates the heart has two main layers of cardiac muscle a peripheral compact layer and an internal trabecular layer. Little is known on the differerences in gene expression between both layers. In zebrafish the outer layer is named cortical layer and the internal also trabecular layer. Here we used a double transgenic line labelling with GFP tbx5 positive cells and cardiomyoctes with nuclear DsRed nucDsRed to distinguish cortical from trabecular myocardium. Then we compared the transcriptome of trabecular and cortical myocardium in the adult zebrafish. We describe that Tbx5a is a good marker of trabecular myocardium. Overall design: Four paired biological replicates consisting on Tbx5 positive and Tbx5 negative adult zebrafish ventricular cardiomyocytes were analysed by RNA seq to compare their transcriptomic profiles. | pubmed:29382818 | tbx5 2neg | GSM2334959 | source name:Heart|age:Adult|tissue:Heart|cell type:Tbx5 negative ventricular cardiomyocytes|pair:2 | tbx5 2neg | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.3. Genome build: Ensembl genebuild 75 Danio rerio assembly Zv9. Supplementary files format and content: matrix table.xls file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | GFP/nucDsRed and nucDsRed cells were isolated using FAC sorting from Tgtbx5:GFP/myl7:nucDsRed double transgenic adult zebrafish cardiac ventricles. Cells were sorted using SONY Synergy sy3200. | RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions. 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. 4 biological replicates consisting of 5 pooled hearts were used per sample. | All experiments were conducted with adult zebrafish between 6 month and 9 month of age raised at a density of 3 fish/l. | age:Adult|tissue:Heart|cell type:Tbx5 negative ventricular cardiomyocytes|pair:2 | GSM2334959 | GSM2334959: tbx5 2neg; Danio rerio; RNA Seq | GSM2334959 | 1 | RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions. 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. 4 biological replicates consisting of 5 pooled hearts were used per sample. | GEO Accession:GSM2334959 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP090801 | tbx5_2neg__HectorSanchez_RNA_Seq_OvationSC_TGGTGA_L001_R1_001.fastq.gz | fastq | 719361654.0 | 11792814.0 | GSM2334959 r1 | 0:61 | A:210895656;C:137890002;G:180431743;T:190135096;N:9157 | 61 | 210895656 | 137890002 | 180431743 | 190135096 | 9157 | SRX2209221 | SRS1726581 | SRA481772 | GEO | Bioinformatics Unit, CNIC | 1 | 0.76636 | 0.15624 | 0.8547 | 0.52604 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2016-10-04 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 41361 | 41361 | SRR4342165 | SRX2209220 | SRS1726582 | SRP090801 | PRJNA345325 | Comparison of tbx5 positive ventricular cardiomyoctes with the rest of ventricular cardiomyocytes from adult zebrafish hearts | GSE87596 | Transcriptome Analysis | In vertebrates the heart has two main layers of cardiac muscle a peripheral compact layer and an internal trabecular layer. Little is known on the differerences in gene expression between both layers. In zebrafish the outer layer is named cortical layer and the internal also trabecular layer. Here we used a double transgenic line labelling with GFP tbx5 positive cells and cardiomyoctes with nuclear DsRed nucDsRed to distinguish cortical from trabecular myocardium. Then we compared the transcriptome of trabecular and cortical myocardium in the adult zebrafish. We describe that Tbx5a is a good marker of trabecular myocardium. Overall design: Four paired biological replicates consisting on Tbx5 positive and Tbx5 negative adult zebrafish ventricular cardiomyocytes were analysed by RNA seq to compare their transcriptomic profiles. | pubmed:29382818 | tbx5 10pos | GSM2334958 | source name:Heart|age:Adult|tissue:Heart|cell type:Tbx5 positive ventricular cardiomyocytes|pair:10 | tbx5 10pos | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.3. Genome build: Ensembl genebuild 75 Danio rerio assembly Zv9. Supplementary files format and content: matrix table.xls file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | GFP/nucDsRed and nucDsRed cells were isolated using FAC sorting from Tgtbx5:GFP/myl7:nucDsRed double transgenic adult zebrafish cardiac ventricles. Cells were sorted using SONY Synergy sy3200. | RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions. 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. 4 biological replicates consisting of 5 pooled hearts were used per sample. | All experiments were conducted with adult zebrafish between 6 month and 9 month of age raised at a density of 3 fish/l. | age:Adult|tissue:Heart|cell type:Tbx5 positive ventricular cardiomyocytes|pair:10 | GSM2334958 | GSM2334958: tbx5 10pos; Danio rerio; RNA Seq | GSM2334958 | 1 | RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions. 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. 4 biological replicates consisting of 5 pooled hearts were used per sample. | GEO Accession:GSM2334958 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP090801 | tbx5_10pos__HectorSanchez_RNA_Seq_OvationSC_AAGCCT_L002_R1_001.fastq.gz | fastq | 754707555.0 | 12372255.0 | GSM2334958 r1 | 0:61 | A:221942809;C:151029762;G:190399372;T:191312963;N:22649 | 61 | 221942809 | 151029762 | 190399372 | 191312963 | 22649 | SRX2209220 | SRS1726582 | SRA481772 | GEO | Bioinformatics Unit, CNIC | 1 | 0.92066 | 0.11265 | 0.85121 | 0.57097 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2016-10-04 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 41362 | 41362 | SRR4342164 | SRX2209219 | SRS1726580 | SRP090801 | PRJNA345325 | Comparison of tbx5 positive ventricular cardiomyoctes with the rest of ventricular cardiomyocytes from adult zebrafish hearts | GSE87596 | Transcriptome Analysis | In vertebrates the heart has two main layers of cardiac muscle a peripheral compact layer and an internal trabecular layer. Little is known on the differerences in gene expression between both layers. In zebrafish the outer layer is named cortical layer and the internal also trabecular layer. Here we used a double transgenic line labelling with GFP tbx5 positive cells and cardiomyoctes with nuclear DsRed nucDsRed to distinguish cortical from trabecular myocardium. Then we compared the transcriptome of trabecular and cortical myocardium in the adult zebrafish. We describe that Tbx5a is a good marker of trabecular myocardium. Overall design: Four paired biological replicates consisting on Tbx5 positive and Tbx5 negative adult zebrafish ventricular cardiomyocytes were analysed by RNA seq to compare their transcriptomic profiles. | pubmed:29382818 | tbx5 10neg | GSM2334957 | source name:Heart|age:Adult|tissue:Heart|cell type:Tbx5 negative ventricular cardiomyocytes|pair:10 | tbx5 10neg | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.3. Genome build: Ensembl genebuild 75 Danio rerio assembly Zv9. Supplementary files format and content: matrix table.xls file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | GFP/nucDsRed and nucDsRed cells were isolated using FAC sorting from Tgtbx5:GFP/myl7:nucDsRed double transgenic adult zebrafish cardiac ventricles. Cells were sorted using SONY Synergy sy3200. | RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions. 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. 4 biological replicates consisting of 5 pooled hearts were used per sample. | All experiments were conducted with adult zebrafish between 6 month and 9 month of age raised at a density of 3 fish/l. | age:Adult|tissue:Heart|cell type:Tbx5 negative ventricular cardiomyocytes|pair:10 | GSM2334957 | GSM2334957: tbx5 10neg; Danio rerio; RNA Seq | GSM2334957 | 1 | RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions. 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. 4 biological replicates consisting of 5 pooled hearts were used per sample. | GEO Accession:GSM2334957 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP090801 | tbx5_10neg__HectorSanchez_RNA_Seq_OvationSC_GTCGTA_L002_R1_001.fastq.gz | fastq | 792684264.0 | 12994824.0 | GSM2334957 r1 | 0:61 | A:231862367;C:153096010;G:201328453;T:206373690;N:23744 | 61 | 231862367 | 153096010 | 201328453 | 206373690 | 23744 | SRX2209219 | SRS1726580 | SRA481772 | GEO | Bioinformatics Unit, CNIC | 1 | 0.89586 | 0.16316 | 0.84435 | 0.53348 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2016-10-04 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 41902 | 41902 | SRR5337748 | SRX2635098 | SRS2043910 | SRP101756 | PRJNA378882 | Transcriptome of the distal late segment of the zebrafish mesonephros | GSE96519 | Transcriptome Analysis | We aimed to gain insights into the evolutionary origin of genetic mechanisms of NaCl handling. To this aim we obtained transcription profilings in the zebrafish distal late DL segment the equvalent segment of the mammalian distal convoluted tubules that play a critical role in NaCl homeostasis. Overall design: We compared the transcriptomes from DL segments and the rest of the mesonephros isolated from transgenic zebrafish expressing mCherry in the DL segments. | pubmed:28656378 | YS6 | GSM2534771 | tissue:Mes1phros DL|transgene:Tgslc12a3:mCherry|genotype:mCh |age:adult | YS6 | none provided by the submitter Genome build: n/a Supplementary files format and content: raw counts | Mesonephros DL | DL segments were manually micro dissected from Tgslc12a3:mCherry and RNAs were extracted using the RNA extraction kit Machery Nagel. Apaptor ligated cDNA libraries were constructed using Ovation Single Cell RNA seq System NuGEN. | transgene:Tgslc12a3:mCherry|genotype:mCh |age:adult | GSM2534771 | GSM2534771: YS6; Danio rerio; RNA Seq | GSM2534771 | 1 | DL segments were manually micro dissected from Tgslc12a3:mCherry and RNAs were extracted using the RNA extraction kit Machery Nagel. Apaptor ligated cDNA libraries were constructed using Ovation Single Cell RNA seq System NuGEN. | GEO Accession:GSM2534771 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP101756 | 20150717.A-YS6_R1.fastq.gz | fastq | 5434051896.0 | 43127396.0 | GSM2534771 r1 | 0:126 | A:1185876928;C:1354521221;G:1643633065;T:1249907593;N:113089 | 126 | 1185876928 | 1354521221 | 1643633065 | 1249907593 | 113089 | SRX2635098 | SRS2043910 | SRA544882 | GEO | Drummond, Nephrology, Massachusetts General Hospital | 1 | 0.97351 | 0.17501 | 0.85303 | 0.75625 | 126 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | United States | 2017-03-12 | Adult | Adult | Kidney | Renal System | |||||||||||||||||||
| 41903 | 41903 | SRR5337747 | SRX2635097 | SRS2043909 | SRP101756 | PRJNA378882 | Transcriptome of the distal late segment of the zebrafish mesonephros | GSE96519 | Transcriptome Analysis | We aimed to gain insights into the evolutionary origin of genetic mechanisms of NaCl handling. To this aim we obtained transcription profilings in the zebrafish distal late DL segment the equvalent segment of the mammalian distal convoluted tubules that play a critical role in NaCl homeostasis. Overall design: We compared the transcriptomes from DL segments and the rest of the mesonephros isolated from transgenic zebrafish expressing mCherry in the DL segments. | pubmed:28656378 | YS5 | GSM2534770 | tissue:DL segments|transgene:Tgslc12a3:mCherry|genotype:mCh+|age:adult | YS5 | none provided by the submitter Genome build: n/a Supplementary files format and content: raw counts | DL segments | DL segments were manually micro dissected from Tgslc12a3:mCherry and RNAs were extracted using the RNA extraction kit Machery Nagel. Apaptor ligated cDNA libraries were constructed using Ovation Single Cell RNA seq System NuGEN. | transgene:Tgslc12a3:mCherry|genotype:mCh+|age:adult | GSM2534770 | GSM2534770: YS5; Danio rerio; RNA Seq | GSM2534770 | 1 | DL segments were manually micro dissected from Tgslc12a3:mCherry and RNAs were extracted using the RNA extraction kit Machery Nagel. Apaptor ligated cDNA libraries were constructed using Ovation Single Cell RNA seq System NuGEN. | GEO Accession:GSM2534770 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP101756 | 20150717.A-YS5_R1.fastq(1).gz | fastq | 2297696058.0 | 18235683.0 | GSM2534770 r1 | 0:126 | A:648837532;C:505738661;G:568578688;T:574489076;N:52101 | 126 | 648837532 | 505738661 | 568578688 | 574489076 | 52101 | SRX2635097 | SRS2043909 | SRA544882 | GEO | Drummond, Nephrology, Massachusetts General Hospital | 1 | 0.94402 | 0.1927 | 0.77585 | 0.67728 | 126 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | United States | 2017-03-12 | Adult | Adult | Kidney | Renal System | |||||||||||||||||||
| 41904 | 41904 | SRR5337746 | SRX2635096 | SRS2043908 | SRP101756 | PRJNA378882 | Transcriptome of the distal late segment of the zebrafish mesonephros | GSE96519 | Transcriptome Analysis | We aimed to gain insights into the evolutionary origin of genetic mechanisms of NaCl handling. To this aim we obtained transcription profilings in the zebrafish distal late DL segment the equvalent segment of the mammalian distal convoluted tubules that play a critical role in NaCl homeostasis. Overall design: We compared the transcriptomes from DL segments and the rest of the mesonephros isolated from transgenic zebrafish expressing mCherry in the DL segments. | pubmed:28656378 | YS4 | GSM2534769 | tissue:Mes1phros DL|transgene:Tgslc12a3:mCherry|genotype:mCh |age:adult | YS4 | none provided by the submitter Genome build: n/a Supplementary files format and content: raw counts | Mesonephros DL | DL segments were manually micro dissected from Tgslc12a3:mCherry and RNAs were extracted using the RNA extraction kit Machery Nagel. Apaptor ligated cDNA libraries were constructed using Ovation Single Cell RNA seq System NuGEN. | transgene:Tgslc12a3:mCherry|genotype:mCh |age:adult | GSM2534769 | GSM2534769: YS4; Danio rerio; RNA Seq | GSM2534769 | 1 | DL segments were manually micro dissected from Tgslc12a3:mCherry and RNAs were extracted using the RNA extraction kit Machery Nagel. Apaptor ligated cDNA libraries were constructed using Ovation Single Cell RNA seq System NuGEN. | GEO Accession:GSM2534769 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP101756 | 20150717.A-YS4_R1.fastq.gz | fastq | 4570634754.0 | 36274879.0 | GSM2534769 r1 | 0:126 | A:1179398927;C:1024363944;G:1239125274;T:1127644877;N:101732 | 126 | 1179398927 | 1024363944 | 1239125274 | 1127644877 | 101732 | SRX2635096 | SRS2043908 | SRA544882 | GEO | Drummond, Nephrology, Massachusetts General Hospital | 1 | 0.93083 | 0.27465 | 0.78102 | 0.70638 | 126 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | United States | 2017-03-12 | Adult | Adult | Kidney | Renal System | |||||||||||||||||||
| 41905 | 41905 | SRR5337745 | SRX2635095 | SRS2043907 | SRP101756 | PRJNA378882 | Transcriptome of the distal late segment of the zebrafish mesonephros | GSE96519 | Transcriptome Analysis | We aimed to gain insights into the evolutionary origin of genetic mechanisms of NaCl handling. To this aim we obtained transcription profilings in the zebrafish distal late DL segment the equvalent segment of the mammalian distal convoluted tubules that play a critical role in NaCl homeostasis. Overall design: We compared the transcriptomes from DL segments and the rest of the mesonephros isolated from transgenic zebrafish expressing mCherry in the DL segments. | pubmed:28656378 | YS3 | GSM2534768 | tissue:DL segments|transgene:Tgslc12a3:mCherry|genotype:mCh+|age:adult | YS3 | none provided by the submitter Genome build: n/a Supplementary files format and content: raw counts | DL segments | DL segments were manually micro dissected from Tgslc12a3:mCherry and RNAs were extracted using the RNA extraction kit Machery Nagel. Apaptor ligated cDNA libraries were constructed using Ovation Single Cell RNA seq System NuGEN. | transgene:Tgslc12a3:mCherry|genotype:mCh+|age:adult | GSM2534768 | GSM2534768: YS3; Danio rerio; RNA Seq | GSM2534768 | 1 | DL segments were manually micro dissected from Tgslc12a3:mCherry and RNAs were extracted using the RNA extraction kit Machery Nagel. Apaptor ligated cDNA libraries were constructed using Ovation Single Cell RNA seq System NuGEN. | GEO Accession:GSM2534768 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP101756 | 20150717.A-YS3_R1.fastq.gz | fastq | 5648398686.0 | 44828561.0 | GSM2534768 r1 | 0:126 | A:1607436982;C:1222995706;G:1369036558;T:1448805498;N:123942 | 126 | 1607436982 | 1222995706 | 1369036558 | 1448805498 | 123942 | SRX2635095 | SRS2043907 | SRA544882 | GEO | Drummond, Nephrology, Massachusetts General Hospital | 1 | 0.93399 | 0.20266 | 0.78076 | 0.73978 | 126 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | United States | 2017-03-12 | Adult | Adult | Kidney | Renal System | |||||||||||||||||||
| 41906 | 41906 | SRR5337744 | SRX2635094 | SRS2043906 | SRP101756 | PRJNA378882 | Transcriptome of the distal late segment of the zebrafish mesonephros | GSE96519 | Transcriptome Analysis | We aimed to gain insights into the evolutionary origin of genetic mechanisms of NaCl handling. To this aim we obtained transcription profilings in the zebrafish distal late DL segment the equvalent segment of the mammalian distal convoluted tubules that play a critical role in NaCl homeostasis. Overall design: We compared the transcriptomes from DL segments and the rest of the mesonephros isolated from transgenic zebrafish expressing mCherry in the DL segments. | pubmed:28656378 | YS2 | GSM2534767 | tissue:Mes1phros DL|transgene:Tgslc12a3:mCherry|genotype:mCh |age:adult | YS2 | none provided by the submitter Genome build: n/a Supplementary files format and content: raw counts | Mesonephros DL | DL segments were manually micro dissected from Tgslc12a3:mCherry and RNAs were extracted using the RNA extraction kit Machery Nagel. Apaptor ligated cDNA libraries were constructed using Ovation Single Cell RNA seq System NuGEN. | transgene:Tgslc12a3:mCherry|genotype:mCh |age:adult | GSM2534767 | GSM2534767: YS2; Danio rerio; RNA Seq | GSM2534767 | 1 | DL segments were manually micro dissected from Tgslc12a3:mCherry and RNAs were extracted using the RNA extraction kit Machery Nagel. Apaptor ligated cDNA libraries were constructed using Ovation Single Cell RNA seq System NuGEN. | GEO Accession:GSM2534767 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP101756 | 20150717.A-YS2_R1.fastq.gz | fastq | 4680679374.0 | 37148249.0 | GSM2534767 r1 | 0:126 | A:1320151433;C:986429614;G:1112497899;T:1261495719;N:104709 | 126 | 1320151433 | 986429614 | 1112497899 | 1261495719 | 104709 | SRX2635094 | SRS2043906 | SRA544882 | GEO | Drummond, Nephrology, Massachusetts General Hospital | 1 | 0.91952 | 0.24724 | 0.73884 | 0.63985 | 126 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | United States | 2017-03-12 | Adult | Adult | Kidney | Renal System | |||||||||||||||||||
| 41907 | 41907 | SRR5337743 | SRX2635093 | SRS2043905 | SRP101756 | PRJNA378882 | Transcriptome of the distal late segment of the zebrafish mesonephros | GSE96519 | Transcriptome Analysis | We aimed to gain insights into the evolutionary origin of genetic mechanisms of NaCl handling. To this aim we obtained transcription profilings in the zebrafish distal late DL segment the equvalent segment of the mammalian distal convoluted tubules that play a critical role in NaCl homeostasis. Overall design: We compared the transcriptomes from DL segments and the rest of the mesonephros isolated from transgenic zebrafish expressing mCherry in the DL segments. | pubmed:28656378 | YS1 | GSM2534766 | tissue:DL segments|transgene:Tgslc12a3:mCherry|genotype:mCh+|age:adult | YS1 | none provided by the submitter Genome build: n/a Supplementary files format and content: raw counts | DL segments | DL segments were manually micro dissected from Tgslc12a3:mCherry and RNAs were extracted using the RNA extraction kit Machery Nagel. Apaptor ligated cDNA libraries were constructed using Ovation Single Cell RNA seq System NuGEN. | transgene:Tgslc12a3:mCherry|genotype:mCh+|age:adult | GSM2534766 | GSM2534766: YS1; Danio rerio; RNA Seq | GSM2534766 | 1 | DL segments were manually micro dissected from Tgslc12a3:mCherry and RNAs were extracted using the RNA extraction kit Machery Nagel. Apaptor ligated cDNA libraries were constructed using Ovation Single Cell RNA seq System NuGEN. | GEO Accession:GSM2534766 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP101756 | 20150717.A-YS1_R1.fastq.gz | fastq | 7000703892.0 | 55561142.0 | GSM2534766 r1 | 0:126 | A:1521231890;C:1760818628;G:2148863730;T:1569634203;N:155441 | 126 | 1521231890 | 1760818628 | 2148863730 | 1569634203 | 155441 | SRX2635093 | SRS2043905 | SRA544882 | GEO | Drummond, Nephrology, Massachusetts General Hospital | 1 | 0.96016 | 0.1982 | 0.86261 | 0.75572 | 126 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | United States | 2017-03-12 | Adult | Adult | Kidney | Renal System | |||||||||||||||||||
| 42873 | 42873 | SRR5817929 | SRX2996183 | SRS2347418 | SRP111552 | PRJNA393857 | Comparison of the expression profiles of kdrl:mCherry positive cells in injured versus uninjured zebrafish cardiac ventricle and analysis of the expression prolife of postnb:citrin positive cells upon injury compared to the rest of cardiac cells. | GSE101200 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the cardiac ventricular apex. Regeneration is preceed by a fibrotic response. To understand the contribution of different cell sources to zebrafish cardiac fibrosis we performed an RNASeq including endocardial kdrl:mCherry cells from an uninjured heart and activated endocardial kdrl:mCherry cells postnb:citrine fibroblasts and the rest of the cells at 7 xxx post injury. Overall design: Three to six biological replicates consisting of different cell types obtained from the ventricular apex. | pubmed:29610343 | neg 7dpi 10 | GSM2700316 | tissue:Heart|cell type:kdrl:mCherry /postn:citrine |treatment:7 xxx post injury|pool:10 | neg 7dpi 10 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | Double transgenic postnb:citrine;kdrl:mCherry were cryoinjured or not as indicated. | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:kdrl:mCherry /postn:citrine |treatment:7 xxx post injury|pool:10 | GSM2700316 | GSM2700316: neg 7dpi 10; Danio rerio; RNA Seq | GSM2700316 | 1 | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700316 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111552 | Neg_7dpi_10__HS_OvationSC_ACCTCA_L001_R1_001.fastq.gz | fastq | 2259317756.0 | 37037996.0 | GSM2700316 r1 | 0:61 | A:593901686;C:479409193;G:663867943;T:522077484;N:61450 | 61 | 593901686 | 479409193 | 663867943 | 522077484 | 61450 | SRX2996183 | SRS2347418 | SRA585701 | GEO | Bioinformatics Unit, CNIC | 1 | 0.78451 | 0.21243 | 0.79275 | 0.70146 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42874 | 42874 | SRR5817928 | SRX2996182 | SRS2347417 | SRP111552 | PRJNA393857 | Comparison of the expression profiles of kdrl:mCherry positive cells in injured versus uninjured zebrafish cardiac ventricle and analysis of the expression prolife of postnb:citrin positive cells upon injury compared to the rest of cardiac cells. | GSE101200 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the cardiac ventricular apex. Regeneration is preceed by a fibrotic response. To understand the contribution of different cell sources to zebrafish cardiac fibrosis we performed an RNASeq including endocardial kdrl:mCherry cells from an uninjured heart and activated endocardial kdrl:mCherry cells postnb:citrine fibroblasts and the rest of the cells at 7 xxx post injury. Overall design: Three to six biological replicates consisting of different cell types obtained from the ventricular apex. | pubmed:29610343 | neg 7dpi 09 | GSM2700315 | tissue:Heart|cell type:kdrl:mCherry /postn:citrine |treatment:7 xxx post injury|pool:9 | neg 7dpi 09 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | Double transgenic postnb:citrine;kdrl:mCherry were cryoinjured or not as indicated. | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:kdrl:mCherry /postn:citrine |treatment:7 xxx post injury|pool:9 | GSM2700315 | GSM2700315: neg 7dpi 09; Danio rerio; RNA Seq | GSM2700315 | 1 | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700315 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111552 | Neg_7dpi_09__HS_OvationSC_AGTGAG_L001_R1_001.fastq.gz | fastq | 1969074205.0 | 32279905.0 | GSM2700315 r1 | 0:61 | A:506203021;C:400192379;G:588278464;T:474347230;N:53111 | 61 | 506203021 | 400192379 | 588278464 | 474347230 | 53111 | SRX2996182 | SRS2347417 | SRA585701 | GEO | Bioinformatics Unit, CNIC | 1 | 0.83786 | 0.24573 | 0.78979 | 0.69734 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42875 | 42875 | SRR5817927 | SRX2996181 | SRS2347416 | SRP111552 | PRJNA393857 | Comparison of the expression profiles of kdrl:mCherry positive cells in injured versus uninjured zebrafish cardiac ventricle and analysis of the expression prolife of postnb:citrin positive cells upon injury compared to the rest of cardiac cells. | GSE101200 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the cardiac ventricular apex. Regeneration is preceed by a fibrotic response. To understand the contribution of different cell sources to zebrafish cardiac fibrosis we performed an RNASeq including endocardial kdrl:mCherry cells from an uninjured heart and activated endocardial kdrl:mCherry cells postnb:citrine fibroblasts and the rest of the cells at 7 xxx post injury. Overall design: Three to six biological replicates consisting of different cell types obtained from the ventricular apex. | pubmed:29610343 | neg 7dpi 08 | GSM2700314 | tissue:Heart|cell type:kdrl:mCherry /postn:citrine |treatment:7 xxx post injury|pool:8 | neg 7dpi 08 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | Double transgenic postnb:citrine;kdrl:mCherry were cryoinjured or not as indicated. | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:kdrl:mCherry /postn:citrine |treatment:7 xxx post injury|pool:8 | GSM2700314 | GSM2700314: neg 7dpi 08; Danio rerio; RNA Seq | GSM2700314 | 1 | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700314 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111552 | Neg_7dpi_08__HS_OvationSC_TCAGAG_L008_R1_001.fastq.gz | fastq | 775093328.0 | 12706448.0 | GSM2700314 r1 | 0:61 | A:207451085;C:158380757;G:223015883;T:186233015;N:12588 | 61 | 207451085 | 158380757 | 223015883 | 186233015 | 12588 | SRX2996181 | SRS2347416 | SRA585701 | GEO | Bioinformatics Unit, CNIC | 1 | 0.77247 | 0.24093 | 0.81142 | 0.61394 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42876 | 42876 | SRR5817926 | SRX2996180 | SRS2347415 | SRP111552 | PRJNA393857 | Comparison of the expression profiles of kdrl:mCherry positive cells in injured versus uninjured zebrafish cardiac ventricle and analysis of the expression prolife of postnb:citrin positive cells upon injury compared to the rest of cardiac cells. | GSE101200 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the cardiac ventricular apex. Regeneration is preceed by a fibrotic response. To understand the contribution of different cell sources to zebrafish cardiac fibrosis we performed an RNASeq including endocardial kdrl:mCherry cells from an uninjured heart and activated endocardial kdrl:mCherry cells postnb:citrine fibroblasts and the rest of the cells at 7 xxx post injury. Overall design: Three to six biological replicates consisting of different cell types obtained from the ventricular apex. | pubmed:29610343 | neg 7dpi 07 | GSM2700313 | tissue:Heart|cell type:kdrl:mCherry /postn:citrine |treatment:7 xxx post injury|pool:7 | neg 7dpi 07 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | Double transgenic postnb:citrine;kdrl:mCherry were cryoinjured or not as indicated. | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:kdrl:mCherry /postn:citrine |treatment:7 xxx post injury|pool:7 | GSM2700313 | GSM2700313: neg 7dpi 07; Danio rerio; RNA Seq | GSM2700313 | 1 | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700313 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111552 | Neg_7dpi_07__HS_OvationSC_AGCATG_L008_R1_001.fastq.gz | fastq | 667662873.0 | 10945293.0 | GSM2700313 r1 | 0:61 | A:184011441;C:129142619;G:186565080;T:167933144;N:10589 | 61 | 184011441 | 129142619 | 186565080 | 167933144 | 10589 | SRX2996180 | SRS2347415 | SRA585701 | GEO | Bioinformatics Unit, CNIC | 1 | 0.78352 | 0.24932 | 0.79322 | 0.5843 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42877 | 42877 | SRR5817925 | SRX2996179 | SRS2347414 | SRP111552 | PRJNA393857 | Comparison of the expression profiles of kdrl:mCherry positive cells in injured versus uninjured zebrafish cardiac ventricle and analysis of the expression prolife of postnb:citrin positive cells upon injury compared to the rest of cardiac cells. | GSE101200 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the cardiac ventricular apex. Regeneration is preceed by a fibrotic response. To understand the contribution of different cell sources to zebrafish cardiac fibrosis we performed an RNASeq including endocardial kdrl:mCherry cells from an uninjured heart and activated endocardial kdrl:mCherry cells postnb:citrine fibroblasts and the rest of the cells at 7 xxx post injury. Overall design: Three to six biological replicates consisting of different cell types obtained from the ventricular apex. | pubmed:29610343 | neg 7dpi 06 | GSM2700312 | tissue:Heart|cell type:kdrl:mCherry /postn:citrine |treatment:7 xxx post injury|pool:6 | neg 7dpi 06 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | Double transgenic postnb:citrine;kdrl:mCherry were cryoinjured or not as indicated. | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:kdrl:mCherry /postn:citrine |treatment:7 xxx post injury|pool:6 | GSM2700312 | GSM2700312: neg 7dpi 06; Danio rerio; RNA Seq | GSM2700312 | 1 | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700312 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111552 | Neg_7dpi_06__HS_OvationSC_GTCGTA_L007_R1_001.fastq.gz | fastq | 1506843472.0 | 24702352.0 | GSM2700312 r1 | 0:61 | A:415665970;C:284643457;G:414417308;T:391840093;N:276644 | 61 | 415665970 | 284643457 | 414417308 | 391840093 | 276644 | SRX2996179 | SRS2347414 | SRA585701 | GEO | Bioinformatics Unit, CNIC | 1 | 0.67862 | 0.21798 | 0.79419 | 0.56611 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42878 | 42878 | SRR5817924 | SRX2996178 | SRS2347412 | SRP111552 | PRJNA393857 | Comparison of the expression profiles of kdrl:mCherry positive cells in injured versus uninjured zebrafish cardiac ventricle and analysis of the expression prolife of postnb:citrin positive cells upon injury compared to the rest of cardiac cells. | GSE101200 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the cardiac ventricular apex. Regeneration is preceed by a fibrotic response. To understand the contribution of different cell sources to zebrafish cardiac fibrosis we performed an RNASeq including endocardial kdrl:mCherry cells from an uninjured heart and activated endocardial kdrl:mCherry cells postnb:citrine fibroblasts and the rest of the cells at 7 xxx post injury. Overall design: Three to six biological replicates consisting of different cell types obtained from the ventricular apex. | pubmed:29610343 | neg 7dpi 05 | GSM2700311 | tissue:Heart|cell type:kdrl:mCherry /postn:citrine |treatment:7 xxx post injury|pool:5 | neg 7dpi 05 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | Double transgenic postnb:citrine;kdrl:mCherry were cryoinjured or not as indicated. | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:kdrl:mCherry /postn:citrine |treatment:7 xxx post injury|pool:5 | GSM2700311 | GSM2700311: neg 7dpi 05; Danio rerio; RNA Seq | GSM2700311 | 1 | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700311 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111552 | Neg_7dpi_05__HS_OvationSC_ACCTCA_L007_R1_001.fastq.gz | fastq | 1170594758.0 | 19190078.0 | GSM2700311 r1 | 0:61 | A:304620201;C:245838062;G:349652017;T:270272581;N:211897 | 61 | 304620201 | 245838062 | 349652017 | 270272581 | 211897 | SRX2996178 | SRS2347412 | SRA585701 | GEO | Bioinformatics Unit, CNIC | 1 | 0.81997 | 0.21036 | 0.81962 | 0.66201 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42879 | 42879 | SRR5817923 | SRX2996177 | SRS2347413 | SRP111552 | PRJNA393857 | Comparison of the expression profiles of kdrl:mCherry positive cells in injured versus uninjured zebrafish cardiac ventricle and analysis of the expression prolife of postnb:citrin positive cells upon injury compared to the rest of cardiac cells. | GSE101200 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the cardiac ventricular apex. Regeneration is preceed by a fibrotic response. To understand the contribution of different cell sources to zebrafish cardiac fibrosis we performed an RNASeq including endocardial kdrl:mCherry cells from an uninjured heart and activated endocardial kdrl:mCherry cells postnb:citrine fibroblasts and the rest of the cells at 7 xxx post injury. Overall design: Three to six biological replicates consisting of different cell types obtained from the ventricular apex. | pubmed:29610343 | postnb citrine 7dpi 10 | GSM2700310 | tissue:Heart|cell type:postnb:citrine+|treatment:7 xxx post injury|pool:10 | postnb citrine 7dpi 10 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | Double transgenic postnb:citrine;kdrl:mCherry were cryoinjured or not as indicated. | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:postnb:citrine+|treatment:7 xxx post injury|pool:10 | GSM2700310 | GSM2700310: postnb citrine 7dpi 10; Danio rerio; RNA Seq | GSM2700310 | 1 | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700310 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111552 | postnb_7dpi_10__HS_OvationSC_GCACTA_L001_R1_001.fastq.gz | fastq | 2252204790.0 | 36921390.0 | GSM2700310 r1 | 0:61 | A:619277021;C:502942463;G:646027370;T:483900520;N:57416 | 61 | 619277021 | 502942463 | 646027370 | 483900520 | 57416 | SRX2996177 | SRS2347413 | SRA585701 | GEO | Bioinformatics Unit, CNIC | 1 | 0.57676 | 0.1734 | 0.83984 | 0.65906 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42880 | 42880 | SRR5817922 | SRX2996176 | SRS2347410 | SRP111552 | PRJNA393857 | Comparison of the expression profiles of kdrl:mCherry positive cells in injured versus uninjured zebrafish cardiac ventricle and analysis of the expression prolife of postnb:citrin positive cells upon injury compared to the rest of cardiac cells. | GSE101200 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the cardiac ventricular apex. Regeneration is preceed by a fibrotic response. To understand the contribution of different cell sources to zebrafish cardiac fibrosis we performed an RNASeq including endocardial kdrl:mCherry cells from an uninjured heart and activated endocardial kdrl:mCherry cells postnb:citrine fibroblasts and the rest of the cells at 7 xxx post injury. Overall design: Three to six biological replicates consisting of different cell types obtained from the ventricular apex. | pubmed:29610343 | postnb citrine 7dpi 09 | GSM2700309 | tissue:Heart|cell type:postnb:citrine+|treatment:7 xxx post injury|pool:9 | postnb citrine 7dpi 09 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | Double transgenic postnb:citrine;kdrl:mCherry were cryoinjured or not as indicated. | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:postnb:citrine+|treatment:7 xxx post injury|pool:9 | GSM2700309 | GSM2700309: postnb citrine 7dpi 09; Danio rerio; RNA Seq | GSM2700309 | 1 | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700309 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111552 | postnb_7dpi_09__HS_OvationSC_AACCAG_L001_R1_001.fastq.gz | fastq | 2283341264.0 | 37431824.0 | GSM2700309 r1 | 0:61 | A:647837199;C:525057060;G:652558979;T:457828691;N:59335 | 61 | 647837199 | 525057060 | 652558979 | 457828691 | 59335 | SRX2996176 | SRS2347410 | SRA585701 | GEO | Bioinformatics Unit, CNIC | 1 | 0.51394 | 0.14658 | 0.85125 | 0.68998 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42881 | 42881 | SRR5817921 | SRX2996175 | SRS2347411 | SRP111552 | PRJNA393857 | Comparison of the expression profiles of kdrl:mCherry positive cells in injured versus uninjured zebrafish cardiac ventricle and analysis of the expression prolife of postnb:citrin positive cells upon injury compared to the rest of cardiac cells. | GSE101200 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the cardiac ventricular apex. Regeneration is preceed by a fibrotic response. To understand the contribution of different cell sources to zebrafish cardiac fibrosis we performed an RNASeq including endocardial kdrl:mCherry cells from an uninjured heart and activated endocardial kdrl:mCherry cells postnb:citrine fibroblasts and the rest of the cells at 7 xxx post injury. Overall design: Three to six biological replicates consisting of different cell types obtained from the ventricular apex. | pubmed:29610343 | postnb citrine 7dpi 07 | GSM2700308 | tissue:Heart|cell type:postnb:citrine+|treatment:7 xxx post injury|pool:7 | postnb citrine 7dpi 07 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | Double transgenic postnb:citrine;kdrl:mCherry were cryoinjured or not as indicated. | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:postnb:citrine+|treatment:7 xxx post injury|pool:7 | GSM2700308 | GSM2700308: postnb citrine 7dpi 07; Danio rerio; RNA Seq | GSM2700308 | 1 | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700308 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111552 | postnb_7dpi_07__HS_OvationSC_GAGTCA_L008_R1_001.fastq.gz | fastq | 722584040.0 | 11845640.0 | GSM2700308 r1 | 0:61 | A:200442958;C:161168985;G:204893226;T:156067063;N:11808 | 61 | 200442958 | 161168985 | 204893226 | 156067063 | 11808 | SRX2996175 | SRS2347411 | SRA585701 | GEO | Bioinformatics Unit, CNIC | 1 | 0.50737 | 0.15544 | 0.85719 | 0.49067 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42882 | 42882 | SRR5817920 | SRX2996174 | SRS2347409 | SRP111552 | PRJNA393857 | Comparison of the expression profiles of kdrl:mCherry positive cells in injured versus uninjured zebrafish cardiac ventricle and analysis of the expression prolife of postnb:citrin positive cells upon injury compared to the rest of cardiac cells. | GSE101200 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the cardiac ventricular apex. Regeneration is preceed by a fibrotic response. To understand the contribution of different cell sources to zebrafish cardiac fibrosis we performed an RNASeq including endocardial kdrl:mCherry cells from an uninjured heart and activated endocardial kdrl:mCherry cells postnb:citrine fibroblasts and the rest of the cells at 7 xxx post injury. Overall design: Three to six biological replicates consisting of different cell types obtained from the ventricular apex. | pubmed:29610343 | kdrl mCherry 7dpi 09 | GSM2700307 | tissue:Heart|cell type:kdrl:mCherry+|treatment:7 xxx post injury|pool:9 | kdrl mCherry 7dpi 09 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | Double transgenic postnb:citrine;kdrl:mCherry were cryoinjured or not as indicated. | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:kdrl:mCherry+|treatment:7 xxx post injury|pool:9 | GSM2700307 | GSM2700307: kdrl mCherry 7dpi 09; Danio rerio; RNA Seq | GSM2700307 | 1 | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700307 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111552 | kdrl_7dpi_09__HS_OvationSC_TGGTGA_L001_R1_001.fastq.gz | fastq | 2145360789.0 | 35169849.0 | GSM2700307 r1 | 0:61 | A:559652295;C:434757157;G:629761603;T:521131593;N:58141 | 61 | 559652295 | 434757157 | 629761603 | 521131593 | 58141 | SRX2996174 | SRS2347409 | SRA585701 | GEO | Bioinformatics Unit, CNIC | 1 | 0.76139 | 0.25919 | 0.80608 | 0.67486 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42883 | 42883 | SRR5817919 | SRX2996173 | SRS2347408 | SRP111552 | PRJNA393857 | Comparison of the expression profiles of kdrl:mCherry positive cells in injured versus uninjured zebrafish cardiac ventricle and analysis of the expression prolife of postnb:citrin positive cells upon injury compared to the rest of cardiac cells. | GSE101200 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the cardiac ventricular apex. Regeneration is preceed by a fibrotic response. To understand the contribution of different cell sources to zebrafish cardiac fibrosis we performed an RNASeq including endocardial kdrl:mCherry cells from an uninjured heart and activated endocardial kdrl:mCherry cells postnb:citrine fibroblasts and the rest of the cells at 7 xxx post injury. Overall design: Three to six biological replicates consisting of different cell types obtained from the ventricular apex. | pubmed:29610343 | kdrl mCherry 7dpi 07 | GSM2700306 | tissue:Heart|cell type:kdrl:mCherry+|treatment:7 xxx post injury|pool:7 | kdrl mCherry 7dpi 07 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | Double transgenic postnb:citrine;kdrl:mCherry were cryoinjured or not as indicated. | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:kdrl:mCherry+|treatment:7 xxx post injury|pool:7 | GSM2700306 | GSM2700306: kdrl mCherry 7dpi 07; Danio rerio; RNA Seq | GSM2700306 | 1 | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700306 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111552 | kdrl_7dpi_07__HS_OvationSC_CGTAGA_L008_R1_001.fastq.gz | fastq | 803488645.0 | 13171945.0 | GSM2700306 r1 | 0:61 | A:219205587;C:172957534;G:230065287;T:181248332;N:11905 | 61 | 219205587 | 172957534 | 230065287 | 181248332 | 11905 | SRX2996173 | SRS2347408 | SRA585701 | GEO | Bioinformatics Unit, CNIC | 1 | 0.61434 | 0.19945 | 0.85242 | 0.62325 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42884 | 42884 | SRR5817918 | SRX2996172 | SRS2347407 | SRP111552 | PRJNA393857 | Comparison of the expression profiles of kdrl:mCherry positive cells in injured versus uninjured zebrafish cardiac ventricle and analysis of the expression prolife of postnb:citrin positive cells upon injury compared to the rest of cardiac cells. | GSE101200 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the cardiac ventricular apex. Regeneration is preceed by a fibrotic response. To understand the contribution of different cell sources to zebrafish cardiac fibrosis we performed an RNASeq including endocardial kdrl:mCherry cells from an uninjured heart and activated endocardial kdrl:mCherry cells postnb:citrine fibroblasts and the rest of the cells at 7 xxx post injury. Overall design: Three to six biological replicates consisting of different cell types obtained from the ventricular apex. | pubmed:29610343 | kdrl mCherry 7dpi 06 | GSM2700305 | tissue:Heart|cell type:kdrl:mCherry+|treatment:7 xxx post injury|pool:6 | kdrl mCherry 7dpi 06 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | Double transgenic postnb:citrine;kdrl:mCherry were cryoinjured or not as indicated. | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:kdrl:mCherry+|treatment:7 xxx post injury|pool:6 | GSM2700305 | GSM2700305: kdrl mCherry 7dpi 06; Danio rerio; RNA Seq | GSM2700305 | 1 | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700305 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111552 | kdrl_7dpi_06__HS_OvationSC_GGAGAA_L008_R1_001.fastq.gz | fastq | 720805646.0 | 11816486.0 | GSM2700305 r1 | 0:61 | A:200358132;C:158104743;G:199543761;T:162788231;N:10779 | 61 | 200358132 | 158104743 | 199543761 | 162788231 | 10779 | SRX2996172 | SRS2347407 | SRA585701 | GEO | Bioinformatics Unit, CNIC | 1 | 0.45356 | 0.17003 | 0.85137 | 0.56525 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42885 | 42885 | SRR5817917 | SRX2996171 | SRS2347406 | SRP111552 | PRJNA393857 | Comparison of the expression profiles of kdrl:mCherry positive cells in injured versus uninjured zebrafish cardiac ventricle and analysis of the expression prolife of postnb:citrin positive cells upon injury compared to the rest of cardiac cells. | GSE101200 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the cardiac ventricular apex. Regeneration is preceed by a fibrotic response. To understand the contribution of different cell sources to zebrafish cardiac fibrosis we performed an RNASeq including endocardial kdrl:mCherry cells from an uninjured heart and activated endocardial kdrl:mCherry cells postnb:citrine fibroblasts and the rest of the cells at 7 xxx post injury. Overall design: Three to six biological replicates consisting of different cell types obtained from the ventricular apex. | pubmed:29610343 | kdrl mCherry 7dpi 05 | GSM2700304 | tissue:Heart|cell type:kdrl:mCherry+|treatment:7 xxx post injury|pool:5 | kdrl mCherry 7dpi 05 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | Double transgenic postnb:citrine;kdrl:mCherry were cryoinjured or not as indicated. | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:kdrl:mCherry+|treatment:7 xxx post injury|pool:5 | GSM2700304 | GSM2700304: kdrl mCherry 7dpi 05; Danio rerio; RNA Seq | GSM2700304 | 1 | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700304 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111552 | kdrl_7dpi_05__HS_OvationSC_AAGCCT_L007_R1_001.fastq.gz | fastq | 1380653870.0 | 22633670.0 | GSM2700304 r1 | 0:61 | A:388484121;C:311044648;G:367785851;T:313097333;N:241917 | 61 | 388484121 | 311044648 | 367785851 | 313097333 | 241917 | SRX2996171 | SRS2347406 | SRA585701 | GEO | Bioinformatics Unit, CNIC | 1 | 0.44514 | 0.18589 | 0.85569 | 0.53637 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42886 | 42886 | SRR5817916 | SRX2996170 | SRS2347405 | SRP111552 | PRJNA393857 | Comparison of the expression profiles of kdrl:mCherry positive cells in injured versus uninjured zebrafish cardiac ventricle and analysis of the expression prolife of postnb:citrin positive cells upon injury compared to the rest of cardiac cells. | GSE101200 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the cardiac ventricular apex. Regeneration is preceed by a fibrotic response. To understand the contribution of different cell sources to zebrafish cardiac fibrosis we performed an RNASeq including endocardial kdrl:mCherry cells from an uninjured heart and activated endocardial kdrl:mCherry cells postnb:citrine fibroblasts and the rest of the cells at 7 xxx post injury. Overall design: Three to six biological replicates consisting of different cell types obtained from the ventricular apex. | pubmed:29610343 | kdrl mCherry uninjured 04 | GSM2700303 | tissue:Heart|cell type:kdrl:mCherry+|treatment:Uninjured|pool:4 | kdrl mCherry uninjured 04 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | Double transgenic postnb:citrine;kdrl:mCherry were cryoinjured or not as indicated. | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:kdrl:mCherry+|treatment:Uninjured|pool:4 | GSM2700303 | GSM2700303: kdrl mCherry uninjured 04; Danio rerio; RNA Seq | GSM2700303 | 1 | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700303 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111552 | kdrl_uninj_04__HS_OvationSC_GCACTA_L007_R1_001.fastq.gz | fastq | 1540717199.0 | 25257659.0 | GSM2700303 r1 | 0:61 | A:419376382;C:337803904;G:429107804;T:354151511;N:277598 | 61 | 419376382 | 337803904 | 429107804 | 354151511 | 277598 | SRX2996170 | SRS2347405 | SRA585701 | GEO | Bioinformatics Unit, CNIC | 1 | 0.5821 | 0.21016 | 0.84904 | 0.6021 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42887 | 42887 | SRR5817915 | SRX2996169 | SRS2347404 | SRP111552 | PRJNA393857 | Comparison of the expression profiles of kdrl:mCherry positive cells in injured versus uninjured zebrafish cardiac ventricle and analysis of the expression prolife of postnb:citrin positive cells upon injury compared to the rest of cardiac cells. | GSE101200 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the cardiac ventricular apex. Regeneration is preceed by a fibrotic response. To understand the contribution of different cell sources to zebrafish cardiac fibrosis we performed an RNASeq including endocardial kdrl:mCherry cells from an uninjured heart and activated endocardial kdrl:mCherry cells postnb:citrine fibroblasts and the rest of the cells at 7 xxx post injury. Overall design: Three to six biological replicates consisting of different cell types obtained from the ventricular apex. | pubmed:29610343 | kdrl mCherry uninjured 03 | GSM2700302 | tissue:Heart|cell type:kdrl:mCherry+|treatment:Uninjured|pool:3 | kdrl mCherry uninjured 03 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | Double transgenic postnb:citrine;kdrl:mCherry were cryoinjured or not as indicated. | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:kdrl:mCherry+|treatment:Uninjured|pool:3 | GSM2700302 | GSM2700302: kdrl mCherry uninjured 03; Danio rerio; RNA Seq | GSM2700302 | 1 | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700302 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111552 | kdrl_uninj_03__HS_OvationSC_AGTGAG_L007_R1_001.fastq.gz | fastq | 1258645879.0 | 20633539.0 | GSM2700302 r1 | 0:61 | A:349212875;C:258591407;G:348719714;T:301896773;N:225110 | 61 | 349212875 | 258591407 | 348719714 | 301896773 | 225110 | SRX2996169 | SRS2347404 | SRA585701 | GEO | Bioinformatics Unit, CNIC | 1 | 0.59499 | 0.22916 | 0.83508 | 0.54761 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42888 | 42888 | SRR5817914 | SRX2996168 | SRS2347403 | SRP111552 | PRJNA393857 | Comparison of the expression profiles of kdrl:mCherry positive cells in injured versus uninjured zebrafish cardiac ventricle and analysis of the expression prolife of postnb:citrin positive cells upon injury compared to the rest of cardiac cells. | GSE101200 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the cardiac ventricular apex. Regeneration is preceed by a fibrotic response. To understand the contribution of different cell sources to zebrafish cardiac fibrosis we performed an RNASeq including endocardial kdrl:mCherry cells from an uninjured heart and activated endocardial kdrl:mCherry cells postnb:citrine fibroblasts and the rest of the cells at 7 xxx post injury. Overall design: Three to six biological replicates consisting of different cell types obtained from the ventricular apex. | pubmed:29610343 | kdrl mCherry uninjured 02 | GSM2700301 | tissue:Heart|cell type:kdrl:mCherry+|treatment:Uninjured|pool:2 | kdrl mCherry uninjured 02 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | Double transgenic postnb:citrine;kdrl:mCherry were cryoinjured or not as indicated. | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:kdrl:mCherry+|treatment:Uninjured|pool:2 | GSM2700301 | GSM2700301: kdrl mCherry uninjured 02; Danio rerio; RNA Seq | GSM2700301 | 1 | 3 5 pooled hearts were used per sample. Ventricular apexes were dissotiated with trypsin. mCherry positive and citrine positive cells were FAC sorted using SONY Synergy sy3200. RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700301 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111552 | kdrl_uninj_02__HS_OvationSC_TGGTGA_L007_R1_001.fastq.gz | fastq | 1339434096.0 | 21957936.0 | GSM2700301 r1 | 0:61 | A:368699684;C:287536628;G:376256631;T:306701372;N:239781 | 61 | 368699684 | 287536628 | 376256631 | 306701372 | 239781 | SRX2996168 | SRS2347403 | SRA585701 | GEO | Bioinformatics Unit, CNIC | 1 | 0.41301 | 0.17019 | 0.85458 | 0.5146 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42889 | 42889 | SRR5818018 | SRX2996265 | SRS2347497 | SRP111553 | PRJNA393878 | Comparison of the expression profile of GFP positive cells from Tg 6.8wt1a:EGFP with the rest of the cells in adult zebrafish cardiac ventricles | GSE101204 | Transcriptome Analysis | wt1a:GFP labels a population of subepicardial cells in the uninjured ventricle. Here we compare the expression profile of wt1a:GFP positive cells to the rest of the cells of the ventricle. Overall design: Four paired biological replicates of wt1a:GFP positive and wt1a:GFP negative cells obtained from pools of 3 5 zebrafish heart ventricles. | pubmed:29610343 | wt1aGFP 4 pos | GSM2700333 | tissue:Heart|cell type:wt1a+|pool:4 | wt1aGFP 4 pos | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: matrix counts.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | No treatment was applied. | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:wt1a+|pool:4 | GSM2700333 | GSM2700333: wt1aGFP 4 pos; Danio rerio; RNA Seq | GSM2700333 | 1 | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700333 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111553 | wt1aV_34_pos__HS_RNA_Seq_OvationSC_GTCGTA_L001_R1_001.fastq.gz | fastq | 723314759.0 | 11857619.0 | GSM2700333 r1 | 0:61 | A:201917485;C:141523845;G:184676365;T:195150579;N:46485 | 61 | 201917485 | 141523845 | 184676365 | 195150579 | 46485 | SRX2996265 | SRS2347497 | SRA585736 | GEO | Bioinformatics Unit, CNIC | 1 | 0.82231 | 0.30947 | 0.80137 | 0.55406 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42890 | 42890 | SRR5818019 | SRX2996265 | SRS2347497 | SRP111553 | PRJNA393878 | Comparison of the expression profile of GFP positive cells from Tg 6.8wt1a:EGFP with the rest of the cells in adult zebrafish cardiac ventricles | GSE101204 | Transcriptome Analysis | wt1a:GFP labels a population of subepicardial cells in the uninjured ventricle. Here we compare the expression profile of wt1a:GFP positive cells to the rest of the cells of the ventricle. Overall design: Four paired biological replicates of wt1a:GFP positive and wt1a:GFP negative cells obtained from pools of 3 5 zebrafish heart ventricles. | pubmed:29610343 | wt1aGFP 4 pos | GSM2700333 | tissue:Heart|cell type:wt1a+|pool:4 | wt1aGFP 4 pos | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: matrix counts.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | No treatment was applied. | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:wt1a+|pool:4 | GSM2700333 | GSM2700333: wt1aGFP 4 pos; Danio rerio; RNA Seq | GSM2700333 | 1 | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700333 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111553 | wt1aV_34_pos__HS_RNA_Seq_OvationSC_GTCGTA_L002_R1_001.fastq.gz | fastq | 736427807.0 | 12072587.0 | GSM2700333 r2 | 0:61 | A:205663718;C:144074430;G:188007794;T:198654037;N:27828 | 61 | 205663718 | 144074430 | 188007794 | 198654037 | 27828 | SRX2996265 | SRS2347497 | SRA585736 | GEO | Bioinformatics Unit, CNIC | 1 | 0.82156 | 0.3081 | 0.80107 | 0.55258 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42891 | 42891 | SRR5818016 | SRX2996264 | SRS2347496 | SRP111553 | PRJNA393878 | Comparison of the expression profile of GFP positive cells from Tg 6.8wt1a:EGFP with the rest of the cells in adult zebrafish cardiac ventricles | GSE101204 | Transcriptome Analysis | wt1a:GFP labels a population of subepicardial cells in the uninjured ventricle. Here we compare the expression profile of wt1a:GFP positive cells to the rest of the cells of the ventricle. Overall design: Four paired biological replicates of wt1a:GFP positive and wt1a:GFP negative cells obtained from pools of 3 5 zebrafish heart ventricles. | pubmed:29610343 | wt1aGFP 4 neg | GSM2700332 | tissue:Heart|cell type:wt1a |pool:4 | wt1aGFP 4 neg | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: matrix counts.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | No treatment was applied. | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:wt1a |pool:4 | GSM2700332 | GSM2700332: wt1aGFP 4 neg; Danio rerio; RNA Seq | GSM2700332 | 1 | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700332 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111553 | wt1aV_34_neg__HS_RNA_Seq_OvationSC_AAGCCT_L001_R1_001.fastq.gz | fastq | 845878277.0 | 13866857.0 | GSM2700332 r1 | 0:61 | A:249667621;C:171998644;G:210584175;T:213573132;N:54705 | 61 | 249667621 | 171998644 | 210584175 | 213573132 | 54705 | SRX2996264 | SRS2347496 | SRA585736 | GEO | Bioinformatics Unit, CNIC | 1 | 0.90245 | 0.18824 | 0.81793 | 0.69585 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42892 | 42892 | SRR5818017 | SRX2996264 | SRS2347496 | SRP111553 | PRJNA393878 | Comparison of the expression profile of GFP positive cells from Tg 6.8wt1a:EGFP with the rest of the cells in adult zebrafish cardiac ventricles | GSE101204 | Transcriptome Analysis | wt1a:GFP labels a population of subepicardial cells in the uninjured ventricle. Here we compare the expression profile of wt1a:GFP positive cells to the rest of the cells of the ventricle. Overall design: Four paired biological replicates of wt1a:GFP positive and wt1a:GFP negative cells obtained from pools of 3 5 zebrafish heart ventricles. | pubmed:29610343 | wt1aGFP 4 neg | GSM2700332 | tissue:Heart|cell type:wt1a |pool:4 | wt1aGFP 4 neg | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: matrix counts.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | No treatment was applied. | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:wt1a |pool:4 | GSM2700332 | GSM2700332: wt1aGFP 4 neg; Danio rerio; RNA Seq | GSM2700332 | 1 | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700332 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111553 | wt1aV_34_neg__HS_RNA_Seq_OvationSC_AAGCCT_L002_R1_001.fastq.gz | fastq | 862736664.0 | 14143224.0 | GSM2700332 r2 | 0:61 | A:254822084;C:175437676;G:214663386;T:217781386;N:32132 | 61 | 254822084 | 175437676 | 214663386 | 217781386 | 32132 | SRX2996264 | SRS2347496 | SRA585736 | GEO | Bioinformatics Unit, CNIC | 1 | 0.90087 | 0.1871 | 0.81779 | 0.68372 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42893 | 42893 | SRR5818014 | SRX2996263 | SRS2347495 | SRP111553 | PRJNA393878 | Comparison of the expression profile of GFP positive cells from Tg 6.8wt1a:EGFP with the rest of the cells in adult zebrafish cardiac ventricles | GSE101204 | Transcriptome Analysis | wt1a:GFP labels a population of subepicardial cells in the uninjured ventricle. Here we compare the expression profile of wt1a:GFP positive cells to the rest of the cells of the ventricle. Overall design: Four paired biological replicates of wt1a:GFP positive and wt1a:GFP negative cells obtained from pools of 3 5 zebrafish heart ventricles. | pubmed:29610343 | wt1aGFP 3 pos | GSM2700331 | tissue:Heart|cell type:wt1a+|pool:3 | wt1aGFP 3 pos | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: matrix counts.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | No treatment was applied. | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:wt1a+|pool:3 | GSM2700331 | GSM2700331: wt1aGFP 3 pos; Danio rerio; RNA Seq | GSM2700331 | 1 | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700331 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111553 | wt1aV_33_pos__HS_RNA_Seq_OvationSC_GTGCTT_L001_R1_001.fastq.gz | fastq | 774308441.0 | 12693581.0 | GSM2700331 r1 | 0:61 | A:214992220;C:150401431;G:203530010;T:205334623;N:50157 | 61 | 214992220 | 150401431 | 203530010 | 205334623 | 50157 | SRX2996263 | SRS2347495 | SRA585736 | GEO | Bioinformatics Unit, CNIC | 1 | 0.85135 | 0.30434 | 0.79859 | 0.56227 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42894 | 42894 | SRR5818015 | SRX2996263 | SRS2347495 | SRP111553 | PRJNA393878 | Comparison of the expression profile of GFP positive cells from Tg 6.8wt1a:EGFP with the rest of the cells in adult zebrafish cardiac ventricles | GSE101204 | Transcriptome Analysis | wt1a:GFP labels a population of subepicardial cells in the uninjured ventricle. Here we compare the expression profile of wt1a:GFP positive cells to the rest of the cells of the ventricle. Overall design: Four paired biological replicates of wt1a:GFP positive and wt1a:GFP negative cells obtained from pools of 3 5 zebrafish heart ventricles. | pubmed:29610343 | wt1aGFP 3 pos | GSM2700331 | tissue:Heart|cell type:wt1a+|pool:3 | wt1aGFP 3 pos | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: matrix counts.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | No treatment was applied. | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:wt1a+|pool:3 | GSM2700331 | GSM2700331: wt1aGFP 3 pos; Danio rerio; RNA Seq | GSM2700331 | 1 | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700331 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111553 | wt1aV_33_pos__HS_RNA_Seq_OvationSC_GTGCTT_L002_R1_001.fastq.gz | fastq | 785516154.0 | 12877314.0 | GSM2700331 r2 | 0:61 | A:218236052;C:152511901;G:206411606;T:208326427;N:30168 | 61 | 218236052 | 152511901 | 206411606 | 208326427 | 30168 | SRX2996263 | SRS2347495 | SRA585736 | GEO | Bioinformatics Unit, CNIC | 1 | 0.85177 | 0.30473 | 0.80081 | 0.56348 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42895 | 42895 | SRR5818012 | SRX2996262 | SRS2347494 | SRP111553 | PRJNA393878 | Comparison of the expression profile of GFP positive cells from Tg 6.8wt1a:EGFP with the rest of the cells in adult zebrafish cardiac ventricles | GSE101204 | Transcriptome Analysis | wt1a:GFP labels a population of subepicardial cells in the uninjured ventricle. Here we compare the expression profile of wt1a:GFP positive cells to the rest of the cells of the ventricle. Overall design: Four paired biological replicates of wt1a:GFP positive and wt1a:GFP negative cells obtained from pools of 3 5 zebrafish heart ventricles. | pubmed:29610343 | wt1aGFP 3 neg | GSM2700330 | tissue:Heart|cell type:wt1a |pool:3 | wt1aGFP 3 neg | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: matrix counts.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | No treatment was applied. | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:wt1a |pool:3 | GSM2700330 | GSM2700330: wt1aGFP 3 neg; Danio rerio; RNA Seq | GSM2700330 | 1 | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700330 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111553 | wt1aV_33_neg__HS_RNA_Seq_OvationSC_ACCTCA_L001_R1_001.fastq.gz | fastq | 725733470.0 | 11897270.0 | GSM2700330 r1 | 0:61 | A:216602034;C:144864671;G:177825033;T:186394034;N:47698 | 61 | 216602034 | 144864671 | 177825033 | 186394034 | 47698 | SRX2996262 | SRS2347494 | SRA585736 | GEO | Bioinformatics Unit, CNIC | 1 | 0.89906 | 0.20936 | 0.81264 | 0.69072 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42896 | 42896 | SRR5818013 | SRX2996262 | SRS2347494 | SRP111553 | PRJNA393878 | Comparison of the expression profile of GFP positive cells from Tg 6.8wt1a:EGFP with the rest of the cells in adult zebrafish cardiac ventricles | GSE101204 | Transcriptome Analysis | wt1a:GFP labels a population of subepicardial cells in the uninjured ventricle. Here we compare the expression profile of wt1a:GFP positive cells to the rest of the cells of the ventricle. Overall design: Four paired biological replicates of wt1a:GFP positive and wt1a:GFP negative cells obtained from pools of 3 5 zebrafish heart ventricles. | pubmed:29610343 | wt1aGFP 3 neg | GSM2700330 | tissue:Heart|cell type:wt1a |pool:3 | wt1aGFP 3 neg | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: matrix counts.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | No treatment was applied. | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:wt1a |pool:3 | GSM2700330 | GSM2700330: wt1aGFP 3 neg; Danio rerio; RNA Seq | GSM2700330 | 1 | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700330 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111553 | wt1aV_33_neg__HS_RNA_Seq_OvationSC_ACCTCA_L002_R1_001.fastq.gz | fastq | 739526485.0 | 12123385.0 | GSM2700330 r2 | 0:61 | A:220804426;C:147618040;G:181199008;T:189877408;N:27603 | 61 | 220804426 | 147618040 | 181199008 | 189877408 | 27603 | SRX2996262 | SRS2347494 | SRA585736 | GEO | Bioinformatics Unit, CNIC | 1 | 0.89897 | 0.20803 | 0.8126 | 0.68941 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42897 | 42897 | SRR5818010 | SRX2996261 | SRS2347493 | SRP111553 | PRJNA393878 | Comparison of the expression profile of GFP positive cells from Tg 6.8wt1a:EGFP with the rest of the cells in adult zebrafish cardiac ventricles | GSE101204 | Transcriptome Analysis | wt1a:GFP labels a population of subepicardial cells in the uninjured ventricle. Here we compare the expression profile of wt1a:GFP positive cells to the rest of the cells of the ventricle. Overall design: Four paired biological replicates of wt1a:GFP positive and wt1a:GFP negative cells obtained from pools of 3 5 zebrafish heart ventricles. | pubmed:29610343 | wt1aGFP 2 pos | GSM2700329 | tissue:Heart|cell type:wt1a+|pool:2 | wt1aGFP 2 pos | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: matrix counts.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | No treatment was applied. | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:wt1a+|pool:2 | GSM2700329 | GSM2700329: wt1aGFP 2 pos; Danio rerio; RNA Seq | GSM2700329 | 1 | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700329 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111553 | wt1aV_32_pos__HS_RNA_Seq_OvationSC_GCACTA_L001_R1_001.fastq.gz | fastq | 754469960.0 | 12368360.0 | GSM2700329 r1 | 0:61 | A:212826941;C:144472909;G:187613892;T:209506276;N:49942 | 61 | 212826941 | 144472909 | 187613892 | 209506276 | 49942 | SRX2996261 | SRS2347493 | SRA585736 | GEO | Bioinformatics Unit, CNIC | 1 | 0.82785 | 0.31821 | 0.79113 | 0.57087 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42898 | 42898 | SRR5818011 | SRX2996261 | SRS2347493 | SRP111553 | PRJNA393878 | Comparison of the expression profile of GFP positive cells from Tg 6.8wt1a:EGFP with the rest of the cells in adult zebrafish cardiac ventricles | GSE101204 | Transcriptome Analysis | wt1a:GFP labels a population of subepicardial cells in the uninjured ventricle. Here we compare the expression profile of wt1a:GFP positive cells to the rest of the cells of the ventricle. Overall design: Four paired biological replicates of wt1a:GFP positive and wt1a:GFP negative cells obtained from pools of 3 5 zebrafish heart ventricles. | pubmed:29610343 | wt1aGFP 2 pos | GSM2700329 | tissue:Heart|cell type:wt1a+|pool:2 | wt1aGFP 2 pos | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: matrix counts.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | No treatment was applied. | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:wt1a+|pool:2 | GSM2700329 | GSM2700329: wt1aGFP 2 pos; Danio rerio; RNA Seq | GSM2700329 | 1 | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700329 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111553 | wt1aV_32_pos__HS_RNA_Seq_OvationSC_GCACTA_L002_R1_001.fastq.gz | fastq | 768777327.0 | 12602907.0 | GSM2700329 r2 | 0:61 | A:216934227;C:147173989;G:191157153;T:213483110;N:28848 | 61 | 216934227 | 147173989 | 191157153 | 213483110 | 28848 | SRX2996261 | SRS2347493 | SRA585736 | GEO | Bioinformatics Unit, CNIC | 1 | 0.82552 | 0.31671 | 0.79088 | 0.50918 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42899 | 42899 | SRR5818008 | SRX2996260 | SRS2347491 | SRP111553 | PRJNA393878 | Comparison of the expression profile of GFP positive cells from Tg 6.8wt1a:EGFP with the rest of the cells in adult zebrafish cardiac ventricles | GSE101204 | Transcriptome Analysis | wt1a:GFP labels a population of subepicardial cells in the uninjured ventricle. Here we compare the expression profile of wt1a:GFP positive cells to the rest of the cells of the ventricle. Overall design: Four paired biological replicates of wt1a:GFP positive and wt1a:GFP negative cells obtained from pools of 3 5 zebrafish heart ventricles. | pubmed:29610343 | wt1aGFP 2 neg | GSM2700328 | tissue:Heart|cell type:wt1a |pool:2 | wt1aGFP 2 neg | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: matrix counts.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | No treatment was applied. | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:wt1a |pool:2 | GSM2700328 | GSM2700328: wt1aGFP 2 neg; Danio rerio; RNA Seq | GSM2700328 | 1 | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700328 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111553 | wt1aV_32_neg__HS_RNA_Seq_OvationSC_AGTGAG_L001_R1_001.fastq.gz | fastq | 692638530.0 | 11354730.0 | GSM2700328 r1 | 0:61 | A:211149267;C:142433123;G:165634275;T:173375719;N:46146 | 61 | 211149267 | 142433123 | 165634275 | 173375719 | 46146 | SRX2996260 | SRS2347491 | SRA585736 | GEO | Bioinformatics Unit, CNIC | 1 | 0.91099 | 0.17805 | 0.81458 | 0.72923 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42900 | 42900 | SRR5818009 | SRX2996260 | SRS2347491 | SRP111553 | PRJNA393878 | Comparison of the expression profile of GFP positive cells from Tg 6.8wt1a:EGFP with the rest of the cells in adult zebrafish cardiac ventricles | GSE101204 | Transcriptome Analysis | wt1a:GFP labels a population of subepicardial cells in the uninjured ventricle. Here we compare the expression profile of wt1a:GFP positive cells to the rest of the cells of the ventricle. Overall design: Four paired biological replicates of wt1a:GFP positive and wt1a:GFP negative cells obtained from pools of 3 5 zebrafish heart ventricles. | pubmed:29610343 | wt1aGFP 2 neg | GSM2700328 | tissue:Heart|cell type:wt1a |pool:2 | wt1aGFP 2 neg | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: matrix counts.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | No treatment was applied. | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:wt1a |pool:2 | GSM2700328 | GSM2700328: wt1aGFP 2 neg; Danio rerio; RNA Seq | GSM2700328 | 1 | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700328 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111553 | wt1aV_32_neg__HS_RNA_Seq_OvationSC_AGTGAG_L002_R1_001.fastq.gz | fastq | 704040406.0 | 11541646.0 | GSM2700328 r2 | 0:61 | A:214725213;C:144725366;G:168345724;T:176217859;N:26244 | 61 | 214725213 | 144725366 | 168345724 | 176217859 | 26244 | SRX2996260 | SRS2347491 | SRA585736 | GEO | Bioinformatics Unit, CNIC | 1 | 0.90997 | 0.17763 | 0.81527 | 0.72316 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42901 | 42901 | SRR5818006 | SRX2996259 | SRS2347492 | SRP111553 | PRJNA393878 | Comparison of the expression profile of GFP positive cells from Tg 6.8wt1a:EGFP with the rest of the cells in adult zebrafish cardiac ventricles | GSE101204 | Transcriptome Analysis | wt1a:GFP labels a population of subepicardial cells in the uninjured ventricle. Here we compare the expression profile of wt1a:GFP positive cells to the rest of the cells of the ventricle. Overall design: Four paired biological replicates of wt1a:GFP positive and wt1a:GFP negative cells obtained from pools of 3 5 zebrafish heart ventricles. | pubmed:29610343 | wt1aGFP 1 pos | GSM2700327 | tissue:Heart|cell type:wt1a+|pool:1 | wt1aGFP 1 pos | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: matrix counts.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | No treatment was applied. | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:wt1a+|pool:1 | GSM2700327 | GSM2700327: wt1aGFP 1 pos; Danio rerio; RNA Seq | GSM2700327 | 1 | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700327 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111553 | wt1aV_31_pos__HS_RNA_Seq_OvationSC_TGGTGA_L001_R1_001.fastq.gz | fastq | 729643509.0 | 11961369.0 | GSM2700327 r1 | 0:61 | A:209109414;C:140044116;G:176769088;T:203672961;N:47930 | 61 | 209109414 | 140044116 | 176769088 | 203672961 | 47930 | SRX2996259 | SRS2347492 | SRA585736 | GEO | Bioinformatics Unit, CNIC | 1 | 0.82015 | 0.30797 | 0.79748 | 0.46884 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42902 | 42902 | SRR5818007 | SRX2996259 | SRS2347492 | SRP111553 | PRJNA393878 | Comparison of the expression profile of GFP positive cells from Tg 6.8wt1a:EGFP with the rest of the cells in adult zebrafish cardiac ventricles | GSE101204 | Transcriptome Analysis | wt1a:GFP labels a population of subepicardial cells in the uninjured ventricle. Here we compare the expression profile of wt1a:GFP positive cells to the rest of the cells of the ventricle. Overall design: Four paired biological replicates of wt1a:GFP positive and wt1a:GFP negative cells obtained from pools of 3 5 zebrafish heart ventricles. | pubmed:29610343 | wt1aGFP 1 pos | GSM2700327 | tissue:Heart|cell type:wt1a+|pool:1 | wt1aGFP 1 pos | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: matrix counts.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | No treatment was applied. | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:wt1a+|pool:1 | GSM2700327 | GSM2700327: wt1aGFP 1 pos; Danio rerio; RNA Seq | GSM2700327 | 1 | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700327 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111553 | wt1aV_31_pos__HS_RNA_Seq_OvationSC_TGGTGA_L002_R1_001.fastq.gz | fastq | 743468183.0 | 12188003.0 | GSM2700327 r2 | 0:61 | A:213138374;C:142664132;G:180105124;T:207532889;N:27664 | 61 | 213138374 | 142664132 | 180105124 | 207532889 | 27664 | SRX2996259 | SRS2347492 | SRA585736 | GEO | Bioinformatics Unit, CNIC | 1 | 0.81957 | 0.30392 | 0.79527 | 0.47293 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42903 | 42903 | SRR5818004 | SRX2996258 | SRS2347490 | SRP111553 | PRJNA393878 | Comparison of the expression profile of GFP positive cells from Tg 6.8wt1a:EGFP with the rest of the cells in adult zebrafish cardiac ventricles | GSE101204 | Transcriptome Analysis | wt1a:GFP labels a population of subepicardial cells in the uninjured ventricle. Here we compare the expression profile of wt1a:GFP positive cells to the rest of the cells of the ventricle. Overall design: Four paired biological replicates of wt1a:GFP positive and wt1a:GFP negative cells obtained from pools of 3 5 zebrafish heart ventricles. | pubmed:29610343 | wt1aGFP 1 neg | GSM2700326 | tissue:Heart|cell type:wt1a |pool:1 | wt1aGFP 1 neg | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: matrix counts.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | No treatment was applied. | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:wt1a |pool:1 | GSM2700326 | GSM2700326: wt1aGFP 1 neg; Danio rerio; RNA Seq | GSM2700326 | 1 | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700326 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111553 | wt1aV_31_neg__HS_RNA_Seq_OvationSC_AACCAG_L001_R1_001.fastq.gz | fastq | 830080436.0 | 13607876.0 | GSM2700326 r1 | 0:61 | A:251391883;C:167411203;G:203106619;T:208117027;N:53704 | 61 | 251391883 | 167411203 | 203106619 | 208117027 | 53704 | SRX2996258 | SRS2347490 | SRA585736 | GEO | Bioinformatics Unit, CNIC | 1 | 0.88568 | 0.18069 | 0.82298 | 0.729 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42904 | 42904 | SRR5818005 | SRX2996258 | SRS2347490 | SRP111553 | PRJNA393878 | Comparison of the expression profile of GFP positive cells from Tg 6.8wt1a:EGFP with the rest of the cells in adult zebrafish cardiac ventricles | GSE101204 | Transcriptome Analysis | wt1a:GFP labels a population of subepicardial cells in the uninjured ventricle. Here we compare the expression profile of wt1a:GFP positive cells to the rest of the cells of the ventricle. Overall design: Four paired biological replicates of wt1a:GFP positive and wt1a:GFP negative cells obtained from pools of 3 5 zebrafish heart ventricles. | pubmed:29610343 | wt1aGFP 1 neg | GSM2700326 | tissue:Heart|cell type:wt1a |pool:1 | wt1aGFP 1 neg | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: matrix counts.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | No treatment was applied. | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | cell type:wt1a |pool:1 | GSM2700326 | GSM2700326: wt1aGFP 1 neg; Danio rerio; RNA Seq | GSM2700326 | 1 | Whole zebrafish heart ventricles were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700326 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111553 | wt1aV_31_neg__HS_RNA_Seq_OvationSC_AACCAG_L002_R1_001.fastq.gz | fastq | 841688675.0 | 13798175.0 | GSM2700326 r2 | 0:61 | A:255002009;C:169696986;G:205887037;T:211071121;N:31522 | 61 | 255002009 | 169696986 | 205887037 | 211071121 | 31522 | SRX2996258 | SRS2347490 | SRA585736 | GEO | Bioinformatics Unit, CNIC | 1 | 0.88535 | 0.18061 | 0.82199 | 0.73203 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42905 | 42905 | SRR5820065 | SRX2997963 | SRS2349071 | SRP111705 | PRJNA393987 | postnb lineage traced cells at 7 and 60 days post cryoinjury dpi during adult zebrafish cardiac ventricle regeneration | GSE101199 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the ventricular apex. Regeneration is preceeded by a transient fibrotic response. Here we compare the expression profile of fibroblast like cells at 7 different time points of fibrosis resolution. Using a postnb:CreERT2; ubb:loxP GFP loxP mCherrycz1701 double transgenic line we permanently label cells that expressed postnb at 3 and 4 xxx post injury dpi with mCherry by administration of 4 OHT. We sequenced mCherry labelled cells obtained from the ventricular apex at 7 and 60 dpi. Overall design: postnb derived cells were FAC sorted from a pool of three to five biological samples. Four pools were collected at 7 dpi and three at 60 dpi. RNA was extracted from those pools and further processed for transcriptome analysis. | pubmed:29610343 | postnbCreERT2 60dpi 4 | GSM2700300 | tissue:Heart|treatment:60 dpi | postnbCreERT2 60dpi 4 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | postnb:CreERT2;ubb:loxP GFP loxP mCherry fish were treated over night with 4 OHT 10 µM at 3 and 4 dpi. Fish were dissected at 7 or 60 dpi. | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | treatment:60 dpi | GSM2700300 | GSM2700300: postnbCreERT2 60dpi 4; Danio rerio; RNA Seq | GSM2700300 | 1 | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700300 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111705 | pstnC60dpi_24__HS_RNA_Seq_OvationSC_TTGGCA_L001_R1_001.fastq.gz | fastq | 658472125.0 | 10794625.0 | GSM2700300 r1 | SRX2997963 | SRS2349071 | SRA586092 | GEO | Bioinformatics Unit, CNIC | 1 | 0.81414 | 0.33277 | 0.81746 | 0.52723 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||||||||||
| 42906 | 42906 | SRR5820066 | SRX2997963 | SRS2349071 | SRP111705 | PRJNA393987 | postnb lineage traced cells at 7 and 60 days post cryoinjury dpi during adult zebrafish cardiac ventricle regeneration | GSE101199 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the ventricular apex. Regeneration is preceeded by a transient fibrotic response. Here we compare the expression profile of fibroblast like cells at 7 different time points of fibrosis resolution. Using a postnb:CreERT2; ubb:loxP GFP loxP mCherrycz1701 double transgenic line we permanently label cells that expressed postnb at 3 and 4 xxx post injury dpi with mCherry by administration of 4 OHT. We sequenced mCherry labelled cells obtained from the ventricular apex at 7 and 60 dpi. Overall design: postnb derived cells were FAC sorted from a pool of three to five biological samples. Four pools were collected at 7 dpi and three at 60 dpi. RNA was extracted from those pools and further processed for transcriptome analysis. | pubmed:29610343 | postnbCreERT2 60dpi 4 | GSM2700300 | tissue:Heart|treatment:60 dpi | postnbCreERT2 60dpi 4 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | postnb:CreERT2;ubb:loxP GFP loxP mCherry fish were treated over night with 4 OHT 10 µM at 3 and 4 dpi. Fish were dissected at 7 or 60 dpi. | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | treatment:60 dpi | GSM2700300 | GSM2700300: postnbCreERT2 60dpi 4; Danio rerio; RNA Seq | GSM2700300 | 1 | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700300 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111705 | pstnC60dpi_24__HS_RNA_Seq_OvationSC_TTGGCA_L002_R1_001.fastq.gz | fastq | 667651710.0 | 10945110.0 | GSM2700300 r2 | 0:61 | A:187398827;C:124387075;G:170371629;T:185469418;N:24761 | 61 | 187398827 | 124387075 | 170371629 | 185469418 | 24761 | SRX2997963 | SRS2349071 | SRA586092 | GEO | Bioinformatics Unit, CNIC | 1 | 0.81012 | 0.32665 | 0.82207 | 0.52786 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42907 | 42907 | SRR5820063 | SRX2997962 | SRS2349070 | SRP111705 | PRJNA393987 | postnb lineage traced cells at 7 and 60 days post cryoinjury dpi during adult zebrafish cardiac ventricle regeneration | GSE101199 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the ventricular apex. Regeneration is preceeded by a transient fibrotic response. Here we compare the expression profile of fibroblast like cells at 7 different time points of fibrosis resolution. Using a postnb:CreERT2; ubb:loxP GFP loxP mCherrycz1701 double transgenic line we permanently label cells that expressed postnb at 3 and 4 xxx post injury dpi with mCherry by administration of 4 OHT. We sequenced mCherry labelled cells obtained from the ventricular apex at 7 and 60 dpi. Overall design: postnb derived cells were FAC sorted from a pool of three to five biological samples. Four pools were collected at 7 dpi and three at 60 dpi. RNA was extracted from those pools and further processed for transcriptome analysis. | pubmed:29610343 | postnbCreERT2 60dpi 2 | GSM2700299 | tissue:Heart|treatment:60 dpi | postnbCreERT2 60dpi 2 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | postnb:CreERT2;ubb:loxP GFP loxP mCherry fish were treated over night with 4 OHT 10 µM at 3 and 4 dpi. Fish were dissected at 7 or 60 dpi. | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | treatment:60 dpi | GSM2700299 | GSM2700299: postnbCreERT2 60dpi 2; Danio rerio; RNA Seq | GSM2700299 | 1 | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700299 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111705 | pstnC60dpi_22__HS_RNA_Seq_OvationSC_TCAGAG_L001_R1_001.fastq.gz | fastq | 812209022.0 | 13314902.0 | GSM2700299 r1 | 0:61 | A:228658409;C:151594988;G:205412898;T:226488086;N:54641 | 61 | 228658409 | 151594988 | 205412898 | 226488086 | 54641 | SRX2997962 | SRS2349070 | SRA586092 | GEO | Bioinformatics Unit, CNIC | 1 | 0.84081 | 0.33669 | 0.80026 | 0.55189 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42908 | 42908 | SRR5820064 | SRX2997962 | SRS2349070 | SRP111705 | PRJNA393987 | postnb lineage traced cells at 7 and 60 days post cryoinjury dpi during adult zebrafish cardiac ventricle regeneration | GSE101199 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the ventricular apex. Regeneration is preceeded by a transient fibrotic response. Here we compare the expression profile of fibroblast like cells at 7 different time points of fibrosis resolution. Using a postnb:CreERT2; ubb:loxP GFP loxP mCherrycz1701 double transgenic line we permanently label cells that expressed postnb at 3 and 4 xxx post injury dpi with mCherry by administration of 4 OHT. We sequenced mCherry labelled cells obtained from the ventricular apex at 7 and 60 dpi. Overall design: postnb derived cells were FAC sorted from a pool of three to five biological samples. Four pools were collected at 7 dpi and three at 60 dpi. RNA was extracted from those pools and further processed for transcriptome analysis. | pubmed:29610343 | postnbCreERT2 60dpi 2 | GSM2700299 | tissue:Heart|treatment:60 dpi | postnbCreERT2 60dpi 2 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | postnb:CreERT2;ubb:loxP GFP loxP mCherry fish were treated over night with 4 OHT 10 µM at 3 and 4 dpi. Fish were dissected at 7 or 60 dpi. | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | treatment:60 dpi | GSM2700299 | GSM2700299: postnbCreERT2 60dpi 2; Danio rerio; RNA Seq | GSM2700299 | 1 | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700299 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111705 | pstnC60dpi_22__HS_RNA_Seq_OvationSC_TCAGAG_L002_R1_001.fastq.gz | fastq | 824141232.0 | 13510512.0 | GSM2700299 r2 | 0:61 | A:232162664;C:153749805;G:208354200;T:229843231;N:31332 | 61 | 232162664 | 153749805 | 208354200 | 229843231 | 31332 | SRX2997962 | SRS2349070 | SRA586092 | GEO | Bioinformatics Unit, CNIC | 1 | 0.83912 | 0.33627 | 0.79935 | 0.55638 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42909 | 42909 | SRR5820061 | SRX2997961 | SRS2349069 | SRP111705 | PRJNA393987 | postnb lineage traced cells at 7 and 60 days post cryoinjury dpi during adult zebrafish cardiac ventricle regeneration | GSE101199 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the ventricular apex. Regeneration is preceeded by a transient fibrotic response. Here we compare the expression profile of fibroblast like cells at 7 different time points of fibrosis resolution. Using a postnb:CreERT2; ubb:loxP GFP loxP mCherrycz1701 double transgenic line we permanently label cells that expressed postnb at 3 and 4 xxx post injury dpi with mCherry by administration of 4 OHT. We sequenced mCherry labelled cells obtained from the ventricular apex at 7 and 60 dpi. Overall design: postnb derived cells were FAC sorted from a pool of three to five biological samples. Four pools were collected at 7 dpi and three at 60 dpi. RNA was extracted from those pools and further processed for transcriptome analysis. | pubmed:29610343 | postnbCreERT2 60dpi 1 | GSM2700298 | tissue:Heart|treatment:60 dpi | postnbCreERT2 60dpi 1 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | postnb:CreERT2;ubb:loxP GFP loxP mCherry fish were treated over night with 4 OHT 10 µM at 3 and 4 dpi. Fish were dissected at 7 or 60 dpi. | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | treatment:60 dpi | GSM2700298 | GSM2700298: postnbCreERT2 60dpi 1; Danio rerio; RNA Seq | GSM2700298 | 1 | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700298 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111705 | pstnC60dpi_21__HS_RNA_Seq_OvationSC_CGTAGA_L001_R1_001.fastq.gz | fastq | 820312811.0 | 13447751.0 | GSM2700298 r1 | 0:61 | A:224903496;C:155230235;G:218395518;T:221729453;N:54109 | 61 | 224903496 | 155230235 | 218395518 | 221729453 | 54109 | SRX2997961 | SRS2349069 | SRA586092 | GEO | Bioinformatics Unit, CNIC | 1 | 0.82352 | 0.30266 | 0.7936 | 0.54956 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42910 | 42910 | SRR5820062 | SRX2997961 | SRS2349069 | SRP111705 | PRJNA393987 | postnb lineage traced cells at 7 and 60 days post cryoinjury dpi during adult zebrafish cardiac ventricle regeneration | GSE101199 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the ventricular apex. Regeneration is preceeded by a transient fibrotic response. Here we compare the expression profile of fibroblast like cells at 7 different time points of fibrosis resolution. Using a postnb:CreERT2; ubb:loxP GFP loxP mCherrycz1701 double transgenic line we permanently label cells that expressed postnb at 3 and 4 xxx post injury dpi with mCherry by administration of 4 OHT. We sequenced mCherry labelled cells obtained from the ventricular apex at 7 and 60 dpi. Overall design: postnb derived cells were FAC sorted from a pool of three to five biological samples. Four pools were collected at 7 dpi and three at 60 dpi. RNA was extracted from those pools and further processed for transcriptome analysis. | pubmed:29610343 | postnbCreERT2 60dpi 1 | GSM2700298 | tissue:Heart|treatment:60 dpi | postnbCreERT2 60dpi 1 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | postnb:CreERT2;ubb:loxP GFP loxP mCherry fish were treated over night with 4 OHT 10 µM at 3 and 4 dpi. Fish were dissected at 7 or 60 dpi. | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | treatment:60 dpi | GSM2700298 | GSM2700298: postnbCreERT2 60dpi 1; Danio rerio; RNA Seq | GSM2700298 | 1 | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700298 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111705 | pstnC60dpi_21__HS_RNA_Seq_OvationSC_CGTAGA_L002_R1_001.fastq.gz | fastq | 831069612.0 | 13624092.0 | GSM2700298 r2 | 0:61 | A:227982894;C:157205567;G:221135004;T:224715301;N:30846 | 61 | 227982894 | 157205567 | 221135004 | 224715301 | 30846 | SRX2997961 | SRS2349069 | SRA586092 | GEO | Bioinformatics Unit, CNIC | 1 | 0.82359 | 0.30223 | 0.79876 | 0.5386 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42911 | 42911 | SRR5820059 | SRX2997960 | SRS2349068 | SRP111705 | PRJNA393987 | postnb lineage traced cells at 7 and 60 days post cryoinjury dpi during adult zebrafish cardiac ventricle regeneration | GSE101199 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the ventricular apex. Regeneration is preceeded by a transient fibrotic response. Here we compare the expression profile of fibroblast like cells at 7 different time points of fibrosis resolution. Using a postnb:CreERT2; ubb:loxP GFP loxP mCherrycz1701 double transgenic line we permanently label cells that expressed postnb at 3 and 4 xxx post injury dpi with mCherry by administration of 4 OHT. We sequenced mCherry labelled cells obtained from the ventricular apex at 7 and 60 dpi. Overall design: postnb derived cells were FAC sorted from a pool of three to five biological samples. Four pools were collected at 7 dpi and three at 60 dpi. RNA was extracted from those pools and further processed for transcriptome analysis. | pubmed:29610343 | postnbCreERT2 7dpi 4 | GSM2700297 | tissue:Heart|treatment:7 dpi | postnbCreERT2 7dpi 4 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | postnb:CreERT2;ubb:loxP GFP loxP mCherry fish were treated over night with 4 OHT 10 µM at 3 and 4 dpi. Fish were dissected at 7 or 60 dpi. | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | treatment:7 dpi | GSM2700297 | GSM2700297: postnbCreERT2 7dpi 4; Danio rerio; RNA Seq | GSM2700297 | 1 | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700297 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111705 | pstnC7dpi_24__HS_RNA_Seq_OvationSC_GAGTCA_L001_R1_001.fastq.gz | fastq | 529129067.0 | 8674247.0 | GSM2700297 r1 | 0:61 | A:145838822;C:101005915;G:133827073;T:148422408;N:34849 | 61 | 145838822 | 101005915 | 133827073 | 148422408 | 34849 | SRX2997960 | SRS2349068 | SRA586092 | GEO | Bioinformatics Unit, CNIC | 1 | 0.85327 | 0.29887 | 0.82398 | 0.59536 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42912 | 42912 | SRR5820060 | SRX2997960 | SRS2349068 | SRP111705 | PRJNA393987 | postnb lineage traced cells at 7 and 60 days post cryoinjury dpi during adult zebrafish cardiac ventricle regeneration | GSE101199 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the ventricular apex. Regeneration is preceeded by a transient fibrotic response. Here we compare the expression profile of fibroblast like cells at 7 different time points of fibrosis resolution. Using a postnb:CreERT2; ubb:loxP GFP loxP mCherrycz1701 double transgenic line we permanently label cells that expressed postnb at 3 and 4 xxx post injury dpi with mCherry by administration of 4 OHT. We sequenced mCherry labelled cells obtained from the ventricular apex at 7 and 60 dpi. Overall design: postnb derived cells were FAC sorted from a pool of three to five biological samples. Four pools were collected at 7 dpi and three at 60 dpi. RNA was extracted from those pools and further processed for transcriptome analysis. | pubmed:29610343 | postnbCreERT2 7dpi 4 | GSM2700297 | tissue:Heart|treatment:7 dpi | postnbCreERT2 7dpi 4 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | postnb:CreERT2;ubb:loxP GFP loxP mCherry fish were treated over night with 4 OHT 10 µM at 3 and 4 dpi. Fish were dissected at 7 or 60 dpi. | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | treatment:7 dpi | GSM2700297 | GSM2700297: postnbCreERT2 7dpi 4; Danio rerio; RNA Seq | GSM2700297 | 1 | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700297 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111705 | pstnC7dpi_24__HS_RNA_Seq_OvationSC_GAGTCA_L002_R1_001.fastq.gz | fastq | 537096033.0 | 8804853.0 | GSM2700297 r2 | 0:61 | A:148103577;C:102498850;G:135735762;T:150738056;N:19788 | 61 | 148103577 | 102498850 | 135735762 | 150738056 | 19788 | SRX2997960 | SRS2349068 | SRA586092 | GEO | Bioinformatics Unit, CNIC | 1 | 0.85107 | 0.29724 | 0.82489 | 0.59155 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42913 | 42913 | SRR5820057 | SRX2997959 | SRS2349067 | SRP111705 | PRJNA393987 | postnb lineage traced cells at 7 and 60 days post cryoinjury dpi during adult zebrafish cardiac ventricle regeneration | GSE101199 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the ventricular apex. Regeneration is preceeded by a transient fibrotic response. Here we compare the expression profile of fibroblast like cells at 7 different time points of fibrosis resolution. Using a postnb:CreERT2; ubb:loxP GFP loxP mCherrycz1701 double transgenic line we permanently label cells that expressed postnb at 3 and 4 xxx post injury dpi with mCherry by administration of 4 OHT. We sequenced mCherry labelled cells obtained from the ventricular apex at 7 and 60 dpi. Overall design: postnb derived cells were FAC sorted from a pool of three to five biological samples. Four pools were collected at 7 dpi and three at 60 dpi. RNA was extracted from those pools and further processed for transcriptome analysis. | pubmed:29610343 | postnbCreERT2 7dpi 3 | GSM2700296 | tissue:Heart|treatment:7 dpi | postnbCreERT2 7dpi 3 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | postnb:CreERT2;ubb:loxP GFP loxP mCherry fish were treated over night with 4 OHT 10 µM at 3 and 4 dpi. Fish were dissected at 7 or 60 dpi. | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | treatment:7 dpi | GSM2700296 | GSM2700296: postnbCreERT2 7dpi 3; Danio rerio; RNA Seq | GSM2700296 | 1 | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700296 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111705 | pstnC7dpi_23__HS_RNA_Seq_OvationSC_AGCATG_L001_R1_001.fastq.gz | fastq | 732770857.0 | 12012637.0 | GSM2700296 r1 | 0:61 | A:202857149;C:140357985;G:191010203;T:198497101;N:48419 | 61 | 202857149 | 140357985 | 191010203 | 198497101 | 48419 | SRX2997959 | SRS2349067 | SRA586092 | GEO | Bioinformatics Unit, CNIC | 1 | 0.84025 | 0.28858 | 0.78297 | 0.58582 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42914 | 42914 | SRR5820058 | SRX2997959 | SRS2349067 | SRP111705 | PRJNA393987 | postnb lineage traced cells at 7 and 60 days post cryoinjury dpi during adult zebrafish cardiac ventricle regeneration | GSE101199 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the ventricular apex. Regeneration is preceeded by a transient fibrotic response. Here we compare the expression profile of fibroblast like cells at 7 different time points of fibrosis resolution. Using a postnb:CreERT2; ubb:loxP GFP loxP mCherrycz1701 double transgenic line we permanently label cells that expressed postnb at 3 and 4 xxx post injury dpi with mCherry by administration of 4 OHT. We sequenced mCherry labelled cells obtained from the ventricular apex at 7 and 60 dpi. Overall design: postnb derived cells were FAC sorted from a pool of three to five biological samples. Four pools were collected at 7 dpi and three at 60 dpi. RNA was extracted from those pools and further processed for transcriptome analysis. | pubmed:29610343 | postnbCreERT2 7dpi 3 | GSM2700296 | tissue:Heart|treatment:7 dpi | postnbCreERT2 7dpi 3 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | postnb:CreERT2;ubb:loxP GFP loxP mCherry fish were treated over night with 4 OHT 10 µM at 3 and 4 dpi. Fish were dissected at 7 or 60 dpi. | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | treatment:7 dpi | GSM2700296 | GSM2700296: postnbCreERT2 7dpi 3; Danio rerio; RNA Seq | GSM2700296 | 1 | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700296 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111705 | pstnC7dpi_23__HS_RNA_Seq_OvationSC_AGCATG_L002_R1_001.fastq.gz | fastq | 742926320.0 | 12179120.0 | GSM2700296 r2 | 0:61 | A:205824167;C:142245364;G:193518156;T:201311005;N:27628 | 61 | 205824167 | 142245364 | 193518156 | 201311005 | 27628 | SRX2997959 | SRS2349067 | SRA586092 | GEO | Bioinformatics Unit, CNIC | 1 | 0.83963 | 0.28878 | 0.78577 | 0.57339 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42915 | 42915 | SRR5820055 | SRX2997958 | SRS2349066 | SRP111705 | PRJNA393987 | postnb lineage traced cells at 7 and 60 days post cryoinjury dpi during adult zebrafish cardiac ventricle regeneration | GSE101199 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the ventricular apex. Regeneration is preceeded by a transient fibrotic response. Here we compare the expression profile of fibroblast like cells at 7 different time points of fibrosis resolution. Using a postnb:CreERT2; ubb:loxP GFP loxP mCherrycz1701 double transgenic line we permanently label cells that expressed postnb at 3 and 4 xxx post injury dpi with mCherry by administration of 4 OHT. We sequenced mCherry labelled cells obtained from the ventricular apex at 7 and 60 dpi. Overall design: postnb derived cells were FAC sorted from a pool of three to five biological samples. Four pools were collected at 7 dpi and three at 60 dpi. RNA was extracted from those pools and further processed for transcriptome analysis. | pubmed:29610343 | postnbCreERT2 7dpi 2 | GSM2700295 | tissue:Heart|treatment:7 dpi | postnbCreERT2 7dpi 2 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | postnb:CreERT2;ubb:loxP GFP loxP mCherry fish were treated over night with 4 OHT 10 µM at 3 and 4 dpi. Fish were dissected at 7 or 60 dpi. | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | treatment:7 dpi | GSM2700295 | GSM2700295: postnbCreERT2 7dpi 2; Danio rerio; RNA Seq | GSM2700295 | 1 | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700295 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111705 | pstnC7dpi_22__HS_RNA_Seq_OvationSC_GGAGAA_L001_R1_001.fastq.gz | fastq | 798125708.0 | 13084028.0 | GSM2700295 r1 | 0:61 | A:220033386;C:154219970;G:209254999;T:214564836;N:52517 | 61 | 220033386 | 154219970 | 209254999 | 214564836 | 52517 | SRX2997958 | SRS2349066 | SRA586092 | GEO | Bioinformatics Unit, CNIC | 1 | 0.84868 | 0.29566 | 0.78395 | 0.60892 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42916 | 42916 | SRR5820056 | SRX2997958 | SRS2349066 | SRP111705 | PRJNA393987 | postnb lineage traced cells at 7 and 60 days post cryoinjury dpi during adult zebrafish cardiac ventricle regeneration | GSE101199 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the ventricular apex. Regeneration is preceeded by a transient fibrotic response. Here we compare the expression profile of fibroblast like cells at 7 different time points of fibrosis resolution. Using a postnb:CreERT2; ubb:loxP GFP loxP mCherrycz1701 double transgenic line we permanently label cells that expressed postnb at 3 and 4 xxx post injury dpi with mCherry by administration of 4 OHT. We sequenced mCherry labelled cells obtained from the ventricular apex at 7 and 60 dpi. Overall design: postnb derived cells were FAC sorted from a pool of three to five biological samples. Four pools were collected at 7 dpi and three at 60 dpi. RNA was extracted from those pools and further processed for transcriptome analysis. | pubmed:29610343 | postnbCreERT2 7dpi 2 | GSM2700295 | tissue:Heart|treatment:7 dpi | postnbCreERT2 7dpi 2 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | postnb:CreERT2;ubb:loxP GFP loxP mCherry fish were treated over night with 4 OHT 10 µM at 3 and 4 dpi. Fish were dissected at 7 or 60 dpi. | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | treatment:7 dpi | GSM2700295 | GSM2700295: postnbCreERT2 7dpi 2; Danio rerio; RNA Seq | GSM2700295 | 1 | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700295 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111705 | pstnC7dpi_22__HS_RNA_Seq_OvationSC_GGAGAA_L002_R1_001.fastq.gz | fastq | 811023060.0 | 13295460.0 | GSM2700295 r2 | 0:61 | A:223729714;C:156680800;G:212510056;T:218071242;N:31248 | 61 | 223729714 | 156680800 | 212510056 | 218071242 | 31248 | SRX2997958 | SRS2349066 | SRA586092 | GEO | Bioinformatics Unit, CNIC | 1 | 0.85147 | 0.29531 | 0.78614 | 0.59452 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42917 | 42917 | SRR5820053 | SRX2997957 | SRS2349065 | SRP111705 | PRJNA393987 | postnb lineage traced cells at 7 and 60 days post cryoinjury dpi during adult zebrafish cardiac ventricle regeneration | GSE101199 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the ventricular apex. Regeneration is preceeded by a transient fibrotic response. Here we compare the expression profile of fibroblast like cells at 7 different time points of fibrosis resolution. Using a postnb:CreERT2; ubb:loxP GFP loxP mCherrycz1701 double transgenic line we permanently label cells that expressed postnb at 3 and 4 xxx post injury dpi with mCherry by administration of 4 OHT. We sequenced mCherry labelled cells obtained from the ventricular apex at 7 and 60 dpi. Overall design: postnb derived cells were FAC sorted from a pool of three to five biological samples. Four pools were collected at 7 dpi and three at 60 dpi. RNA was extracted from those pools and further processed for transcriptome analysis. | pubmed:29610343 | postnbCreERT2 7dpi 1 | GSM2700294 | tissue:Heart|treatment:7 dpi | postnbCreERT2 7dpi 1 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | postnb:CreERT2;ubb:loxP GFP loxP mCherry fish were treated over night with 4 OHT 10 µM at 3 and 4 dpi. Fish were dissected at 7 or 60 dpi. | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | treatment:7 dpi | GSM2700294 | GSM2700294: postnbCreERT2 7dpi 1; Danio rerio; RNA Seq | GSM2700294 | 1 | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700294 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111705 | pstnC7dpi_21__HS_RNA_Seq_OvationSC_AAGAGG_L001_R1_001.fastq.gz | fastq | 791727113.0 | 12979133.0 | GSM2700294 r1 | 0:61 | A:221474690;C:149322441;G:203129939;T:217747332;N:52711 | 61 | 221474690 | 149322441 | 203129939 | 217747332 | 52711 | SRX2997957 | SRS2349065 | SRA586092 | GEO | Bioinformatics Unit, CNIC | 1 | 0.82196 | 0.30812 | 0.7895 | 0.58101 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 42918 | 42918 | SRR5820054 | SRX2997957 | SRS2349065 | SRP111705 | PRJNA393987 | postnb lineage traced cells at 7 and 60 days post cryoinjury dpi during adult zebrafish cardiac ventricle regeneration | GSE101199 | Transcriptome Analysis | Contrary to mammals zebrafish regenerate their heart upon cryoinjury of the ventricular apex. Regeneration is preceeded by a transient fibrotic response. Here we compare the expression profile of fibroblast like cells at 7 different time points of fibrosis resolution. Using a postnb:CreERT2; ubb:loxP GFP loxP mCherrycz1701 double transgenic line we permanently label cells that expressed postnb at 3 and 4 xxx post injury dpi with mCherry by administration of 4 OHT. We sequenced mCherry labelled cells obtained from the ventricular apex at 7 and 60 dpi. Overall design: postnb derived cells were FAC sorted from a pool of three to five biological samples. Four pools were collected at 7 dpi and three at 60 dpi. RNA was extracted from those pools and further processed for transcriptome analysis. | pubmed:29610343 | postnbCreERT2 7dpi 1 | GSM2700294 | tissue:Heart|treatment:7 dpi | postnbCreERT2 7dpi 1 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.25. Genome build: Ensembl genebuild 10 release 82 Danio rerio assembly Zv9. Supplementary files format and content: Matrix table.xlsx file contains ENSEMBL gene Ids and TMM Normalized counts per million for each sample. | Heart | postnb:CreERT2;ubb:loxP GFP loxP mCherry fish were treated over night with 4 OHT 10 µM at 3 and 4 dpi. Fish were dissected at 7 or 60 dpi. | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | All experiments were conducted with adult zebrafish between 3 month and 9 month of age raised at a density of 3 fish/l. | treatment:7 dpi | GSM2700294 | GSM2700294: postnbCreERT2 7dpi 1; Danio rerio; RNA Seq | GSM2700294 | 1 | Ventricular apex were dissotiated using pronase elastase DNase and liberase TH. mCherry positive cells were FAC sorted ventricular apex. Cells were sorted using SONY Synergy sy3200 and RNA was extracted using Arcturus Pico Pure Thermofisher following manufacturer instructions.0.2 0.6 ng of total RNA was used to generate barcoded RNA seq libraries using the Ovation Single Cell RNA Seq System NuGEN with two rounds of library amplification. The size of the libraries was calculated using the Agilent 2100 Bioanalyzer. Library concentration was determined using the Qubit® fluorometer ThermoFisher Scientific. Libraries were sequenced on a HiSeq2500 Illumina to generate 60 bases single reads. FastQ files for each sample were obtained using CASAVA v1.8 software Illumina. 3 5 pooled hearts were used per sample. Index tagged cDNA libraries were constructed with the TruSeq RNA Sample Preparation v2 Kit Illumina San Diego CA. | GEO Accession:GSM2700294 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111705 | pstnC7dpi_21__HS_RNA_Seq_OvationSC_AAGAGG_L002_R1_001.fastq.gz | fastq | 801987435.0 | 13147335.0 | GSM2700294 r2 | 0:61 | A:224436021;C:151157500;G:205611822;T:220752212;N:29880 | 61 | 224436021 | 151157500 | 205611822 | 220752212 | 29880 | SRX2997957 | SRS2349065 | SRA586092 | GEO | Bioinformatics Unit, CNIC | 1 | 0.82242 | 0.30689 | 0.79044 | 0.57309 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2017-07-11 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||||
| 44967 | 44967 | SRR6345660 | SRX3442976 | SRS2733636 | SRP126106 | PRJNA421016 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] | GSE107682 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. | parent bioproject:PRJNA315403 | pubmed:30086300 | smRNA seq library of ovary from tdrd6a mut fish | GSM2875719 | source name:Ovary from tdrd6a mut fish|tissue:whole ovary|genotype:tdrd6a mutant | smRNA seq library of ovary from tdrd6a mut fish | 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks. | Ovary from tdrd6a mut fish | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | tissue:whole ovary|genotype:tdrd6a mutant | GSM2875719 | GSM2875719: smRNA seq library of ovary from tdrd6a mut fish; Danio rerio; ncRNA Seq | GSM2875719 | 1 | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | GEO Accession:GSM2875719 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP126106 | Tdrd6a-mut-ovary-input-Adult.fastq.gz | fastq | 817885062.0 | 16036962.0 | GSM2875719 r1 | 0:51 | A:212456064;C:163491733;G:233627239;T:208262707;N:47319 | 51 | 212456064 | 163491733 | 233627239 | 208262707 | 47319 | SRX3442976 | SRS2733636 | SRA636010 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.46308 | 0.13668 | 0.83587 | 0.79104 | 51 | B | usable mapping rate | illumina | hiseq_era | 5prime | size_fractionation | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2017-12-04 | Undetermined | Undetermined | Gonad | Reproductive System | ||||||||||||||||||
| 44968 | 44968 | SRR6345659 | SRX3442975 | SRS2733637 | SRP126106 | PRJNA421016 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] | GSE107682 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. | parent bioproject:PRJNA315403 | pubmed:30086300 | smRNA seq library of ovary from tdrd6a het fish | GSM2875718 | source name:Ovary from tdrd6a het fish|tissue:whole ovary|genotype:tdrd6a heterozygous | smRNA seq library of ovary from tdrd6a het fish | 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks. | Ovary from tdrd6a het fish | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | tissue:whole ovary|genotype:tdrd6a heterozygous | GSM2875718 | GSM2875718: smRNA seq library of ovary from tdrd6a het fish; Danio rerio; ncRNA Seq | GSM2875718 | 1 | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | GEO Accession:GSM2875718 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP126106 | Tdrd6a-het-ovary-input-Adult.fastq.gz | fastq | 1452353571.0 | 28477521.0 | GSM2875718 r1 | 0:51 | A:397993735;C:284194126;G:396142390;T:373939235;N:84085 | 51 | 397993735 | 284194126 | 396142390 | 373939235 | 84085 | SRX3442975 | SRS2733637 | SRA636010 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.3869 | 0.1369 | 0.86397 | 0.77165 | 51 | B | usable mapping rate | illumina | hiseq_era | 5prime | size_fractionation | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2017-12-04 | Undetermined | Undetermined | Gonad | Reproductive System | ||||||||||||||||||
| 44969 | 44969 | SRR6345658 | SRX3442974 | SRS2733632 | SRP126106 | PRJNA421016 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] | GSE107682 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. | parent bioproject:PRJNA315403 | pubmed:30086300 | smRNA seq library of late oocytes from tdrd6a hett fish | GSM2875717 | source name:late oocytes from tdrd6a hett fish|tissue:late oocytes|genotype:tdrd6a heterozygous | smRNA seq library of late oocytes from tdrd6a hett fish | 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks. | late oocytes from tdrd6a hett fish | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | tissue:late oocytes|genotype:tdrd6a heterozygous | GSM2875717 | GSM2875717: smRNA seq library of late oocytes from tdrd6a hett fish; Danio rerio; ncRNA Seq | GSM2875717 | 1 | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | GEO Accession:GSM2875717 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP126106 | tdrd6a-het_oocytes-late-input.fastq.gz | fastq | 1884769630.0 | 28130890.0 | GSM2875717 r1 | 0:67 | A:519051884;C:437635381;G:510738306;T:417295309;N:48750 | 67 | 519051884 | 437635381 | 510738306 | 417295309 | 48750 | SRX3442974 | SRS2733632 | SRA636010 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.17778 | 0.06655 | 0.95931 | 0.91529 | 67 | B | usable mapping rate | illumina | hiseq_era | 5prime | size_fractionation | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2017-12-04 | Zygote | Embryo | Oocyte | Reproductive System | ||||||||||||||||||
| 44970 | 44970 | SRR6345657 | SRX3442973 | SRS2733634 | SRP126106 | PRJNA421016 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] | GSE107682 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. | parent bioproject:PRJNA315403 | pubmed:30086300 | smRNA seq library of early oocytes from tdrd6a mut fish | GSM2875716 | source name:early oocytes from tdrd6a mut fish|tissue:early oocytes|genotype:tdrd6a mutant | smRNA seq library of early oocytes from tdrd6a mut fish | 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks. | early oocytes from tdrd6a mut fish | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | tissue:early oocytes|genotype:tdrd6a mutant | GSM2875716 | GSM2875716: smRNA seq library of early oocytes from tdrd6a mut fish; Danio rerio; ncRNA Seq | GSM2875716 | 1 | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | GEO Accession:GSM2875716 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP126106 | tdrd6a-mut_oocytes-early-input.fastq.gz | fastq | 2102216723.0 | 31376369.0 | GSM2875716 r1 | 0:67 | A:592618102;C:472348913;G:550028898;T:487165955;N:54855 | 67 | 592618102 | 472348913 | 550028898 | 487165955 | 54855 | SRX3442973 | SRS2733634 | SRA636010 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.08293 | 0.04595 | 0.96193 | 0.77321 | 67 | B | usable mapping rate | illumina | hiseq_era | 5prime | size_fractionation | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2017-12-04 | Zygote | Embryo | Oocyte | Reproductive System | ||||||||||||||||||
| 44971 | 44971 | SRR6345656 | SRX3442972 | SRS2733635 | SRP126106 | PRJNA421016 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] | GSE107682 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. | parent bioproject:PRJNA315403 | pubmed:30086300 | smRNA seq library of late oocytes from tdrd6a mut fish | GSM2875715 | source name:late oocytes from tdrd6a mut fish|tissue:late oocytes|genotype:tdrd6a mutant | smRNA seq library of late oocytes from tdrd6a mut fish | 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks. | late oocytes from tdrd6a mut fish | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | tissue:late oocytes|genotype:tdrd6a mutant | GSM2875715 | GSM2875715: smRNA seq library of late oocytes from tdrd6a mut fish; Danio rerio; ncRNA Seq | GSM2875715 | 1 | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | GEO Accession:GSM2875715 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP126106 | tdrd6a-mut_oocytes-late-input.fastq.gz | fastq | 2110760295.0 | 31503885.0 | GSM2875715 r1 | 0:67 | A:582021495;C:486821539;G:582933348;T:458929133;N:54780 | 67 | 582021495 | 486821539 | 582933348 | 458929133 | 54780 | SRX3442972 | SRS2733635 | SRA636010 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.17064 | 0.06728 | 0.96173 | 0.9114 | 67 | B | usable mapping rate | illumina | hiseq_era | 5prime | size_fractionation | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2017-12-04 | Zygote | Embryo | Oocyte | Reproductive System | ||||||||||||||||||
| 44972 | 44972 | SRR6345655 | SRX3442971 | SRS2733633 | SRP126106 | PRJNA421016 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] | GSE107682 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. | parent bioproject:PRJNA315403 | pubmed:30086300 | smRNA seq library of early oocytes from tdrd6a het fish | GSM2875714 | source name:early oocytes from tdrd6a het fish|tissue:Early oocytes|genotype:tdrd6a heterozygous | smRNA seq library of early oocytes from tdrd6a het fish | 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks. | early oocytes from tdrd6a het fish | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | tissue:Early oocytes|genotype:tdrd6a heterozygous | GSM2875714 | GSM2875714: smRNA seq library of early oocytes from tdrd6a het fish; Danio rerio; ncRNA Seq | GSM2875714 | 1 | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | GEO Accession:GSM2875714 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP126106 | tdrd6a-het_oocytes-early-input.fastq.gz | fastq | 2243425655.0 | 33483965.0 | GSM2875714 r1 | 0:67 | A:633468129;C:503239215;G:592089295;T:514571679;N:57337 | 67 | 633468129 | 503239215 | 592089295 | 514571679 | 57337 | SRX3442971 | SRS2733633 | SRA636010 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.06641 | 0.04254 | 0.96806 | 0.58509 | 67 | B | usable mapping rate | illumina | hiseq_era | 5prime | size_fractionation | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2017-12-04 | Zygote | Embryo | Oocyte | Reproductive System | ||||||||||||||||||
| 48425 | 48425 | SRR7266726 | SRX4170565 | SRS3382375 | SRP149832 | PRJNA474730 | Transcriptome analysis of wt1b:eGFP positive macrophages in the regenerating zebrafish heart | GSE115381 | Transcriptome Analysis | Little is known about zebrafish macrophage subtypes and their contribution to organ regeneration. Using the transgenic line wt1b:eGFP we identified a subtype of macrophages in the regenerating heart that is transcriptionally different from the rest of macrophages. Overall design: Hearts from Tgwt1b:eGFP; mpeg1:mCherry zebrafish were cryoinjured and at 4 dpi mCherry and GFP/mCherry cells were FAC sorted. RNA was extracted from 4 pools of GFP/mCherry and 4 pools of mCherry single positive cells and RNAseq was performed. | parent bioproject:PRJNA485878 | pubmed:31365871 | MRWT1 5 | GSM3177088 | tissue:mpeg1:mCherry/wt1b:eGFP cells from 4dpi hearts|phenotype:mpeg1:mCherry/wt1b:eGFP|library batch:2 | MRWT1 5 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.3. Genome build: Ensembl genebuild 75 Danio rerio assembly Zv9. Supplementary files format and content: matrix table.xls file contains ENSEMBL gene Ids and TMM normalized batch corrected counts per million for each sample. | mpeg1:mCherry/wt1b:eGFP cells from 4dpi hearts | Four biological replicates consisting of FAC sorted cells coming from five to seven pooled hearts were used per phenotype. | RNA was extracted with PicoPure™ RNA Isolation Kit Index tagged cDNA libraries were constructed in two batches from total RNA 1 ng with the TruSeq RNA sample preparation v2 kit Illumina post amplification with the NuGen OvationSC RNA Seq System. Quality quantity and size distribution of the Illumina libraries were determined using the DNA 1000 kit Agilent Bioanalyzer. RNASeq. Libraries were sequenced single end mode and length of 60 61 bp on the Illumina HiSeq 2500 system using the standard RNA sequencing protocol in the TruSeq SBS kit v5. | All experiments were conducted with adult zebrafish between 6 month and 9 month of age raised at a density of 3 fish/l. | phenotype:mpeg1:mCherry/wt1b:eGFP|library batch:2 | GSM3177088 | GSM3177088: MRWT1 5; Danio rerio; RNA Seq | GSM3177088 | 1 | RNA was extracted with PicoPure™ RNA Isolation Kit Index tagged cDNA libraries were constructed in two batches from total RNA 1 ng with the TruSeq RNA sample preparation v2 kit Illumina post amplification with the NuGen OvationSC RNA Seq System. Quality quantity and size distribution of the Illumina libraries were determined using the DNA 1000 kit Agilent Bioanalyzer. RNASeq. Libraries were sequenced single end mode and length of 60 61 bp on the Illumina HiSeq 2500 system using the standard RNA sequencing protocol in the TruSeq SBS kit v5. | GEO Accession:GSM3177088 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP149832 | MRWT15__AnaBelenGarcia_RNA_Seq_OvationSC_GAGTCA_L002_R1_001.fastq.gz | fastq | 1609149012.0 | 26379492.0 | GSM3177088 r1 | 0:61 1:0 | A:432557422;C:346615764;G:438332984;T:391553708;N:89134 | 61 | 0 | 432557422 | 346615764 | 438332984 | 391553708 | 89134 | SRX4170565 | SRS3382375 | SRA715602 | GEO | Bioinformatics Unit, CNIC | 1 | 0.75712 | 0.25964 | 0.83737 | 0.58775 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2018-06-05 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||
| 48426 | 48426 | SRR7266725 | SRX4170564 | SRS3382374 | SRP149832 | PRJNA474730 | Transcriptome analysis of wt1b:eGFP positive macrophages in the regenerating zebrafish heart | GSE115381 | Transcriptome Analysis | Little is known about zebrafish macrophage subtypes and their contribution to organ regeneration. Using the transgenic line wt1b:eGFP we identified a subtype of macrophages in the regenerating heart that is transcriptionally different from the rest of macrophages. Overall design: Hearts from Tgwt1b:eGFP; mpeg1:mCherry zebrafish were cryoinjured and at 4 dpi mCherry and GFP/mCherry cells were FAC sorted. RNA was extracted from 4 pools of GFP/mCherry and 4 pools of mCherry single positive cells and RNAseq was performed. | parent bioproject:PRJNA485878 | pubmed:31365871 | MRWT1 4 | GSM3177087 | tissue:mpeg1:mCherry/wt1b:eGFP cells from 4dpi hearts|phenotype:mpeg1:mCherry/wt1b:eGFP|library batch:2 | MRWT1 4 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.3. Genome build: Ensembl genebuild 75 Danio rerio assembly Zv9. Supplementary files format and content: matrix table.xls file contains ENSEMBL gene Ids and TMM normalized batch corrected counts per million for each sample. | mpeg1:mCherry/wt1b:eGFP cells from 4dpi hearts | Four biological replicates consisting of FAC sorted cells coming from five to seven pooled hearts were used per phenotype. | RNA was extracted with PicoPure™ RNA Isolation Kit Index tagged cDNA libraries were constructed in two batches from total RNA 1 ng with the TruSeq RNA sample preparation v2 kit Illumina post amplification with the NuGen OvationSC RNA Seq System. Quality quantity and size distribution of the Illumina libraries were determined using the DNA 1000 kit Agilent Bioanalyzer. RNASeq. Libraries were sequenced single end mode and length of 60 61 bp on the Illumina HiSeq 2500 system using the standard RNA sequencing protocol in the TruSeq SBS kit v5. | All experiments were conducted with adult zebrafish between 6 month and 9 month of age raised at a density of 3 fish/l. | phenotype:mpeg1:mCherry/wt1b:eGFP|library batch:2 | GSM3177087 | GSM3177087: MRWT1 4; Danio rerio; RNA Seq | GSM3177087 | 1 | RNA was extracted with PicoPure™ RNA Isolation Kit Index tagged cDNA libraries were constructed in two batches from total RNA 1 ng with the TruSeq RNA sample preparation v2 kit Illumina post amplification with the NuGen OvationSC RNA Seq System. Quality quantity and size distribution of the Illumina libraries were determined using the DNA 1000 kit Agilent Bioanalyzer. RNASeq. Libraries were sequenced single end mode and length of 60 61 bp on the Illumina HiSeq 2500 system using the standard RNA sequencing protocol in the TruSeq SBS kit v5. | GEO Accession:GSM3177087 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP149832 | MRWT14__AnaBelenGarcia_RNA_Seq_OvationSC_AGCATG_L002_R1_001.fastq.gz | fastq | 1578335899.0 | 25874359.0 | GSM3177087 r1 | 0:61 1:0 | A:403622771;C:331438424;G:444808774;T:398377182;N:88748 | 61 | 0 | 403622771 | 331438424 | 444808774 | 398377182 | 88748 | SRX4170564 | SRS3382374 | SRA715602 | GEO | Bioinformatics Unit, CNIC | 1 | 0.87043 | 0.29681 | 0.84376 | 0.60111 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2018-06-05 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||
| 48427 | 48427 | SRR7266724 | SRX4170563 | SRS3382372 | SRP149832 | PRJNA474730 | Transcriptome analysis of wt1b:eGFP positive macrophages in the regenerating zebrafish heart | GSE115381 | Transcriptome Analysis | Little is known about zebrafish macrophage subtypes and their contribution to organ regeneration. Using the transgenic line wt1b:eGFP we identified a subtype of macrophages in the regenerating heart that is transcriptionally different from the rest of macrophages. Overall design: Hearts from Tgwt1b:eGFP; mpeg1:mCherry zebrafish were cryoinjured and at 4 dpi mCherry and GFP/mCherry cells were FAC sorted. RNA was extracted from 4 pools of GFP/mCherry and 4 pools of mCherry single positive cells and RNAseq was performed. | parent bioproject:PRJNA485878 | pubmed:31365871 | MRWT1 2 | GSM3177086 | tissue:mpeg1:mCherry/wt1b:eGFP cells from 4dpi hearts|phenotype:mpeg1:mCherry/wt1b:eGFP|library batch:1 | MRWT1 2 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.3. Genome build: Ensembl genebuild 75 Danio rerio assembly Zv9. Supplementary files format and content: matrix table.xls file contains ENSEMBL gene Ids and TMM normalized batch corrected counts per million for each sample. | mpeg1:mCherry/wt1b:eGFP cells from 4dpi hearts | Four biological replicates consisting of FAC sorted cells coming from five to seven pooled hearts were used per phenotype. | RNA was extracted with PicoPure™ RNA Isolation Kit Index tagged cDNA libraries were constructed in two batches from total RNA 1 ng with the TruSeq RNA sample preparation v2 kit Illumina post amplification with the NuGen OvationSC RNA Seq System. Quality quantity and size distribution of the Illumina libraries were determined using the DNA 1000 kit Agilent Bioanalyzer. RNASeq. Libraries were sequenced single end mode and length of 60 61 bp on the Illumina HiSeq 2500 system using the standard RNA sequencing protocol in the TruSeq SBS kit v5. | All experiments were conducted with adult zebrafish between 6 month and 9 month of age raised at a density of 3 fish/l. | phenotype:mpeg1:mCherry/wt1b:eGFP|library batch:1 | GSM3177086 | GSM3177086: MRWT1 2; Danio rerio; RNA Seq | GSM3177086 | 1 | RNA was extracted with PicoPure™ RNA Isolation Kit Index tagged cDNA libraries were constructed in two batches from total RNA 1 ng with the TruSeq RNA sample preparation v2 kit Illumina post amplification with the NuGen OvationSC RNA Seq System. Quality quantity and size distribution of the Illumina libraries were determined using the DNA 1000 kit Agilent Bioanalyzer. RNASeq. Libraries were sequenced single end mode and length of 60 61 bp on the Illumina HiSeq 2500 system using the standard RNA sequencing protocol in the TruSeq SBS kit v5. | GEO Accession:GSM3177086 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP149832 | MRWT1_2__AnaBelenGarcia_RNA_Seq_OvationSC_CACAGT_L001_R1_001.fastq.gz | fastq | 1647958920.0 | 27465982.0 | GSM3177086 r1 | 0:60 | A:443708613;C:313933032;G:445835945;T:444367644;N:113686 | 60 | 443708613 | 313933032 | 445835945 | 444367644 | 113686 | SRX4170563 | SRS3382372 | SRA715602 | GEO | Bioinformatics Unit, CNIC | 1 | 0.85143 | 0.29582 | 0.83564 | 0.59274 | 60 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2018-06-05 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||
| 48428 | 48428 | SRR7266723 | SRX4170562 | SRS3382373 | SRP149832 | PRJNA474730 | Transcriptome analysis of wt1b:eGFP positive macrophages in the regenerating zebrafish heart | GSE115381 | Transcriptome Analysis | Little is known about zebrafish macrophage subtypes and their contribution to organ regeneration. Using the transgenic line wt1b:eGFP we identified a subtype of macrophages in the regenerating heart that is transcriptionally different from the rest of macrophages. Overall design: Hearts from Tgwt1b:eGFP; mpeg1:mCherry zebrafish were cryoinjured and at 4 dpi mCherry and GFP/mCherry cells were FAC sorted. RNA was extracted from 4 pools of GFP/mCherry and 4 pools of mCherry single positive cells and RNAseq was performed. | parent bioproject:PRJNA485878 | pubmed:31365871 | MRWT1 1 | GSM3177085 | tissue:mpeg1:mCherry/wt1b:eGFP cells from 4dpi hearts|phenotype:mpeg1:mCherry/wt1b:eGFP|library batch:1 | MRWT1 1 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.3. Genome build: Ensembl genebuild 75 Danio rerio assembly Zv9. Supplementary files format and content: matrix table.xls file contains ENSEMBL gene Ids and TMM normalized batch corrected counts per million for each sample. | mpeg1:mCherry/wt1b:eGFP cells from 4dpi hearts | Four biological replicates consisting of FAC sorted cells coming from five to seven pooled hearts were used per phenotype. | RNA was extracted with PicoPure™ RNA Isolation Kit Index tagged cDNA libraries were constructed in two batches from total RNA 1 ng with the TruSeq RNA sample preparation v2 kit Illumina post amplification with the NuGen OvationSC RNA Seq System. Quality quantity and size distribution of the Illumina libraries were determined using the DNA 1000 kit Agilent Bioanalyzer. RNASeq. Libraries were sequenced single end mode and length of 60 61 bp on the Illumina HiSeq 2500 system using the standard RNA sequencing protocol in the TruSeq SBS kit v5. | All experiments were conducted with adult zebrafish between 6 month and 9 month of age raised at a density of 3 fish/l. | phenotype:mpeg1:mCherry/wt1b:eGFP|library batch:1 | GSM3177085 | GSM3177085: MRWT1 1; Danio rerio; RNA Seq | GSM3177085 | 1 | RNA was extracted with PicoPure™ RNA Isolation Kit Index tagged cDNA libraries were constructed in two batches from total RNA 1 ng with the TruSeq RNA sample preparation v2 kit Illumina post amplification with the NuGen OvationSC RNA Seq System. Quality quantity and size distribution of the Illumina libraries were determined using the DNA 1000 kit Agilent Bioanalyzer. RNASeq. Libraries were sequenced single end mode and length of 60 61 bp on the Illumina HiSeq 2500 system using the standard RNA sequencing protocol in the TruSeq SBS kit v5. | GEO Accession:GSM3177085 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP149832 | MRWT1_1__AnaBelenGarcia_RNA_Seq_OvationSC_TCAGAG_L001_R1_001.fastq.gz | fastq | 1361787360.0 | 22696456.0 | GSM3177085 r1 | 0:60 | A:365235306;C:266923973;G:370787525;T:358747902;N:92654 | 60 | 365235306 | 266923973 | 370787525 | 358747902 | 92654 | SRX4170562 | SRS3382373 | SRA715602 | GEO | Bioinformatics Unit, CNIC | 1 | 0.79693 | 0.28628 | 0.87903 | 0.55995 | 60 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2018-06-05 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||
| 48429 | 48429 | SRR7266722 | SRX4170561 | SRS3382371 | SRP149832 | PRJNA474730 | Transcriptome analysis of wt1b:eGFP positive macrophages in the regenerating zebrafish heart | GSE115381 | Transcriptome Analysis | Little is known about zebrafish macrophage subtypes and their contribution to organ regeneration. Using the transgenic line wt1b:eGFP we identified a subtype of macrophages in the regenerating heart that is transcriptionally different from the rest of macrophages. Overall design: Hearts from Tgwt1b:eGFP; mpeg1:mCherry zebrafish were cryoinjured and at 4 dpi mCherry and GFP/mCherry cells were FAC sorted. RNA was extracted from 4 pools of GFP/mCherry and 4 pools of mCherry single positive cells and RNAseq was performed. | parent bioproject:PRJNA485878 | pubmed:31365871 | MR 5 | GSM3177084 | tissue:mpeg1:mCherry cells from 4dpi hearts|phenotype:mpeg1:mCherry|library batch:2 | MR 5 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.3. Genome build: Ensembl genebuild 75 Danio rerio assembly Zv9. Supplementary files format and content: matrix table.xls file contains ENSEMBL gene Ids and TMM normalized batch corrected counts per million for each sample. | mpeg1:mCherry cells from 4dpi hearts | Four biological replicates consisting of FAC sorted cells coming from five to seven pooled hearts were used per phenotype. | RNA was extracted with PicoPure™ RNA Isolation Kit Index tagged cDNA libraries were constructed in two batches from total RNA 1 ng with the TruSeq RNA sample preparation v2 kit Illumina post amplification with the NuGen OvationSC RNA Seq System. Quality quantity and size distribution of the Illumina libraries were determined using the DNA 1000 kit Agilent Bioanalyzer. RNASeq. Libraries were sequenced single end mode and length of 60 61 bp on the Illumina HiSeq 2500 system using the standard RNA sequencing protocol in the TruSeq SBS kit v5. | All experiments were conducted with adult zebrafish between 6 month and 9 month of age raised at a density of 3 fish/l. | phenotype:mpeg1:mCherry|library batch:2 | GSM3177084 | GSM3177084: MR 5; Danio rerio; RNA Seq | GSM3177084 | 1 | RNA was extracted with PicoPure™ RNA Isolation Kit Index tagged cDNA libraries were constructed in two batches from total RNA 1 ng with the TruSeq RNA sample preparation v2 kit Illumina post amplification with the NuGen OvationSC RNA Seq System. Quality quantity and size distribution of the Illumina libraries were determined using the DNA 1000 kit Agilent Bioanalyzer. RNASeq. Libraries were sequenced single end mode and length of 60 61 bp on the Illumina HiSeq 2500 system using the standard RNA sequencing protocol in the TruSeq SBS kit v5. | GEO Accession:GSM3177084 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP149832 | MR5__AnaBelenGarcia_RNA_Seq_OvationSC_GGAGAA_L002_R1_001.fastq.gz | fastq | 1159385276.0 | 19006316.0 | GSM3177084 r1 | 0:61 1:0 | A:316084223;C:249253761;G:317016302;T:276966251;N:64739 | 61 | 0 | 316084223 | 249253761 | 317016302 | 276966251 | 64739 | SRX4170561 | SRS3382371 | SRA715602 | GEO | Bioinformatics Unit, CNIC | 1 | 0.72668 | 0.26774 | 0.84078 | 0.56426 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2018-06-05 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||
| 48430 | 48430 | SRR7266721 | SRX4170560 | SRS3382369 | SRP149832 | PRJNA474730 | Transcriptome analysis of wt1b:eGFP positive macrophages in the regenerating zebrafish heart | GSE115381 | Transcriptome Analysis | Little is known about zebrafish macrophage subtypes and their contribution to organ regeneration. Using the transgenic line wt1b:eGFP we identified a subtype of macrophages in the regenerating heart that is transcriptionally different from the rest of macrophages. Overall design: Hearts from Tgwt1b:eGFP; mpeg1:mCherry zebrafish were cryoinjured and at 4 dpi mCherry and GFP/mCherry cells were FAC sorted. RNA was extracted from 4 pools of GFP/mCherry and 4 pools of mCherry single positive cells and RNAseq was performed. | parent bioproject:PRJNA485878 | pubmed:31365871 | MR 4 | GSM3177083 | tissue:mpeg1:mCherry cells from 4dpi hearts|phenotype:mpeg1:mCherry|library batch:2 | MR 4 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.3. Genome build: Ensembl genebuild 75 Danio rerio assembly Zv9. Supplementary files format and content: matrix table.xls file contains ENSEMBL gene Ids and TMM normalized batch corrected counts per million for each sample. | mpeg1:mCherry cells from 4dpi hearts | Four biological replicates consisting of FAC sorted cells coming from five to seven pooled hearts were used per phenotype. | RNA was extracted with PicoPure™ RNA Isolation Kit Index tagged cDNA libraries were constructed in two batches from total RNA 1 ng with the TruSeq RNA sample preparation v2 kit Illumina post amplification with the NuGen OvationSC RNA Seq System. Quality quantity and size distribution of the Illumina libraries were determined using the DNA 1000 kit Agilent Bioanalyzer. RNASeq. Libraries were sequenced single end mode and length of 60 61 bp on the Illumina HiSeq 2500 system using the standard RNA sequencing protocol in the TruSeq SBS kit v5. | All experiments were conducted with adult zebrafish between 6 month and 9 month of age raised at a density of 3 fish/l. | phenotype:mpeg1:mCherry|library batch:2 | GSM3177083 | GSM3177083: MR 4; Danio rerio; RNA Seq | GSM3177083 | 1 | RNA was extracted with PicoPure™ RNA Isolation Kit Index tagged cDNA libraries were constructed in two batches from total RNA 1 ng with the TruSeq RNA sample preparation v2 kit Illumina post amplification with the NuGen OvationSC RNA Seq System. Quality quantity and size distribution of the Illumina libraries were determined using the DNA 1000 kit Agilent Bioanalyzer. RNASeq. Libraries were sequenced single end mode and length of 60 61 bp on the Illumina HiSeq 2500 system using the standard RNA sequencing protocol in the TruSeq SBS kit v5. | GEO Accession:GSM3177083 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP149832 | MR4__AnaBelenGarcia_RNA_Seq_OvationSC_AAGAGG_L002_R1_001.fastq.gz | fastq | 1031492188.0 | 16909708.0 | GSM3177083 r1 | 0:61 1:0 | A:275201446;C:215010611;G:277227531;T:263995484;N:57116 | 61 | 0 | 275201446 | 215010611 | 277227531 | 263995484 | 57116 | SRX4170560 | SRS3382369 | SRA715602 | GEO | Bioinformatics Unit, CNIC | 1 | 0.8243 | 0.31617 | 0.83883 | 0.54481 | 61 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2018-06-05 | Adult | Adult | Heart | Cardiovascular System | |||||||||||||||
| 48431 | 48431 | SRR7266720 | SRX4170559 | SRS3382370 | SRP149832 | PRJNA474730 | Transcriptome analysis of wt1b:eGFP positive macrophages in the regenerating zebrafish heart | GSE115381 | Transcriptome Analysis | Little is known about zebrafish macrophage subtypes and their contribution to organ regeneration. Using the transgenic line wt1b:eGFP we identified a subtype of macrophages in the regenerating heart that is transcriptionally different from the rest of macrophages. Overall design: Hearts from Tgwt1b:eGFP; mpeg1:mCherry zebrafish were cryoinjured and at 4 dpi mCherry and GFP/mCherry cells were FAC sorted. RNA was extracted from 4 pools of GFP/mCherry and 4 pools of mCherry single positive cells and RNAseq was performed. | parent bioproject:PRJNA485878 | pubmed:31365871 | MR 2 | GSM3177082 | tissue:mpeg1:mCherry cells from 4dpi hearts|phenotype:mpeg1:mCherry|library batch:1 | MR 2 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.3. Genome build: Ensembl genebuild 75 Danio rerio assembly Zv9. Supplementary files format and content: matrix table.xls file contains ENSEMBL gene Ids and TMM normalized batch corrected counts per million for each sample. | mpeg1:mCherry cells from 4dpi hearts | Four biological replicates consisting of FAC sorted cells coming from five to seven pooled hearts were used per phenotype. | RNA was extracted with PicoPure™ RNA Isolation Kit Index tagged cDNA libraries were constructed in two batches from total RNA 1 ng with the TruSeq RNA sample preparation v2 kit Illumina post amplification with the NuGen OvationSC RNA Seq System. Quality quantity and size distribution of the Illumina libraries were determined using the DNA 1000 kit Agilent Bioanalyzer. RNASeq. Libraries were sequenced single end mode and length of 60 61 bp on the Illumina HiSeq 2500 system using the standard RNA sequencing protocol in the TruSeq SBS kit v5. | All experiments were conducted with adult zebrafish between 6 month and 9 month of age raised at a density of 3 fish/l. | phenotype:mpeg1:mCherry|library batch:1 | GSM3177082 | GSM3177082: MR 2; Danio rerio; RNA Seq | GSM3177082 | 1 | RNA was extracted with PicoPure™ RNA Isolation Kit Index tagged cDNA libraries were constructed in two batches from total RNA 1 ng with the TruSeq RNA sample preparation v2 kit Illumina post amplification with the NuGen OvationSC RNA Seq System. Quality quantity and size distribution of the Illumina libraries were determined using the DNA 1000 kit Agilent Bioanalyzer. RNASeq. Libraries were sequenced single end mode and length of 60 61 bp on the Illumina HiSeq 2500 system using the standard RNA sequencing protocol in the TruSeq SBS kit v5. | GEO Accession:GSM3177082 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP149832 | MR2__AnaBelenGarcia_RNA_Seq_OvationSC_GAGTCA_L001_R1_001.fastq.gz | fastq | 1423227000.0 | 23720450.0 | GSM3177082 r1 | 0:60 | A:409084360;C:294887211;G:360615674;T:358543749;N:96006 | 60 | 409084360 | 294887211 | 360615674 | 358543749 | 96006 | SRX4170559 | SRS3382370 | SRA715602 | GEO | Bioinformatics Unit, CNIC | 1 | 0.65591 | 0.26043 | 0.82041 | 0.62336 | 60 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2018-06-05 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||
| 48432 | 48432 | SRR7266719 | SRX4170558 | SRS3382368 | SRP149832 | PRJNA474730 | Transcriptome analysis of wt1b:eGFP positive macrophages in the regenerating zebrafish heart | GSE115381 | Transcriptome Analysis | Little is known about zebrafish macrophage subtypes and their contribution to organ regeneration. Using the transgenic line wt1b:eGFP we identified a subtype of macrophages in the regenerating heart that is transcriptionally different from the rest of macrophages. Overall design: Hearts from Tgwt1b:eGFP; mpeg1:mCherry zebrafish were cryoinjured and at 4 dpi mCherry and GFP/mCherry cells were FAC sorted. RNA was extracted from 4 pools of GFP/mCherry and 4 pools of mCherry single positive cells and RNAseq was performed. | parent bioproject:PRJNA485878 | pubmed:31365871 | MR 1 | GSM3177081 | tissue:mpeg1:mCherry cells from 4dpi hearts|phenotype:mpeg1:mCherry|library batch:1 | MR 1 | Fastq files containing reads for each library were extracted and demultiplexed using Casava v1.8.2 pipeline. Sequencing adaptor contaminations were removed from reads using cutadapt. Preprocessed reads were mapped and quantified on the transcriptome using RSEM v1.2.3. Genome build: Ensembl genebuild 75 Danio rerio assembly Zv9. Supplementary files format and content: matrix table.xls file contains ENSEMBL gene Ids and TMM normalized batch corrected counts per million for each sample. | mpeg1:mCherry cells from 4dpi hearts | Four biological replicates consisting of FAC sorted cells coming from five to seven pooled hearts were used per phenotype. | RNA was extracted with PicoPure™ RNA Isolation Kit Index tagged cDNA libraries were constructed in two batches from total RNA 1 ng with the TruSeq RNA sample preparation v2 kit Illumina post amplification with the NuGen OvationSC RNA Seq System. Quality quantity and size distribution of the Illumina libraries were determined using the DNA 1000 kit Agilent Bioanalyzer. RNASeq. Libraries were sequenced single end mode and length of 60 61 bp on the Illumina HiSeq 2500 system using the standard RNA sequencing protocol in the TruSeq SBS kit v5. | All experiments were conducted with adult zebrafish between 6 month and 9 month of age raised at a density of 3 fish/l. | phenotype:mpeg1:mCherry|library batch:1 | GSM3177081 | GSM3177081: MR 1; Danio rerio; RNA Seq | GSM3177081 | 1 | RNA was extracted with PicoPure™ RNA Isolation Kit Index tagged cDNA libraries were constructed in two batches from total RNA 1 ng with the TruSeq RNA sample preparation v2 kit Illumina post amplification with the NuGen OvationSC RNA Seq System. Quality quantity and size distribution of the Illumina libraries were determined using the DNA 1000 kit Agilent Bioanalyzer. RNASeq. Libraries were sequenced single end mode and length of 60 61 bp on the Illumina HiSeq 2500 system using the standard RNA sequencing protocol in the TruSeq SBS kit v5. | GEO Accession:GSM3177081 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP149832 | MR1__AnaBelenGarcia_RNA_Seq_OvationSC_AGCATG_L001_R1_001.fastq.gz | fastq | 1634874420.0 | 27247907.0 | GSM3177081 r1 | 0:60 | A:466410867;C:312698413;G:414814899;T:440838061;N:112180 | 60 | 466410867 | 312698413 | 414814899 | 440838061 | 112180 | SRX4170558 | SRS3382368 | SRA715602 | GEO | Bioinformatics Unit, CNIC | 1 | 0.20756 | 0.07949 | 0.90019 | 0.64646 | 60 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | sc_generic | single_cell_generic | generic-scrnaseq-only | Spain | 2018-06-05 | Adult | Adult | Heart | Cardiovascular System | ||||||||||||||||
| 54345 | 54345 | SRR10126111 | SRX6854760 | SRS5392962 | SRP221784 | PRJNA565778 | Single cell sequencing of radial glia progeny reveals diversity of newborn neurons in the adult zebrafish brain | GSE137525 | Transcriptome Analysis | Zebrafish display widespread and pronounced adult neurogenesis which is fundamental for their regeneration capability post central nervous system injury. However the cellular identity and the biological properties of adult newborn neurons are elusive for most brain areas. Here we used short term lineage tracing of radial glia progeny to prospectively isolate newborn neurons from the her4.1+ radial glia lineage in the homeostatic adult forebrain. Transcriptome analysis of radial glia newborn neurons and mature neurons using single cell sequencing identified distinct transcriptional profiles including novel markers for each population. Specifically we detected 2 separate newborn neuron types which showed diversity of cell fate commitment and location. Further analyses showed homology of these cell types to neurogenic cells in the mammalian brain identified neurogenic commitment in proliferating radial glia and indicated that glutamatergic projection neurons fate are generated in the adult zebrafish telecephalon. Thus we prospectively isolated adult newborn neurons from the adult zebrafish forebrain identified markers for newborn and mature neurons in the adult brain revealed intrinsic heterogeneity among adult newborn neurons and their homology to mammalian adult neurogenic cell types. Overall design: single cell sequencing to identify specific markers and functional subpopulations of adult newborn neurons in the zebrafish forebrain | pubmed:31908317 | RG 1 01 E02 | GSM4080997 | tissue:Brain|sorting:RG|FISH id:bfx855 01|batch:bfx855|fraction mapped:0.0813302707773932 | RG 1 01 E02 | FastQC was used to examine quality of the reads post sequencing. Alignment with GSNAP v 2017 08 15 with parameters for sample ON15 01 G10 all other samples accordingly: ‘gsnap.sse42 D /projects/seq work/user/pipeline/gmap d GRCz10 gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit read group id=L22281 ON15 01 G10 read group name=ON15 01 G10 read group library=L22281 read group platform=illumina fastq/L22281 ON15 01 G10 R1.fastq.gz’ Ensembl gene annotation version 87 was used to detect exon spanning reads featureCounts v1.5.3 was used with the same Ensembl annotation to count the uniquely aligned reads to the genes and to create a counts table. Parameters: " a" "/projects/seq work/user/pipeline/annotation/danio rerio/GRCz10/EnsemblGene 87.GRCz10.TR.gtf" " s" "2" " o" "genecount/bfx811.GRCz10.e87.txt" " Q" "1" " T" "8" " tmpDir" "/tmp/418815.1.ngs.q" Genome build: GRCz10 reference inclusive the 92 ERCC Spike In transcripts Supplementary files format and content: `counts.csv` is a comma separated table and contains the raw count matrix. | Brain | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | sorting:RG|FISH id:bfx855 01|batch:bfx855|fraction mapped:0.0813302707773932 | GSM4080997 | GSM4080997: RG 1 01 E02; Danio rerio; RNA Seq | GSM4080997 | 1 | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | GEO Accession:GSM4080997 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP221784 | intentional duplicate|dangling references:treat as unmapped | L23839_RG_1_01_E02.bam | bam | 16444652.0 | 216377.0 | GSM4080997 r1 | 0:76 | A:4583352;C:3984328;G:3906383;T:3970500;N:89 | 76 | 4583352 | 3984328 | 3906383 | 3970500 | 89 | SRX6854760 | SRS5392962 | SRA962624 | GEO | Statistical physics of living systems, Biological Physics, Max Planck Institute for the Physics of Complex Systems | 1 | 0.26908 | 0.09242 | 0.99825 | 0.67661 | 76 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2019-09-16 | Adult | Adult | Brain | Nervous System | ||||||||||||||||||
| 54346 | 54346 | SRR10126110 | SRX6854759 | SRS5392961 | SRP221784 | PRJNA565778 | Single cell sequencing of radial glia progeny reveals diversity of newborn neurons in the adult zebrafish brain | GSE137525 | Transcriptome Analysis | Zebrafish display widespread and pronounced adult neurogenesis which is fundamental for their regeneration capability post central nervous system injury. However the cellular identity and the biological properties of adult newborn neurons are elusive for most brain areas. Here we used short term lineage tracing of radial glia progeny to prospectively isolate newborn neurons from the her4.1+ radial glia lineage in the homeostatic adult forebrain. Transcriptome analysis of radial glia newborn neurons and mature neurons using single cell sequencing identified distinct transcriptional profiles including novel markers for each population. Specifically we detected 2 separate newborn neuron types which showed diversity of cell fate commitment and location. Further analyses showed homology of these cell types to neurogenic cells in the mammalian brain identified neurogenic commitment in proliferating radial glia and indicated that glutamatergic projection neurons fate are generated in the adult zebrafish telecephalon. Thus we prospectively isolated adult newborn neurons from the adult zebrafish forebrain identified markers for newborn and mature neurons in the adult brain revealed intrinsic heterogeneity among adult newborn neurons and their homology to mammalian adult neurogenic cell types. Overall design: single cell sequencing to identify specific markers and functional subpopulations of adult newborn neurons in the zebrafish forebrain | pubmed:31908317 | RG 1 01 B02 | GSM4080996 | tissue:Brain|sorting:RG|FISH id:bfx855 01|batch:bfx855|fraction mapped:0.137111856361026 | RG 1 01 B02 | FastQC was used to examine quality of the reads post sequencing. Alignment with GSNAP v 2017 08 15 with parameters for sample ON15 01 G10 all other samples accordingly: ‘gsnap.sse42 D /projects/seq work/user/pipeline/gmap d GRCz10 gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit read group id=L22281 ON15 01 G10 read group name=ON15 01 G10 read group library=L22281 read group platform=illumina fastq/L22281 ON15 01 G10 R1.fastq.gz’ Ensembl gene annotation version 87 was used to detect exon spanning reads featureCounts v1.5.3 was used with the same Ensembl annotation to count the uniquely aligned reads to the genes and to create a counts table. Parameters: " a" "/projects/seq work/user/pipeline/annotation/danio rerio/GRCz10/EnsemblGene 87.GRCz10.TR.gtf" " s" "2" " o" "genecount/bfx811.GRCz10.e87.txt" " Q" "1" " T" "8" " tmpDir" "/tmp/418815.1.ngs.q" Genome build: GRCz10 reference inclusive the 92 ERCC Spike In transcripts Supplementary files format and content: `counts.csv` is a comma separated table and contains the raw count matrix. | Brain | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | sorting:RG|FISH id:bfx855 01|batch:bfx855|fraction mapped:0.137111856361026 | GSM4080996 | GSM4080996: RG 1 01 B02; Danio rerio; RNA Seq | GSM4080996 | 1 | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | GEO Accession:GSM4080996 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP221784 | intentional duplicate|dangling references:treat as unmapped | L23836_RG_1_01_B02.bam | bam | 14345076.0 | 188751.0 | GSM4080996 r1 | 0:76 | A:4237579;C:3235570;G:3240300;T:3631525;N:102 | 76 | 4237579 | 3235570 | 3240300 | 3631525 | 102 | SRX6854759 | SRS5392961 | SRA962624 | GEO | Statistical physics of living systems, Biological Physics, Max Planck Institute for the Physics of Complex Systems | 1 | 0.37026 | 0.12862 | 0.99805 | 0.83484 | 76 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2019-09-16 | Adult | Adult | Brain | Nervous System | ||||||||||||||||||
| 54347 | 54347 | SRR10126109 | SRX6854758 | SRS5392960 | SRP221784 | PRJNA565778 | Single cell sequencing of radial glia progeny reveals diversity of newborn neurons in the adult zebrafish brain | GSE137525 | Transcriptome Analysis | Zebrafish display widespread and pronounced adult neurogenesis which is fundamental for their regeneration capability post central nervous system injury. However the cellular identity and the biological properties of adult newborn neurons are elusive for most brain areas. Here we used short term lineage tracing of radial glia progeny to prospectively isolate newborn neurons from the her4.1+ radial glia lineage in the homeostatic adult forebrain. Transcriptome analysis of radial glia newborn neurons and mature neurons using single cell sequencing identified distinct transcriptional profiles including novel markers for each population. Specifically we detected 2 separate newborn neuron types which showed diversity of cell fate commitment and location. Further analyses showed homology of these cell types to neurogenic cells in the mammalian brain identified neurogenic commitment in proliferating radial glia and indicated that glutamatergic projection neurons fate are generated in the adult zebrafish telecephalon. Thus we prospectively isolated adult newborn neurons from the adult zebrafish forebrain identified markers for newborn and mature neurons in the adult brain revealed intrinsic heterogeneity among adult newborn neurons and their homology to mammalian adult neurogenic cell types. Overall design: single cell sequencing to identify specific markers and functional subpopulations of adult newborn neurons in the zebrafish forebrain | pubmed:31908317 | RG 1 01 C01 | GSM4080995 | tissue:Brain|sorting:RG|FISH id:bfx855 01|batch:bfx855|fraction mapped:0.596981146320204 | RG 1 01 C01 | FastQC was used to examine quality of the reads post sequencing. Alignment with GSNAP v 2017 08 15 with parameters for sample ON15 01 G10 all other samples accordingly: ‘gsnap.sse42 D /projects/seq work/user/pipeline/gmap d GRCz10 gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit read group id=L22281 ON15 01 G10 read group name=ON15 01 G10 read group library=L22281 read group platform=illumina fastq/L22281 ON15 01 G10 R1.fastq.gz’ Ensembl gene annotation version 87 was used to detect exon spanning reads featureCounts v1.5.3 was used with the same Ensembl annotation to count the uniquely aligned reads to the genes and to create a counts table. Parameters: " a" "/projects/seq work/user/pipeline/annotation/danio rerio/GRCz10/EnsemblGene 87.GRCz10.TR.gtf" " s" "2" " o" "genecount/bfx811.GRCz10.e87.txt" " Q" "1" " T" "8" " tmpDir" "/tmp/418815.1.ngs.q" Genome build: GRCz10 reference inclusive the 92 ERCC Spike In transcripts Supplementary files format and content: `counts.csv` is a comma separated table and contains the raw count matrix. | Brain | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | sorting:RG|FISH id:bfx855 01|batch:bfx855|fraction mapped:0.596981146320204 | GSM4080995 | GSM4080995: RG 1 01 C01; Danio rerio; RNA Seq | GSM4080995 | 1 | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | GEO Accession:GSM4080995 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP221784 | intentional duplicate|dangling references:treat as unmapped | L23829_RG_1_01_C01_mod.bam | bam | 44287252.0 | 582727.0 | GSM4080995 r1 | 0:76 | A:12057290;C:10158222;G:10161190;T:11910345;N:205 | 76 | 12057290 | 10158222 | 10161190 | 11910345 | 205 | SRX6854758 | SRS5392960 | SRA962624 | GEO | Statistical physics of living systems, Biological Physics, Max Planck Institute for the Physics of Complex Systems | 1 | 0.83606 | 0.11078 | 0.97364 | 0.51554 | 76 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2019-09-16 | Adult | Adult | Brain | Nervous System | ||||||||||||||||||
| 54348 | 54348 | SRR10126108 | SRX6854757 | SRS5392959 | SRP221784 | PRJNA565778 | Single cell sequencing of radial glia progeny reveals diversity of newborn neurons in the adult zebrafish brain | GSE137525 | Transcriptome Analysis | Zebrafish display widespread and pronounced adult neurogenesis which is fundamental for their regeneration capability post central nervous system injury. However the cellular identity and the biological properties of adult newborn neurons are elusive for most brain areas. Here we used short term lineage tracing of radial glia progeny to prospectively isolate newborn neurons from the her4.1+ radial glia lineage in the homeostatic adult forebrain. Transcriptome analysis of radial glia newborn neurons and mature neurons using single cell sequencing identified distinct transcriptional profiles including novel markers for each population. Specifically we detected 2 separate newborn neuron types which showed diversity of cell fate commitment and location. Further analyses showed homology of these cell types to neurogenic cells in the mammalian brain identified neurogenic commitment in proliferating radial glia and indicated that glutamatergic projection neurons fate are generated in the adult zebrafish telecephalon. Thus we prospectively isolated adult newborn neurons from the adult zebrafish forebrain identified markers for newborn and mature neurons in the adult brain revealed intrinsic heterogeneity among adult newborn neurons and their homology to mammalian adult neurogenic cell types. Overall design: single cell sequencing to identify specific markers and functional subpopulations of adult newborn neurons in the zebrafish forebrain | pubmed:31908317 | RG 1 01 G02 | GSM4080994 | tissue:Brain|sorting:RG|FISH id:bfx855 01|batch:bfx855|fraction mapped:0.336437957921624 | RG 1 01 G02 | FastQC was used to examine quality of the reads post sequencing. Alignment with GSNAP v 2017 08 15 with parameters for sample ON15 01 G10 all other samples accordingly: ‘gsnap.sse42 D /projects/seq work/user/pipeline/gmap d GRCz10 gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit read group id=L22281 ON15 01 G10 read group name=ON15 01 G10 read group library=L22281 read group platform=illumina fastq/L22281 ON15 01 G10 R1.fastq.gz’ Ensembl gene annotation version 87 was used to detect exon spanning reads featureCounts v1.5.3 was used with the same Ensembl annotation to count the uniquely aligned reads to the genes and to create a counts table. Parameters: " a" "/projects/seq work/user/pipeline/annotation/danio rerio/GRCz10/EnsemblGene 87.GRCz10.TR.gtf" " s" "2" " o" "genecount/bfx811.GRCz10.e87.txt" " Q" "1" " T" "8" " tmpDir" "/tmp/418815.1.ngs.q" Genome build: GRCz10 reference inclusive the 92 ERCC Spike In transcripts Supplementary files format and content: `counts.csv` is a comma separated table and contains the raw count matrix. | Brain | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | sorting:RG|FISH id:bfx855 01|batch:bfx855|fraction mapped:0.336437957921624 | GSM4080994 | GSM4080994: RG 1 01 G02; Danio rerio; RNA Seq | GSM4080994 | 1 | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | GEO Accession:GSM4080994 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP221784 | intentional duplicate|dangling references:treat as unmapped | L23841_RG_1_01_G02_mod.bam | bam | 18090356.0 | 238031.0 | GSM4080994 r1 | 0:76 | A:5124071;C:4154073;G:4123933;T:4688206;N:73 | 76 | 5124071 | 4154073 | 4123933 | 4688206 | 73 | SRX6854757 | SRS5392959 | SRA962624 | GEO | Statistical physics of living systems, Biological Physics, Max Planck Institute for the Physics of Complex Systems | 1 | 0.63512 | 0.05239 | 0.99257 | 0.67835 | 76 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2019-09-16 | Adult | Adult | Brain | Nervous System | ||||||||||||||||||
| 54349 | 54349 | SRR10126107 | SRX6854756 | SRS5392958 | SRP221784 | PRJNA565778 | Single cell sequencing of radial glia progeny reveals diversity of newborn neurons in the adult zebrafish brain | GSE137525 | Transcriptome Analysis | Zebrafish display widespread and pronounced adult neurogenesis which is fundamental for their regeneration capability post central nervous system injury. However the cellular identity and the biological properties of adult newborn neurons are elusive for most brain areas. Here we used short term lineage tracing of radial glia progeny to prospectively isolate newborn neurons from the her4.1+ radial glia lineage in the homeostatic adult forebrain. Transcriptome analysis of radial glia newborn neurons and mature neurons using single cell sequencing identified distinct transcriptional profiles including novel markers for each population. Specifically we detected 2 separate newborn neuron types which showed diversity of cell fate commitment and location. Further analyses showed homology of these cell types to neurogenic cells in the mammalian brain identified neurogenic commitment in proliferating radial glia and indicated that glutamatergic projection neurons fate are generated in the adult zebrafish telecephalon. Thus we prospectively isolated adult newborn neurons from the adult zebrafish forebrain identified markers for newborn and mature neurons in the adult brain revealed intrinsic heterogeneity among adult newborn neurons and their homology to mammalian adult neurogenic cell types. Overall design: single cell sequencing to identify specific markers and functional subpopulations of adult newborn neurons in the zebrafish forebrain | pubmed:31908317 | RG 1 01 F02 | GSM4080993 | tissue:Brain|sorting:RG|FISH id:bfx855 01|batch:bfx855|fraction mapped:0.169583947726024 | RG 1 01 F02 | FastQC was used to examine quality of the reads post sequencing. Alignment with GSNAP v 2017 08 15 with parameters for sample ON15 01 G10 all other samples accordingly: ‘gsnap.sse42 D /projects/seq work/user/pipeline/gmap d GRCz10 gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit read group id=L22281 ON15 01 G10 read group name=ON15 01 G10 read group library=L22281 read group platform=illumina fastq/L22281 ON15 01 G10 R1.fastq.gz’ Ensembl gene annotation version 87 was used to detect exon spanning reads featureCounts v1.5.3 was used with the same Ensembl annotation to count the uniquely aligned reads to the genes and to create a counts table. Parameters: " a" "/projects/seq work/user/pipeline/annotation/danio rerio/GRCz10/EnsemblGene 87.GRCz10.TR.gtf" " s" "2" " o" "genecount/bfx811.GRCz10.e87.txt" " Q" "1" " T" "8" " tmpDir" "/tmp/418815.1.ngs.q" Genome build: GRCz10 reference inclusive the 92 ERCC Spike In transcripts Supplementary files format and content: `counts.csv` is a comma separated table and contains the raw count matrix. | Brain | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | sorting:RG|FISH id:bfx855 01|batch:bfx855|fraction mapped:0.169583947726024 | GSM4080993 | GSM4080993: RG 1 01 F02; Danio rerio; RNA Seq | GSM4080993 | 1 | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | GEO Accession:GSM4080993 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP221784 | intentional duplicate|dangling references:treat as unmapped | L23840_RG_1_01_F02.bam | bam | 13143060.0 | 172935.0 | GSM4080993 r1 | 0:76 | A:3676240;C:3051166;G:3081467;T:3334128;N:59 | 76 | 3676240 | 3051166 | 3081467 | 3334128 | 59 | SRX6854756 | SRS5392958 | SRA962624 | GEO | Statistical physics of living systems, Biological Physics, Max Planck Institute for the Physics of Complex Systems | 1 | 0.4252 | 0.0971 | 0.99697 | 0.81536 | 76 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2019-09-16 | Adult | Adult | Brain | Nervous System | ||||||||||||||||||
| 54350 | 54350 | SRR10126106 | SRX6854755 | SRS5392957 | SRP221784 | PRJNA565778 | Single cell sequencing of radial glia progeny reveals diversity of newborn neurons in the adult zebrafish brain | GSE137525 | Transcriptome Analysis | Zebrafish display widespread and pronounced adult neurogenesis which is fundamental for their regeneration capability post central nervous system injury. However the cellular identity and the biological properties of adult newborn neurons are elusive for most brain areas. Here we used short term lineage tracing of radial glia progeny to prospectively isolate newborn neurons from the her4.1+ radial glia lineage in the homeostatic adult forebrain. Transcriptome analysis of radial glia newborn neurons and mature neurons using single cell sequencing identified distinct transcriptional profiles including novel markers for each population. Specifically we detected 2 separate newborn neuron types which showed diversity of cell fate commitment and location. Further analyses showed homology of these cell types to neurogenic cells in the mammalian brain identified neurogenic commitment in proliferating radial glia and indicated that glutamatergic projection neurons fate are generated in the adult zebrafish telecephalon. Thus we prospectively isolated adult newborn neurons from the adult zebrafish forebrain identified markers for newborn and mature neurons in the adult brain revealed intrinsic heterogeneity among adult newborn neurons and their homology to mammalian adult neurogenic cell types. Overall design: single cell sequencing to identify specific markers and functional subpopulations of adult newborn neurons in the zebrafish forebrain | pubmed:31908317 | ON30 01 F12 | GSM4080992 | tissue:Brain|sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.307951918399687 | ON30 01 F12 | FastQC was used to examine quality of the reads post sequencing. Alignment with GSNAP v 2017 08 15 with parameters for sample ON15 01 G10 all other samples accordingly: ‘gsnap.sse42 D /projects/seq work/user/pipeline/gmap d GRCz10 gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit read group id=L22281 ON15 01 G10 read group name=ON15 01 G10 read group library=L22281 read group platform=illumina fastq/L22281 ON15 01 G10 R1.fastq.gz’ Ensembl gene annotation version 87 was used to detect exon spanning reads featureCounts v1.5.3 was used with the same Ensembl annotation to count the uniquely aligned reads to the genes and to create a counts table. Parameters: " a" "/projects/seq work/user/pipeline/annotation/danio rerio/GRCz10/EnsemblGene 87.GRCz10.TR.gtf" " s" "2" " o" "genecount/bfx811.GRCz10.e87.txt" " Q" "1" " T" "8" " tmpDir" "/tmp/418815.1.ngs.q" Genome build: GRCz10 reference inclusive the 92 ERCC Spike In transcripts Supplementary files format and content: `counts.csv` is a comma separated table and contains the raw count matrix. | Brain | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.307951918399687 | GSM4080992 | GSM4080992: ON30 01 F12; Danio rerio; RNA Seq | GSM4080992 | 1 | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | GEO Accession:GSM4080992 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP221784 | intentional duplicate|dangling references:treat as unmapped | L22296_ON30_01_F12_mod.bam | bam | 45464644.0 | 598219.0 | GSM4080992 r1 | 0:76 | A:13070969;C:9463048;G:9617299;T:13313099;N:229 | 76 | 13070969 | 9463048 | 9617299 | 13313099 | 229 | SRX6854755 | SRS5392957 | SRA962624 | GEO | Statistical physics of living systems, Biological Physics, Max Planck Institute for the Physics of Complex Systems | 1 | 0.85125 | 0.28428 | 0.94795 | 0.49176 | 76 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2019-09-16 | Adult | Adult | Brain | Nervous System | ||||||||||||||||||
| 54351 | 54351 | SRR10126105 | SRX6854754 | SRS5392956 | SRP221784 | PRJNA565778 | Single cell sequencing of radial glia progeny reveals diversity of newborn neurons in the adult zebrafish brain | GSE137525 | Transcriptome Analysis | Zebrafish display widespread and pronounced adult neurogenesis which is fundamental for their regeneration capability post central nervous system injury. However the cellular identity and the biological properties of adult newborn neurons are elusive for most brain areas. Here we used short term lineage tracing of radial glia progeny to prospectively isolate newborn neurons from the her4.1+ radial glia lineage in the homeostatic adult forebrain. Transcriptome analysis of radial glia newborn neurons and mature neurons using single cell sequencing identified distinct transcriptional profiles including novel markers for each population. Specifically we detected 2 separate newborn neuron types which showed diversity of cell fate commitment and location. Further analyses showed homology of these cell types to neurogenic cells in the mammalian brain identified neurogenic commitment in proliferating radial glia and indicated that glutamatergic projection neurons fate are generated in the adult zebrafish telecephalon. Thus we prospectively isolated adult newborn neurons from the adult zebrafish forebrain identified markers for newborn and mature neurons in the adult brain revealed intrinsic heterogeneity among adult newborn neurons and their homology to mammalian adult neurogenic cell types. Overall design: single cell sequencing to identify specific markers and functional subpopulations of adult newborn neurons in the zebrafish forebrain | pubmed:31908317 | RG31 01 H12 | GSM4080991 | tissue:Brain|sorting:RG|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.349622553699452 | RG31 01 H12 | FastQC was used to examine quality of the reads post sequencing. Alignment with GSNAP v 2017 08 15 with parameters for sample ON15 01 G10 all other samples accordingly: ‘gsnap.sse42 D /projects/seq work/user/pipeline/gmap d GRCz10 gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit read group id=L22281 ON15 01 G10 read group name=ON15 01 G10 read group library=L22281 read group platform=illumina fastq/L22281 ON15 01 G10 R1.fastq.gz’ Ensembl gene annotation version 87 was used to detect exon spanning reads featureCounts v1.5.3 was used with the same Ensembl annotation to count the uniquely aligned reads to the genes and to create a counts table. Parameters: " a" "/projects/seq work/user/pipeline/annotation/danio rerio/GRCz10/EnsemblGene 87.GRCz10.TR.gtf" " s" "2" " o" "genecount/bfx811.GRCz10.e87.txt" " Q" "1" " T" "8" " tmpDir" "/tmp/418815.1.ngs.q" Genome build: GRCz10 reference inclusive the 92 ERCC Spike In transcripts Supplementary files format and content: `counts.csv` is a comma separated table and contains the raw count matrix. | Brain | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | sorting:RG|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.349622553699452 | GSM4080991 | GSM4080991: RG31 01 H12; Danio rerio; RNA Seq | GSM4080991 | 1 | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | GEO Accession:GSM4080991 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP221784 | intentional duplicate|dangling references:treat as unmapped | L22298_RG31_01_H12_mod.bam | bam | 54043448.0 | 711098.0 | GSM4080991 r1 | 0:76 | A:14990424;C:11836357;G:12008841;T:15207589;N:237 | 76 | 14990424 | 11836357 | 12008841 | 15207589 | 237 | SRX6854754 | SRS5392956 | SRA962624 | GEO | Statistical physics of living systems, Biological Physics, Max Planck Institute for the Physics of Complex Systems | 1 | 0.85818 | 0.139 | 0.95706 | 0.49646 | 76 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2019-09-16 | Adult | Adult | Brain | Nervous System | ||||||||||||||||||
| 54352 | 54352 | SRR10126104 | SRX6854753 | SRS5392955 | SRP221784 | PRJNA565778 | Single cell sequencing of radial glia progeny reveals diversity of newborn neurons in the adult zebrafish brain | GSE137525 | Transcriptome Analysis | Zebrafish display widespread and pronounced adult neurogenesis which is fundamental for their regeneration capability post central nervous system injury. However the cellular identity and the biological properties of adult newborn neurons are elusive for most brain areas. Here we used short term lineage tracing of radial glia progeny to prospectively isolate newborn neurons from the her4.1+ radial glia lineage in the homeostatic adult forebrain. Transcriptome analysis of radial glia newborn neurons and mature neurons using single cell sequencing identified distinct transcriptional profiles including novel markers for each population. Specifically we detected 2 separate newborn neuron types which showed diversity of cell fate commitment and location. Further analyses showed homology of these cell types to neurogenic cells in the mammalian brain identified neurogenic commitment in proliferating radial glia and indicated that glutamatergic projection neurons fate are generated in the adult zebrafish telecephalon. Thus we prospectively isolated adult newborn neurons from the adult zebrafish forebrain identified markers for newborn and mature neurons in the adult brain revealed intrinsic heterogeneity among adult newborn neurons and their homology to mammalian adult neurogenic cell types. Overall design: single cell sequencing to identify specific markers and functional subpopulations of adult newborn neurons in the zebrafish forebrain | pubmed:31908317 | ON29 01 E12 | GSM4080990 | tissue:Brain|sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.270605518893939 | ON29 01 E12 | FastQC was used to examine quality of the reads post sequencing. Alignment with GSNAP v 2017 08 15 with parameters for sample ON15 01 G10 all other samples accordingly: ‘gsnap.sse42 D /projects/seq work/user/pipeline/gmap d GRCz10 gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit read group id=L22281 ON15 01 G10 read group name=ON15 01 G10 read group library=L22281 read group platform=illumina fastq/L22281 ON15 01 G10 R1.fastq.gz’ Ensembl gene annotation version 87 was used to detect exon spanning reads featureCounts v1.5.3 was used with the same Ensembl annotation to count the uniquely aligned reads to the genes and to create a counts table. Parameters: " a" "/projects/seq work/user/pipeline/annotation/danio rerio/GRCz10/EnsemblGene 87.GRCz10.TR.gtf" " s" "2" " o" "genecount/bfx811.GRCz10.e87.txt" " Q" "1" " T" "8" " tmpDir" "/tmp/418815.1.ngs.q" Genome build: GRCz10 reference inclusive the 92 ERCC Spike In transcripts Supplementary files format and content: `counts.csv` is a comma separated table and contains the raw count matrix. | Brain | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.270605518893939 | GSM4080990 | GSM4080990: ON29 01 E12; Danio rerio; RNA Seq | GSM4080990 | 1 | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | GEO Accession:GSM4080990 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP221784 | intentional duplicate|dangling references:treat as unmapped | L22295_ON29_01_E12_mod.bam | bam | 31968716.0 | 420641.0 | GSM4080990 r1 | 0:76 | A:9066610;C:6733147;G:6934070;T:9234786;N:103 | 76 | 9066610 | 6733147 | 6934070 | 9234786 | 103 | SRX6854753 | SRS5392955 | SRA962624 | GEO | Statistical physics of living systems, Biological Physics, Max Planck Institute for the Physics of Complex Systems | 1 | 0.76341 | 0.34992 | 0.97583 | 0.47889 | 76 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2019-09-16 | Adult | Adult | Brain | Nervous System | ||||||||||||||||||
| 54353 | 54353 | SRR10126103 | SRX6854752 | SRS5392954 | SRP221784 | PRJNA565778 | Single cell sequencing of radial glia progeny reveals diversity of newborn neurons in the adult zebrafish brain | GSE137525 | Transcriptome Analysis | Zebrafish display widespread and pronounced adult neurogenesis which is fundamental for their regeneration capability post central nervous system injury. However the cellular identity and the biological properties of adult newborn neurons are elusive for most brain areas. Here we used short term lineage tracing of radial glia progeny to prospectively isolate newborn neurons from the her4.1+ radial glia lineage in the homeostatic adult forebrain. Transcriptome analysis of radial glia newborn neurons and mature neurons using single cell sequencing identified distinct transcriptional profiles including novel markers for each population. Specifically we detected 2 separate newborn neuron types which showed diversity of cell fate commitment and location. Further analyses showed homology of these cell types to neurogenic cells in the mammalian brain identified neurogenic commitment in proliferating radial glia and indicated that glutamatergic projection neurons fate are generated in the adult zebrafish telecephalon. Thus we prospectively isolated adult newborn neurons from the adult zebrafish forebrain identified markers for newborn and mature neurons in the adult brain revealed intrinsic heterogeneity among adult newborn neurons and their homology to mammalian adult neurogenic cell types. Overall design: single cell sequencing to identify specific markers and functional subpopulations of adult newborn neurons in the zebrafish forebrain | pubmed:31908317 | ON27 01 C12 | GSM4080989 | tissue:Brain|sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.207435774030802 | ON27 01 C12 | FastQC was used to examine quality of the reads post sequencing. Alignment with GSNAP v 2017 08 15 with parameters for sample ON15 01 G10 all other samples accordingly: ‘gsnap.sse42 D /projects/seq work/user/pipeline/gmap d GRCz10 gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit read group id=L22281 ON15 01 G10 read group name=ON15 01 G10 read group library=L22281 read group platform=illumina fastq/L22281 ON15 01 G10 R1.fastq.gz’ Ensembl gene annotation version 87 was used to detect exon spanning reads featureCounts v1.5.3 was used with the same Ensembl annotation to count the uniquely aligned reads to the genes and to create a counts table. Parameters: " a" "/projects/seq work/user/pipeline/annotation/danio rerio/GRCz10/EnsemblGene 87.GRCz10.TR.gtf" " s" "2" " o" "genecount/bfx811.GRCz10.e87.txt" " Q" "1" " T" "8" " tmpDir" "/tmp/418815.1.ngs.q" Genome build: GRCz10 reference inclusive the 92 ERCC Spike In transcripts Supplementary files format and content: `counts.csv` is a comma separated table and contains the raw count matrix. | Brain | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.207435774030802 | GSM4080989 | GSM4080989: ON27 01 C12; Danio rerio; RNA Seq | GSM4080989 | 1 | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | GEO Accession:GSM4080989 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP221784 | intentional duplicate|dangling references:treat as unmapped | L22293_ON27_01_C12_mod.bam | bam | 36635572.0 | 482047.0 | GSM4080989 r1 | 0:76 | A:10775220;C:6902317;G:7294618;T:11663244;N:173 | 76 | 10775220 | 6902317 | 7294618 | 11663244 | 173 | SRX6854752 | SRS5392954 | SRA962624 | GEO | Statistical physics of living systems, Biological Physics, Max Planck Institute for the Physics of Complex Systems | 1 | 0.6712 | 0.38208 | 0.98563 | 0.6672 | 76 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2019-09-16 | Adult | Adult | Brain | Nervous System | ||||||||||||||||||
| 54354 | 54354 | SRR10126102 | SRX6854751 | SRS5392953 | SRP221784 | PRJNA565778 | Single cell sequencing of radial glia progeny reveals diversity of newborn neurons in the adult zebrafish brain | GSE137525 | Transcriptome Analysis | Zebrafish display widespread and pronounced adult neurogenesis which is fundamental for their regeneration capability post central nervous system injury. However the cellular identity and the biological properties of adult newborn neurons are elusive for most brain areas. Here we used short term lineage tracing of radial glia progeny to prospectively isolate newborn neurons from the her4.1+ radial glia lineage in the homeostatic adult forebrain. Transcriptome analysis of radial glia newborn neurons and mature neurons using single cell sequencing identified distinct transcriptional profiles including novel markers for each population. Specifically we detected 2 separate newborn neuron types which showed diversity of cell fate commitment and location. Further analyses showed homology of these cell types to neurogenic cells in the mammalian brain identified neurogenic commitment in proliferating radial glia and indicated that glutamatergic projection neurons fate are generated in the adult zebrafish telecephalon. Thus we prospectively isolated adult newborn neurons from the adult zebrafish forebrain identified markers for newborn and mature neurons in the adult brain revealed intrinsic heterogeneity among adult newborn neurons and their homology to mammalian adult neurogenic cell types. Overall design: single cell sequencing to identify specific markers and functional subpopulations of adult newborn neurons in the zebrafish forebrain | pubmed:31908317 | ON28 01 D12 | GSM4080988 | tissue:Brain|sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.361448206817182 | ON28 01 D12 | FastQC was used to examine quality of the reads post sequencing. Alignment with GSNAP v 2017 08 15 with parameters for sample ON15 01 G10 all other samples accordingly: ‘gsnap.sse42 D /projects/seq work/user/pipeline/gmap d GRCz10 gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit read group id=L22281 ON15 01 G10 read group name=ON15 01 G10 read group library=L22281 read group platform=illumina fastq/L22281 ON15 01 G10 R1.fastq.gz’ Ensembl gene annotation version 87 was used to detect exon spanning reads featureCounts v1.5.3 was used with the same Ensembl annotation to count the uniquely aligned reads to the genes and to create a counts table. Parameters: " a" "/projects/seq work/user/pipeline/annotation/danio rerio/GRCz10/EnsemblGene 87.GRCz10.TR.gtf" " s" "2" " o" "genecount/bfx811.GRCz10.e87.txt" " Q" "1" " T" "8" " tmpDir" "/tmp/418815.1.ngs.q" Genome build: GRCz10 reference inclusive the 92 ERCC Spike In transcripts Supplementary files format and content: `counts.csv` is a comma separated table and contains the raw count matrix. | Brain | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.361448206817182 | GSM4080988 | GSM4080988: ON28 01 D12; Danio rerio; RNA Seq | GSM4080988 | 1 | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | GEO Accession:GSM4080988 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP221784 | intentional duplicate|dangling references:treat as unmapped | L22294_ON28_01_D12_mod.bam | bam | 48734088.0 | 641238.0 | GSM4080988 r1 | 0:76 | A:13468719;C:10758080;G:10910748;T:13596298;N:243 | 76 | 13468719 | 10758080 | 10910748 | 13596298 | 243 | SRX6854751 | SRS5392953 | SRA962624 | GEO | Statistical physics of living systems, Biological Physics, Max Planck Institute for the Physics of Complex Systems | 1 | 0.88752 | 0.18774 | 0.94911 | 0.46357 | 76 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2019-09-16 | Adult | Adult | Brain | Nervous System | ||||||||||||||||||
| 54355 | 54355 | SRR10126101 | SRX6854750 | SRS5392952 | SRP221784 | PRJNA565778 | Single cell sequencing of radial glia progeny reveals diversity of newborn neurons in the adult zebrafish brain | GSE137525 | Transcriptome Analysis | Zebrafish display widespread and pronounced adult neurogenesis which is fundamental for their regeneration capability post central nervous system injury. However the cellular identity and the biological properties of adult newborn neurons are elusive for most brain areas. Here we used short term lineage tracing of radial glia progeny to prospectively isolate newborn neurons from the her4.1+ radial glia lineage in the homeostatic adult forebrain. Transcriptome analysis of radial glia newborn neurons and mature neurons using single cell sequencing identified distinct transcriptional profiles including novel markers for each population. Specifically we detected 2 separate newborn neuron types which showed diversity of cell fate commitment and location. Further analyses showed homology of these cell types to neurogenic cells in the mammalian brain identified neurogenic commitment in proliferating radial glia and indicated that glutamatergic projection neurons fate are generated in the adult zebrafish telecephalon. Thus we prospectively isolated adult newborn neurons from the adult zebrafish forebrain identified markers for newborn and mature neurons in the adult brain revealed intrinsic heterogeneity among adult newborn neurons and their homology to mammalian adult neurogenic cell types. Overall design: single cell sequencing to identify specific markers and functional subpopulations of adult newborn neurons in the zebrafish forebrain | pubmed:31908317 | ON26 01 B12 | GSM4080987 | tissue:Brain|sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.400282577622292 | ON26 01 B12 | FastQC was used to examine quality of the reads post sequencing. Alignment with GSNAP v 2017 08 15 with parameters for sample ON15 01 G10 all other samples accordingly: ‘gsnap.sse42 D /projects/seq work/user/pipeline/gmap d GRCz10 gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit read group id=L22281 ON15 01 G10 read group name=ON15 01 G10 read group library=L22281 read group platform=illumina fastq/L22281 ON15 01 G10 R1.fastq.gz’ Ensembl gene annotation version 87 was used to detect exon spanning reads featureCounts v1.5.3 was used with the same Ensembl annotation to count the uniquely aligned reads to the genes and to create a counts table. Parameters: " a" "/projects/seq work/user/pipeline/annotation/danio rerio/GRCz10/EnsemblGene 87.GRCz10.TR.gtf" " s" "2" " o" "genecount/bfx811.GRCz10.e87.txt" " Q" "1" " T" "8" " tmpDir" "/tmp/418815.1.ngs.q" Genome build: GRCz10 reference inclusive the 92 ERCC Spike In transcripts Supplementary files format and content: `counts.csv` is a comma separated table and contains the raw count matrix. | Brain | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.400282577622292 | GSM4080987 | GSM4080987: ON26 01 B12; Danio rerio; RNA Seq | GSM4080987 | 1 | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | GEO Accession:GSM4080987 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP221784 | intentional duplicate|dangling references:treat as unmapped | L22292_ON26_01_B12_mod.bam | bam | 46093468.0 | 606493.0 | GSM4080987 r1 | 0:76 | A:12497312;C:10446137;G:10539301;T:12610508;N:210 | 76 | 12497312 | 10446137 | 10539301 | 12610508 | 210 | SRX6854750 | SRS5392952 | SRA962624 | GEO | Statistical physics of living systems, Biological Physics, Max Planck Institute for the Physics of Complex Systems | 1 | 0.89062 | 0.07593 | 0.95146 | 0.50127 | 76 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2019-09-16 | Adult | Adult | Brain | Nervous System | ||||||||||||||||||
| 54356 | 54356 | SRR10126100 | SRX6854749 | SRS5392951 | SRP221784 | PRJNA565778 | Single cell sequencing of radial glia progeny reveals diversity of newborn neurons in the adult zebrafish brain | GSE137525 | Transcriptome Analysis | Zebrafish display widespread and pronounced adult neurogenesis which is fundamental for their regeneration capability post central nervous system injury. However the cellular identity and the biological properties of adult newborn neurons are elusive for most brain areas. Here we used short term lineage tracing of radial glia progeny to prospectively isolate newborn neurons from the her4.1+ radial glia lineage in the homeostatic adult forebrain. Transcriptome analysis of radial glia newborn neurons and mature neurons using single cell sequencing identified distinct transcriptional profiles including novel markers for each population. Specifically we detected 2 separate newborn neuron types which showed diversity of cell fate commitment and location. Further analyses showed homology of these cell types to neurogenic cells in the mammalian brain identified neurogenic commitment in proliferating radial glia and indicated that glutamatergic projection neurons fate are generated in the adult zebrafish telecephalon. Thus we prospectively isolated adult newborn neurons from the adult zebrafish forebrain identified markers for newborn and mature neurons in the adult brain revealed intrinsic heterogeneity among adult newborn neurons and their homology to mammalian adult neurogenic cell types. Overall design: single cell sequencing to identify specific markers and functional subpopulations of adult newborn neurons in the zebrafish forebrain | pubmed:31908317 | ON25 01 A12 | GSM4080986 | tissue:Brain|sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.36034551688211 | ON25 01 A12 | FastQC was used to examine quality of the reads post sequencing. Alignment with GSNAP v 2017 08 15 with parameters for sample ON15 01 G10 all other samples accordingly: ‘gsnap.sse42 D /projects/seq work/user/pipeline/gmap d GRCz10 gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit read group id=L22281 ON15 01 G10 read group name=ON15 01 G10 read group library=L22281 read group platform=illumina fastq/L22281 ON15 01 G10 R1.fastq.gz’ Ensembl gene annotation version 87 was used to detect exon spanning reads featureCounts v1.5.3 was used with the same Ensembl annotation to count the uniquely aligned reads to the genes and to create a counts table. Parameters: " a" "/projects/seq work/user/pipeline/annotation/danio rerio/GRCz10/EnsemblGene 87.GRCz10.TR.gtf" " s" "2" " o" "genecount/bfx811.GRCz10.e87.txt" " Q" "1" " T" "8" " tmpDir" "/tmp/418815.1.ngs.q" Genome build: GRCz10 reference inclusive the 92 ERCC Spike In transcripts Supplementary files format and content: `counts.csv` is a comma separated table and contains the raw count matrix. | Brain | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.36034551688211 | GSM4080986 | GSM4080986: ON25 01 A12; Danio rerio; RNA Seq | GSM4080986 | 1 | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | GEO Accession:GSM4080986 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP221784 | intentional duplicate|dangling references:treat as unmapped | L22291_ON25_01_A12_mod.bam | bam | 56456068.0 | 742843.0 | GSM4080986 r1 | 0:76 | A:16017845;C:12025190;G:12186747;T:16226025;N:261 | 76 | 16017845 | 12025190 | 12186747 | 16226025 | 261 | SRX6854749 | SRS5392951 | SRA962624 | GEO | Statistical physics of living systems, Biological Physics, Max Planck Institute for the Physics of Complex Systems | 1 | 0.87174 | 0.20317 | 0.94446 | 0.48709 | 76 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2019-09-16 | Adult | Adult | Brain | Nervous System | ||||||||||||||||||
| 54357 | 54357 | SRR10126099 | SRX6854748 | SRS5392950 | SRP221784 | PRJNA565778 | Single cell sequencing of radial glia progeny reveals diversity of newborn neurons in the adult zebrafish brain | GSE137525 | Transcriptome Analysis | Zebrafish display widespread and pronounced adult neurogenesis which is fundamental for their regeneration capability post central nervous system injury. However the cellular identity and the biological properties of adult newborn neurons are elusive for most brain areas. Here we used short term lineage tracing of radial glia progeny to prospectively isolate newborn neurons from the her4.1+ radial glia lineage in the homeostatic adult forebrain. Transcriptome analysis of radial glia newborn neurons and mature neurons using single cell sequencing identified distinct transcriptional profiles including novel markers for each population. Specifically we detected 2 separate newborn neuron types which showed diversity of cell fate commitment and location. Further analyses showed homology of these cell types to neurogenic cells in the mammalian brain identified neurogenic commitment in proliferating radial glia and indicated that glutamatergic projection neurons fate are generated in the adult zebrafish telecephalon. Thus we prospectively isolated adult newborn neurons from the adult zebrafish forebrain identified markers for newborn and mature neurons in the adult brain revealed intrinsic heterogeneity among adult newborn neurons and their homology to mammalian adult neurogenic cell types. Overall design: single cell sequencing to identify specific markers and functional subpopulations of adult newborn neurons in the zebrafish forebrain | pubmed:31908317 | ON24 01 H11 | GSM4080985 | tissue:Brain|sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.324713155088674 | ON24 01 H11 | FastQC was used to examine quality of the reads post sequencing. Alignment with GSNAP v 2017 08 15 with parameters for sample ON15 01 G10 all other samples accordingly: ‘gsnap.sse42 D /projects/seq work/user/pipeline/gmap d GRCz10 gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit read group id=L22281 ON15 01 G10 read group name=ON15 01 G10 read group library=L22281 read group platform=illumina fastq/L22281 ON15 01 G10 R1.fastq.gz’ Ensembl gene annotation version 87 was used to detect exon spanning reads featureCounts v1.5.3 was used with the same Ensembl annotation to count the uniquely aligned reads to the genes and to create a counts table. Parameters: " a" "/projects/seq work/user/pipeline/annotation/danio rerio/GRCz10/EnsemblGene 87.GRCz10.TR.gtf" " s" "2" " o" "genecount/bfx811.GRCz10.e87.txt" " Q" "1" " T" "8" " tmpDir" "/tmp/418815.1.ngs.q" Genome build: GRCz10 reference inclusive the 92 ERCC Spike In transcripts Supplementary files format and content: `counts.csv` is a comma separated table and contains the raw count matrix. | Brain | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.324713155088674 | GSM4080985 | GSM4080985: ON24 01 H11; Danio rerio; RNA Seq | GSM4080985 | 1 | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | GEO Accession:GSM4080985 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP221784 | intentional duplicate|dangling references:treat as unmapped | L22290_ON24_01_H11_mod.bam | bam | 49961108.0 | 657383.0 | GSM4080985 r1 | 0:76 | A:14127615;C:10704711;G:10835971;T:14292589;N:222 | 76 | 14127615 | 10704711 | 10835971 | 14292589 | 222 | SRX6854748 | SRS5392950 | SRA962624 | GEO | Statistical physics of living systems, Biological Physics, Max Planck Institute for the Physics of Complex Systems | 1 | 0.87519 | 0.24291 | 0.91543 | 0.48833 | 76 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2019-09-16 | Adult | Adult | Brain | Nervous System | ||||||||||||||||||
| 54358 | 54358 | SRR10126098 | SRX6854747 | SRS5392949 | SRP221784 | PRJNA565778 | Single cell sequencing of radial glia progeny reveals diversity of newborn neurons in the adult zebrafish brain | GSE137525 | Transcriptome Analysis | Zebrafish display widespread and pronounced adult neurogenesis which is fundamental for their regeneration capability post central nervous system injury. However the cellular identity and the biological properties of adult newborn neurons are elusive for most brain areas. Here we used short term lineage tracing of radial glia progeny to prospectively isolate newborn neurons from the her4.1+ radial glia lineage in the homeostatic adult forebrain. Transcriptome analysis of radial glia newborn neurons and mature neurons using single cell sequencing identified distinct transcriptional profiles including novel markers for each population. Specifically we detected 2 separate newborn neuron types which showed diversity of cell fate commitment and location. Further analyses showed homology of these cell types to neurogenic cells in the mammalian brain identified neurogenic commitment in proliferating radial glia and indicated that glutamatergic projection neurons fate are generated in the adult zebrafish telecephalon. Thus we prospectively isolated adult newborn neurons from the adult zebrafish forebrain identified markers for newborn and mature neurons in the adult brain revealed intrinsic heterogeneity among adult newborn neurons and their homology to mammalian adult neurogenic cell types. Overall design: single cell sequencing to identify specific markers and functional subpopulations of adult newborn neurons in the zebrafish forebrain | pubmed:31908317 | ON20 01 D11 | GSM4080984 | tissue:Brain|sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.345805160446015 | ON20 01 D11 | FastQC was used to examine quality of the reads post sequencing. Alignment with GSNAP v 2017 08 15 with parameters for sample ON15 01 G10 all other samples accordingly: ‘gsnap.sse42 D /projects/seq work/user/pipeline/gmap d GRCz10 gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit read group id=L22281 ON15 01 G10 read group name=ON15 01 G10 read group library=L22281 read group platform=illumina fastq/L22281 ON15 01 G10 R1.fastq.gz’ Ensembl gene annotation version 87 was used to detect exon spanning reads featureCounts v1.5.3 was used with the same Ensembl annotation to count the uniquely aligned reads to the genes and to create a counts table. Parameters: " a" "/projects/seq work/user/pipeline/annotation/danio rerio/GRCz10/EnsemblGene 87.GRCz10.TR.gtf" " s" "2" " o" "genecount/bfx811.GRCz10.e87.txt" " Q" "1" " T" "8" " tmpDir" "/tmp/418815.1.ngs.q" Genome build: GRCz10 reference inclusive the 92 ERCC Spike In transcripts Supplementary files format and content: `counts.csv` is a comma separated table and contains the raw count matrix. | Brain | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.345805160446015 | GSM4080984 | GSM4080984: ON20 01 D11; Danio rerio; RNA Seq | GSM4080984 | 1 | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | GEO Accession:GSM4080984 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP221784 | intentional duplicate|dangling references:treat as unmapped | L22286_ON20_01_D11_mod.bam | bam | 45645220.0 | 600595.0 | GSM4080984 r1 | 0:76 | A:12652866;C:10016610;G:10144796;T:12830749;N:199 | 76 | 12652866 | 10016610 | 10144796 | 12830749 | 199 | SRX6854747 | SRS5392949 | SRA962624 | GEO | Statistical physics of living systems, Biological Physics, Max Planck Institute for the Physics of Complex Systems | 1 | 0.8612 | 0.21429 | 0.94649 | 0.51433 | 76 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2019-09-16 | Adult | Adult | Brain | Nervous System | ||||||||||||||||||
| 54359 | 54359 | SRR10126097 | SRX6854746 | SRS5392948 | SRP221784 | PRJNA565778 | Single cell sequencing of radial glia progeny reveals diversity of newborn neurons in the adult zebrafish brain | GSE137525 | Transcriptome Analysis | Zebrafish display widespread and pronounced adult neurogenesis which is fundamental for their regeneration capability post central nervous system injury. However the cellular identity and the biological properties of adult newborn neurons are elusive for most brain areas. Here we used short term lineage tracing of radial glia progeny to prospectively isolate newborn neurons from the her4.1+ radial glia lineage in the homeostatic adult forebrain. Transcriptome analysis of radial glia newborn neurons and mature neurons using single cell sequencing identified distinct transcriptional profiles including novel markers for each population. Specifically we detected 2 separate newborn neuron types which showed diversity of cell fate commitment and location. Further analyses showed homology of these cell types to neurogenic cells in the mammalian brain identified neurogenic commitment in proliferating radial glia and indicated that glutamatergic projection neurons fate are generated in the adult zebrafish telecephalon. Thus we prospectively isolated adult newborn neurons from the adult zebrafish forebrain identified markers for newborn and mature neurons in the adult brain revealed intrinsic heterogeneity among adult newborn neurons and their homology to mammalian adult neurogenic cell types. Overall design: single cell sequencing to identify specific markers and functional subpopulations of adult newborn neurons in the zebrafish forebrain | pubmed:31908317 | ON19 01 C11 | GSM4080983 | tissue:Brain|sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.342848231466316 | ON19 01 C11 | FastQC was used to examine quality of the reads post sequencing. Alignment with GSNAP v 2017 08 15 with parameters for sample ON15 01 G10 all other samples accordingly: ‘gsnap.sse42 D /projects/seq work/user/pipeline/gmap d GRCz10 gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit read group id=L22281 ON15 01 G10 read group name=ON15 01 G10 read group library=L22281 read group platform=illumina fastq/L22281 ON15 01 G10 R1.fastq.gz’ Ensembl gene annotation version 87 was used to detect exon spanning reads featureCounts v1.5.3 was used with the same Ensembl annotation to count the uniquely aligned reads to the genes and to create a counts table. Parameters: " a" "/projects/seq work/user/pipeline/annotation/danio rerio/GRCz10/EnsemblGene 87.GRCz10.TR.gtf" " s" "2" " o" "genecount/bfx811.GRCz10.e87.txt" " Q" "1" " T" "8" " tmpDir" "/tmp/418815.1.ngs.q" Genome build: GRCz10 reference inclusive the 92 ERCC Spike In transcripts Supplementary files format and content: `counts.csv` is a comma separated table and contains the raw count matrix. | Brain | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.342848231466316 | GSM4080983 | GSM4080983: ON19 01 C11; Danio rerio; RNA Seq | GSM4080983 | 1 | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | GEO Accession:GSM4080983 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP221784 | intentional duplicate|dangling references:treat as unmapped | L22285_ON19_01_C11_mod.bam | bam | 44588516.0 | 586691.0 | GSM4080983 r1 | 0:76 | A:12252079;C:9823426;G:9954660;T:12558164;N:187 | 76 | 12252079 | 9823426 | 9954660 | 12558164 | 187 | SRX6854746 | SRS5392948 | SRA962624 | GEO | Statistical physics of living systems, Biological Physics, Max Planck Institute for the Physics of Complex Systems | 1 | 0.8663 | 0.1874 | 0.95057 | 0.48221 | 76 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2019-09-16 | Adult | Adult | Brain | Nervous System | ||||||||||||||||||
| 54360 | 54360 | SRR10126096 | SRX6854745 | SRS5392947 | SRP221784 | PRJNA565778 | Single cell sequencing of radial glia progeny reveals diversity of newborn neurons in the adult zebrafish brain | GSE137525 | Transcriptome Analysis | Zebrafish display widespread and pronounced adult neurogenesis which is fundamental for their regeneration capability post central nervous system injury. However the cellular identity and the biological properties of adult newborn neurons are elusive for most brain areas. Here we used short term lineage tracing of radial glia progeny to prospectively isolate newborn neurons from the her4.1+ radial glia lineage in the homeostatic adult forebrain. Transcriptome analysis of radial glia newborn neurons and mature neurons using single cell sequencing identified distinct transcriptional profiles including novel markers for each population. Specifically we detected 2 separate newborn neuron types which showed diversity of cell fate commitment and location. Further analyses showed homology of these cell types to neurogenic cells in the mammalian brain identified neurogenic commitment in proliferating radial glia and indicated that glutamatergic projection neurons fate are generated in the adult zebrafish telecephalon. Thus we prospectively isolated adult newborn neurons from the adult zebrafish forebrain identified markers for newborn and mature neurons in the adult brain revealed intrinsic heterogeneity among adult newborn neurons and their homology to mammalian adult neurogenic cell types. Overall design: single cell sequencing to identify specific markers and functional subpopulations of adult newborn neurons in the zebrafish forebrain | pubmed:31908317 | ON18 01 B11 | GSM4080982 | tissue:Brain|sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.356681923777462 | ON18 01 B11 | FastQC was used to examine quality of the reads post sequencing. Alignment with GSNAP v 2017 08 15 with parameters for sample ON15 01 G10 all other samples accordingly: ‘gsnap.sse42 D /projects/seq work/user/pipeline/gmap d GRCz10 gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit read group id=L22281 ON15 01 G10 read group name=ON15 01 G10 read group library=L22281 read group platform=illumina fastq/L22281 ON15 01 G10 R1.fastq.gz’ Ensembl gene annotation version 87 was used to detect exon spanning reads featureCounts v1.5.3 was used with the same Ensembl annotation to count the uniquely aligned reads to the genes and to create a counts table. Parameters: " a" "/projects/seq work/user/pipeline/annotation/danio rerio/GRCz10/EnsemblGene 87.GRCz10.TR.gtf" " s" "2" " o" "genecount/bfx811.GRCz10.e87.txt" " Q" "1" " T" "8" " tmpDir" "/tmp/418815.1.ngs.q" Genome build: GRCz10 reference inclusive the 92 ERCC Spike In transcripts Supplementary files format and content: `counts.csv` is a comma separated table and contains the raw count matrix. | Brain | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.356681923777462 | GSM4080982 | GSM4080982: ON18 01 B11; Danio rerio; RNA Seq | GSM4080982 | 1 | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | GEO Accession:GSM4080982 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP221784 | intentional duplicate|dangling references:treat as unmapped | L22284_ON18_01_B11_mod.bam | bam | 41805776.0 | 550076.0 | GSM4080982 r1 | 0:76 | A:11557097;C:9225654;G:9383396;T:11639451;N:178 | 76 | 11557097 | 9225654 | 9383396 | 11639451 | 178 | SRX6854745 | SRS5392947 | SRA962624 | GEO | Statistical physics of living systems, Biological Physics, Max Planck Institute for the Physics of Complex Systems | 1 | 0.88353 | 0.19606 | 0.93237 | 0.49124 | 76 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2019-09-16 | Adult | Adult | Brain | Nervous System | ||||||||||||||||||
| 54361 | 54361 | SRR10126095 | SRX6854744 | SRS5392946 | SRP221784 | PRJNA565778 | Single cell sequencing of radial glia progeny reveals diversity of newborn neurons in the adult zebrafish brain | GSE137525 | Transcriptome Analysis | Zebrafish display widespread and pronounced adult neurogenesis which is fundamental for their regeneration capability post central nervous system injury. However the cellular identity and the biological properties of adult newborn neurons are elusive for most brain areas. Here we used short term lineage tracing of radial glia progeny to prospectively isolate newborn neurons from the her4.1+ radial glia lineage in the homeostatic adult forebrain. Transcriptome analysis of radial glia newborn neurons and mature neurons using single cell sequencing identified distinct transcriptional profiles including novel markers for each population. Specifically we detected 2 separate newborn neuron types which showed diversity of cell fate commitment and location. Further analyses showed homology of these cell types to neurogenic cells in the mammalian brain identified neurogenic commitment in proliferating radial glia and indicated that glutamatergic projection neurons fate are generated in the adult zebrafish telecephalon. Thus we prospectively isolated adult newborn neurons from the adult zebrafish forebrain identified markers for newborn and mature neurons in the adult brain revealed intrinsic heterogeneity among adult newborn neurons and their homology to mammalian adult neurogenic cell types. Overall design: single cell sequencing to identify specific markers and functional subpopulations of adult newborn neurons in the zebrafish forebrain | pubmed:31908317 | ON23 01 G11 | GSM4080981 | tissue:Brain|sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.337622302046746 | ON23 01 G11 | FastQC was used to examine quality of the reads post sequencing. Alignment with GSNAP v 2017 08 15 with parameters for sample ON15 01 G10 all other samples accordingly: ‘gsnap.sse42 D /projects/seq work/user/pipeline/gmap d GRCz10 gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit read group id=L22281 ON15 01 G10 read group name=ON15 01 G10 read group library=L22281 read group platform=illumina fastq/L22281 ON15 01 G10 R1.fastq.gz’ Ensembl gene annotation version 87 was used to detect exon spanning reads featureCounts v1.5.3 was used with the same Ensembl annotation to count the uniquely aligned reads to the genes and to create a counts table. Parameters: " a" "/projects/seq work/user/pipeline/annotation/danio rerio/GRCz10/EnsemblGene 87.GRCz10.TR.gtf" " s" "2" " o" "genecount/bfx811.GRCz10.e87.txt" " Q" "1" " T" "8" " tmpDir" "/tmp/418815.1.ngs.q" Genome build: GRCz10 reference inclusive the 92 ERCC Spike In transcripts Supplementary files format and content: `counts.csv` is a comma separated table and contains the raw count matrix. | Brain | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.337622302046746 | GSM4080981 | GSM4080981: ON23 01 G11; Danio rerio; RNA Seq | GSM4080981 | 1 | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | GEO Accession:GSM4080981 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP221784 | intentional duplicate|dangling references:treat as unmapped | L22289_ON23_01_G11_mod.bam | bam | 34314608.0 | 451508.0 | GSM4080981 r1 | 0:76 | A:9639586;C:7428852;G:7549525;T:9696492;N:153 | 76 | 9639586 | 7428852 | 7549525 | 9696492 | 153 | SRX6854744 | SRS5392946 | SRA962624 | GEO | Statistical physics of living systems, Biological Physics, Max Planck Institute for the Physics of Complex Systems | 1 | 0.87321 | 0.25858 | 0.95168 | 0.504 | 76 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2019-09-16 | Adult | Adult | Brain | Nervous System | ||||||||||||||||||
| 54362 | 54362 | SRR10126094 | SRX6854743 | SRS5392945 | SRP221784 | PRJNA565778 | Single cell sequencing of radial glia progeny reveals diversity of newborn neurons in the adult zebrafish brain | GSE137525 | Transcriptome Analysis | Zebrafish display widespread and pronounced adult neurogenesis which is fundamental for their regeneration capability post central nervous system injury. However the cellular identity and the biological properties of adult newborn neurons are elusive for most brain areas. Here we used short term lineage tracing of radial glia progeny to prospectively isolate newborn neurons from the her4.1+ radial glia lineage in the homeostatic adult forebrain. Transcriptome analysis of radial glia newborn neurons and mature neurons using single cell sequencing identified distinct transcriptional profiles including novel markers for each population. Specifically we detected 2 separate newborn neuron types which showed diversity of cell fate commitment and location. Further analyses showed homology of these cell types to neurogenic cells in the mammalian brain identified neurogenic commitment in proliferating radial glia and indicated that glutamatergic projection neurons fate are generated in the adult zebrafish telecephalon. Thus we prospectively isolated adult newborn neurons from the adult zebrafish forebrain identified markers for newborn and mature neurons in the adult brain revealed intrinsic heterogeneity among adult newborn neurons and their homology to mammalian adult neurogenic cell types. Overall design: single cell sequencing to identify specific markers and functional subpopulations of adult newborn neurons in the zebrafish forebrain | pubmed:31908317 | ON22 01 F11 | GSM4080980 | tissue:Brain|sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.351704193217474 | ON22 01 F11 | FastQC was used to examine quality of the reads post sequencing. Alignment with GSNAP v 2017 08 15 with parameters for sample ON15 01 G10 all other samples accordingly: ‘gsnap.sse42 D /projects/seq work/user/pipeline/gmap d GRCz10 gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit read group id=L22281 ON15 01 G10 read group name=ON15 01 G10 read group library=L22281 read group platform=illumina fastq/L22281 ON15 01 G10 R1.fastq.gz’ Ensembl gene annotation version 87 was used to detect exon spanning reads featureCounts v1.5.3 was used with the same Ensembl annotation to count the uniquely aligned reads to the genes and to create a counts table. Parameters: " a" "/projects/seq work/user/pipeline/annotation/danio rerio/GRCz10/EnsemblGene 87.GRCz10.TR.gtf" " s" "2" " o" "genecount/bfx811.GRCz10.e87.txt" " Q" "1" " T" "8" " tmpDir" "/tmp/418815.1.ngs.q" Genome build: GRCz10 reference inclusive the 92 ERCC Spike In transcripts Supplementary files format and content: `counts.csv` is a comma separated table and contains the raw count matrix. | Brain | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.351704193217474 | GSM4080980 | GSM4080980: ON22 01 F11; Danio rerio; RNA Seq | GSM4080980 | 1 | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | GEO Accession:GSM4080980 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP221784 | intentional duplicate|dangling references:treat as unmapped | L22288_ON22_01_F11_mod.bam | bam | 47930388.0 | 630663.0 | GSM4080980 r1 | 0:76 | A:13368035;C:10449666;G:10572110;T:13540361;N:216 | 76 | 13368035 | 10449666 | 10572110 | 13540361 | 216 | SRX6854743 | SRS5392945 | SRA962624 | GEO | Statistical physics of living systems, Biological Physics, Max Planck Institute for the Physics of Complex Systems | 1 | 0.87895 | 0.21319 | 0.92736 | 0.49859 | 76 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2019-09-16 | Adult | Adult | Brain | Nervous System | ||||||||||||||||||
| 54363 | 54363 | SRR10126093 | SRX6854742 | SRS5392944 | SRP221784 | PRJNA565778 | Single cell sequencing of radial glia progeny reveals diversity of newborn neurons in the adult zebrafish brain | GSE137525 | Transcriptome Analysis | Zebrafish display widespread and pronounced adult neurogenesis which is fundamental for their regeneration capability post central nervous system injury. However the cellular identity and the biological properties of adult newborn neurons are elusive for most brain areas. Here we used short term lineage tracing of radial glia progeny to prospectively isolate newborn neurons from the her4.1+ radial glia lineage in the homeostatic adult forebrain. Transcriptome analysis of radial glia newborn neurons and mature neurons using single cell sequencing identified distinct transcriptional profiles including novel markers for each population. Specifically we detected 2 separate newborn neuron types which showed diversity of cell fate commitment and location. Further analyses showed homology of these cell types to neurogenic cells in the mammalian brain identified neurogenic commitment in proliferating radial glia and indicated that glutamatergic projection neurons fate are generated in the adult zebrafish telecephalon. Thus we prospectively isolated adult newborn neurons from the adult zebrafish forebrain identified markers for newborn and mature neurons in the adult brain revealed intrinsic heterogeneity among adult newborn neurons and their homology to mammalian adult neurogenic cell types. Overall design: single cell sequencing to identify specific markers and functional subpopulations of adult newborn neurons in the zebrafish forebrain | pubmed:31908317 | ON21 01 E11 | GSM4080979 | tissue:Brain|sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.330638956789342 | ON21 01 E11 | FastQC was used to examine quality of the reads post sequencing. Alignment with GSNAP v 2017 08 15 with parameters for sample ON15 01 G10 all other samples accordingly: ‘gsnap.sse42 D /projects/seq work/user/pipeline/gmap d GRCz10 gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit read group id=L22281 ON15 01 G10 read group name=ON15 01 G10 read group library=L22281 read group platform=illumina fastq/L22281 ON15 01 G10 R1.fastq.gz’ Ensembl gene annotation version 87 was used to detect exon spanning reads featureCounts v1.5.3 was used with the same Ensembl annotation to count the uniquely aligned reads to the genes and to create a counts table. Parameters: " a" "/projects/seq work/user/pipeline/annotation/danio rerio/GRCz10/EnsemblGene 87.GRCz10.TR.gtf" " s" "2" " o" "genecount/bfx811.GRCz10.e87.txt" " Q" "1" " T" "8" " tmpDir" "/tmp/418815.1.ngs.q" Genome build: GRCz10 reference inclusive the 92 ERCC Spike In transcripts Supplementary files format and content: `counts.csv` is a comma separated table and contains the raw count matrix. | Brain | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | sorting:MN|FISH id:bfx811 01|batch:bfx811|fraction mapped:0.330638956789342 | GSM4080979 | GSM4080979: ON21 01 E11; Danio rerio; RNA Seq | GSM4080979 | 1 | adult zebrafish brains were collected digested into single cells using the Papain Neural Tissue Dissociation Kit Miltenyi and sorted by FACS to isolate cells expressing GFP or mcherry The Illumina Nextera DNA library preparation kit FC 121 1031 was used to prepare libraries. | GEO Accession:GSM4080979 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP221784 | intentional duplicate|dangling references:treat as unmapped | L22287_ON21_01_E11_mod.bam | bam | 46820788.0 | 616063.0 | GSM4080979 r1 | 0:76 | A:13360602;C:9787624;G:10022727;T:13649641;N:194 | 76 | 13360602 | 9787624 | 10022727 | 13649641 | 194 | SRX6854742 | SRS5392944 | SRA962624 | GEO | Statistical physics of living systems, Biological Physics, Max Planck Institute for the Physics of Complex Systems | 1 | 0.85652 | 0.23734 | 0.95629 | 0.49147 | 76 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2019-09-16 | Adult | Adult | Brain | Nervous System |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;