RNAquarium Metadata Server
Institute Website Terms of Use Privacy Policy

run_metadata

223 rows where experiment.library_layout = "SINGLE", experiment.library_source = "TRANSCRIPTOMIC" and experiment.library_strategy = "ncRNA-Seq"

✎ View and edit SQL

This data as json, CSV (advanced)

devstage_curation 9

devstage_curation_coarse 4

technology 3

experiment.platform 1

experiment.library_strategy 1

  • ncRNA-Seq · 223 ✖

experiment.library_source 1

  • TRANSCRIPTOMIC · 223 ✖

experiment.library_selection 1

experiment.library_layout 1

  • SINGLE · 223 ✖
Link rowid ▼ run.accession experiment.accession sample.accession study.accession bioproject study.title study.alias study.type study.abstract study.attributes study.PMIDs sample.description sample.title sample.alias sample.centername sample.attributes GEOsample.title GEOsample.dataprocessing GEOsample.source GEOsample.treatmentprotocol GEOsample.extractprotocol GEOsample.growthprotocol GEOsample.characteristics GEOsample.accession experiment.title experiment.alias experiment.library_name experiment.design_description experiment.library_construction_protocol experiment.attributes experiment.library_strategy experiment.library_source experiment.library_selection experiment.library_layout experiment.platform experiment.instrument_model experiment.spot_descriptor experiment.study_ref run.title run.attributes run.filename run.semantic_name run.total_bases run.total_spots run.alias run.read_lengths run.base_counts run.r1_length run.r2_length run.r3_length run.r4_length run.Acount run.Ccount run.Gcount run.Tcount run.Ncount run.experiment run.pool_member submission.accession submission.srasource submission.bioprojectsource seqdetective.n_mates seqdetective.mapping_rate.mate1 seqdetective.mapping_rate.mate2 seqdetective.nofeature_rate.mate1 seqdetective.nofeature_rate.mate2 seqdetective.sparsity.mate1 seqdetective.sparsity.mate2 seqdetective.pos_strand_rate.mate1 seqdetective.pos_strand_rate.mate2 seqdetective.readlen.mate1 seqdetective.readlen.mate2 seqdetective.judgement.mate1 seqdetective.judgement.mate2 seqdetective.judgement.reason platform_family instrument_generation read_bias selection_class prep_kit sc_or_bulk tech_class technology tech_variant submission.bioprojectsource.country earliest_date devstage_curation devstage_curation_coarse tissue_curation tissue_curation_coarse
25162 25162 SRR25655085 SRX21381122 SRS18622091 SRP455342 PRJNA1005926 miR 29a is downregulated in progenies derived from chronically stressed males GSE240954 Transcriptome Analysis To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.   pubmed:37762407   Sample 8 AU1038 STRSS4 GSM7712891   source name:larvae|tissue:larvae|genotype:WT|treatment:From parent chronically stressed|geo loc name:missing|collection date:missing Sample 8 AU1038 STRSS4 Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts larvae   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:larvae|genotype:WT|treatment:From parent chronically stressed GSM7712891 GSM7712891: Sample 8 AU1038 STRSS4; Danio rerio; ncRNA Seq GSM7712891 r1 GSM7712891 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP455342   loader:fastq load.py STRS04_10932AAD_TGTCCTAC-ACATGAGT_R1_001.fastq.gz fastq 641236400.0 12824728.0 GSM7712891 r1 0:50 A:183546979;C:159774155;G:156033079;T:141881902;N:285 50       183546979 159774155 156033079 141881902 285 SRX21381122 SRS18622091 SRA1693666 CNAG CNAG 1 0.4736   0.03992   0.96788   0.87662   50   B   usable mapping rate illumina novaseq_era unknown size_fractionation unknown bulk unknown unknown   Spain 2023-08-16 Larval Larval Undetermined Undetermined
25163 25163 SRR25655086 SRX21381121 SRS18622090 SRP455342 PRJNA1005926 miR 29a is downregulated in progenies derived from chronically stressed males GSE240954 Transcriptome Analysis To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.   pubmed:37762407   Sample 7 AU1037 STRSS3 GSM7712890   source name:larvae|tissue:larvae|genotype:WT|treatment:From parent chronically stressed|geo loc name:missing|collection date:missing Sample 7 AU1037 STRSS3 Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts larvae   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:larvae|genotype:WT|treatment:From parent chronically stressed GSM7712890 GSM7712890: Sample 7 AU1037 STRSS3; Danio rerio; ncRNA Seq GSM7712890 r1 GSM7712890 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP455342   loader:fastq load.py STRS03_10931AAD_GCACGATT-CGTCTGCA_R1_001.fastq.gz fastq 434646850.0 8692937.0 GSM7712890 r1 0:50 A:126760670;C:102577685;G:109591447;T:95716876;N:172 50       126760670 102577685 109591447 95716876 172 SRX21381121 SRS18622090 SRA1693666 CNAG CNAG 1 0.52132   0.04615   0.96477   0.85481   50   B   usable mapping rate illumina novaseq_era unknown size_fractionation unknown bulk unknown unknown   Spain 2023-08-16 Larval Larval Undetermined Undetermined
25164 25164 SRR25655087 SRX21381120 SRS18622089 SRP455342 PRJNA1005926 miR 29a is downregulated in progenies derived from chronically stressed males GSE240954 Transcriptome Analysis To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.   pubmed:37762407   Sample 6 AU1036 STRSS2 GSM7712889   source name:larvae|tissue:larvae|genotype:WT|treatment:From parent chronically stressed|geo loc name:missing|collection date:missing Sample 6 AU1036 STRSS2 Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts larvae   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:larvae|genotype:WT|treatment:From parent chronically stressed GSM7712889 GSM7712889: Sample 6 AU1036 STRSS2; Danio rerio; ncRNA Seq GSM7712889 r1 GSM7712889 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP455342   loader:fastq load.py STRS02_10930AAD_ATGAAGCG-GCGGACAG_R1_001.fastq.gz fastq 907610650.0 18152213.0 GSM7712889 r1 0:50 A:271494673;C:215304417;G:220608756;T:200202267;N:537 50       271494673 215304417 220608756 200202267 537 SRX21381120 SRS18622089 SRA1693666 CNAG CNAG 1 0.44189   0.03477   0.97335   0.88092   50   B   usable mapping rate illumina novaseq_era unknown size_fractionation unknown bulk unknown unknown   Spain 2023-08-16 Larval Larval Undetermined Undetermined
25165 25165 SRR25655088 SRX21381119 SRS18622088 SRP455342 PRJNA1005926 miR 29a is downregulated in progenies derived from chronically stressed males GSE240954 Transcriptome Analysis To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.   pubmed:37762407   Sample 5 AU1035 STRSS1 GSM7712888   source name:larvae|tissue:larvae|genotype:WT|treatment:From parent chronically stressed|geo loc name:missing|collection date:missing Sample 5 AU1035 STRSS1 Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts larvae   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:larvae|genotype:WT|treatment:From parent chronically stressed GSM7712888 GSM7712888: Sample 5 AU1035 STRSS1; Danio rerio; ncRNA Seq GSM7712888 r1 GSM7712888 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP455342   loader:fastq load.py STRS01_10929AAD_CACTTCGA-TAGGCTTC_R1_001.fastq.gz fastq 711276100.0 14225522.0 GSM7712888 r1 0:50 A:207284968;C:173540770;G:172961619;T:157488473;N:270 50       207284968 173540770 172961619 157488473 270 SRX21381119 SRS18622088 SRA1693666 CNAG CNAG 1 0.47865   0.03881   0.97001   0.87616   50   B   usable mapping rate illumina novaseq_era unknown size_fractionation unknown bulk unknown unknown   Spain 2023-08-16 Larval Larval Undetermined Undetermined
25166 25166 SRR25655089 SRX21381118 SRS18622087 SRP455342 PRJNA1005926 miR 29a is downregulated in progenies derived from chronically stressed males GSE240954 Transcriptome Analysis To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.   pubmed:37762407   Sample 4 AU1028 CTRL4 GSM7712887   source name:larvae|tissue:larvae|genotype:WT|treatment:Control|geo loc name:missing|collection date:missing Sample 4 AU1028 CTRL4 Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts larvae   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:larvae|genotype:WT|treatment:Control GSM7712887 GSM7712887: Sample 4 AU1028 CTRL4; Danio rerio; ncRNA Seq GSM7712887 r1 GSM7712887 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP455342   loader:fastq load.py CTRL04_10928AAD_GACTAGGC-GCCTCGAC_R1_001.fastq.gz fastq 568037350.0 11360747.0 GSM7712887 r1 0:50 A:165826590;C:133109854;G:141956673;T:127143732;N:501 50       165826590 133109854 141956673 127143732 501 SRX21381118 SRS18622087 SRA1693666 CNAG CNAG 1 0.48051   0.0347   0.97268   0.87465   50   B   usable mapping rate illumina novaseq_era unknown size_fractionation unknown bulk unknown unknown   Spain 2023-08-16 Larval Larval Undetermined Undetermined
25167 25167 SRR25655090 SRX21381117 SRS18622086 SRP455342 PRJNA1005926 miR 29a is downregulated in progenies derived from chronically stressed males GSE240954 Transcriptome Analysis To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.   pubmed:37762407   Sample 3 AU1027 CTRL3 GSM7712886   source name:larvae|tissue:larvae|genotype:WT|treatment:Control|geo loc name:missing|collection date:missing Sample 3 AU1027 CTRL3 Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts larvae   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:larvae|genotype:WT|treatment:Control GSM7712886 GSM7712886: Sample 3 AU1027 CTRL3; Danio rerio; ncRNA Seq GSM7712886 r1 GSM7712886 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP455342   loader:fastq load.py CTRL03_10927AAD_AGTATACT-CGAATCGG_R1_001.fastq.gz fastq 651469300.0 13029386.0 GSM7712886 r1 0:50 A:191788726;C:154951271;G:161329211;T:143399936;N:156 50       191788726 154951271 161329211 143399936 156 SRX21381117 SRS18622086 SRA1693666 CNAG CNAG 1 0.45412   0.04073   0.96934   0.88507   50   B   usable mapping rate illumina novaseq_era unknown size_fractionation unknown bulk unknown unknown   Spain 2023-08-16 Larval Larval Undetermined Undetermined
25168 25168 SRR25655091 SRX21381116 SRS18622085 SRP455342 PRJNA1005926 miR 29a is downregulated in progenies derived from chronically stressed males GSE240954 Transcriptome Analysis To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.   pubmed:37762407   Sample 2 AU1026 CTRL2 GSM7712885   source name:larvae|tissue:larvae|genotype:WT|treatment:Control|geo loc name:missing|collection date:missing Sample 2 AU1026 CTRL2 Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts larvae   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:larvae|genotype:WT|treatment:Control GSM7712885 GSM7712885: Sample 2 AU1026 CTRL2; Danio rerio; ncRNA Seq GSM7712885 r1 GSM7712885 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP455342   loader:fastq load.py CTRL02_10926AAD_CCGCGTAG-TTCTGATT_R1_001.fastq.gz fastq 754615100.0 15092302.0 GSM7712885 r1 0:50 A:217013981;C:184328493;G:188964773;T:164307508;N:345 50       217013981 184328493 188964773 164307508 345 SRX21381116 SRS18622085 SRA1693666 CNAG CNAG 1 0.48926   0.04654   0.96418   0.8889   50   B   usable mapping rate illumina novaseq_era unknown size_fractionation unknown bulk unknown unknown   Spain 2023-08-16 Larval Larval Undetermined Undetermined
25169 25169 SRR25655092 SRX21381115 SRS18622084 SRP455342 PRJNA1005926 miR 29a is downregulated in progenies derived from chronically stressed males GSE240954 Transcriptome Analysis To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.   pubmed:37762407   Sample 1 AU1024 CTRL1 GSM7712884   source name:larvae|tissue:larvae|genotype:WT|treatment:Control|geo loc name:missing|collection date:missing Sample 1 AU1024 CTRL1 Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts larvae   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:larvae|genotype:WT|treatment:Control GSM7712884 GSM7712884: Sample 1 AU1024 CTRL1; Danio rerio; ncRNA Seq GSM7712884 r1 GSM7712884 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP455342   loader:fastq load.py CTRL01_10925AAD_TTAGCCTA-AATCATCA_R1_001.fastq.gz fastq 670580700.0 13411614.0 GSM7712884 r1 0:50 A:194653643;C:158916446;G:165941477;T:151068917;N:217 50       194653643 158916446 165941477 151068917 217 SRX21381115 SRS18622084 SRA1693666 CNAG CNAG 1 0.47093   0.03457   0.97187   0.8867   50   B   usable mapping rate illumina novaseq_era unknown size_fractionation unknown bulk unknown unknown   Spain 2023-08-16 Larval Larval Undetermined Undetermined
25277 25277 SRR30160454 SRX25627658 SRS22272474 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT bud 10 hpf charged tRNA seqrep 3 GSM8441306   tissue:10 hpf embryos|cell type:10 hpf embryos|geo loc name:missing|collection date:missing WT bud 10 hpf charged tRNA seqrep 3 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions 10 hpf embryos   Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.   cell type:10 hpf embryos GSM8441306 GSM8441306: WT bud 10 hpf charged tRNA seqrep 3; Danio rerio; ncRNA Seq GSM8441306 r1 GSM8441306 1 Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP457111     10hpf_aa_rep3.fastq.gz fastq 193965330.0 3367323.0 GSM8441306 r1 0:57.60 A:36799299;C:55100074;G:53758955;T:48306966;N:36 57       36799299 55100074 53758955 48306966 36 SRX25627658 SRS22272474 SRA1941998 Max Planck Institute of Biochemistry Max Planck Institute of Biochemistry 1 0.34405   0.05049   0.89471   0.46469   88   B   usable mapping rate illumina novaseq_era 5prime size_fractionation unknown bulk unknown unknown   Germany 2024-08-05 Multi-stage Embryo Embryo Imprecise All anatomical structures
25278 25278 SRR30160455 SRX25627657 SRS22272473 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT bud 10 hpf charged tRNA seqrep 2 GSM8441305   tissue:10 hpf embryos|cell type:10 hpf embryos|geo loc name:missing|collection date:missing WT bud 10 hpf charged tRNA seqrep 2 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions 10 hpf embryos   Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.   cell type:10 hpf embryos GSM8441305 GSM8441305: WT bud 10 hpf charged tRNA seqrep 2; Danio rerio; ncRNA Seq GSM8441305 r1 GSM8441305 1 Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP457111     10hpf_aa_rep2.fastq.gz fastq 138524715.0 2369009.0 GSM8441305 r1 0:58.47 A:26396279;C:39139297;G:38459048;T:34530060;N:31 58       26396279 39139297 38459048 34530060 31 SRX25627657 SRS22272473 SRA1941998 Max Planck Institute of Biochemistry Max Planck Institute of Biochemistry 1 0.35458   0.05179   0.89424   0.46401   74   B   usable mapping rate illumina novaseq_era 5prime size_fractionation unknown bulk unknown unknown   Germany 2024-08-05 Multi-stage Embryo Embryo Imprecise All anatomical structures
25279 25279 SRR30160456 SRX25627656 SRS22272472 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT bud 10 hpf charged tRNA seqrep 1 GSM8441304   tissue:10 hpf embryos|cell type:10 hpf embryos|geo loc name:missing|collection date:missing WT bud 10 hpf charged tRNA seqrep 1 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions 10 hpf embryos   Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.   cell type:10 hpf embryos GSM8441304 GSM8441304: WT bud 10 hpf charged tRNA seqrep 1; Danio rerio; ncRNA Seq GSM8441304 r1 GSM8441304 1 Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP457111     10hpf_aa_rep1.fastq.gz fastq 54473618.0 946419.0 GSM8441304 r1 0:57.56 A:10345022;C:15413782;G:15135500;T:13579304;N:10 57       10345022 15413782 15135500 13579304 10 SRX25627656 SRS22272472 SRA1941998 Max Planck Institute of Biochemistry Max Planck Institute of Biochemistry 1 0.36103   0.0515   0.89227   0.4748   81   B   usable mapping rate illumina novaseq_era 5prime size_fractionation unknown bulk unknown unknown   Germany 2024-08-05 Multi-stage Embryo Embryo Imprecise All anatomical structures
25280 25280 SRR30160457 SRX25627655 SRS22272471 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT sphere 4 hpf charged tRNA seqrep 3 GSM8441303   tissue:4 hpf embryos|cell type:4 hpf embryos|geo loc name:missing|collection date:missing WT sphere 4 hpf charged tRNA seqrep 3 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions 4 hpf embryos   Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.   cell type:4 hpf embryos GSM8441303 GSM8441303: WT sphere 4 hpf charged tRNA seqrep 3; Danio rerio; ncRNA Seq GSM8441303 r1 GSM8441303 1 Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP457111     4hpf_aa_rep3.fastq.gz fastq 100810543.0 1747597.0 GSM8441303 r1 0:57.69 A:20466558;C:28054923;G:26849246;T:25439798;N:18 57       20466558 28054923 26849246 25439798 18 SRX25627655 SRS22272471 SRA1941998 Max Planck Institute of Biochemistry Max Planck Institute of Biochemistry 1 0.36374   0.06294   0.87316   0.54642   39   B   usable mapping rate illumina novaseq_era 5prime size_fractionation unknown bulk unknown unknown   Germany 2024-08-05 Multi-stage Embryo Embryo Imprecise All anatomical structures
25281 25281 SRR30160458 SRX25627654 SRS22272470 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT sphere 4 hpf charged tRNA seqrep 2 GSM8441302   tissue:4 hpf embryos|cell type:4 hpf embryos|geo loc name:missing|collection date:missing WT sphere 4 hpf charged tRNA seqrep 2 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions 4 hpf embryos   Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.   cell type:4 hpf embryos GSM8441302 GSM8441302: WT sphere 4 hpf charged tRNA seqrep 2; Danio rerio; ncRNA Seq GSM8441302 r1 GSM8441302 1 Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP457111     4hpf_aa_rep2.fastq.gz fastq 121662759.0 2046536.0 GSM8441302 r1 0:59.45 A:24519095;C:33689156;G:32726095;T:30728382;N:31 59       24519095 33689156 32726095 30728382 31 SRX25627654 SRS22272470 SRA1941998 Max Planck Institute of Biochemistry Max Planck Institute of Biochemistry 1 0.3726   0.06263   0.87136   0.55584   31   B   usable mapping rate illumina novaseq_era 5prime size_fractionation unknown bulk unknown unknown   Germany 2024-08-05 Multi-stage Embryo Embryo Imprecise All anatomical structures
25282 25282 SRR30160459 SRX25627653 SRS22272469 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT sphere 4 hpf charged tRNA seqrep 1 GSM8441301   tissue:4 hpf embryos|cell type:4 hpf embryos|geo loc name:missing|collection date:missing WT sphere 4 hpf charged tRNA seqrep 1 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions 4 hpf embryos   Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.   cell type:4 hpf embryos GSM8441301 GSM8441301: WT sphere 4 hpf charged tRNA seqrep 1; Danio rerio; ncRNA Seq GSM8441301 r1 GSM8441301 1 Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP457111     4hpf_aa_rep1.fastq.gz fastq 124990980.0 2116213.0 GSM8441301 r1 0:59.06 A:25487542;C:34621140;G:33284460;T:31597816;N:22 59       25487542 34621140 33284460 31597816 22 SRX25627653 SRS22272469 SRA1941998 Max Planck Institute of Biochemistry Max Planck Institute of Biochemistry 1 0.36013   0.05967   0.87387   0.55002   44   B   usable mapping rate illumina novaseq_era 5prime size_fractionation unknown bulk unknown unknown   Germany 2024-08-05 Multi-stage Embryo Embryo Imprecise All anatomical structures
25283 25283 SRR25764121 SRX21486801 SRS18719093 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT bud 10 hpf tRNA seq rep2 GSM7734782   source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT|geo loc name:missing|collection date:missing WT bud 10 hpf tRNA seq rep2 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts Gastrula unperturbed growth conditions in E3 medium for zebrafish embryos. 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT GSM7734782 GSM7734782: WT bud 10 hpf tRNA seq rep2; Danio rerio; ncRNA Seq GSM7734782 r1 GSM7734782 1 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP457111     WT_tRNA_bud_2.fastq.gz fastq 278145656.0 4215107.0 GSM7734782 r1 0:65.99 A:52499947;C:77161357;G:79314034;T:69169753;N:565 65       52499947 77161357 79314034 69169753 565 SRX21486801 SRS18719093 SRA1700461 Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry Max Planck Institute of Biochemistry 1 0.31888   0.01661   0.92348   0.40156   75   B   usable mapping rate illumina nextseq 5prime size_fractionation unknown bulk unknown unknown   Germany 2023-08-28 Gastrula Embryo Whole Organism All anatomical structures
25284 25284 SRR25764122 SRX21486800 SRS18719092 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT bud 10 hpf tRNA seq rep1 GSM7734781   source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT|geo loc name:missing|collection date:missing WT bud 10 hpf tRNA seq rep1 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts Gastrula unperturbed growth conditions in E3 medium for zebrafish embryos. 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT GSM7734781 GSM7734781: WT bud 10 hpf tRNA seq rep1; Danio rerio; ncRNA Seq GSM7734781 r1 GSM7734781 1 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP457111     WT_tRNA_bud_1.fastq.gz fastq 385514625.0 5770392.0 GSM7734781 r1 0:66.81 A:73305393;C:107155246;G:109793285;T:95259823;N:878 66       73305393 107155246 109793285 95259823 878 SRX21486800 SRS18719092 SRA1700461 Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry Max Planck Institute of Biochemistry 1 0.33213   0.01782   0.92354   0.42724   39   B   usable mapping rate illumina nextseq 5prime size_fractionation unknown bulk unknown unknown   Germany 2023-08-28 Gastrula Embryo Whole Organism All anatomical structures
25285 25285 SRR25764123 SRX21486799 SRS18719098 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT shield 6 hpf tRNA seq rep2 GSM7734780   source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Shield 6 hpf|genotype:WT|geo loc name:missing|collection date:missing WT shield 6 hpf tRNA seq rep2 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts Gastrula unperturbed growth conditions in E3 medium for zebrafish embryos. 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. strain:TLAB strain|tissue:Gastrula|developmental stage:Shield 6 hpf|genotype:WT GSM7734780 GSM7734780: WT shield 6 hpf tRNA seq rep2; Danio rerio; ncRNA Seq GSM7734780 r1 GSM7734780 1 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP457111     WT_tRNA_shield_2.fastq.gz fastq 469031736.0 7421688.0 GSM7734780 r1 0:63.20 A:90257219;C:130440728;G:130549302;T:117783411;N:1076 63       90257219 130440728 130549302 117783411 1076 SRX21486799 SRS18719098 SRA1700461 Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry Max Planck Institute of Biochemistry 1 0.29535   0.02113   0.91528   0.43824   37   B   usable mapping rate illumina nextseq 5prime size_fractionation unknown bulk unknown unknown   Germany 2023-08-28 Gastrula Embryo Whole Organism All anatomical structures
25286 25286 SRR25764124 SRX21486798 SRS18719100 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT shield 6 hpf tRNA seq rep1 GSM7734779   source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Shield 6 hpf|genotype:WT|geo loc name:missing|collection date:missing WT shield 6 hpf tRNA seq rep1 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts Gastrula unperturbed growth conditions in E3 medium for zebrafish embryos. 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. strain:TLAB strain|tissue:Gastrula|developmental stage:Shield 6 hpf|genotype:WT GSM7734779 GSM7734779: WT shield 6 hpf tRNA seq rep1; Danio rerio; ncRNA Seq GSM7734779 r1 GSM7734779 1 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP457111     WT_tRNA_shield_1.fastq.gz fastq 487207771.0 7521930.0 GSM7734779 r1 0:64.77 A:94654510;C:134893975;G:135716906;T:121941280;N:1100 64       94654510 134893975 135716906 121941280 1100 SRX21486798 SRS18719100 SRA1700461 Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry Max Planck Institute of Biochemistry 1 0.30664   0.02274   0.91297   0.46012   79   B   usable mapping rate illumina nextseq 5prime size_fractionation unknown bulk unknown unknown   Germany 2023-08-28 Gastrula Embryo Whole Organism All anatomical structures
25287 25287 SRR25764125 SRX21486797 SRS18719094 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT sphere 4 hpf tRNA seq rep2 GSM7734778   source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT|geo loc name:missing|collection date:missing WT sphere 4 hpf tRNA seq rep2 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts Blastula unperturbed growth conditions in E3 medium for zebrafish embryos. 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT GSM7734778 GSM7734778: WT sphere 4 hpf tRNA seq rep2; Danio rerio; ncRNA Seq GSM7734778 r1 GSM7734778 1 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP457111     WT_tRNA_sphere_2.fastq.gz fastq 196089572.0 2998867.0 GSM7734778 r1 0:65.39 A:39134451;C:53803100;G:53602781;T:49548779;N:461 65       39134451 53803100 53602781 49548779 461 SRX21486797 SRS18719094 SRA1700461 Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry Max Planck Institute of Biochemistry 1 0.28808   0.01959   0.91553   0.47742   78   B   usable mapping rate illumina nextseq 5prime size_fractionation unknown bulk unknown unknown   Germany 2023-08-28 Blastula Embryo Whole Organism All anatomical structures
25288 25288 SRR25764126 SRX21486796 SRS18719096 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT sphere 4 hpf tRNA seq rep1 GSM7734777   source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT|geo loc name:missing|collection date:missing WT sphere 4 hpf tRNA seq rep1 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts Blastula unperturbed growth conditions in E3 medium for zebrafish embryos. 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT GSM7734777 GSM7734777: WT sphere 4 hpf tRNA seq rep1; Danio rerio; ncRNA Seq GSM7734777 r1 GSM7734777 1 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP457111     WT_tRNA_sphere_1.fastq.gz fastq 273027894.0 4080366.0 GSM7734777 r1 0:66.91 A:54678043;C:74713512;G:74872888;T:68762883;N:568 66       54678043 74713512 74872888 68762883 568 SRX21486796 SRS18719096 SRA1700461 Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry Max Planck Institute of Biochemistry 1 0.30124   0.01877   0.9163   0.49987   79   B   usable mapping rate illumina nextseq 5prime size_fractionation unknown bulk unknown unknown   Germany 2023-08-28 Blastula Embryo Whole Organism All anatomical structures
25289 25289 SRR25764127 SRX21486795 SRS18719097 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT 1000 cell 3 hpf tRNA seq rep2 GSM7734776   source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:1000 cell 3 hpf|genotype:WT|geo loc name:missing|collection date:missing WT 1000 cell 3 hpf tRNA seq rep2 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts Blastula unperturbed growth conditions in E3 medium for zebrafish embryos. 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. strain:TLAB strain|tissue:Blastula|developmental stage:1000 cell 3 hpf|genotype:WT GSM7734776 GSM7734776: WT 1000 cell 3 hpf tRNA seq rep2; Danio rerio; ncRNA Seq GSM7734776 r1 GSM7734776 1 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP457111     WT_tRNA_1Kcell_2.fastq.gz fastq 240973473.0 3918764.0 GSM7734776 r1 0:61.49 A:48091658;C:66684510;G:65183534;T:61013184;N:587 61       48091658 66684510 65183534 61013184 587 SRX21486795 SRS18719097 SRA1700461 Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry Max Planck Institute of Biochemistry 1 0.26629   0.02297   0.92305   0.48525   79   B   usable mapping rate illumina nextseq 5prime size_fractionation unknown bulk unknown unknown   Germany 2023-08-28 Blastula Embryo Whole Organism All anatomical structures
25290 25290 SRR25764128 SRX21486794 SRS18719095 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT 1000 cell 3 hpf tRNA seq rep1 GSM7734775   source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:1000 cell 3 hpf|genotype:WT|geo loc name:missing|collection date:missing WT 1000 cell 3 hpf tRNA seq rep1 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts Blastula unperturbed growth conditions in E3 medium for zebrafish embryos. 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. strain:TLAB strain|tissue:Blastula|developmental stage:1000 cell 3 hpf|genotype:WT GSM7734775 GSM7734775: WT 1000 cell 3 hpf tRNA seq rep1; Danio rerio; ncRNA Seq GSM7734775 r1 GSM7734775 1 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP457111     WT_tRNA_1Kcell_1.fastq.gz fastq 153597915.0 2445091.0 GSM7734775 r1 0:62.82 A:30905842;C:42377268;G:41639937;T:38674503;N:365 62       30905842 42377268 41639937 38674503 365 SRX21486794 SRS18719095 SRA1700461 Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry Max Planck Institute of Biochemistry 1 0.27317   0.02516   0.92454   0.49385   77   B   usable mapping rate illumina nextseq 5prime size_fractionation unknown bulk unknown unknown   Germany 2023-08-28 Blastula Embryo Whole Organism All anatomical structures
25291 25291 SRR25764129 SRX21486793 SRS18719091 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT 256 cell 2.5 hpf tRNA seq rep2 GSM7734774   source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:256 cell 2.5 hpf|genotype:WT|geo loc name:missing|collection date:missing WT 256 cell 2.5 hpf tRNA seq rep2 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts Blastula unperturbed growth conditions in E3 medium for zebrafish embryos. 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. strain:TLAB strain|tissue:Blastula|developmental stage:256 cell 2.5 hpf|genotype:WT GSM7734774 GSM7734774: WT 256 cell 2.5 hpf tRNA seq rep2; Danio rerio; ncRNA Seq GSM7734774 r1 GSM7734774 1 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP457111     WT_tRNA_256cell_2.fastq.gz fastq 844659062.0 13660310.0 GSM7734774 r1 0:61.83 A:165996817;C:234451560;G:230230791;T:213977958;N:1936 61       165996817 234451560 230230791 213977958 1936 SRX21486793 SRS18719091 SRA1700461 Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry Max Planck Institute of Biochemistry 1 0.26001   0.01993   0.92594   0.45714   61   B   usable mapping rate illumina nextseq 5prime size_fractionation unknown bulk unknown unknown   Germany 2023-08-28 Blastula Embryo Whole Organism All anatomical structures
25292 25292 SRR25764130 SRX21486792 SRS18719088 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT 256 cell 2.5 hpf tRNA seq rep1 GSM7734773   source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:256 cell 2.5 hpf|genotype:WT|geo loc name:missing|collection date:missing WT 256 cell 2.5 hpf tRNA seq rep1 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts Blastula unperturbed growth conditions in E3 medium for zebrafish embryos. 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. strain:TLAB strain|tissue:Blastula|developmental stage:256 cell 2.5 hpf|genotype:WT GSM7734773 GSM7734773: WT 256 cell 2.5 hpf tRNA seq rep1; Danio rerio; ncRNA Seq GSM7734773 r1 GSM7734773 1 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP457111     WT_tRNA_256cell_1.fastq.gz fastq 215968508.0 3436266.0 GSM7734773 r1 0:62.85 A:43791388;C:59547637;G:58130851;T:54498124;N:508 62       43791388 59547637 58130851 54498124 508 SRX21486792 SRS18719088 SRA1700461 Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry Max Planck Institute of Biochemistry 1 0.27383   0.02205   0.92748   0.46217   71   B   usable mapping rate illumina nextseq 5prime size_fractionation unknown bulk unknown unknown   Germany 2023-08-28 Blastula Embryo Whole Organism All anatomical structures
25293 25293 SRR25764131 SRX21486791 SRS18719090 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT egg 0 hpf tRNA seq rep2 GSM7734772   source name:Unfertilized egg|strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT|geo loc name:missing|collection date:missing WT egg 0 hpf tRNA seq rep2 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts Unfertilized egg unperturbed growth conditions in E3 medium for zebrafish embryos. 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT GSM7734772 GSM7734772: WT egg 0 hpf tRNA seq rep2; Danio rerio; ncRNA Seq GSM7734772 r1 GSM7734772 1 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP457111     WT_tRNA_egg_2.fastq.gz fastq 206374994.0 3181706.0 GSM7734772 r1 0:64.86 A:41195250;C:56578032;G:56479855;T:52121365;N:492 64       41195250 56578032 56479855 52121365 492 SRX21486791 SRS18719090 SRA1700461 Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry Max Planck Institute of Biochemistry 1 0.28659   0.02017   0.9207   0.48536   78   B   usable mapping rate illumina nextseq 5prime size_fractionation unknown bulk unknown unknown   Germany 2023-08-28 Zygote Embryo Oocyte Reproductive System
25294 25294 SRR25764132 SRX21486790 SRS18719089 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT egg 0 hpf tRNA seq rep1 GSM7734771   source name:Unfertilized egg|strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT|geo loc name:missing|collection date:missing WT egg 0 hpf tRNA seq rep1 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts Unfertilized egg unperturbed growth conditions in E3 medium for zebrafish embryos. 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT GSM7734771 GSM7734771: WT egg 0 hpf tRNA seq rep1; Danio rerio; ncRNA Seq GSM7734771 r1 GSM7734771 1 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP457111     WT_tRNA_egg_1.fastq.gz fastq 86021968.0 1304769.0 GSM7734771 r1 0:65.93 A:17511521;C:23474625;G:23300759;T:21734864;N:199 65       17511521 23474625 23300759 21734864 199 SRX21486790 SRS18719089 SRA1700461 Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry Max Planck Institute of Biochemistry 1 0.29829   0.02027   0.92245   0.48877   74   B   usable mapping rate illumina nextseq 5prime size_fractionation unknown bulk unknown unknown   Germany 2023-08-28 Zygote Embryo Oocyte Reproductive System
28985 28985 SRR26936267 SRX22630108 SRS19628590 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   La 6 GSM7916507   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing La 6 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low2 GSM7916507 GSM7916507: La 6; Danio rerio; ncRNA Seq GSM7916507 r1 GSM7916507 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X32_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz fastq 810705967.0 27544418.0 GSM7916507 r1 0:29.43 A:141437993;C:173890211;G:258408531;T:236922660;N:46572 29       141437993 173890211 258408531 236922660 46572 SRX22630108 SRS19628590 SRA1756943 University of East Anglia University of East Anglia 1 0.86832   0.1884   0.84735   0.64657   21   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28986 28986 SRR26936231 SRX22630107 SRS19628589 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   La 5 GSM7916506   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing La 5 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low1 GSM7916506 GSM7916506: La 5; Danio rerio; ncRNA Seq GSM7916506 r1 GSM7916506 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X31_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz fastq 1237906972.0 45149037.0 GSM7916506 r1 0:27.42 A:273044213;C:252818121;G:368519115;T:343444331;N:81192 27       273044213 252818121 368519115 343444331 81192 SRX22630107 SRS19628589 SRA1756943 University of East Anglia University of East Anglia 1 0.86015   0.25463   0.83798   0.67166   25   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28987 28987 SRR26936232 SRX22630106 SRS19628588 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Hb 2 GSM7916505   tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing Hb 2 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High2 GSM7916505 GSM7916505: Hb 2; Danio rerio; ncRNA Seq GSM7916505 r1 GSM7916505 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X30_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz fastq 214730387.0 7217086.0 GSM7916505 r1 0:29.75 A:42819722;C:48080032;G:67677978;T:56140049;N:12606 29       42819722 48080032 67677978 56140049 12606 SRX22630106 SRS19628588 SRA1756943 University of East Anglia University of East Anglia 1 0.85212   0.1617   0.86856   0.69163   50   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28988 28988 SRR26936233 SRX22630105 SRS19628587 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Hb 1 GSM7916504   tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing Hb 1 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High2 GSM7916504 GSM7916504: Hb 1; Danio rerio; ncRNA Seq GSM7916504 r1 GSM7916504 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X29_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz fastq 595989272.0 21399963.0 GSM7916504 r1 0:27.85 A:128259525;C:125823294;G:181746588;T:160121380;N:38485 27       128259525 125823294 181746588 160121380 38485 SRX22630105 SRS19628587 SRA1756943 University of East Anglia University of East Anglia 1 0.85218   0.22941   0.83595   0.6151   30   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28989 28989 SRR26936234 SRX22630104 SRS19628586 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Lb 6 GSM7916503   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing Lb 6 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low2 GSM7916503 GSM7916503: Lb 6; Danio rerio; ncRNA Seq GSM7916503 r1 GSM7916503 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X28_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz fastq 969307398.0 35511411.0 GSM7916503 r1 0:27.30 A:205174189;C:203840471;G:285952255;T:274278193;N:62290 27       205174189 203840471 285952255 274278193 62290 SRX22630104 SRS19628586 SRA1756943 University of East Anglia University of East Anglia 1 0.85414   0.22608   0.8505   0.62202   33   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28990 28990 SRR26936235 SRX22630103 SRS19628585 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Ha 6 GSM7916502   tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing Ha 6 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High1 GSM7916502 GSM7916502: Ha 6; Danio rerio; ncRNA Seq GSM7916502 r1 GSM7916502 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X27_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz fastq 1326612630.0 47094729.0 GSM7916502 r1 0:28.17 A:303455697;C:273680466;G:382978796;T:366416311;N:81360 28       303455697 273680466 382978796 366416311 81360 SRX22630103 SRS19628585 SRA1756943 University of East Anglia University of East Anglia 1 0.84786   0.24696   0.82946   0.68975   37   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28991 28991 SRR26936236 SRX22630102 SRS19628584 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Ha 5 GSM7916501   tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing Ha 5 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High1 GSM7916501 GSM7916501: Ha 5; Danio rerio; ncRNA Seq GSM7916501 r1 GSM7916501 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X26_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz fastq 471823428.0 16704799.0 GSM7916501 r1 0:28.24 A:103178860;C:100561292;G:155557190;T:112495106;N:30980 28       103178860 100561292 155557190 112495106 30980 SRX22630102 SRS19628584 SRA1756943 University of East Anglia University of East Anglia 1 0.61628   0.14433   0.91275   0.6543   28   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28992 28992 SRR26936237 SRX22630101 SRS19628583 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   La 4 GSM7916500   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing La 4 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low1 GSM7916500 GSM7916500: La 4; Danio rerio; ncRNA Seq GSM7916500 r1 GSM7916500 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X25_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz fastq 713371286.0 25212566.0 GSM7916500 r1 0:28.29 A:155201946;C:151864186;G:207971547;T:198288220;N:45387 28       155201946 151864186 207971547 198288220 45387 SRX22630101 SRS19628583 SRA1756943 University of East Anglia University of East Anglia 1 0.8507   0.2078   0.83031   0.62739   22   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28993 28993 SRR26936238 SRX22630100 SRS19628582 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Hb 5 GSM7916499   tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing Hb 5 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High2 GSM7916499 GSM7916499: Hb 5; Danio rerio; ncRNA Seq GSM7916499 r1 GSM7916499 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X24_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz fastq 1043060550.0 35761504.0 GSM7916499 r1 0:29.17 A:217942105;C:216398395;G:316456102;T:292217159;N:46789 29       217942105 216398395 316456102 292217159 46789 SRX22630100 SRS19628582 SRA1756943 University of East Anglia University of East Anglia 1 0.82114   0.20881   0.85622   0.68486   19   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28994 28994 SRR26936239 SRX22630099 SRS19628581 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Hb 4 GSM7916498   tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing Hb 4 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High2 GSM7916498 GSM7916498: Hb 4; Danio rerio; ncRNA Seq GSM7916498 r1 GSM7916498 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X23_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz fastq 1357956641.0 47869361.0 GSM7916498 r1 0:28.37 A:293740473;C:276333777;G:404639503;T:383181225;N:61663 28       293740473 276333777 404639503 383181225 61663 SRX22630099 SRS19628581 SRA1756943 University of East Anglia University of East Anglia 1 0.79885   0.22306   0.8425   0.6656   26   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28995 28995 SRR26936240 SRX22630098 SRS19628580 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Lb 5 GSM7916497   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing Lb 5 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low2 GSM7916497 GSM7916497: Lb 5; Danio rerio; ncRNA Seq GSM7916497 r1 GSM7916497 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X22_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz fastq 669771811.0 23848259.0 GSM7916497 r1 0:28.08 A:132916986;C:135594797;G:198730347;T:202498953;N:30728 28       132916986 135594797 198730347 202498953 30728 SRX22630098 SRS19628580 SRA1756943 University of East Anglia University of East Anglia 1 0.80999   0.24188   0.84658   0.68339   20   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28996 28996 SRR26936241 SRX22630097 SRS19628579 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Ha 4 GSM7916496   tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing Ha 4 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High1 GSM7916496 GSM7916496: Ha 4; Danio rerio; ncRNA Seq GSM7916496 r1 GSM7916496 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X21_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz fastq 853803123.0 28538725.0 GSM7916496 r1 0:29.92 A:158220512;C:186146914;G:264519321;T:244878221;N:38155 29       158220512 186146914 264519321 244878221 38155 SRX22630097 SRS19628579 SRA1756943 University of East Anglia University of East Anglia 1 0.828   0.18458   0.85851   0.6483   32   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28997 28997 SRR26936242 SRX22630096 SRS19628578 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Ha 3 GSM7916495   tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing Ha 3 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High1 GSM7916495 GSM7916495: Ha 3; Danio rerio; ncRNA Seq GSM7916495 r1 GSM7916495 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X20_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz fastq 629106097.0 21383957.0 GSM7916495 r1 0:29.42 A:117216944;C:131994022;G:192623524;T:187243523;N:28084 29       117216944 131994022 192623524 187243523 28084 SRX22630096 SRS19628578 SRA1756943 University of East Anglia University of East Anglia 1 0.8166   0.20457   0.84112   0.65357   22   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28998 28998 SRR26936243 SRX22630095 SRS19628577 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   La 1 GSM7916494   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing La 1 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low1 GSM7916494 GSM7916494: La 1; Danio rerio; ncRNA Seq GSM7916494 r1 GSM7916494 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X19_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz fastq 21178378.0 739280.0 GSM7916494 r1 0:28.65 A:4323144;C:4478932;G:6303136;T:6072190;N:976 28       4323144 4478932 6303136 6072190 976 SRX22630095 SRS19628577 SRA1756943 University of East Anglia University of East Anglia 1 0.85277   0.21158   0.87434   0.62601   26   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28999 28999 SRR26936244 SRX22630094 SRS19628576 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Lb 4 GSM7916493   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing Lb 4 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low2 GSM7916493 GSM7916493: Lb 4; Danio rerio; ncRNA Seq GSM7916493 r1 GSM7916493 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X18_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz fastq 959247745.0 33043430.0 GSM7916493 r1 0:29.03 A:225208425;C:212535680;G:284062577;T:237397072;N:43991 29       225208425 212535680 284062577 237397072 43991 SRX22630094 SRS19628576 SRA1756943 University of East Anglia University of East Anglia 1 0.82232   0.22592   0.87073   0.6135   22   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29000 29000 SRR26936245 SRX22630093 SRS19628575 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Lb 3 GSM7916492   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing Lb 3 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low1 GSM7916492 GSM7916492: Lb 3; Danio rerio; ncRNA Seq GSM7916492 r1 GSM7916492 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X17_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz fastq 900287704.0 31947371.0 GSM7916492 r1 0:28.18 A:224093089;C:188919051;G:262824615;T:224407166;N:43783 28       224093089 188919051 262824615 224407166 43783 SRX22630093 SRS19628575 SRA1756943 University of East Anglia University of East Anglia 1 0.67003   0.17024   0.87095   0.6869   19   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29001 29001 SRR26936246 SRX22630092 SRS19628574 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Hb 3 GSM7916491   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing Hb 3 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low2 GSM7916491 GSM7916491: Hb 3; Danio rerio; ncRNA Seq GSM7916491 r1 GSM7916491 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X16_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz fastq 80986783.0 3427704.0 GSM7916491 r1 0:23.63 A:18164838;C:19014879;G:24153410;T:19641723;N:11933 23       18164838 19014879 24153410 19641723 11933 SRX22630092 SRS19628574 SRA1756943 University of East Anglia University of East Anglia 1 0.83312   0.24402   0.88749   0.63345   50   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29002 29002 SRR26936247 SRX22630091 SRS19628573 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   La 3 GSM7916490   tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing La 3 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High2 GSM7916490 GSM7916490: La 3; Danio rerio; ncRNA Seq GSM7916490 r1 GSM7916490 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X15_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz fastq 148933985.0 6314805.0 GSM7916490 r1 0:23.58 A:39058546;C:30363738;G:44242466;T:35240575;N:28660 23       39058546 30363738 44242466 35240575 28660 SRX22630091 SRS19628573 SRA1756943 University of East Anglia University of East Anglia 1 0.41302   0.13369   0.89802   0.57553   22   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29003 29003 SRR26936248 SRX22630090 SRS19628572 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   La 2 GSM7916489   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing La 2 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low1 GSM7916489 GSM7916489: La 2; Danio rerio; ncRNA Seq GSM7916489 r1 GSM7916489 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X14_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz fastq 538382421.0 23079847.0 GSM7916489 r1 0:23.33 A:119659971;C:112896468;G:162693210;T:143063074;N:69698 23       119659971 112896468 162693210 143063074 69698 SRX22630090 SRS19628572 SRA1756943 University of East Anglia University of East Anglia 1 0.81532   0.23945   0.8758   0.62425   50   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29004 29004 SRR26936249 SRX22630089 SRS19628571 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Ha 1 GSM7916488   tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing Ha 1 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High1 GSM7916488 GSM7916488: Ha 1; Danio rerio; ncRNA Seq GSM7916488 r1 GSM7916488 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X13_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz fastq 761541737.0 32310434.0 GSM7916488 r1 0:23.57 A:182485471;C:173949932;G:214306916;T:190683160;N:116258 23       182485471 173949932 214306916 190683160 116258 SRX22630089 SRS19628571 SRA1756943 University of East Anglia University of East Anglia 1 0.82936   0.23022   0.85098   0.59571   19   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29005 29005 SRR26936250 SRX22630088 SRS19628570 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Lb 2 GSM7916487   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing Lb 2 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low2 GSM7916487 GSM7916487: Lb 2; Danio rerio; ncRNA Seq GSM7916487 r1 GSM7916487 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X12_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz fastq 559417322.0 23757934.0 GSM7916487 r1 0:23.55 A:126286771;C:106333997;G:170445137;T:156287131;N:64286 23       126286771 106333997 170445137 156287131 64286 SRX22630088 SRS19628570 SRA1756943 University of East Anglia University of East Anglia 1 0.85098   0.26224   0.8608   0.59344   22   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29006 29006 SRR26936251 SRX22630087 SRS19628569 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Lb 1 GSM7916486   tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing Lb 1 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High2 GSM7916486 GSM7916486: Lb 1; Danio rerio; ncRNA Seq GSM7916486 r1 GSM7916486 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X11_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz fastq 498695572.0 21269833.0 GSM7916486 r1 0:23.45 A:122716879;C:84997892;G:144626268;T:146292630;N:61903 23       122716879 84997892 144626268 146292630 61903 SRX22630087 SRS19628569 SRA1756943 University of East Anglia University of East Anglia 1 0.84251   0.1958   0.8591   0.61008   24   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29007 29007 SRR26936252 SRX22630086 SRS19628568 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Hb 10 GSM7916485   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing Hb 10 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low1 GSM7916485 GSM7916485: Hb 10; Danio rerio; ncRNA Seq GSM7916485 r1 GSM7916485 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X10_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz fastq 686865211.0 29320389.0 GSM7916485 r1 0:23.43 A:156131568;C:132162427;G:201526230;T:196961742;N:83244 23       156131568 132162427 201526230 196961742 83244 SRX22630086 SRS19628568 SRA1756943 University of East Anglia University of East Anglia 1 0.85707   0.27856   0.85648   0.59717   28   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29008 29008 SRR26936253 SRX22630085 SRS19628567 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   La 9 GSM7916484   tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing La 9 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High1 GSM7916484 GSM7916484: La 9; Danio rerio; ncRNA Seq GSM7916484 r1 GSM7916484 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X9_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz fastq 561289514.0 23860643.0 GSM7916484 r1 0:23.52 A:140848879;C:98838555;G:161520871;T:160013845;N:67364 23       140848879 98838555 161520871 160013845 67364 SRX22630085 SRS19628567 SRA1756943 University of East Anglia University of East Anglia 1 0.85507   0.17768   0.86969   0.64792   22   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29009 29009 SRR26936254 SRX22630084 SRS19628566 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   La 8 GSM7916483   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing La 8 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low2 GSM7916483 GSM7916483: La 8; Danio rerio; ncRNA Seq GSM7916483 r1 GSM7916483 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X8_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz fastq 458491681.0 16224249.0 GSM7916483 r1 0:28.26 A:99631677;C:90884289;G:139467457;T:128470855;N:37403 28       99631677 90884289 139467457 128470855 37403 SRX22630084 SRS19628566 SRA1756943 University of East Anglia University of East Anglia 1 0.81704   0.21909   0.84762   0.6293   50   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29010 29010 SRR26936255 SRX22630083 SRS19628565 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Ha 9 GSM7916482   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing Ha 9 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low1 GSM7916482 GSM7916482: Ha 9; Danio rerio; ncRNA Seq GSM7916482 r1 GSM7916482 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X7_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz fastq 574511047.0 20295283.0 GSM7916482 r1 0:28.31 A:134481373;C:122719422;G:169313406;T:147944946;N:51900 28       134481373 122719422 169313406 147944946 51900 SRX22630083 SRS19628565 SRA1756943 University of East Anglia University of East Anglia 1 0.81932   0.19984   0.85987   0.58268   23   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29011 29011 SRR26936256 SRX22630082 SRS19628564 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Lb 8 GSM7916481   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing Lb 8 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low2 GSM7916481 GSM7916481: Lb 8; Danio rerio; ncRNA Seq GSM7916481 r1 GSM7916481 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X6_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz fastq 1086899780.0 37486748.0 GSM7916481 r1 0:28.99 A:219996636;C:232899819;G:335644980;T:298269921;N:88424 28       219996636 232899819 335644980 298269921 88424 SRX22630082 SRS19628564 SRA1756943 University of East Anglia University of East Anglia 1 0.86943   0.2105   0.84461   0.67703   44   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29012 29012 SRR26936257 SRX22630081 SRS19628563 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Hb 9 GSM7916480   tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing Hb 9 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High2 GSM7916480 GSM7916480: Hb 9; Danio rerio; ncRNA Seq GSM7916480 r1 GSM7916480 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X5_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz fastq 1144093618.0 39048750.0 GSM7916480 r1 0:29.30 A:223769668;C:238953593;G:358148504;T:323130325;N:91528 29       223769668 238953593 358148504 323130325 91528 SRX22630081 SRS19628563 SRA1756943 University of East Anglia University of East Anglia 1 0.87445   0.1906   0.87237   0.70919   50   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29013 29013 SRR26936258 SRX22630080 SRS19628562 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Hb 7 GSM7916515   tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing Hb 7 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High2 GSM7916515 GSM7916515: Hb 7; Danio rerio; ncRNA Seq GSM7916515 r1 GSM7916515 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X40_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz fastq 263782568.0 9802454.0 GSM7916515 r1 0:26.91 A:59378855;C:53589034;G:83219251;T:67574216;N:21212 26       59378855 53589034 83219251 67574216 21212 SRX22630080 SRS19628562 SRA1756943 University of East Anglia University of East Anglia 1 0.80146   0.31524   0.81008   0.47305   30   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29014 29014 SRR26936260 SRX22630079 SRS19628561 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Ha 8 GSM7916514   tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing Ha 8 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High1 GSM7916514 GSM7916514: Ha 8; Danio rerio; ncRNA Seq GSM7916514 r1 GSM7916514 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X39_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz fastq 252119227.0 9309447.0 GSM7916514 r1 0:27.08 A:53293803;C:51577689;G:79148986;T:68078043;N:20706 27       53293803 51577689 79148986 68078043 20706 SRX22630079 SRS19628561 SRA1756943 University of East Anglia University of East Anglia 1 0.75593   0.29042   0.83412   0.59657   21   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29015 29015 SRR26936261 SRX22630078 SRS19628560 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Hb 6 GSM7916513   tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing Hb 6 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High2 GSM7916513 GSM7916513: Hb 6; Danio rerio; ncRNA Seq GSM7916513 r1 GSM7916513 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X38_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz fastq 516408240.0 19719085.0 GSM7916513 r1 0:26.19 A:112791146;C:102652986;G:160354602;T:140566375;N:43131 26       112791146 102652986 160354602 140566375 43131 SRX22630078 SRS19628560 SRA1756943 University of East Anglia University of East Anglia 1 0.80401   0.31982   0.83765   0.57755   22   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29016 29016 SRR26936262 SRX22630077 SRS19628559 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Ha 7 GSM7916512   tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing Ha 7 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High1 GSM7916512 GSM7916512: Ha 7; Danio rerio; ncRNA Seq GSM7916512 r1 GSM7916512 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X37_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz fastq 554171558.0 20779285.0 GSM7916512 r1 0:26.67 A:125256371;C:111354628;G:172197000;T:145317427;N:46132 26       125256371 111354628 172197000 145317427 46132 SRX22630077 SRS19628559 SRA1756943 University of East Anglia University of East Anglia 1 0.81035   0.28326   0.82933   0.62525   35   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29017 29017 SRR26936263 SRX22630076 SRS19628558 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Lb 10 GSM7916511   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing Lb 10 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low2 GSM7916511 GSM7916511: Lb 10; Danio rerio; ncRNA Seq GSM7916511 r1 GSM7916511 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X36_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz fastq 983846643.0 32513493.0 GSM7916511 r1 0:30.26 A:181840038;C:211101778;G:320659770;T:270174775;N:70282 30       181840038 211101778 320659770 270174775 70282 SRX22630076 SRS19628558 SRA1756943 University of East Anglia University of East Anglia 1 0.88133   0.15829   0.86324   0.67761   37   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29018 29018 SRR26936264 SRX22630075 SRS19628557 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Lb 9 GSM7916510   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing Lb 9 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low2 GSM7916510 GSM7916510: Lb 9; Danio rerio; ncRNA Seq GSM7916510 r1 GSM7916510 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X35_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz fastq 1077131964.0 37869598.0 GSM7916510 r1 0:28.44 A:210508796;C:220304812;G:327237157;T:319001223;N:79976 28       210508796 220304812 327237157 319001223 79976 SRX22630075 SRS19628557 SRA1756943 University of East Anglia University of East Anglia 1 0.84871   0.22867   0.83968   0.66027   35   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29019 29019 SRR26936265 SRX22630074 SRS19628556 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Lb 7 GSM7916509   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing Lb 7 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low1 GSM7916509 GSM7916509: Lb 7; Danio rerio; ncRNA Seq GSM7916509 r1 GSM7916509 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X34_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz fastq 1203153474.0 42565421.0 GSM7916509 r1 0:28.27 A:269760359;C:263088083;G:348288367;T:321910116;N:106549 28       269760359 263088083 348288367 321910116 106549 SRX22630074 SRS19628556 SRA1756943 University of East Anglia University of East Anglia 1 0.82319   0.21661   0.82432   0.65954   33   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29020 29020 SRR26936266 SRX22630073 SRS19628555 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   La 7 GSM7916508   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing La 7 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low1 GSM7916508 GSM7916508: La 7; Danio rerio; ncRNA Seq GSM7916508 r1 GSM7916508 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X33_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz fastq 1137464666.0 42434385.0 GSM7916508 r1 0:26.81 A:240256314;C:218420241;G:336730784;T:341968066;N:89261 26       240256314 218420241 336730784 341968066 89261 SRX22630073 SRS19628555 SRA1756943 University of East Anglia University of East Anglia 1 0.84647   0.26357   0.85313   0.67665   22   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29021 29021 SRR26936259 SRX22630072 SRS19628554 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Hb 8 GSM7916479   tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing Hb 8 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High2 GSM7916479 GSM7916479: Hb 8; Danio rerio; ncRNA Seq GSM7916479 r1 GSM7916479 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X4_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz fastq 1014850001.0 36540733.0 GSM7916479 r1 0:27.77 A:205870762;C:199482442;G:294628769;T:314783528;N:84500 27       205870762 199482442 294628769 314783528 84500 SRX22630072 SRS19628554 SRA1756943 University of East Anglia University of East Anglia 1 0.84303   0.28884   0.81692   0.66059   26   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29022 29022 SRR26936268 SRX22630071 SRS19628553 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   La 10 GSM7916478   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing La 10 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low1 GSM7916478 GSM7916478: La 10; Danio rerio; ncRNA Seq GSM7916478 r1 GSM7916478 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X3_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz fastq 916186556.0 32659639.0 GSM7916478 r1 0:28.05 A:216314501;C:191651870;G:267047552;T:241092719;N:79914 28       216314501 191651870 267047552 241092719 79914 SRX22630071 SRS19628553 SRA1756943 University of East Anglia University of East Anglia 1 0.84312   0.23836   0.83132   0.57754   33   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29023 29023 SRR26936269 SRX22630070 SRS19628552 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Ha 10 GSM7916477   tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing Ha 10 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High1 GSM7916477 GSM7916477: Ha 10; Danio rerio; ncRNA Seq GSM7916477 r1 GSM7916477 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X2_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz fastq 858990742.0 30463457.0 GSM7916477 r1 0:28.20 A:182799146;C:179417249;G:265490509;T:231201694;N:82144 28       182799146 179417249 265490509 231201694 82144 SRX22630070 SRS19628552 SRA1756943 University of East Anglia University of East Anglia 1 0.67221   0.19137   0.87986   0.67831   33   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29024 29024 SRR26936270 SRX22630069 SRS19628551 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Ha 2 GSM7916476   tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing Ha 2 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High1 GSM7916476 GSM7916476: Ha 2; Danio rerio; ncRNA Seq GSM7916476 r1 GSM7916476 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X1_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz fastq 262855265.0 9317037.0 GSM7916476 r1 0:28.21 A:59555006;C:56655912;G:79385169;T:67236972;N:22206 28       59555006 56655912 79385169 67236972 22206 SRX22630069 SRS19628551 SRA1756943 University of East Anglia University of East Anglia 1 0.85088   0.21543   0.84102   0.63415   28   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
36266 36266 SRR953577 SRX336218 SRS471213 SRP028895 PRJNA138095 Transcriptome wide analysis of small RNA expression in early zebrafish development GSE27722 Transcriptome Analysis During early vertebrate development a large number of noncoding RNAs are maternally inherited or expressed upon activation of zygotic transcription. The exact identity expression levels and function during early vertebrate development for most of these noncoding RNAs remains largely unknown. miRNAs microRNAs and piRNAs piwi interacting RNAs are two classes of small non coding RNAs that play important roles in gene regulation during early embryonic development. Here we utilized Illumina next generation sequencing technology to determine temporal expression patterns for both miRNAs and piRNAs during four distinct stages of early vertebrate development using zebrafish as a model system. For miRNAs the expression patterns for 192 known miRNAs and 12 novel miRNAs within 123 different miRNA families were determined. Significant sequence variation was observed at the five prime' and three prime' ends of miRNAs with a large number of extra nucleotides added in a non template directed manner. We also identified a large and diverse set of piRNAs expressed during early development far beyond that expected if piRNA expression is restricted to germ cells. Our analyses represent the deepest investigation to date of small RNA expression during early vertebrate development and suggest important novel functions for small RNAs during embryogenesis. Overall design: Identify the expression of small RNAs in zebrafish embryos of four different developmental stages using high through put sequencing   pubmed:22408181   embryo 1dpf rep1 GSM686385   source name:the whole embryo|strain:AB*WT|developmental stage:1dpf|tissue:the whole embryos embryo 1dpf rep1 fasta: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. All the sequence with N inside was removed as well. The unique sequences were retained with the counts indicating thier abundance. The header of each sequence is composed of a unique sequence ID followed by a " x" and the reads counts. e.g. unique ID x counts. alignment: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. Small RNAs with perfect matches to the zebrafish genome Zv8 from Ensembl http://www.ensembl.org were retrieved using megaBLAST http://www.ncbi.nlm.nih.gov/blast/megablast.shtml and Bowtie http://bowtie bio.sourceforge.net/tutorial.shtml. To identify piRNAs consensus sequences from zebrafish repetitive elements were retrieved from Repbase http://www.girinst.org/repbase/index.html and Repeat Maskers using the UCSC genome browser http://genome.ucsc.edu. Small RNAs perfectly mapping to these consensus sequences and their genomic flanking regions were sorted into piRNA libraries with up to 3 genomic mapping positions for each unique RNA sequence. fasta files description: small RNA 15 30 nt alignment file description: piRNA map to repetitive elements the whole embryo   Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. Embryos were raised at 28°C in egg water 0.03% Instant Ocean marine salt mix for the initial several hours of development strain:AB*WT|developmental stage:1dpf|tissue:the whole embryos GSM686385 GSM686385: embryo 1dpf rep1; Danio rerio; ncRNA Seq GSM686385   1 Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. GEO Accession:GSM686385 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer II   SRP028895     GSM686385_1dpf_Raw.txt fastq 293700240.0 8158340.0 GSM686385 r1 0:36 A:74642033;C:62153879;G:83836688;T:69542606;N:3525034 36       74642033 62153879 83836688 69542606 3525034 SRX336218 SRS471213 SRA098146 GEO Lee Lab, Molecular Biology, Mass General Hospital 1 0.00386   0.00274   0.99758   0.53623   36   T   under 1.2% mapping rate illumina early_illumina 5prime size_fractionation unknown bulk unknown unknown   United States 2011-03-07 Pharyngula Embryo Whole Organism All anatomical structures
36267 36267 SRR953576 SRX336217 SRS471211 SRP028895 PRJNA138095 Transcriptome wide analysis of small RNA expression in early zebrafish development GSE27722 Transcriptome Analysis During early vertebrate development a large number of noncoding RNAs are maternally inherited or expressed upon activation of zygotic transcription. The exact identity expression levels and function during early vertebrate development for most of these noncoding RNAs remains largely unknown. miRNAs microRNAs and piRNAs piwi interacting RNAs are two classes of small non coding RNAs that play important roles in gene regulation during early embryonic development. Here we utilized Illumina next generation sequencing technology to determine temporal expression patterns for both miRNAs and piRNAs during four distinct stages of early vertebrate development using zebrafish as a model system. For miRNAs the expression patterns for 192 known miRNAs and 12 novel miRNAs within 123 different miRNA families were determined. Significant sequence variation was observed at the five prime' and three prime' ends of miRNAs with a large number of extra nucleotides added in a non template directed manner. We also identified a large and diverse set of piRNAs expressed during early development far beyond that expected if piRNA expression is restricted to germ cells. Our analyses represent the deepest investigation to date of small RNA expression during early vertebrate development and suggest important novel functions for small RNAs during embryogenesis. Overall design: Identify the expression of small RNAs in zebrafish embryos of four different developmental stages using high through put sequencing   pubmed:22408181   embryo Shield rep1 GSM686384   source name:the whole embryo|strain:AB*WT|developmental stage:Shield|tissue:the whole embryos embryo Shield rep1 fasta: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. All the sequence with N inside was removed as well. The unique sequences were retained with the counts indicating thier abundance. The header of each sequence is composed of a unique sequence ID followed by a " x" and the reads counts. e.g. unique ID x counts. alignment: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. Small RNAs with perfect matches to the zebrafish genome Zv8 from Ensembl http://www.ensembl.org were retrieved using megaBLAST http://www.ncbi.nlm.nih.gov/blast/megablast.shtml and Bowtie http://bowtie bio.sourceforge.net/tutorial.shtml. To identify piRNAs consensus sequences from zebrafish repetitive elements were retrieved from Repbase http://www.girinst.org/repbase/index.html and Repeat Maskers using the UCSC genome browser http://genome.ucsc.edu. Small RNAs perfectly mapping to these consensus sequences and their genomic flanking regions were sorted into piRNA libraries with up to 3 genomic mapping positions for each unique RNA sequence. fasta files description: small RNA 15 30 nt alignment file description: piRNA map to repetitive elements the whole embryo   Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. Embryos were raised at 28°C in egg water 0.03% Instant Ocean marine salt mix for the initial several hours of development strain:AB*WT|developmental stage:Shield|tissue:the whole embryos GSM686384 GSM686384: embryo Shield rep1; Danio rerio; ncRNA Seq GSM686384   1 Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. GEO Accession:GSM686384 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer II   SRP028895     GSM686384_Shield_Raw.txt fastq 115067916.0 3196331.0 GSM686384 r1 0:36 A:28435718;C:21893278;G:31779352;T:26635839;N:6323729 36       28435718 21893278 31779352 26635839 6323729 SRX336217 SRS471211 SRA098146 GEO Lee Lab, Molecular Biology, Mass General Hospital 1 0.00278   0.00217   0.99933   0.60606   36   T   under 1.2% mapping rate illumina early_illumina 5prime size_fractionation unknown bulk unknown unknown   United States 2011-03-07 Gastrula Embryo Whole Organism All anatomical structures
36268 36268 SRR953575 SRX336216 SRS471212 SRP028895 PRJNA138095 Transcriptome wide analysis of small RNA expression in early zebrafish development GSE27722 Transcriptome Analysis During early vertebrate development a large number of noncoding RNAs are maternally inherited or expressed upon activation of zygotic transcription. The exact identity expression levels and function during early vertebrate development for most of these noncoding RNAs remains largely unknown. miRNAs microRNAs and piRNAs piwi interacting RNAs are two classes of small non coding RNAs that play important roles in gene regulation during early embryonic development. Here we utilized Illumina next generation sequencing technology to determine temporal expression patterns for both miRNAs and piRNAs during four distinct stages of early vertebrate development using zebrafish as a model system. For miRNAs the expression patterns for 192 known miRNAs and 12 novel miRNAs within 123 different miRNA families were determined. Significant sequence variation was observed at the five prime' and three prime' ends of miRNAs with a large number of extra nucleotides added in a non template directed manner. We also identified a large and diverse set of piRNAs expressed during early development far beyond that expected if piRNA expression is restricted to germ cells. Our analyses represent the deepest investigation to date of small RNA expression during early vertebrate development and suggest important novel functions for small RNAs during embryogenesis. Overall design: Identify the expression of small RNAs in zebrafish embryos of four different developmental stages using high through put sequencing   pubmed:22408181   embryo sphere rep2 GSM686383   source name:the whole embryo|strain:AB*WT|developmental stage:sphere|tissue:the whole embryos embryo sphere rep2 fasta: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. All the sequence with N inside was removed as well. The unique sequences were retained with the counts indicating thier abundance. The header of each sequence is composed of a unique sequence ID followed by a " x" and the reads counts. e.g. unique ID x counts. alignment: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. Small RNAs with perfect matches to the zebrafish genome Zv8 from Ensembl http://www.ensembl.org were retrieved using megaBLAST http://www.ncbi.nlm.nih.gov/blast/megablast.shtml and Bowtie http://bowtie bio.sourceforge.net/tutorial.shtml. To identify piRNAs consensus sequences from zebrafish repetitive elements were retrieved from Repbase http://www.girinst.org/repbase/index.html and Repeat Maskers using the UCSC genome browser http://genome.ucsc.edu. Small RNAs perfectly mapping to these consensus sequences and their genomic flanking regions were sorted into piRNA libraries with up to 3 genomic mapping positions for each unique RNA sequence. fasta files description: small RNA 15 30 nt alignment file description: piRNA map to repetitive elements the whole embryo   Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. Embryos were raised at 28°C in egg water 0.03% Instant Ocean marine salt mix for the initial several hours of development strain:AB*WT|developmental stage:sphere|tissue:the whole embryos GSM686383 GSM686383: embryo sphere rep2; Danio rerio; ncRNA Seq GSM686383   1 Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. GEO Accession:GSM686383 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer II   SRP028895     GSM686383_Sphere_2_Raw.txt fastq 369741456.0 10270596.0 GSM686383 r1 0:36 A:89854472;C:70044086;G:109552597;T:100266590;N:23711 36       89854472 70044086 109552597 100266590 23711 SRX336216 SRS471212 SRA098146 GEO Lee Lab, Molecular Biology, Mass General Hospital 1 0.00421   0.00367   0.99924   0.51111   36   T   under 1.2% mapping rate illumina early_illumina 5prime size_fractionation unknown bulk unknown unknown   United States 2011-03-07 Blastula Embryo Whole Organism All anatomical structures
36269 36269 SRR953574 SRX336215 SRS471209 SRP028895 PRJNA138095 Transcriptome wide analysis of small RNA expression in early zebrafish development GSE27722 Transcriptome Analysis During early vertebrate development a large number of noncoding RNAs are maternally inherited or expressed upon activation of zygotic transcription. The exact identity expression levels and function during early vertebrate development for most of these noncoding RNAs remains largely unknown. miRNAs microRNAs and piRNAs piwi interacting RNAs are two classes of small non coding RNAs that play important roles in gene regulation during early embryonic development. Here we utilized Illumina next generation sequencing technology to determine temporal expression patterns for both miRNAs and piRNAs during four distinct stages of early vertebrate development using zebrafish as a model system. For miRNAs the expression patterns for 192 known miRNAs and 12 novel miRNAs within 123 different miRNA families were determined. Significant sequence variation was observed at the five prime' and three prime' ends of miRNAs with a large number of extra nucleotides added in a non template directed manner. We also identified a large and diverse set of piRNAs expressed during early development far beyond that expected if piRNA expression is restricted to germ cells. Our analyses represent the deepest investigation to date of small RNA expression during early vertebrate development and suggest important novel functions for small RNAs during embryogenesis. Overall design: Identify the expression of small RNAs in zebrafish embryos of four different developmental stages using high through put sequencing   pubmed:22408181   embryo sphere rep1 GSM686382   source name:the whole embryo|strain:AB*WT|developmental stage:sphere|tissue:the whole embryos embryo sphere rep1 fasta: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. All the sequence with N inside was removed as well. The unique sequences were retained with the counts indicating thier abundance. The header of each sequence is composed of a unique sequence ID followed by a " x" and the reads counts. e.g. unique ID x counts. alignment: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. Small RNAs with perfect matches to the zebrafish genome Zv8 from Ensembl http://www.ensembl.org were retrieved using megaBLAST http://www.ncbi.nlm.nih.gov/blast/megablast.shtml and Bowtie http://bowtie bio.sourceforge.net/tutorial.shtml. To identify piRNAs consensus sequences from zebrafish repetitive elements were retrieved from Repbase http://www.girinst.org/repbase/index.html and Repeat Maskers using the UCSC genome browser http://genome.ucsc.edu. Small RNAs perfectly mapping to these consensus sequences and their genomic flanking regions were sorted into piRNA libraries with up to 3 genomic mapping positions for each unique RNA sequence. fasta files description: small RNA 15 30 nt alignment file description: piRNA map to repetitive elements the whole embryo   Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. Embryos were raised at 28°C in egg water 0.03% Instant Ocean marine salt mix for the initial several hours of development strain:AB*WT|developmental stage:sphere|tissue:the whole embryos GSM686382 GSM686382: embryo sphere rep1; Danio rerio; ncRNA Seq GSM686382   1 Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. GEO Accession:GSM686382 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer II   SRP028895     GSM686382_Sphere_1_Raw.txt fastq 492502284.0 13680619.0 GSM686382 r1 0:36 A:114418890;C:99502519;G:142841794;T:135061742;N:677339 36       114418890 99502519 142841794 135061742 677339 SRX336215 SRS471209 SRA098146 GEO Lee Lab, Molecular Biology, Mass General Hospital 1 0.00828   0.00636   0.9964   0.54822   36   T   under 1.2% mapping rate illumina early_illumina 5prime size_fractionation unknown bulk unknown unknown   United States 2011-03-07 Blastula Embryo Whole Organism All anatomical structures
36270 36270 SRR953573 SRX336214 SRS471210 SRP028895 PRJNA138095 Transcriptome wide analysis of small RNA expression in early zebrafish development GSE27722 Transcriptome Analysis During early vertebrate development a large number of noncoding RNAs are maternally inherited or expressed upon activation of zygotic transcription. The exact identity expression levels and function during early vertebrate development for most of these noncoding RNAs remains largely unknown. miRNAs microRNAs and piRNAs piwi interacting RNAs are two classes of small non coding RNAs that play important roles in gene regulation during early embryonic development. Here we utilized Illumina next generation sequencing technology to determine temporal expression patterns for both miRNAs and piRNAs during four distinct stages of early vertebrate development using zebrafish as a model system. For miRNAs the expression patterns for 192 known miRNAs and 12 novel miRNAs within 123 different miRNA families were determined. Significant sequence variation was observed at the five prime' and three prime' ends of miRNAs with a large number of extra nucleotides added in a non template directed manner. We also identified a large and diverse set of piRNAs expressed during early development far beyond that expected if piRNA expression is restricted to germ cells. Our analyses represent the deepest investigation to date of small RNA expression during early vertebrate development and suggest important novel functions for small RNAs during embryogenesis. Overall design: Identify the expression of small RNAs in zebrafish embryos of four different developmental stages using high through put sequencing   pubmed:22408181   embryo 256 cell rep1 GSM686381   source name:the whole embryo|strain:AB* WT|developmental stage:256 cell|tissue:the whole embryos embryo 256 cell rep1 fasta: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. All the sequence with N inside was removed as well. The unique sequences were retained with the counts indicating thier abundance. The header of each sequence is composed of a unique sequence ID followed by a " x" and the reads counts. e.g. unique ID x counts. alignment: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. Small RNAs with perfect matches to the zebrafish genome Zv8 from Ensembl http://www.ensembl.org were retrieved using megaBLAST http://www.ncbi.nlm.nih.gov/blast/megablast.shtml and Bowtie http://bowtie bio.sourceforge.net/tutorial.shtml. To identify piRNAs consensus sequences from zebrafish repetitive elements were retrieved from Repbase http://www.girinst.org/repbase/index.html and Repeat Maskers using the UCSC genome browser http://genome.ucsc.edu. Small RNAs perfectly mapping to these consensus sequences and their genomic flanking regions were sorted into piRNA libraries with up to 3 genomic mapping positions for each unique RNA sequence. fasta files description: small RNA 15 30 nt alignment file description: piRNA map to repetitive elements the whole embryo   Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. Embryos were raised at 28°C in egg water 0.03% Instant Ocean marine salt mix for the initial several hours of development strain:AB* WT|developmental stage:256 cell|tissue:the whole embryos GSM686381 GSM686381: embryo 256 cell rep1; Danio rerio; ncRNA Seq GSM686381   1 Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. GEO Accession:GSM686381 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer II   SRP028895     GSM686381_256-cell_Raw.txt fastq 177430716.0 4928631.0 GSM686381 r1 0:36 A:46047586;C:39494059;G:46591098;T:42305117;N:2992856 36       46047586 39494059 46591098 42305117 2992856 SRX336214 SRS471210 SRA098146 GEO Lee Lab, Molecular Biology, Mass General Hospital 1 0.01914   0.01515   0.99164   0.52579   36   B   usable mapping rate illumina early_illumina 5prime size_fractionation unknown bulk unknown unknown   United States 2011-03-07 Blastula Embryo Whole Organism All anatomical structures
37985 37985 SRR1216351 SRX510531 SRS588958 SRP040940 PRJNA243510 Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish GSE56498 Transcriptome Analysis ATF6 is a key regulator of the unfolded protein response. Through use of zebrafish and cultured cells we demonstrate that ATF6 drives fatty liver disease by interaction with fatty acid synthase FASN. Overall design: Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. parent bioproject:PRJNA541472 pubmed:24874946   nls Cherry Ethanol #2 GSM1362715   tissue:Zebrafish 5 dpf liver|tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf nls Cherry Ethanol #2 Illumina CASAVA version 1.7 used for basecalling ? Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes reads and their frequencies. Zebrafish 5 dpf liver   Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.   tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf GSM1362715 GSM1362715: nls Cherry Ethanol #2; Danio rerio; ncRNA Seq GSM1362715   1 Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. GEO Accession:GSM1362715 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer IIx   SRP040940     Cherry2-ethanol_raw.txt.gz fastq 2547597500.0 25475975.0 GSM1362715 r1 0:100 A:667878423;C:617022069;G:603019059;T:656604341;N:3073608 100       667878423 617022069 603019059 656604341 3073608 SRX510531 SRS588958 SRA156310 GEO sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai 1 0.903   0.06203   0.78173   0.47105   100   B   usable mapping rate illumina early_illumina unknown size_fractionation unknown bulk unknown unknown   United States 2014-04-03 Larval Larval Liver Liver and Biliary System
37986 37986 SRR1216350 SRX510530 SRS588959 SRP040940 PRJNA243510 Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish GSE56498 Transcriptome Analysis ATF6 is a key regulator of the unfolded protein response. Through use of zebrafish and cultured cells we demonstrate that ATF6 drives fatty liver disease by interaction with fatty acid synthase FASN. Overall design: Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. parent bioproject:PRJNA541472 pubmed:24874946   nls Cherry Ethanol #1 GSM1362714   tissue:Zebrafish 5 dpf liver|tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf nls Cherry Ethanol #1 Illumina CASAVA version 1.7 used for basecalling ? Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes reads and their frequencies. Zebrafish 5 dpf liver   Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.   tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf GSM1362714 GSM1362714: nls Cherry Ethanol #1; Danio rerio; ncRNA Seq GSM1362714   1 Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. GEO Accession:GSM1362714 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer IIx   SRP040940     Cherry1-ethanol_raw.txt.gz fastq 2848772300.0 28487723.0 GSM1362714 r1 0:100 A:754173668;C:673034180;G:669171787;T:748900638;N:3492027 100       754173668 673034180 669171787 748900638 3492027 SRX510530 SRS588959 SRA156310 GEO sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai 1 0.93424   0.04344   0.80365   0.45184   100   B   usable mapping rate illumina early_illumina unknown size_fractionation unknown bulk unknown unknown   United States 2014-04-03 Larval Larval Liver Liver and Biliary System
37987 37987 SRR1216349 SRX510529 SRS588957 SRP040940 PRJNA243510 Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish GSE56498 Transcriptome Analysis ATF6 is a key regulator of the unfolded protein response. Through use of zebrafish and cultured cells we demonstrate that ATF6 drives fatty liver disease by interaction with fatty acid synthase FASN. Overall design: Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. parent bioproject:PRJNA541472 pubmed:24874946   nAtf6 Cherry #1 GSM1362713   tissue:Zebrafish 5 dpf liver|tissue type:liver|genotype:Tgfabp10:nAtf6 cherry; cmlc2:GFP|developmental stage:5 dpf nAtf6 Cherry #1 Illumina CASAVA version 1.7 used for basecalling ? Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes reads and their frequencies. Zebrafish 5 dpf liver   Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.   tissue type:liver|genotype:Tgfabp10:nAtf6 cherry; cmlc2:GFP|developmental stage:5 dpf GSM1362713 GSM1362713: nAtf6 Cherry #1; Danio rerio; ncRNA Seq GSM1362713   1 Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. GEO Accession:GSM1362713 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer IIx   SRP040940     nAtf61_raw.txt.gz fastq 2259581400.0 22595814.0 GSM1362713 r1 0:100 A:577752854;C:550694305;G:551105918;T:577235877;N:2792446 100       577752854 550694305 551105918 577235877 2792446 SRX510529 SRS588957 SRA156310 GEO sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai 1 0.94581   0.04947   0.80375   0.52352   100   B   usable mapping rate illumina early_illumina unknown size_fractionation unknown bulk unknown unknown   United States 2014-04-03 Larval Larval Liver Liver and Biliary System
37988 37988 SRR1216348 SRX510528 SRS588956 SRP040940 PRJNA243510 Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish GSE56498 Transcriptome Analysis ATF6 is a key regulator of the unfolded protein response. Through use of zebrafish and cultured cells we demonstrate that ATF6 drives fatty liver disease by interaction with fatty acid synthase FASN. Overall design: Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. parent bioproject:PRJNA541472 pubmed:24874946   nls Cherry #2 GSM1362712   tissue:Zebrafish 5 dpf liver|tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf nls Cherry #2 Illumina CASAVA version 1.7 used for basecalling ? Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes reads and their frequencies. Zebrafish 5 dpf liver   Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.   tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf GSM1362712 GSM1362712: nls Cherry #2; Danio rerio; ncRNA Seq GSM1362712   1 Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. GEO Accession:GSM1362712 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer IIx   SRP040940     Cherry2_raw.txt.gz fastq 2132003100.0 21320031.0 GSM1362712 r1 0:100 A:536532013;C:533562250;G:522685362;T:536641910;N:2581565 100       536532013 533562250 522685362 536641910 2581565 SRX510528 SRS588956 SRA156310 GEO sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai 1 0.88352   0.04379   0.81947   0.52367   100   B   usable mapping rate illumina early_illumina unknown size_fractionation unknown bulk unknown unknown   United States 2014-04-03 Larval Larval Liver Liver and Biliary System
37989 37989 SRR1216347 SRX510527 SRS588955 SRP040940 PRJNA243510 Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish GSE56498 Transcriptome Analysis ATF6 is a key regulator of the unfolded protein response. Through use of zebrafish and cultured cells we demonstrate that ATF6 drives fatty liver disease by interaction with fatty acid synthase FASN. Overall design: Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. parent bioproject:PRJNA541472 pubmed:24874946   nls Cherry #1 GSM1362711   tissue:Zebrafish 5 dpf liver|tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf nls Cherry #1 Illumina CASAVA version 1.7 used for basecalling ? Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes reads and their frequencies. Zebrafish 5 dpf liver   Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.   tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf GSM1362711 GSM1362711: nls Cherry #1; Danio rerio; ncRNA Seq GSM1362711   1 Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. GEO Accession:GSM1362711 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer IIx   SRP040940     Cherry1_raw.txt.gz fastq 2098395500.0 20983955.0 GSM1362711 r1 0:100 A:533756912;C:521877600;G:512200617;T:528020965;N:2539406 100       533756912 521877600 512200617 528020965 2539406 SRX510527 SRS588955 SRA156310 GEO sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai 1 0.89447   0.02865   0.82436   0.50802   100   B   usable mapping rate illumina early_illumina unknown size_fractionation unknown bulk unknown unknown   United States 2014-04-03 Larval Larval Liver Liver and Biliary System
41150 41150 SRR3744678 SRX1898686 SRS1541536 SRP077941 PRJNA327880 Analysis of piRNA production in meioc moto mutant zebrafish testis GSE84060 Transcriptome Analysis We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.   pubmed:39605693   moto homozygous 5 GSM2226636   tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / moto homozygous 5 Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. testis   Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.   strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / GSM2226636 GSM2226636: moto homozygous 5; Danio rerio; ncRNA Seq GSM2226636   1 Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. GEO Accession:GSM2226636 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP077941         2118467988.0 41538588.0 GSM2226636 r1 0:51 A:616161510;C:469529175;G:576120961;T:456560109;N:96233 51       616161510 469529175 576120961 456560109 96233 SRX1898686 SRS1541536 SRA438045 GEO Bioinformatics Core Facility, Institute of Molecular Biology 1 0.52011   0.38818   0.90193   0.51677   51   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   Germany 2016-07-05 Adult Adult Gonad Reproductive System
41151 41151 SRR3744677 SRX1898685 SRS1541535 SRP077941 PRJNA327880 Analysis of piRNA production in meioc moto mutant zebrafish testis GSE84060 Transcriptome Analysis We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.   pubmed:39605693   moto homozygous 4 GSM2226635   tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / moto homozygous 4 Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. testis   Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.   strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / GSM2226635 GSM2226635: moto homozygous 4; Danio rerio; ncRNA Seq GSM2226635   1 Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. GEO Accession:GSM2226635 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP077941         1771929771.0 34743721.0 GSM2226635 r1 0:51 A:524609276;C:393148247;G:436902442;T:417188575;N:81231 51       524609276 393148247 436902442 417188575 81231 SRX1898685 SRS1541535 SRA438045 GEO Bioinformatics Core Facility, Institute of Molecular Biology 1 0.62874   0.45148   0.89008   0.52837   51   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   Germany 2016-07-05 Adult Adult Gonad Reproductive System
41152 41152 SRR3744676 SRX1898684 SRS1541534 SRP077941 PRJNA327880 Analysis of piRNA production in meioc moto mutant zebrafish testis GSE84060 Transcriptome Analysis We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.   pubmed:39605693   moto homozygous 3 GSM2226634   tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / moto homozygous 3 Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. testis   Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.   strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / GSM2226634 GSM2226634: moto homozygous 3; Danio rerio; ncRNA Seq GSM2226634   1 Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. GEO Accession:GSM2226634 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP077941         1849849917.0 36271567.0 GSM2226634 r1 0:51 A:554317433;C:408404232;G:459010543;T:428033928;N:83781 51       554317433 408404232 459010543 428033928 83781 SRX1898684 SRS1541534 SRA438045 GEO Bioinformatics Core Facility, Institute of Molecular Biology 1 0.69752   0.51829   0.89027   0.53775   51   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   Germany 2016-07-05 Adult Adult Gonad Reproductive System
41153 41153 SRR3744675 SRX1898683 SRS1541533 SRP077941 PRJNA327880 Analysis of piRNA production in meioc moto mutant zebrafish testis GSE84060 Transcriptome Analysis We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.   pubmed:39605693   moto homozygous 2 GSM2226633   tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / moto homozygous 2 Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. testis   Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.   strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / GSM2226633 GSM2226633: moto homozygous 2; Danio rerio; ncRNA Seq GSM2226633   1 Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. GEO Accession:GSM2226633 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP077941         1863615327.0 36541477.0 GSM2226633 r1 0:51 A:554370010;C:414418365;G:465346091;T:429394630;N:86231 51       554370010 414418365 465346091 429394630 86231 SRX1898683 SRS1541533 SRA438045 GEO Bioinformatics Core Facility, Institute of Molecular Biology 1 0.74326   0.52319   0.87361   0.53081   51   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   Germany 2016-07-05 Adult Adult Gonad Reproductive System
41154 41154 SRR3744674 SRX1898682 SRS1541532 SRP077941 PRJNA327880 Analysis of piRNA production in meioc moto mutant zebrafish testis GSE84060 Transcriptome Analysis We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.   pubmed:39605693   moto homozygous 1 GSM2226632   tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / moto homozygous 1 Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. testis   Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.   strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / GSM2226632 GSM2226632: moto homozygous 1; Danio rerio; ncRNA Seq GSM2226632   1 Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. GEO Accession:GSM2226632 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP077941         1453145193.0 28493043.0 GSM2226632 r1 0:51 A:435644830;C:320413861;G:361678589;T:335340817;N:67096 51       435644830 320413861 361678589 335340817 67096 SRX1898682 SRS1541532 SRA438045 GEO Bioinformatics Core Facility, Institute of Molecular Biology 1 0.66367   0.47841   0.88262   0.50114   51   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   Germany 2016-07-05 Adult Adult Gonad Reproductive System
41155 41155 SRR3744673 SRX1898681 SRS1541531 SRP077941 PRJNA327880 Analysis of piRNA production in meioc moto mutant zebrafish testis GSE84060 Transcriptome Analysis We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.   pubmed:39605693   moto heterozygous 6 GSM2226631   tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ moto heterozygous 6 Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. testis   Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.   strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ GSM2226631 GSM2226631: moto heterozygous 6; Danio rerio; ncRNA Seq GSM2226631   1 Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. GEO Accession:GSM2226631 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP077941         2009800248.0 39407848.0 GSM2226631 r1 0:51 A:586066305;C:443066820;G:503291347;T:477284226;N:91550 51       586066305 443066820 503291347 477284226 91550 SRX1898681 SRS1541531 SRA438045 GEO Bioinformatics Core Facility, Institute of Molecular Biology 1 0.69598   0.49191   0.8828   0.51759   51   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   Germany 2016-07-05 Adult Adult Gonad Reproductive System
41156 41156 SRR3744672 SRX1898680 SRS1541530 SRP077941 PRJNA327880 Analysis of piRNA production in meioc moto mutant zebrafish testis GSE84060 Transcriptome Analysis We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.   pubmed:39605693   moto heterozygous 5 GSM2226630   tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ moto heterozygous 5 Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. testis   Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.   strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ GSM2226630 GSM2226630: moto heterozygous 5; Danio rerio; ncRNA Seq GSM2226630   1 Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. GEO Accession:GSM2226630 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP077941         1833618504.0 35953304.0 GSM2226630 r1 0:51 A:510624241;C:446979639;G:473431335;T:402499572;N:83717 51       510624241 446979639 473431335 402499572 83717 SRX1898680 SRS1541530 SRA438045 GEO Bioinformatics Core Facility, Institute of Molecular Biology 1 0.73675   0.50008   0.87957   0.53243   51   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   Germany 2016-07-05 Adult Adult Gonad Reproductive System
41157 41157 SRR3744671 SRX1898679 SRS1541529 SRP077941 PRJNA327880 Analysis of piRNA production in meioc moto mutant zebrafish testis GSE84060 Transcriptome Analysis We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.   pubmed:39605693   moto heterozygous 4 GSM2226629   tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ moto heterozygous 4 Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. testis   Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.   strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ GSM2226629 GSM2226629: moto heterozygous 4; Danio rerio; ncRNA Seq GSM2226629   1 Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. GEO Accession:GSM2226629 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP077941         2011846776.0 39447976.0 GSM2226629 r1 0:51 A:566935163;C:480777294;G:518987229;T:445055757;N:91333 51       566935163 480777294 518987229 445055757 91333 SRX1898679 SRS1541529 SRA438045 GEO Bioinformatics Core Facility, Institute of Molecular Biology 1 0.7246   0.49021   0.88051   0.5202   51   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   Germany 2016-07-05 Adult Adult Gonad Reproductive System
41158 41158 SRR3744670 SRX1898678 SRS1541528 SRP077941 PRJNA327880 Analysis of piRNA production in meioc moto mutant zebrafish testis GSE84060 Transcriptome Analysis We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.   pubmed:39605693   moto heterozygous 3 GSM2226628   tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ moto heterozygous 3 Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. testis   Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.   strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ GSM2226628 GSM2226628: moto heterozygous 3; Danio rerio; ncRNA Seq GSM2226628   1 Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. GEO Accession:GSM2226628 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP077941         1618368312.0 31732712.0 GSM2226628 r1 0:51 A:476792369;C:353703619;G:406141931;T:381656601;N:73792 51       476792369 353703619 406141931 381656601 73792 SRX1898678 SRS1541528 SRA438045 GEO Bioinformatics Core Facility, Institute of Molecular Biology 1 0.67806   0.48273   0.88363   0.53518   51   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   Germany 2016-07-05 Adult Adult Gonad Reproductive System
41159 41159 SRR3744669 SRX1898677 SRS1541527 SRP077941 PRJNA327880 Analysis of piRNA production in meioc moto mutant zebrafish testis GSE84060 Transcriptome Analysis We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.   pubmed:39605693   moto heterozygous 2 GSM2226627   tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ moto heterozygous 2 Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. testis   Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.   strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ GSM2226627 GSM2226627: moto heterozygous 2; Danio rerio; ncRNA Seq GSM2226627   1 Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. GEO Accession:GSM2226627 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP077941         1825076565.0 35785815.0 GSM2226627 r1 0:51 A:543891854;C:404479103;G:451780092;T:424842227;N:83289 51       543891854 404479103 451780092 424842227 83289 SRX1898677 SRS1541527 SRA438045 GEO Bioinformatics Core Facility, Institute of Molecular Biology 1 0.53478   0.39486   0.89899   0.52282   51   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   Germany 2016-07-05 Adult Adult Gonad Reproductive System
41160 41160 SRR3744668 SRX1898676 SRS1541526 SRP077941 PRJNA327880 Analysis of piRNA production in meioc moto mutant zebrafish testis GSE84060 Transcriptome Analysis We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.   pubmed:39605693   moto heterozygous 1 GSM2226626   tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ moto heterozygous 1 Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type. testis   Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.   strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ GSM2226626 GSM2226626: moto heterozygous 1; Danio rerio; ncRNA Seq GSM2226626   1 Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina. GEO Accession:GSM2226626 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP077941         1358381226.0 26634926.0 GSM2226626 r1 0:51 A:402110510;C:300618987;G:340178435;T:315410530;N:62764 51       402110510 300618987 340178435 315410530 62764 SRX1898676 SRS1541526 SRA438045 GEO Bioinformatics Core Facility, Institute of Molecular Biology 1 0.68106   0.46812   0.87596   0.53427   51   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   Germany 2016-07-05 Adult Adult Gonad Reproductive System
41250 41250 SRR3987432 SRX1989729 SRS1593551 SRP080353 PRJNA335856 High throughput sequencing analysis identify miRNAs in 7dpf F1 zebrafish under ß diketone antibiotics exposure to F0 zebrafish GSE85004 Transcriptome Analysis Small RNA high throughput sequencing technology was used to characterize the miRNAs in F1 zebrafish post 90 day ß diketone antibiotic DKA exposure to F0 zebrafish at 6.25 and 12.5 mg/L. The small RNA libraries from 7 dpf F1 zebrafish were constructed. In total 10 117 347 9 818 830 and 12 049 949 raw reads were acquired respectively under the different DKA exposure treatments 0 6.25 mg/L and 12.5mg/L from the three miRNAs libraries by Illumina sequencing. Low quality reads were removed which included five prime' contaminants those missing the three prime' primer or insert tag sequences with a poly A tail and those shorter than 17 nt and longer than 25 nt. As a result 8 141 146 representing 312 735 unique sequences; control 8 687 210 representing 251 508 unique sequences; 6.25 mg/L and 10 569 566 representing 441 938 unique sequences; 12.5 mg/L valid reads in the 17 to 25 nt size range were isolated for further analysis. The sRNAs from the three libraries were similar and the unique sRNA reads were mainly distributed in the 20 24 nt range among which 22 and 23 nt accounted for 41.8% and 20.0% of total unique sRNA reads respectively. The 22 nt sRNAs were the most abundant with the length distribution of counts of sequ seqs and unique miRNAs displaying a normal distribution. Overall design: Sample 1: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 0 mg/L; Sample 2: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 6.25 mg/L; Sample 3: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 12.5 mg/L.       S12 F1 GSM2255739   source name:F1 zebrafish 7 dpf F0 12.5 mg/L DKA exposure|strain/background:AB|genotype/variation:WT|f0 treatment:12.5 mg/L DKA exposure for 90 days|tissue:F1 whole body|f1 developmental stage:7 dpf S12 F1 Briefly the raw reads were subjected to the Illumina pipeline filter Solexa 0.3 and then the dataset was further processed with an in house program ACGT101 miR LC Sciences Houston Texas USA to remove adapter dimers junk low complexity common RNA families rRNA tRNA snRNA snoRNA and repeats. Subsequently unique sequences with length in 1826 nucleotide were mapped to specific species precursors in miRBase 20.0 by BLAST search to identify known miRNAs and novel 3p and 5p derived miRNAs. Length variation at both 3’ and 5’ ends and one mismatch inside of the sequence were allowed in the alignment. The unique sequences mapping to specific species mature miRNAs in hairpin arms were identified as known miRNAs. The unique sequences mapping to the other arm of known specific species precursor hairpin opposite to the annotated mature miRNA containing arm were considered to be novel 5p or 3p derived miRNA candidates. The remaining sequences were mapped to other selected species precursors with the exclusion of specific species in miRBase 20.0 by BLAST search and the mapped pre miRNAs were further BLASTed against the specific species genomes to determine their genomic locations. The above two we defined as known miRNAs. The unmapped sequences were BLASTed against the specific genomes and the hairpin RNA structures containing sequences were predicated from the flank 80 nt sequences using RNAfold software http://rna.tbi.univie.ac.at/cgi bin/RNAfold.cgi. The criteria for secondary structure prediction were: 1 number of nucleotides in one bulge in stem <=12; 2 number of base pairs in the stem region of the predicted hairpin >=16; 3 cutoff of free energy kCal/mol <=15; 4 length of hairpin up and down stems + terminal loop >=50; 5 length of hairpin loop <=20; 6 number of nucleotides in one bulge in mature region <=8; 7 number of biased errors in one bulge in mature region<=4; 8 number of biased bulges in mature region <=2; 9 number of errors in mature region <=7; 10 number of base pairs in the mature region of the … F1 zebrafish 7 dpf F0 12.5 mg/L DKA exposure Adult wild type zebrafish AB strain were purchased from a local supplier. Embryos at 6 hpf were exposed to control and two DKA treatments 6.25 and 12.5 mg/L composed of a mix of the six DKA species listed below with equal weight concentrations and equal volumes of each DKA species. post 90 days of DKA exposure F1 zebrafish at 7 dpf for each group control and two DKA exposure treatments were collected. Certified DKA reference standards were sourced from Amresco Solon OH USA and used as received: ofluoxacin CAS No. 82419 36 1 purity of 99% ciprofloxacin 85721 33 1 99% enrofloxacin 93106 60 6 99% doxycycline 24390 14 5 99% chlortetracycline 64 72 2 95% and oxytetracycline 79 57 2 99%. Total RNA was extracted using Trizol reagent Invitrogen CA USA following the manufacturer’s procedure. The total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent CA USA with RIN number >7.0. Approximately 1 μg of total RNA was used to prepare small RNA library according to protocol of TruSeq Small RNA Sample Prep Kits Illumina San Diego USA. Then we performed the single end sequencing 36 bp on an Illumina HiSeq 2500 at the LC BIO Hangzhou China following the vendor’s recommended protocol.   strain/background:AB|genotype/variation:WT|f0 treatment:12.5 mg/L DKA exposure for 90 days|tissue:F1 whole body|f1 developmental stage:7 dpf GSM2255739 GSM2255739: S12 F1; Danio rerio; ncRNA Seq GSM2255739   1 Total RNA was extracted using Trizol reagent Invitrogen CA USA following the manufacturer’s procedure. The total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent CA USA with RIN number >7.0. Approximately 1 μg of total RNA was used to prepare small RNA library according to protocol of TruSeq Small RNA Sample Prep Kits Illumina San Diego USA. Then we performed the single end sequencing 36 bp on an Illumina HiSeq 2500 at the LC BIO Hangzhou China following the vendor’s recommended protocol. GEO Accession:GSM2255739 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP080353     S12_F1.fq fastq 602497450.0 12049949.0 GSM2255739 r1 0:50 A:147750395;C:138369661;G:162147841;T:153975593;N:253960 50       147750395 138369661 162147841 153975593 253960 SRX1989729 SRS1593551 SRA446490 GEO Wenzhou Medical University Chashan Campus Chashan University Town, Wenzhou, Zhejiang Province 1 0.0   0.0   1.0       50   T   under 1.2% mapping rate illumina hiseq_era unknown size_fractionation trueseq bulk unknown unknown   China 2016-07-29 Larval Larval Trunk Surface Structure
41251 41251 SRR3987431 SRX1989728 SRS1593550 SRP080353 PRJNA335856 High throughput sequencing analysis identify miRNAs in 7dpf F1 zebrafish under ß diketone antibiotics exposure to F0 zebrafish GSE85004 Transcriptome Analysis Small RNA high throughput sequencing technology was used to characterize the miRNAs in F1 zebrafish post 90 day ß diketone antibiotic DKA exposure to F0 zebrafish at 6.25 and 12.5 mg/L. The small RNA libraries from 7 dpf F1 zebrafish were constructed. In total 10 117 347 9 818 830 and 12 049 949 raw reads were acquired respectively under the different DKA exposure treatments 0 6.25 mg/L and 12.5mg/L from the three miRNAs libraries by Illumina sequencing. Low quality reads were removed which included five prime' contaminants those missing the three prime' primer or insert tag sequences with a poly A tail and those shorter than 17 nt and longer than 25 nt. As a result 8 141 146 representing 312 735 unique sequences; control 8 687 210 representing 251 508 unique sequences; 6.25 mg/L and 10 569 566 representing 441 938 unique sequences; 12.5 mg/L valid reads in the 17 to 25 nt size range were isolated for further analysis. The sRNAs from the three libraries were similar and the unique sRNA reads were mainly distributed in the 20 24 nt range among which 22 and 23 nt accounted for 41.8% and 20.0% of total unique sRNA reads respectively. The 22 nt sRNAs were the most abundant with the length distribution of counts of sequ seqs and unique miRNAs displaying a normal distribution. Overall design: Sample 1: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 0 mg/L; Sample 2: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 6.25 mg/L; Sample 3: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 12.5 mg/L.       S6 F1 GSM2255738   source name:F1 zebrafish 7 dpf F0 6.25 mg/L DKA exposure|strain/background:AB|genotype/variation:WT|f0 treatment:6.25 mg/L DKA exposure for 90 days|tissue:F1 whole body|f1 developmental stage:7 dpf S6 F1 Briefly the raw reads were subjected to the Illumina pipeline filter Solexa 0.3 and then the dataset was further processed with an in house program ACGT101 miR LC Sciences Houston Texas USA to remove adapter dimers junk low complexity common RNA families rRNA tRNA snRNA snoRNA and repeats. Subsequently unique sequences with length in 1826 nucleotide were mapped to specific species precursors in miRBase 20.0 by BLAST search to identify known miRNAs and novel 3p and 5p derived miRNAs. Length variation at both 3’ and 5’ ends and one mismatch inside of the sequence were allowed in the alignment. The unique sequences mapping to specific species mature miRNAs in hairpin arms were identified as known miRNAs. The unique sequences mapping to the other arm of known specific species precursor hairpin opposite to the annotated mature miRNA containing arm were considered to be novel 5p or 3p derived miRNA candidates. The remaining sequences were mapped to other selected species precursors with the exclusion of specific species in miRBase 20.0 by BLAST search and the mapped pre miRNAs were further BLASTed against the specific species genomes to determine their genomic locations. The above two we defined as known miRNAs. The unmapped sequences were BLASTed against the specific genomes and the hairpin RNA structures containing sequences were predicated from the flank 80 nt sequences using RNAfold software http://rna.tbi.univie.ac.at/cgi bin/RNAfold.cgi. The criteria for secondary structure prediction were: 1 number of nucleotides in one bulge in stem <=12; 2 number of base pairs in the stem region of the predicted hairpin >=16; 3 cutoff of free energy kCal/mol <=15; 4 length of hairpin up and down stems + terminal loop >=50; 5 length of hairpin loop <=20; 6 number of nucleotides in one bulge in mature region <=8; 7 number of biased errors in one bulge in mature region<=4; 8 number of biased bulges in mature region <=2; 9 number of errors in mature region <=7; 10 number of base pairs in the mature region of the … F1 zebrafish 7 dpf F0 6.25 mg/L DKA exposure Adult wild type zebrafish AB strain were purchased from a local supplier. Embryos at 6 hpf were exposed to control and two DKA treatments 6.25 and 12.5 mg/L composed of a mix of the six DKA species listed below with equal weight concentrations and equal volumes of each DKA species. post 90 days of DKA exposure F1 zebrafish at 7 dpf for each group control and two DKA exposure treatments were collected. Certified DKA reference standards were sourced from Amresco Solon OH USA and used as received: ofluoxacin CAS No. 82419 36 1 purity of 99% ciprofloxacin 85721 33 1 99% enrofloxacin 93106 60 6 99% doxycycline 24390 14 5 99% chlortetracycline 64 72 2 95% and oxytetracycline 79 57 2 99%. Total RNA was extracted using Trizol reagent Invitrogen CA USA following the manufacturer’s procedure. The total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent CA USA with RIN number >7.0. Approximately 1 μg of total RNA was used to prepare small RNA library according to protocol of TruSeq Small RNA Sample Prep Kits Illumina San Diego USA. Then we performed the single end sequencing 36 bp on an Illumina HiSeq 2500 at the LC BIO Hangzhou China following the vendor’s recommended protocol.   strain/background:AB|genotype/variation:WT|f0 treatment:6.25 mg/L DKA exposure for 90 days|tissue:F1 whole body|f1 developmental stage:7 dpf GSM2255738 GSM2255738: S6 F1; Danio rerio; ncRNA Seq GSM2255738   1 Total RNA was extracted using Trizol reagent Invitrogen CA USA following the manufacturer’s procedure. The total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent CA USA with RIN number >7.0. Approximately 1 μg of total RNA was used to prepare small RNA library according to protocol of TruSeq Small RNA Sample Prep Kits Illumina San Diego USA. Then we performed the single end sequencing 36 bp on an Illumina HiSeq 2500 at the LC BIO Hangzhou China following the vendor’s recommended protocol. GEO Accession:GSM2255738 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP080353     S6_F1.fq fastq 490941500.0 9818830.0 GSM2255738 r1 0:50 A:119942635;C:111532763;G:133144810;T:126303825;N:17467 50       119942635 111532763 133144810 126303825 17467 SRX1989728 SRS1593550 SRA446490 GEO Wenzhou Medical University Chashan Campus Chashan University Town, Wenzhou, Zhejiang Province 1 1e-05   0.0   1.0       50   T   under 1.2% mapping rate illumina hiseq_era unknown size_fractionation trueseq bulk unknown unknown   China 2016-07-29 Larval Larval Trunk Surface Structure
41252 41252 SRR3987430 SRX1989727 SRS1593549 SRP080353 PRJNA335856 High throughput sequencing analysis identify miRNAs in 7dpf F1 zebrafish under ß diketone antibiotics exposure to F0 zebrafish GSE85004 Transcriptome Analysis Small RNA high throughput sequencing technology was used to characterize the miRNAs in F1 zebrafish post 90 day ß diketone antibiotic DKA exposure to F0 zebrafish at 6.25 and 12.5 mg/L. The small RNA libraries from 7 dpf F1 zebrafish were constructed. In total 10 117 347 9 818 830 and 12 049 949 raw reads were acquired respectively under the different DKA exposure treatments 0 6.25 mg/L and 12.5mg/L from the three miRNAs libraries by Illumina sequencing. Low quality reads were removed which included five prime' contaminants those missing the three prime' primer or insert tag sequences with a poly A tail and those shorter than 17 nt and longer than 25 nt. As a result 8 141 146 representing 312 735 unique sequences; control 8 687 210 representing 251 508 unique sequences; 6.25 mg/L and 10 569 566 representing 441 938 unique sequences; 12.5 mg/L valid reads in the 17 to 25 nt size range were isolated for further analysis. The sRNAs from the three libraries were similar and the unique sRNA reads were mainly distributed in the 20 24 nt range among which 22 and 23 nt accounted for 41.8% and 20.0% of total unique sRNA reads respectively. The 22 nt sRNAs were the most abundant with the length distribution of counts of sequ seqs and unique miRNAs displaying a normal distribution. Overall design: Sample 1: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 0 mg/L; Sample 2: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 6.25 mg/L; Sample 3: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 12.5 mg/L.       CON F1 GSM2255737   source name:F1 zebrafish 7 dpf F0 0 mg/L DKA exposure|strain/background:AB|genotype/variation:WT|f0 treatment:0 mg/L DKA exposure for 90 days|tissue:F1 whole body|f1 developmental stage:7 dpf CON F1 Briefly the raw reads were subjected to the Illumina pipeline filter Solexa 0.3 and then the dataset was further processed with an in house program ACGT101 miR LC Sciences Houston Texas USA to remove adapter dimers junk low complexity common RNA families rRNA tRNA snRNA snoRNA and repeats. Subsequently unique sequences with length in 1826 nucleotide were mapped to specific species precursors in miRBase 20.0 by BLAST search to identify known miRNAs and novel 3p and 5p derived miRNAs. Length variation at both 3’ and 5’ ends and one mismatch inside of the sequence were allowed in the alignment. The unique sequences mapping to specific species mature miRNAs in hairpin arms were identified as known miRNAs. The unique sequences mapping to the other arm of known specific species precursor hairpin opposite to the annotated mature miRNA containing arm were considered to be novel 5p or 3p derived miRNA candidates. The remaining sequences were mapped to other selected species precursors with the exclusion of specific species in miRBase 20.0 by BLAST search and the mapped pre miRNAs were further BLASTed against the specific species genomes to determine their genomic locations. The above two we defined as known miRNAs. The unmapped sequences were BLASTed against the specific genomes and the hairpin RNA structures containing sequences were predicated from the flank 80 nt sequences using RNAfold software http://rna.tbi.univie.ac.at/cgi bin/RNAfold.cgi. The criteria for secondary structure prediction were: 1 number of nucleotides in one bulge in stem <=12; 2 number of base pairs in the stem region of the predicted hairpin >=16; 3 cutoff of free energy kCal/mol <=15; 4 length of hairpin up and down stems + terminal loop >=50; 5 length of hairpin loop <=20; 6 number of nucleotides in one bulge in mature region <=8; 7 number of biased errors in one bulge in mature region<=4; 8 number of biased bulges in mature region <=2; 9 number of errors in mature region <=7; 10 number of base pairs in the mature region of the … F1 zebrafish 7 dpf F0 0 mg/L DKA exposure Adult wild type zebrafish AB strain were purchased from a local supplier. Embryos at 6 hpf were exposed to control and two DKA treatments 6.25 and 12.5 mg/L composed of a mix of the six DKA species listed below with equal weight concentrations and equal volumes of each DKA species. post 90 days of DKA exposure F1 zebrafish at 7 dpf for each group control and two DKA exposure treatments were collected. Certified DKA reference standards were sourced from Amresco Solon OH USA and used as received: ofluoxacin CAS No. 82419 36 1 purity of 99% ciprofloxacin 85721 33 1 99% enrofloxacin 93106 60 6 99% doxycycline 24390 14 5 99% chlortetracycline 64 72 2 95% and oxytetracycline 79 57 2 99%. Total RNA was extracted using Trizol reagent Invitrogen CA USA following the manufacturer’s procedure. The total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent CA USA with RIN number >7.0. Approximately 1 μg of total RNA was used to prepare small RNA library according to protocol of TruSeq Small RNA Sample Prep Kits Illumina San Diego USA. Then we performed the single end sequencing 36 bp on an Illumina HiSeq 2500 at the LC BIO Hangzhou China following the vendor’s recommended protocol.   strain/background:AB|genotype/variation:WT|f0 treatment:0 mg/L DKA exposure for 90 days|tissue:F1 whole body|f1 developmental stage:7 dpf GSM2255737 GSM2255737: CON F1; Danio rerio; ncRNA Seq GSM2255737   1 Total RNA was extracted using Trizol reagent Invitrogen CA USA following the manufacturer’s procedure. The total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent CA USA with RIN number >7.0. Approximately 1 μg of total RNA was used to prepare small RNA library according to protocol of TruSeq Small RNA Sample Prep Kits Illumina San Diego USA. Then we performed the single end sequencing 36 bp on an Illumina HiSeq 2500 at the LC BIO Hangzhou China following the vendor’s recommended protocol. GEO Accession:GSM2255737 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP080353     CON_F1.fq fastq 505867350.0 10117347.0 GSM2255737 r1 0:50 A:123471791;C:114424623;G:138931875;T:129020913;N:18148 50       123471791 114424623 138931875 129020913 18148 SRX1989727 SRS1593549 SRA446490 GEO Wenzhou Medical University Chashan Campus Chashan University Town, Wenzhou, Zhejiang Province 1 2e-05   0.0   0.99993   0.66666   50   T   under 1.2% mapping rate illumina hiseq_era unknown size_fractionation trueseq bulk unknown unknown   China 2016-07-29 Larval Larval Trunk Surface Structure
41693 41693 SRR5122167 SRX2437316 SRS1872014 SRP095411 PRJNA358209 Identification of a specific 13 miRNA expression signature during follicle activation in Zebrafish GSE92639 Transcriptome Analysis Purpose: We aimed to investigate important miRNA events and to define specific miRNA expression signature underlying the follicle activation of zebrafish. Methods: By using small and regular RNA sequencing we performed transcriptomic analyses of PG primary growth stage I; inactive and PV pre vitellogenic stage II; activated follicles to decipher important miRNA and gene events underlying follicle activation of zebrafish. We identified differentially expressed miRNAs for subsequent qPCR validation and miRNA::target gene prediction. Interaction of candidate miRNA:: target gene pairs were further validated by luciferase reporter assay. Global gene networks involved during PG to PV transition were also assessed by Gene Ontology as well as KEGG pathway analyses. Results and Conclusion: Our expression results indicated that PG follicles can be well differentiated from PV follicles by simply using a specific 13 miRNA expression signature let 7a 7b 7c 5p 7d 5p 7h 7i; miR 21 23a 27c 3p 107a 3p 125b 5p 145 3p 202 5p. Besides we validated interactions of let 7i::atg4a miR 202 5p::c23h20orf24 and miR 144::ybx1 by luciferase reporter assay. Purpose: we aimed to investigate important miRNA events and to define specific miRNA expression signature underlying the follicle activation of zebrafish Overall design: To identify differentially expressed miRNAs and its potential downstream targets during follicle activation of zebrafish we carried out transcriptomic profiling by both small and regular RNA sequencing. By intersecting gene lists of the online predicted targets and RNA seq derived differentially expressed transcripts with a reciprocal expression pattern of miRNAs we shortlisted 6 pairs of miRNA::target gene for validation using luciferase reporter assay.   pubmed:29228146   PG small RNA seq 2 GSM2433869   tissue:Ovarian follicle|strain:AB|cell type:Pre vitellogenic follicle|age:from ovary of 3 month zebrafish PG small RNA seq 2 For the RNA seq data all the pair end reads were mapped to the zebrafish genome using TopHat version 2.0.11. Genome annotation files with GTF format for known genes were downloaded from Ensembl. FPKM and RPKM values were calculated for each miRNA and gene respectively using Cufflinks software version 2.2.1 with default parameters. Genome build: Zv9 Ensembl release 79 Supplementary files format and content: tab delimited text files include FFKM for each mRNA transcript; tab delimited text files include RFKM for each miRNA. Ovarian follicle Ovaries from 3 mpf adult zebrafish were dissected in 60% medium of Leibovitz L 15 and follicles PG PV were sorted out according to the size and morphology. RNA was extracted with miRNeasy and RNAeasy extraction kits Qiagen RNA Seq libraries were constructed according to Illumima TrueSeq and small RNA seq protocol and sequenced with the Illumina Hiseq 2000 Single end sequencing and pair end sequencing were used for small RNA seq library and RNA seq library respectively AB fish was housed under a stable flow through condition at 28°C on a 14L:10D photoperiod with the light on at 0800 and off at 2200. Fish were fed regularly twice a day with live brine shrimp with supplement of commercial tropical fish food at a fixed time basis. strain:AB|cell type:Pre vitellogenic follicle|age:from ovary of 3 month zebrafish GSM2433869 GSM2433869: PG small RNA seq 2; Danio rerio; ncRNA Seq GSM2433869   1 RNA was extracted with miRNeasy and RNAeasy extraction kits Qiagen RNA Seq libraries were constructed according to Illumima TrueSeq and small RNA seq protocol and sequenced with the Illumina Hiseq 2000 Single end sequencing and pair end sequencing were used for small RNA seq library and RNA seq library respectively GEO Accession:GSM2433869 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP095411     Ctrl_PV_1.fq.gz fastq 532189753.0 19043107.0 GSM2433869 r1 0:27.95 1:0 A:138460901;C:107807428;G:115489810;T:170431567;N:47 27 0     138460901 107807428 115489810 170431567 47 SRX2437316 SRS1872014 SRA505873 GEO Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institute of Health 1 0.86612   0.65562   0.84486   0.53167   26   B   usable mapping rate illumina hiseq_era unknown size_fractionation trueseq bulk unknown unknown   United States 2016-12-20 Adult Adult Gonad Reproductive System
41694 41694 SRR5122166 SRX2437315 SRS1872013 SRP095411 PRJNA358209 Identification of a specific 13 miRNA expression signature during follicle activation in Zebrafish GSE92639 Transcriptome Analysis Purpose: We aimed to investigate important miRNA events and to define specific miRNA expression signature underlying the follicle activation of zebrafish. Methods: By using small and regular RNA sequencing we performed transcriptomic analyses of PG primary growth stage I; inactive and PV pre vitellogenic stage II; activated follicles to decipher important miRNA and gene events underlying follicle activation of zebrafish. We identified differentially expressed miRNAs for subsequent qPCR validation and miRNA::target gene prediction. Interaction of candidate miRNA:: target gene pairs were further validated by luciferase reporter assay. Global gene networks involved during PG to PV transition were also assessed by Gene Ontology as well as KEGG pathway analyses. Results and Conclusion: Our expression results indicated that PG follicles can be well differentiated from PV follicles by simply using a specific 13 miRNA expression signature let 7a 7b 7c 5p 7d 5p 7h 7i; miR 21 23a 27c 3p 107a 3p 125b 5p 145 3p 202 5p. Besides we validated interactions of let 7i::atg4a miR 202 5p::c23h20orf24 and miR 144::ybx1 by luciferase reporter assay. Purpose: we aimed to investigate important miRNA events and to define specific miRNA expression signature underlying the follicle activation of zebrafish Overall design: To identify differentially expressed miRNAs and its potential downstream targets during follicle activation of zebrafish we carried out transcriptomic profiling by both small and regular RNA sequencing. By intersecting gene lists of the online predicted targets and RNA seq derived differentially expressed transcripts with a reciprocal expression pattern of miRNAs we shortlisted 6 pairs of miRNA::target gene for validation using luciferase reporter assay.   pubmed:29228146   PG small RNA seq 1 GSM2433868   tissue:Ovarian follicle|strain:AB|cell type:Primary growth follicle|age:from ovary of 3 month zebrafish PG small RNA seq 1 For the RNA seq data all the pair end reads were mapped to the zebrafish genome using TopHat version 2.0.11. Genome annotation files with GTF format for known genes were downloaded from Ensembl. FPKM and RPKM values were calculated for each miRNA and gene respectively using Cufflinks software version 2.2.1 with default parameters. Genome build: Zv9 Ensembl release 79 Supplementary files format and content: tab delimited text files include FFKM for each mRNA transcript; tab delimited text files include RFKM for each miRNA. Ovarian follicle Ovaries from 3 mpf adult zebrafish were dissected in 60% medium of Leibovitz L 15 and follicles PG PV were sorted out according to the size and morphology. RNA was extracted with miRNeasy and RNAeasy extraction kits Qiagen RNA Seq libraries were constructed according to Illumima TrueSeq and small RNA seq protocol and sequenced with the Illumina Hiseq 2000 Single end sequencing and pair end sequencing were used for small RNA seq library and RNA seq library respectively AB fish was housed under a stable flow through condition at 28°C on a 14L:10D photoperiod with the light on at 0800 and off at 2200. Fish were fed regularly twice a day with live brine shrimp with supplement of commercial tropical fish food at a fixed time basis. strain:AB|cell type:Primary growth follicle|age:from ovary of 3 month zebrafish GSM2433868 GSM2433868: PG small RNA seq 1; Danio rerio; ncRNA Seq GSM2433868   1 RNA was extracted with miRNeasy and RNAeasy extraction kits Qiagen RNA Seq libraries were constructed according to Illumima TrueSeq and small RNA seq protocol and sequenced with the Illumina Hiseq 2000 Single end sequencing and pair end sequencing were used for small RNA seq library and RNA seq library respectively GEO Accession:GSM2433868 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP095411     Ctrl_PG_1.fq.gz fastq 368945203.0 13147324.0 GSM2433868 r1 0:28.06 1:0 A:96466912;C:75527992;G:78177838;T:118772423;N:38 28 0     96466912 75527992 78177838 118772423 38 SRX2437315 SRS1872013 SRA505873 GEO Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institute of Health 1 0.8524   0.67638   0.86074   0.48958   27   B   usable mapping rate illumina hiseq_era unknown size_fractionation trueseq bulk unknown unknown   United States 2016-12-20 Adult Adult Gonad Reproductive System
44967 44967 SRR6345660 SRX3442976 SRS2733636 SRP126106 PRJNA421016 Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] GSE107682 Transcriptome Analysis Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. parent bioproject:PRJNA315403 pubmed:30086300   smRNA seq library of ovary from tdrd6a mut fish GSM2875719   source name:Ovary from tdrd6a mut fish|tissue:whole ovary|genotype:tdrd6a mutant smRNA seq library of ovary from tdrd6a mut fish 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15  6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.    8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.  Supplementary files format and content: Files ending in .bw are bigwig tracks. Ovary from tdrd6a mut fish   RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation   tissue:whole ovary|genotype:tdrd6a mutant GSM2875719 GSM2875719: smRNA seq library of ovary from tdrd6a mut fish; Danio rerio; ncRNA Seq GSM2875719   1 RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation GEO Accession:GSM2875719 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP126106     Tdrd6a-mut-ovary-input-Adult.fastq.gz fastq 817885062.0 16036962.0 GSM2875719 r1 0:51 A:212456064;C:163491733;G:233627239;T:208262707;N:47319 51       212456064 163491733 233627239 208262707 47319 SRX3442976 SRS2733636 SRA636010 GEO Rene Ketting, RNA silencing, IMB 1 0.46308   0.13668   0.83587   0.79104   51   B   usable mapping rate illumina hiseq_era 5prime size_fractionation unknown sc_generic single_cell_generic generic-scrnaseq-only   Germany 2017-12-04 Undetermined Undetermined Gonad Reproductive System
44968 44968 SRR6345659 SRX3442975 SRS2733637 SRP126106 PRJNA421016 Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] GSE107682 Transcriptome Analysis Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. parent bioproject:PRJNA315403 pubmed:30086300   smRNA seq library of ovary from tdrd6a het fish GSM2875718   source name:Ovary from tdrd6a het fish|tissue:whole ovary|genotype:tdrd6a heterozygous smRNA seq library of ovary from tdrd6a het fish 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15  6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.    8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.  Supplementary files format and content: Files ending in .bw are bigwig tracks. Ovary from tdrd6a het fish   RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation   tissue:whole ovary|genotype:tdrd6a heterozygous GSM2875718 GSM2875718: smRNA seq library of ovary from tdrd6a het fish; Danio rerio; ncRNA Seq GSM2875718   1 RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation GEO Accession:GSM2875718 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP126106     Tdrd6a-het-ovary-input-Adult.fastq.gz fastq 1452353571.0 28477521.0 GSM2875718 r1 0:51 A:397993735;C:284194126;G:396142390;T:373939235;N:84085 51       397993735 284194126 396142390 373939235 84085 SRX3442975 SRS2733637 SRA636010 GEO Rene Ketting, RNA silencing, IMB 1 0.3869   0.1369   0.86397   0.77165   51   B   usable mapping rate illumina hiseq_era 5prime size_fractionation unknown sc_generic single_cell_generic generic-scrnaseq-only   Germany 2017-12-04 Undetermined Undetermined Gonad Reproductive System
44969 44969 SRR6345658 SRX3442974 SRS2733632 SRP126106 PRJNA421016 Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] GSE107682 Transcriptome Analysis Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. parent bioproject:PRJNA315403 pubmed:30086300   smRNA seq library of late oocytes from tdrd6a hett fish GSM2875717   source name:late oocytes from tdrd6a hett fish|tissue:late oocytes|genotype:tdrd6a heterozygous smRNA seq library of late oocytes from tdrd6a hett fish 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15  6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.    8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.  Supplementary files format and content: Files ending in .bw are bigwig tracks. late oocytes from tdrd6a hett fish   RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation   tissue:late oocytes|genotype:tdrd6a heterozygous GSM2875717 GSM2875717: smRNA seq library of late oocytes from tdrd6a hett fish; Danio rerio; ncRNA Seq GSM2875717   1 RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation GEO Accession:GSM2875717 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP126106     tdrd6a-het_oocytes-late-input.fastq.gz fastq 1884769630.0 28130890.0 GSM2875717 r1 0:67 A:519051884;C:437635381;G:510738306;T:417295309;N:48750 67       519051884 437635381 510738306 417295309 48750 SRX3442974 SRS2733632 SRA636010 GEO Rene Ketting, RNA silencing, IMB 1 0.17778   0.06655   0.95931   0.91529   67   B   usable mapping rate illumina hiseq_era 5prime size_fractionation unknown sc_generic single_cell_generic generic-scrnaseq-only   Germany 2017-12-04 Zygote Embryo Oocyte Reproductive System
44970 44970 SRR6345657 SRX3442973 SRS2733634 SRP126106 PRJNA421016 Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] GSE107682 Transcriptome Analysis Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. parent bioproject:PRJNA315403 pubmed:30086300   smRNA seq library of early oocytes from tdrd6a mut fish GSM2875716   source name:early oocytes from tdrd6a mut fish|tissue:early oocytes|genotype:tdrd6a mutant smRNA seq library of early oocytes from tdrd6a mut fish 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15  6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.    8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.  Supplementary files format and content: Files ending in .bw are bigwig tracks. early oocytes from tdrd6a mut fish   RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation   tissue:early oocytes|genotype:tdrd6a mutant GSM2875716 GSM2875716: smRNA seq library of early oocytes from tdrd6a mut fish; Danio rerio; ncRNA Seq GSM2875716   1 RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation GEO Accession:GSM2875716 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP126106     tdrd6a-mut_oocytes-early-input.fastq.gz fastq 2102216723.0 31376369.0 GSM2875716 r1 0:67 A:592618102;C:472348913;G:550028898;T:487165955;N:54855 67       592618102 472348913 550028898 487165955 54855 SRX3442973 SRS2733634 SRA636010 GEO Rene Ketting, RNA silencing, IMB 1 0.08293   0.04595   0.96193   0.77321   67   B   usable mapping rate illumina hiseq_era 5prime size_fractionation unknown sc_generic single_cell_generic generic-scrnaseq-only   Germany 2017-12-04 Zygote Embryo Oocyte Reproductive System
44971 44971 SRR6345656 SRX3442972 SRS2733635 SRP126106 PRJNA421016 Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] GSE107682 Transcriptome Analysis Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. parent bioproject:PRJNA315403 pubmed:30086300   smRNA seq library of late oocytes from tdrd6a mut fish GSM2875715   source name:late oocytes from tdrd6a mut fish|tissue:late oocytes|genotype:tdrd6a mutant smRNA seq library of late oocytes from tdrd6a mut fish 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15  6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.    8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.  Supplementary files format and content: Files ending in .bw are bigwig tracks. late oocytes from tdrd6a mut fish   RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation   tissue:late oocytes|genotype:tdrd6a mutant GSM2875715 GSM2875715: smRNA seq library of late oocytes from tdrd6a mut fish; Danio rerio; ncRNA Seq GSM2875715   1 RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation GEO Accession:GSM2875715 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP126106     tdrd6a-mut_oocytes-late-input.fastq.gz fastq 2110760295.0 31503885.0 GSM2875715 r1 0:67 A:582021495;C:486821539;G:582933348;T:458929133;N:54780 67       582021495 486821539 582933348 458929133 54780 SRX3442972 SRS2733635 SRA636010 GEO Rene Ketting, RNA silencing, IMB 1 0.17064   0.06728   0.96173   0.9114   67   B   usable mapping rate illumina hiseq_era 5prime size_fractionation unknown sc_generic single_cell_generic generic-scrnaseq-only   Germany 2017-12-04 Zygote Embryo Oocyte Reproductive System
44972 44972 SRR6345655 SRX3442971 SRS2733633 SRP126106 PRJNA421016 Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] GSE107682 Transcriptome Analysis Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. parent bioproject:PRJNA315403 pubmed:30086300   smRNA seq library of early oocytes from tdrd6a het fish GSM2875714   source name:early oocytes from tdrd6a het fish|tissue:Early oocytes|genotype:tdrd6a heterozygous smRNA seq library of early oocytes from tdrd6a het fish 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15  6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.    8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.  Supplementary files format and content: Files ending in .bw are bigwig tracks. early oocytes from tdrd6a het fish   RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation   tissue:Early oocytes|genotype:tdrd6a heterozygous GSM2875714 GSM2875714: smRNA seq library of early oocytes from tdrd6a het fish; Danio rerio; ncRNA Seq GSM2875714   1 RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation GEO Accession:GSM2875714 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP126106     tdrd6a-het_oocytes-early-input.fastq.gz fastq 2243425655.0 33483965.0 GSM2875714 r1 0:67 A:633468129;C:503239215;G:592089295;T:514571679;N:57337 67       633468129 503239215 592089295 514571679 57337 SRX3442971 SRS2733633 SRA636010 GEO Rene Ketting, RNA silencing, IMB 1 0.06641   0.04254   0.96806   0.58509   67   B   usable mapping rate illumina hiseq_era 5prime size_fractionation unknown sc_generic single_cell_generic generic-scrnaseq-only   Germany 2017-12-04 Zygote Embryo Oocyte Reproductive System
48990 48990 SRR7612999 SRX4477699 SRS3602899 SRP155545 PRJNA483217 Sequencing of Danio rerio brain for 5 age groups GSE117807 Transcriptome Analysis Comparison of temporal small RNA gene expression profiles from Danio rerio brain. The smallRNA seq data comprise 5 age groups at 6 12 24 36 month and 42 month. Jena Centre for Systems Biology of Ageing JenAge www.jenage.de Overall design: 25 samples in 5 groups: 6 month 5 samples 12 month 5 samples 24 month 5 samples 36 month 5 samples 42 month 5 samples.       NH FLI 156 ZF brain smallRNAseq GSM3309607   source name:brain|strain:AB JxT\xFC Tgpu.1:GFP|tissue:brain|age:3 years|Sex:male NH FLI 156 ZF brain smallRNAseq Sequence information was extracted in FastQ format using CASAVA software 1.8.4 data processing step. Reads were trimmed und filtered using trimmomatic 0.36 [parameter: ILLUMINACLIP:smallRNAAdapter:2:6:6 LEADING:15 SLIDINGWINDOW:4:15 MINLEN:20]. Reads were mapped using BWA 0.7.12 r1039 [parameter: n 0 o 0 e 0 l 8 k 0]. Reads per gene were counted using samtools 1.3.1 9 ge5dfb0a. Genome build: mirBase Release 21 D. rerio sequences only Supplementary files format and content: The Excel file includes raw counts sample counts.xls of all mirBase D. rerio sequences for each sample. brain   Extraction was done as described in Baumgart et al. 2012. PMID:22487494 Library preparation was done using Illumina's TruSeq smallRNA Library Preparation Kit following the manufacturer's instruction.   strain:AB JxT\xFC Tgpu.1:GFP|tissue:brain|age:3 years|Sex:male GSM3309607 GSM3309607: NH FLI 156 ZF brain smallRNAseq; Danio rerio; ncRNA Seq GSM3309607   1 Extraction was done as described in Baumgart et al. 2012. PMID:22487494 Library preparation was done using Illumina's TruSeq smallRNA Library Preparation Kit following the manufacturer's instruction. GEO Accession:GSM3309607 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP155545         681376400.0 13627528.0 GSM3309607 r1 0:50 A:149742268;C:163827889;G:200725169;T:167045618;N:35456 50       149742268 163827889 200725169 167045618 35456 SRX4477699 SRS3602899 SRA745937 GEO Leibniz Institute for Age Research - Fritz Lipmann Institute 1 0.00576   0.00087   0.9959   0.70299   50   T   under 1.2% mapping rate illumina hiseq_era unknown size_fractionation trueseq bulk unknown unknown   Germany 2018-07-27 Adult Adult Brain Nervous System
48991 48991 SRR7612998 SRX4477698 SRS3602898 SRP155545 PRJNA483217 Sequencing of Danio rerio brain for 5 age groups GSE117807 Transcriptome Analysis Comparison of temporal small RNA gene expression profiles from Danio rerio brain. The smallRNA seq data comprise 5 age groups at 6 12 24 36 month and 42 month. Jena Centre for Systems Biology of Ageing JenAge www.jenage.de Overall design: 25 samples in 5 groups: 6 month 5 samples 12 month 5 samples 24 month 5 samples 36 month 5 samples 42 month 5 samples.       NH FLI 154 ZF brain smallRNAseq GSM3309606   source name:brain|strain:AB JxT\xFC Tgpu.1:GFP|tissue:brain|age:3 years|Sex:male NH FLI 154 ZF brain smallRNAseq Sequence information was extracted in FastQ format using CASAVA software 1.8.4 data processing step. Reads were trimmed und filtered using trimmomatic 0.36 [parameter: ILLUMINACLIP:smallRNAAdapter:2:6:6 LEADING:15 SLIDINGWINDOW:4:15 MINLEN:20]. Reads were mapped using BWA 0.7.12 r1039 [parameter: n 0 o 0 e 0 l 8 k 0]. Reads per gene were counted using samtools 1.3.1 9 ge5dfb0a. Genome build: mirBase Release 21 D. rerio sequences only Supplementary files format and content: The Excel file includes raw counts sample counts.xls of all mirBase D. rerio sequences for each sample. brain   Extraction was done as described in Baumgart et al. 2012. PMID:22487494 Library preparation was done using Illumina's TruSeq smallRNA Library Preparation Kit following the manufacturer's instruction.   strain:AB JxT\xFC Tgpu.1:GFP|tissue:brain|age:3 years|Sex:male GSM3309606 GSM3309606: NH FLI 154 ZF brain smallRNAseq; Danio rerio; ncRNA Seq GSM3309606   1 Extraction was done as described in Baumgart et al. 2012. PMID:22487494 Library preparation was done using Illumina's TruSeq smallRNA Library Preparation Kit following the manufacturer's instruction. GEO Accession:GSM3309606 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP155545         1196666100.0 23933322.0 GSM3309606 r1 0:50 A:243243770;C:320296221;G:371488432;T:261584801;N:52876 50       243243770 320296221 371488432 261584801 52876 SRX4477698 SRS3602898 SRA745937 GEO Leibniz Institute for Age Research - Fritz Lipmann Institute 1 0.01627   0.00325   0.99293   0.7183   50   B   usable mapping rate illumina hiseq_era unknown size_fractionation trueseq bulk unknown unknown   Germany 2018-07-27 Adult Adult Brain Nervous System

Next page

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;