RNAquarium Metadata Server
Institute Website Terms of Use Privacy Policy

run_metadata

41 rows where experiment.library_layout = "SINGLE", experiment.library_selection = "size fractionation" and tissue_curation = "Undetermined"

✎ View and edit SQL

This data as json, CSV (advanced)

experiment.library_strategy 3

tissue_curation_coarse 2

devstage_curation_coarse 2

devstage_curation 2

tissue_curation 1

  • Undetermined · 41 ✖

technology 1

experiment.platform 1

experiment.library_source 1

experiment.library_selection 1

  • size fractionation · 41 ✖

experiment.library_layout 1

  • SINGLE · 41 ✖
Link rowid ▼ run.accession experiment.accession sample.accession study.accession bioproject study.title study.alias study.type study.abstract study.attributes study.PMIDs sample.description sample.title sample.alias sample.centername sample.attributes GEOsample.title GEOsample.dataprocessing GEOsample.source GEOsample.treatmentprotocol GEOsample.extractprotocol GEOsample.growthprotocol GEOsample.characteristics GEOsample.accession experiment.title experiment.alias experiment.library_name experiment.design_description experiment.library_construction_protocol experiment.attributes experiment.library_strategy experiment.library_source experiment.library_selection experiment.library_layout experiment.platform experiment.instrument_model experiment.spot_descriptor experiment.study_ref run.title run.attributes run.filename run.semantic_name run.total_bases run.total_spots run.alias run.read_lengths run.base_counts run.r1_length run.r2_length run.r3_length run.r4_length run.Acount run.Ccount run.Gcount run.Tcount run.Ncount run.experiment run.pool_member submission.accession submission.srasource submission.bioprojectsource seqdetective.n_mates seqdetective.mapping_rate.mate1 seqdetective.mapping_rate.mate2 seqdetective.nofeature_rate.mate1 seqdetective.nofeature_rate.mate2 seqdetective.sparsity.mate1 seqdetective.sparsity.mate2 seqdetective.pos_strand_rate.mate1 seqdetective.pos_strand_rate.mate2 seqdetective.readlen.mate1 seqdetective.readlen.mate2 seqdetective.judgement.mate1 seqdetective.judgement.mate2 seqdetective.judgement.reason platform_family instrument_generation read_bias selection_class prep_kit sc_or_bulk tech_class technology tech_variant submission.bioprojectsource.country earliest_date devstage_curation devstage_curation_coarse tissue_curation tissue_curation_coarse
25162 25162 SRR25655085 SRX21381122 SRS18622091 SRP455342 PRJNA1005926 miR 29a is downregulated in progenies derived from chronically stressed males GSE240954 Transcriptome Analysis To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.   pubmed:37762407   Sample 8 AU1038 STRSS4 GSM7712891   source name:larvae|tissue:larvae|genotype:WT|treatment:From parent chronically stressed|geo loc name:missing|collection date:missing Sample 8 AU1038 STRSS4 Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts larvae   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:larvae|genotype:WT|treatment:From parent chronically stressed GSM7712891 GSM7712891: Sample 8 AU1038 STRSS4; Danio rerio; ncRNA Seq GSM7712891 r1 GSM7712891 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP455342   loader:fastq load.py STRS04_10932AAD_TGTCCTAC-ACATGAGT_R1_001.fastq.gz fastq 641236400.0 12824728.0 GSM7712891 r1 0:50 A:183546979;C:159774155;G:156033079;T:141881902;N:285 50       183546979 159774155 156033079 141881902 285 SRX21381122 SRS18622091 SRA1693666 CNAG CNAG 1 0.4736   0.03992   0.96788   0.87662   50   B   usable mapping rate illumina novaseq_era unknown size_fractionation unknown bulk unknown unknown   Spain 2023-08-16 Larval Larval Undetermined Undetermined
25163 25163 SRR25655086 SRX21381121 SRS18622090 SRP455342 PRJNA1005926 miR 29a is downregulated in progenies derived from chronically stressed males GSE240954 Transcriptome Analysis To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.   pubmed:37762407   Sample 7 AU1037 STRSS3 GSM7712890   source name:larvae|tissue:larvae|genotype:WT|treatment:From parent chronically stressed|geo loc name:missing|collection date:missing Sample 7 AU1037 STRSS3 Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts larvae   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:larvae|genotype:WT|treatment:From parent chronically stressed GSM7712890 GSM7712890: Sample 7 AU1037 STRSS3; Danio rerio; ncRNA Seq GSM7712890 r1 GSM7712890 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP455342   loader:fastq load.py STRS03_10931AAD_GCACGATT-CGTCTGCA_R1_001.fastq.gz fastq 434646850.0 8692937.0 GSM7712890 r1 0:50 A:126760670;C:102577685;G:109591447;T:95716876;N:172 50       126760670 102577685 109591447 95716876 172 SRX21381121 SRS18622090 SRA1693666 CNAG CNAG 1 0.52132   0.04615   0.96477   0.85481   50   B   usable mapping rate illumina novaseq_era unknown size_fractionation unknown bulk unknown unknown   Spain 2023-08-16 Larval Larval Undetermined Undetermined
25164 25164 SRR25655087 SRX21381120 SRS18622089 SRP455342 PRJNA1005926 miR 29a is downregulated in progenies derived from chronically stressed males GSE240954 Transcriptome Analysis To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.   pubmed:37762407   Sample 6 AU1036 STRSS2 GSM7712889   source name:larvae|tissue:larvae|genotype:WT|treatment:From parent chronically stressed|geo loc name:missing|collection date:missing Sample 6 AU1036 STRSS2 Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts larvae   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:larvae|genotype:WT|treatment:From parent chronically stressed GSM7712889 GSM7712889: Sample 6 AU1036 STRSS2; Danio rerio; ncRNA Seq GSM7712889 r1 GSM7712889 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP455342   loader:fastq load.py STRS02_10930AAD_ATGAAGCG-GCGGACAG_R1_001.fastq.gz fastq 907610650.0 18152213.0 GSM7712889 r1 0:50 A:271494673;C:215304417;G:220608756;T:200202267;N:537 50       271494673 215304417 220608756 200202267 537 SRX21381120 SRS18622089 SRA1693666 CNAG CNAG 1 0.44189   0.03477   0.97335   0.88092   50   B   usable mapping rate illumina novaseq_era unknown size_fractionation unknown bulk unknown unknown   Spain 2023-08-16 Larval Larval Undetermined Undetermined
25165 25165 SRR25655088 SRX21381119 SRS18622088 SRP455342 PRJNA1005926 miR 29a is downregulated in progenies derived from chronically stressed males GSE240954 Transcriptome Analysis To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.   pubmed:37762407   Sample 5 AU1035 STRSS1 GSM7712888   source name:larvae|tissue:larvae|genotype:WT|treatment:From parent chronically stressed|geo loc name:missing|collection date:missing Sample 5 AU1035 STRSS1 Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts larvae   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:larvae|genotype:WT|treatment:From parent chronically stressed GSM7712888 GSM7712888: Sample 5 AU1035 STRSS1; Danio rerio; ncRNA Seq GSM7712888 r1 GSM7712888 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP455342   loader:fastq load.py STRS01_10929AAD_CACTTCGA-TAGGCTTC_R1_001.fastq.gz fastq 711276100.0 14225522.0 GSM7712888 r1 0:50 A:207284968;C:173540770;G:172961619;T:157488473;N:270 50       207284968 173540770 172961619 157488473 270 SRX21381119 SRS18622088 SRA1693666 CNAG CNAG 1 0.47865   0.03881   0.97001   0.87616   50   B   usable mapping rate illumina novaseq_era unknown size_fractionation unknown bulk unknown unknown   Spain 2023-08-16 Larval Larval Undetermined Undetermined
25166 25166 SRR25655089 SRX21381118 SRS18622087 SRP455342 PRJNA1005926 miR 29a is downregulated in progenies derived from chronically stressed males GSE240954 Transcriptome Analysis To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.   pubmed:37762407   Sample 4 AU1028 CTRL4 GSM7712887   source name:larvae|tissue:larvae|genotype:WT|treatment:Control|geo loc name:missing|collection date:missing Sample 4 AU1028 CTRL4 Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts larvae   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:larvae|genotype:WT|treatment:Control GSM7712887 GSM7712887: Sample 4 AU1028 CTRL4; Danio rerio; ncRNA Seq GSM7712887 r1 GSM7712887 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP455342   loader:fastq load.py CTRL04_10928AAD_GACTAGGC-GCCTCGAC_R1_001.fastq.gz fastq 568037350.0 11360747.0 GSM7712887 r1 0:50 A:165826590;C:133109854;G:141956673;T:127143732;N:501 50       165826590 133109854 141956673 127143732 501 SRX21381118 SRS18622087 SRA1693666 CNAG CNAG 1 0.48051   0.0347   0.97268   0.87465   50   B   usable mapping rate illumina novaseq_era unknown size_fractionation unknown bulk unknown unknown   Spain 2023-08-16 Larval Larval Undetermined Undetermined
25167 25167 SRR25655090 SRX21381117 SRS18622086 SRP455342 PRJNA1005926 miR 29a is downregulated in progenies derived from chronically stressed males GSE240954 Transcriptome Analysis To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.   pubmed:37762407   Sample 3 AU1027 CTRL3 GSM7712886   source name:larvae|tissue:larvae|genotype:WT|treatment:Control|geo loc name:missing|collection date:missing Sample 3 AU1027 CTRL3 Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts larvae   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:larvae|genotype:WT|treatment:Control GSM7712886 GSM7712886: Sample 3 AU1027 CTRL3; Danio rerio; ncRNA Seq GSM7712886 r1 GSM7712886 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP455342   loader:fastq load.py CTRL03_10927AAD_AGTATACT-CGAATCGG_R1_001.fastq.gz fastq 651469300.0 13029386.0 GSM7712886 r1 0:50 A:191788726;C:154951271;G:161329211;T:143399936;N:156 50       191788726 154951271 161329211 143399936 156 SRX21381117 SRS18622086 SRA1693666 CNAG CNAG 1 0.45412   0.04073   0.96934   0.88507   50   B   usable mapping rate illumina novaseq_era unknown size_fractionation unknown bulk unknown unknown   Spain 2023-08-16 Larval Larval Undetermined Undetermined
25168 25168 SRR25655091 SRX21381116 SRS18622085 SRP455342 PRJNA1005926 miR 29a is downregulated in progenies derived from chronically stressed males GSE240954 Transcriptome Analysis To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.   pubmed:37762407   Sample 2 AU1026 CTRL2 GSM7712885   source name:larvae|tissue:larvae|genotype:WT|treatment:Control|geo loc name:missing|collection date:missing Sample 2 AU1026 CTRL2 Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts larvae   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:larvae|genotype:WT|treatment:Control GSM7712885 GSM7712885: Sample 2 AU1026 CTRL2; Danio rerio; ncRNA Seq GSM7712885 r1 GSM7712885 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP455342   loader:fastq load.py CTRL02_10926AAD_CCGCGTAG-TTCTGATT_R1_001.fastq.gz fastq 754615100.0 15092302.0 GSM7712885 r1 0:50 A:217013981;C:184328493;G:188964773;T:164307508;N:345 50       217013981 184328493 188964773 164307508 345 SRX21381116 SRS18622085 SRA1693666 CNAG CNAG 1 0.48926   0.04654   0.96418   0.8889   50   B   usable mapping rate illumina novaseq_era unknown size_fractionation unknown bulk unknown unknown   Spain 2023-08-16 Larval Larval Undetermined Undetermined
25169 25169 SRR25655092 SRX21381115 SRS18622084 SRP455342 PRJNA1005926 miR 29a is downregulated in progenies derived from chronically stressed males GSE240954 Transcriptome Analysis To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.   pubmed:37762407   Sample 1 AU1024 CTRL1 GSM7712884   source name:larvae|tissue:larvae|genotype:WT|treatment:Control|geo loc name:missing|collection date:missing Sample 1 AU1024 CTRL1 Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts larvae   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:larvae|genotype:WT|treatment:Control GSM7712884 GSM7712884: Sample 1 AU1024 CTRL1; Danio rerio; ncRNA Seq GSM7712884 r1 GSM7712884 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP455342   loader:fastq load.py CTRL01_10925AAD_TTAGCCTA-AATCATCA_R1_001.fastq.gz fastq 670580700.0 13411614.0 GSM7712884 r1 0:50 A:194653643;C:158916446;G:165941477;T:151068917;N:217 50       194653643 158916446 165941477 151068917 217 SRX21381115 SRS18622084 SRA1693666 CNAG CNAG 1 0.47093   0.03457   0.97187   0.8867   50   B   usable mapping rate illumina novaseq_era unknown size_fractionation unknown bulk unknown unknown   Spain 2023-08-16 Larval Larval Undetermined Undetermined
29745 29745 SRR27467678 SRX23139228 SRS20090268 SRP482074 PRJNA1061456 tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development PRJNA1061456 Other           eggs mock R2   strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:activated eggs|collection date:2022|geo loc name:Austria|sex:mixed|tissue:activated eggs|treatment:mock|BioSampleModel:Model organism or animal                 tRAM seq of zebrafish: eggs mock rep2 EV04001 EV04001 RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.     OTHER TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP482074     EV04001.R1.fastq.gz fastq 970037880.0 6928842.0 EV04001.R1.fastq.gz 0:140 A:258735538;C:237798398;G:268588390;T:204871983;N:43571 140       258735538 237798398 268588390 204871983 43571 SRX23139228 SRS20090268 SRA1781872 Medical University of Vienna|Cell and Developmental Biology Medical University of Vienna 1 0.0   0.0   1.0       140   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation nebnext bulk unknown unknown   Austria 2024-01-09 Undetermined Embryo Undetermined Embryo Imprecise
29761 29761 SRR27437481 SRX23109816 SRS20064569 SRP482074 PRJNA1061456 tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development PRJNA1061456 Other           eggs BS R3   strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:activated eggs|collection date:2022|geo loc name:Austria|sex:mixed|tissue:activated eggs|treatment:BS|BioSampleModel:Model organism or animal                 tRAM seq of zebrafish: eggs BS rep3 EV07003 EV07003 RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.     OTHER TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP482074     EV07003.R1.fastq.gz fastq 688960160.0 4921144.0 EV07003.R1.fastq.gz 0:140 A:187831021;C:119362814;G:195214528;T:186533242;N:18555 140       187831021 119362814 195214528 186533242 18555 SRX23109816 SRS20064569 SRA1780298 Medical University of Vienna|Cell and Developmental Biology Medical University of Vienna 1 0.0   0.0   1.0       140   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation nebnext bulk unknown unknown   Austria 2024-01-06 Undetermined Embryo Undetermined Embryo Imprecise
29762 29762 SRR27437482 SRX23109815 SRS20064568 SRP482074 PRJNA1061456 tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development PRJNA1061456 Other           eggs DM R3   strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:activated eggs|collection date:2022|geo loc name:Austria|sex:mixed|tissue:activated eggs|treatment:DM|BioSampleModel:Model organism or animal                 tRAM seq of zebrafish: eggs DM rep3 EV07002 EV07002 RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.     OTHER TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP482074     EV07002.R1.fastq.gz fastq 520725380.0 3719467.0 EV07002.R1.fastq.gz 0:140 A:138972126;C:125739732;G:142785467;T:113214166;N:13889 140       138972126 125739732 142785467 113214166 13889 SRX23109815 SRS20064568 SRA1780298 Medical University of Vienna|Cell and Developmental Biology Medical University of Vienna 1 0.00014   1e-05   0.99969   0.5   140   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation nebnext bulk unknown unknown   Austria 2024-01-06 Undetermined Embryo Undetermined Embryo Imprecise
29763 29763 SRR27437483 SRX23109814 SRS20064570 SRP482074 PRJNA1061456 tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development PRJNA1061456 Other           eggs mock R3   strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:activated eggs|collection date:2022|geo loc name:Austria|sex:mixed|tissue:activated eggs|treatment:mock|BioSampleModel:Model organism or animal                 tRAM seq of zebrafish: eggs mock rep3 EV07001 EV07001 RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.     OTHER TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP482074     EV07001.R1.fastq.gz fastq 684538960.0 4889564.0 EV07001.R1.fastq.gz 0:140 A:178906891;C:169237174;G:192342342;T:144034095;N:18458 140       178906891 169237174 192342342 144034095 18458 SRX23109814 SRS20064570 SRA1780298 Medical University of Vienna|Cell and Developmental Biology Medical University of Vienna 1 0.0001   1e-05   0.99977   0.76923   140   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation nebnext bulk unknown unknown   Austria 2024-01-06 Undetermined Embryo Undetermined Embryo Imprecise
29782 29782 SRR27435867 SRX23108229 SRS20063067 SRP482074 PRJNA1061456 tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development PRJNA1061456 Other           eggs BS R4   strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:activated eggs|collection date:2022|geo loc name:Austria|sex:mixed|tissue:activated eggs|treatment:BS|BioSampleModel:Model organism or animal                 tRAM seq of zebrafish: eggs BS rep4 EV08006 EV08006 RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.     OTHER TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP482074     EV08006.R1.fastq.gz fastq 501745580.0 3583897.0 EV08006.R1.fastq.gz 0:140 A:124242793;C:76040623;G:131428076;T:170000220;N:33868 140       124242793 76040623 131428076 170000220 33868 SRX23108229 SRS20063067 SRA1780265 Medical University of Vienna|Cell and Developmental Biology Medical University of Vienna 1 4e-05   0.0   0.99993   0.66666   140   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation nebnext bulk unknown unknown   Austria 2024-01-05 Undetermined Embryo Undetermined Embryo Imprecise
29783 29783 SRR27435868 SRX23108228 SRS20063063 SRP482074 PRJNA1061456 tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development PRJNA1061456 Other           eggs DM R4   strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:activated eggs|collection date:2022|geo loc name:Austria|sex:mixed|tissue:activated eggs|treatment:DM|BioSampleModel:Model organism or animal                 tRAM seq of zebrafish: eggs DM rep4 EV08005 EV08005 RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.     OTHER TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP482074     EV08005.R1.fastq.gz fastq 740147520.0 5286768.0 EV08005.R1.fastq.gz 0:140 A:192131338;C:198130943;G:182616631;T:167216834;N:51774 140       192131338 198130943 182616631 167216834 51774 SRX23108228 SRS20063063 SRA1780265 Medical University of Vienna|Cell and Developmental Biology Medical University of Vienna 1 0.00052   8e-05   0.99922   0.92537   140   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation nebnext bulk unknown unknown   Austria 2024-01-05 Undetermined Embryo Undetermined Embryo Imprecise
29784 29784 SRR27435869 SRX23108227 SRS20063065 SRP482074 PRJNA1061456 tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development PRJNA1061456 Other           eggs mock R4   strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:activated eggs|collection date:2022|geo loc name:Austria|sex:mixed|tissue:activated eggs|treatment:mock|BioSampleModel:Model organism or animal                 tRAM seq of zebrafish: eggs mock rep4 EV08004 EV08004 RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.     OTHER TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP482074     EV08004.R1.fastq.gz fastq 761663140.0 5440451.0 EV08004.R1.fastq.gz 0:140 A:194684966;C:192212418;G:196372829;T:178340184;N:52743 140       194684966 192212418 196372829 178340184 52743 SRX23108227 SRS20063065 SRA1780265 Medical University of Vienna|Cell and Developmental Biology Medical University of Vienna 1 0.00151   0.00037   0.99884   0.82352   140   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation nebnext bulk unknown unknown   Austria 2024-01-05 Undetermined Embryo Undetermined Embryo Imprecise
39627 39627 SRR1931774 SRX970023 SRS885229 SRP056603 PRJNA279522 tRNA sequencing in Danio rerio PRJNA279522 Other Small RNA sequencing to look for disruption of CCA nucleotidyltransferase activity post TRNT1 knockdown.       WT Danio rerio tRNAseq000 WT   breed:not collected|age:5 day|sex:not collected|tissue:whole|phenotype:normal morphology|BioSampleModel:Model organism or animal                 tRNA sequencing WT tRNA sequencing WT WT 1     miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>150</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP056603     2-WT_S1_L001_R1_001.fastq.gz fastq 1588656656.0 10577741.0 tRNA sequencing WT 0:150.19 1:0 A:478698865;C:376122807;G:338649726;T:395185202;N:56 150 0     478698865 376122807 338649726 395185202 56 SRX970023 SRS885229 SRA248889 University of Iowa|Stephen A. Wynn Institute for Vision Research University of Iowa 1 3e-05   0.0   0.99989   0.4   151   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2015-08-09 Larval Larval Undetermined Undetermined
39628 39628 SRR1931761 SRX970012 SRS885221 SRP056603 PRJNA279522 tRNA sequencing in Danio rerio PRJNA279522 Other Small RNA sequencing to look for disruption of CCA nucleotidyltransferase activity post TRNT1 knockdown.       TRNT1 KD tRNAseq000 MO   breed:not collected|age:5 day|sex:not collected|tissue:whole|phenotype:normal morphology|BioSampleModel:Model organism or animal                 tRNA sequencing of TRNT1 KD tRNA sequencing of TRNT1 KD 1 1     miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>150</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP056603     3-mutant1-TRNT-M0_S2_L001_R1_001.fastq.gz fastq 1355519463.0 9025087.0 tRNA sequencing of TRNT1 KD 0:150.19 1:0 A:399052503;C:312898077;G:288848586;T:354720282;N:15 150 0     399052503 312898077 288848586 354720282 15 SRX970012 SRS885221 SRA248889 University of Iowa|Stephen A. Wynn Institute for Vision Research University of Iowa 1 0.00012   0.0   0.99965   0.78947   151   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2015-08-09 Larval Larval Undetermined Undetermined
57144 57144 SRR11218074 SRX7830305 SRS6240984 SRP251357 PRJNA609915 Small RNAs in anti tuberculosis drug induced liver injury GSE146260 Transcriptome Analysis The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.       SS 8PY GSM4369117   tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA SS 8PY The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b "GTTCAGAGTTCTACAGTCCGACGATC" b "TGGAATTCTCGGGTGCCAAGG" b "GATCGTCGGACTGTAGAACTCTGAAC" b "CCTTGGCACCCGAGAATTCCA" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample PYR 5dpf larvae Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample; Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA GSM4369117 GSM4369117: SS 8PY; Danio rerio; ncRNA Seq GSM4369117   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4369117 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251357     SS.8_PYR.fq.gz fastq 957995832.0 18784232.0 GSM4369117 r1 0:51 1:0 A:228507696;C:213417776;G:258943243;T:257032661;N:94456 51 0     228507696 213417776 258943243 257032661 94456 SRX7830305 SRS6240984 SRA1050374 GEO Centre for Immunity, Infection and Evolution 1 0.60772   0.1313   0.9877   0.5307   51   B   usable mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2020-03-03 Larval Larval Undetermined Undetermined
57145 57145 SRR11218073 SRX7830304 SRS6240983 SRP251357 PRJNA609915 Small RNAs in anti tuberculosis drug induced liver injury GSE146260 Transcriptome Analysis The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.       SS 8IN GSM4369116   tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA SS 8IN The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b "GTTCAGAGTTCTACAGTCCGACGATC" b "TGGAATTCTCGGGTGCCAAGG" b "GATCGTCGGACTGTAGAACTCTGAAC" b "CCTTGGCACCCGAGAATTCCA" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample INH 5dpf larvae Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample; Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA GSM4369116 GSM4369116: SS 8IN; Danio rerio; ncRNA Seq GSM4369116   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4369116 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251357     SS.8_INH.fq.gz fastq 469965.0 9215.0 GSM4369116 r1 0:51 1:0 A:115943;C:105774;G:126829;T:121280;N:139 51 0     115943 105774 126829 121280 139 SRX7830304 SRS6240983 SRA1050374 GEO Centre for Immunity, Infection and Evolution 1 0.63582   0.11966   0.99628   0.52244   51   B   usable mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2020-03-03 Larval Larval Undetermined Undetermined
57146 57146 SRR11218072 SRX7830303 SRS6240982 SRP251357 PRJNA609915 Small RNAs in anti tuberculosis drug induced liver injury GSE146260 Transcriptome Analysis The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.       SS 8Co GSM4369115   tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA SS 8Co The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b "GTTCAGAGTTCTACAGTCCGACGATC" b "TGGAATTCTCGGGTGCCAAGG" b "GATCGTCGGACTGTAGAACTCTGAAC" b "CCTTGGCACCCGAGAATTCCA" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample Control 5dpf larvae Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample; Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA GSM4369115 GSM4369115: SS 8Co; Danio rerio; ncRNA Seq GSM4369115   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4369115 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251357     SS.8_Control.fq.gz fastq 1016301786.0 19927486.0 GSM4369115 r1 0:51 1:0 A:234047138;C:231668317;G:283673780;T:266812487;N:100064 51 0     234047138 231668317 283673780 266812487 100064 SRX7830303 SRS6240982 SRA1050374 GEO Centre for Immunity, Infection and Evolution 1 0.45617   0.08006   0.98756   0.53318   51   B   usable mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2020-03-03 Larval Larval Undetermined Undetermined
57147 57147 SRR11218071 SRX7830302 SRS6240981 SRP251357 PRJNA609915 Small RNAs in anti tuberculosis drug induced liver injury GSE146260 Transcriptome Analysis The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.       SS 7PY GSM4369114   tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA SS 7PY The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b "GTTCAGAGTTCTACAGTCCGACGATC" b "TGGAATTCTCGGGTGCCAAGG" b "GATCGTCGGACTGTAGAACTCTGAAC" b "CCTTGGCACCCGAGAATTCCA" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample PYR 5dpf larvae Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample; Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA GSM4369114 GSM4369114: SS 7PY; Danio rerio; ncRNA Seq GSM4369114   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4369114 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251357     SS.7_PYR.fq.gz fastq 994662945.0 19503195.0 GSM4369114 r1 0:51 1:0 A:238913864;C:226034038;G:265449938;T:264166944;N:98161 51 0     238913864 226034038 265449938 264166944 98161 SRX7830302 SRS6240981 SRA1050374 GEO Centre for Immunity, Infection and Evolution 1 0.72706   0.14266   0.98796   0.45475   51   B   usable mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2020-03-03 Larval Larval Undetermined Undetermined
57148 57148 SRR11218070 SRX7830301 SRS6240980 SRP251357 PRJNA609915 Small RNAs in anti tuberculosis drug induced liver injury GSE146260 Transcriptome Analysis The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.       SS 7IN GSM4369113   tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA SS 7IN The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b "GTTCAGAGTTCTACAGTCCGACGATC" b "TGGAATTCTCGGGTGCCAAGG" b "GATCGTCGGACTGTAGAACTCTGAAC" b "CCTTGGCACCCGAGAATTCCA" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample INH 5dpf larvae Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample; Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA GSM4369113 GSM4369113: SS 7IN; Danio rerio; ncRNA Seq GSM4369113   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4369113 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251357     SS.7_INH.fq.gz fastq 698866770.0 13703270.0 GSM4369113 r1 0:51 1:0 A:163946545;C:151571623;G:188671555;T:194609709;N:67338 51 0     163946545 151571623 188671555 194609709 67338 SRX7830301 SRS6240980 SRA1050374 GEO Centre for Immunity, Infection and Evolution 1 0.5089   0.12515   0.98636   0.5449   51   B   usable mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2020-03-03 Larval Larval Undetermined Undetermined
57149 57149 SRR11218069 SRX7830300 SRS6240979 SRP251357 PRJNA609915 Small RNAs in anti tuberculosis drug induced liver injury GSE146260 Transcriptome Analysis The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.       SS 7Co GSM4369112   tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA SS 7Co The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b "GTTCAGAGTTCTACAGTCCGACGATC" b "TGGAATTCTCGGGTGCCAAGG" b "GATCGTCGGACTGTAGAACTCTGAAC" b "CCTTGGCACCCGAGAATTCCA" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample Control 5dpf larvae Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample; Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA GSM4369112 GSM4369112: SS 7Co; Danio rerio; ncRNA Seq GSM4369112   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4369112 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251357     SS.7_Control.fq.gz fastq 675141111.0 13238061.0 GSM4369112 r1 0:51 1:0 A:158015253;C:144827125;G:185064213;T:187168263;N:66257 51 0     158015253 144827125 185064213 187168263 66257 SRX7830300 SRS6240979 SRA1050374 GEO Centre for Immunity, Infection and Evolution 1 0.40459   0.10193   0.98723   0.50939   51   B   usable mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2020-03-03 Larval Larval Undetermined Undetermined
57150 57150 SRR11218068 SRX7830299 SRS6240978 SRP251357 PRJNA609915 Small RNAs in anti tuberculosis drug induced liver injury GSE146260 Transcriptome Analysis The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.       SS 6PY GSM4369111   tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA SS 6PY The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b "GTTCAGAGTTCTACAGTCCGACGATC" b "TGGAATTCTCGGGTGCCAAGG" b "GATCGTCGGACTGTAGAACTCTGAAC" b "CCTTGGCACCCGAGAATTCCA" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample PYR 5dpf larvae Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample; Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA GSM4369111 GSM4369111: SS 6PY; Danio rerio; ncRNA Seq GSM4369111   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4369111 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251357     SS.6_PYR.fq.gz fastq 750671142.0 14719042.0 GSM4369111 r1 0:51 1:0 A:179604494;C:169819225;G:201679305;T:199493837;N:74281 51 0     179604494 169819225 201679305 199493837 74281 SRX7830299 SRS6240978 SRA1050374 GEO Centre for Immunity, Infection and Evolution 1 0.6831   0.13287   0.98739   0.53779   51   B   usable mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2020-03-03 Larval Larval Undetermined Undetermined
57151 57151 SRR11218067 SRX7830298 SRS6240977 SRP251357 PRJNA609915 Small RNAs in anti tuberculosis drug induced liver injury GSE146260 Transcriptome Analysis The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.       SS 6IN GSM4369110   tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA SS 6IN The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b "GTTCAGAGTTCTACAGTCCGACGATC" b "TGGAATTCTCGGGTGCCAAGG" b "GATCGTCGGACTGTAGAACTCTGAAC" b "CCTTGGCACCCGAGAATTCCA" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample INH 5dpf larvae Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample; Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA GSM4369110 GSM4369110: SS 6IN; Danio rerio; ncRNA Seq GSM4369110   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4369110 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251357     SS.6_INH.fq.gz fastq 665736915.0 13053665.0 GSM4369110 r1 0:51 1:0 A:157656775;C:147244006;G:178619094;T:182150634;N:66406 51 0     157656775 147244006 178619094 182150634 66406 SRX7830298 SRS6240977 SRA1050374 GEO Centre for Immunity, Infection and Evolution 1 0.5998   0.13571   0.9867   0.50064   51   B   usable mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2020-03-03 Larval Larval Undetermined Undetermined
57152 57152 SRR11218066 SRX7830297 SRS6240976 SRP251357 PRJNA609915 Small RNAs in anti tuberculosis drug induced liver injury GSE146260 Transcriptome Analysis The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.       SS 6Co GSM4369109   tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA SS 6Co The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b "GTTCAGAGTTCTACAGTCCGACGATC" b "TGGAATTCTCGGGTGCCAAGG" b "GATCGTCGGACTGTAGAACTCTGAAC" b "CCTTGGCACCCGAGAATTCCA" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample Control 5dpf larvae Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample; Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA GSM4369109 GSM4369109: SS 6Co; Danio rerio; ncRNA Seq GSM4369109   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4369109 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251357     SS.6_Control.fq.gz fastq 615356565.0 12065815.0 GSM4369109 r1 0:51 1:0 A:145586024;C:131520739;G:167413237;T:170777582;N:58983 51 0     145586024 131520739 167413237 170777582 58983 SRX7830297 SRS6240976 SRA1050374 GEO Centre for Immunity, Infection and Evolution 1 0.43246   0.11481   0.98721   0.51875   51   B   usable mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2020-03-03 Larval Larval Undetermined Undetermined
57153 57153 SRR11218065 SRX7830296 SRS6240975 SRP251357 PRJNA609915 Small RNAs in anti tuberculosis drug induced liver injury GSE146260 Transcriptome Analysis The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.       SS 5PY GSM4369108   tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA SS 5PY The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b "GTTCAGAGTTCTACAGTCCGACGATC" b "TGGAATTCTCGGGTGCCAAGG" b "GATCGTCGGACTGTAGAACTCTGAAC" b "CCTTGGCACCCGAGAATTCCA" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample PYR 5dpf larvae Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample; Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA GSM4369108 GSM4369108: SS 5PY; Danio rerio; ncRNA Seq GSM4369108   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4369108 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251357     SS.5_PYR.fq.gz fastq 765220677.0 15004327.0 GSM4369108 r1 0:51 1:0 A:184664309;C:170899633;G:204508602;T:205072262;N:75871 51 0     184664309 170899633 204508602 205072262 75871 SRX7830296 SRS6240975 SRA1050374 GEO Centre for Immunity, Infection and Evolution 1 0.68375   0.14802   0.98819   0.54732   51   B   usable mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2020-03-03 Larval Larval Undetermined Undetermined
57154 57154 SRR11218064 SRX7830295 SRS6240974 SRP251357 PRJNA609915 Small RNAs in anti tuberculosis drug induced liver injury GSE146260 Transcriptome Analysis The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.       SS 5IN GSM4369107   tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA SS 5IN The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b "GTTCAGAGTTCTACAGTCCGACGATC" b "TGGAATTCTCGGGTGCCAAGG" b "GATCGTCGGACTGTAGAACTCTGAAC" b "CCTTGGCACCCGAGAATTCCA" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample INH 5dpf larvae Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample; Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA GSM4369107 GSM4369107: SS 5IN; Danio rerio; ncRNA Seq GSM4369107   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4369107 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251357     SS.5_INH.fq.gz fastq 814440114.0 15969414.0 GSM4369107 r1 0:51 1:0 A:190771507;C:181466379;G:220318895;T:221802003;N:81330 51 0     190771507 181466379 220318895 221802003 81330 SRX7830295 SRS6240974 SRA1050374 GEO Centre for Immunity, Infection and Evolution 1 0.58304   0.11681   0.98725   0.53607   51   B   usable mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2020-03-03 Larval Larval Undetermined Undetermined
57155 57155 SRR11218063 SRX7830294 SRS6240973 SRP251357 PRJNA609915 Small RNAs in anti tuberculosis drug induced liver injury GSE146260 Transcriptome Analysis The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.       SS 5Co GSM4369106   tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA SS 5Co The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b "GTTCAGAGTTCTACAGTCCGACGATC" b "TGGAATTCTCGGGTGCCAAGG" b "GATCGTCGGACTGTAGAACTCTGAAC" b "CCTTGGCACCCGAGAATTCCA" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample Control 5dpf larvae Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample; Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA GSM4369106 GSM4369106: SS 5Co; Danio rerio; ncRNA Seq GSM4369106   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4369106 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251357     SS.5_Control.fq.gz fastq 677415660.0 13282660.0 GSM4369106 r1 0:51 1:0 A:159925012;C:146760884;G:184475935;T:186186960;N:66869 51 0     159925012 146760884 184475935 186186960 66869 SRX7830294 SRS6240973 SRA1050374 GEO Centre for Immunity, Infection and Evolution 1 0.48645   0.11412   0.98701   0.5051   51   B   usable mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2020-03-03 Larval Larval Undetermined Undetermined
57156 57156 SRR11218062 SRX7830293 SRS6240972 SRP251357 PRJNA609915 Small RNAs in anti tuberculosis drug induced liver injury GSE146260 Transcriptome Analysis The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.       SS 4PY GSM4369105   tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA SS 4PY The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b "GTTCAGAGTTCTACAGTCCGACGATC" b "TGGAATTCTCGGGTGCCAAGG" b "GATCGTCGGACTGTAGAACTCTGAAC" b "CCTTGGCACCCGAGAATTCCA" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample PYR 5dpf larvae Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample; Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA GSM4369105 GSM4369105: SS 4PY; Danio rerio; ncRNA Seq GSM4369105   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4369105 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251357     SS.4_PYR.fq.gz fastq 708855120.0 13899120.0 GSM4369105 r1 0:51 1:0 A:166247754;C:166449883;G:193535378;T:182549405;N:72700 51 0     166247754 166449883 193535378 182549405 72700 SRX7830293 SRS6240972 SRA1050374 GEO Centre for Immunity, Infection and Evolution 1 0.71998   0.10284   0.9865   0.51364   51   B   usable mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2020-03-03 Larval Larval Undetermined Undetermined
57157 57157 SRR11218061 SRX7830292 SRS6240971 SRP251357 PRJNA609915 Small RNAs in anti tuberculosis drug induced liver injury GSE146260 Transcriptome Analysis The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.       SS 4IN GSM4369104   tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA SS 4IN The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b "GTTCAGAGTTCTACAGTCCGACGATC" b "TGGAATTCTCGGGTGCCAAGG" b "GATCGTCGGACTGTAGAACTCTGAAC" b "CCTTGGCACCCGAGAATTCCA" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample INH 5dpf larvae Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample; Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA GSM4369104 GSM4369104: SS 4IN; Danio rerio; ncRNA Seq GSM4369104   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4369104 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251357     SS.4_INH.fq.gz fastq 1113750597.0 21838247.0 GSM4369104 r1 0:51 1:0 A:258675243;C:241304435;G:306760462;T:306899964;N:110493 51 0     258675243 241304435 306760462 306899964 110493 SRX7830292 SRS6240971 SRA1050374 GEO Centre for Immunity, Infection and Evolution 1 0.38867   0.10253   0.98739   0.54594   51   B   usable mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2020-03-03 Larval Larval Undetermined Undetermined
57158 57158 SRR11218060 SRX7830291 SRS6240970 SRP251357 PRJNA609915 Small RNAs in anti tuberculosis drug induced liver injury GSE146260 Transcriptome Analysis The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.       SS 4Co GSM4369103   tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA SS 4Co The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b "GTTCAGAGTTCTACAGTCCGACGATC" b "TGGAATTCTCGGGTGCCAAGG" b "GATCGTCGGACTGTAGAACTCTGAAC" b "CCTTGGCACCCGAGAATTCCA" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample Control 5dpf larvae Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample; Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA GSM4369103 GSM4369103: SS 4Co; Danio rerio; ncRNA Seq GSM4369103   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4369103 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251357     SS.4_Control.fq.gz fastq 837457944.0 16420744.0 GSM4369103 r1 0:51 1:0 A:194913060;C:201962625;G:234236177;T:206260303;N:85779 51 0     194913060 201962625 234236177 206260303 85779 SRX7830291 SRS6240970 SRA1050374 GEO Centre for Immunity, Infection and Evolution 1 0.78427   0.07281   0.98938   0.51853   51   B   usable mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2020-03-03 Larval Larval Undetermined Undetermined
57159 57159 SRR11218059 SRX7830290 SRS6240969 SRP251357 PRJNA609915 Small RNAs in anti tuberculosis drug induced liver injury GSE146260 Transcriptome Analysis The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.       SS 3PY GSM4369102   tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA SS 3PY The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b "GTTCAGAGTTCTACAGTCCGACGATC" b "TGGAATTCTCGGGTGCCAAGG" b "GATCGTCGGACTGTAGAACTCTGAAC" b "CCTTGGCACCCGAGAATTCCA" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample PYR 5dpf larvae Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample; Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA GSM4369102 GSM4369102: SS 3PY; Danio rerio; ncRNA Seq GSM4369102   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4369102 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251357     SS.3_PYR.fq.gz fastq 760961157.0 14920807.0 GSM4369102 r1 0:51 1:0 A:180329733;C:162762377;G:203401780;T:214391898;N:75369 51 0     180329733 162762377 203401780 214391898 75369 SRX7830290 SRS6240969 SRA1050374 GEO Centre for Immunity, Infection and Evolution 1 0.52001   0.13578   0.98721   0.54044   51   B   usable mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2020-03-03 Larval Larval Undetermined Undetermined
57160 57160 SRR11218058 SRX7830289 SRS6240968 SRP251357 PRJNA609915 Small RNAs in anti tuberculosis drug induced liver injury GSE146260 Transcriptome Analysis The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.       SS 3IN GSM4369101   tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA SS 3IN The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b "GTTCAGAGTTCTACAGTCCGACGATC" b "TGGAATTCTCGGGTGCCAAGG" b "GATCGTCGGACTGTAGAACTCTGAAC" b "CCTTGGCACCCGAGAATTCCA" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample INH 5dpf larvae Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample; Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA GSM4369101 GSM4369101: SS 3IN; Danio rerio; ncRNA Seq GSM4369101   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4369101 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251357     SS.3_INH.fq.gz fastq 1018682364.0 19974164.0 GSM4369101 r1 0:51 1:0 A:234817384;C:219512001;G:281378236;T:282876741;N:98002 51 0     234817384 219512001 281378236 282876741 98002 SRX7830289 SRS6240968 SRA1050374 GEO Centre for Immunity, Infection and Evolution 1 0.35713   0.09659   0.98642   0.48819   51   B   usable mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2020-03-03 Larval Larval Undetermined Undetermined
57161 57161 SRR11218057 SRX7830288 SRS6240967 SRP251357 PRJNA609915 Small RNAs in anti tuberculosis drug induced liver injury GSE146260 Transcriptome Analysis The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.       SS 3Co GSM4369100   tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA SS 3Co The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b "GTTCAGAGTTCTACAGTCCGACGATC" b "TGGAATTCTCGGGTGCCAAGG" b "GATCGTCGGACTGTAGAACTCTGAAC" b "CCTTGGCACCCGAGAATTCCA" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample Control 5dpf larvae Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample; Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA GSM4369100 GSM4369100: SS 3Co; Danio rerio; ncRNA Seq GSM4369100   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4369100 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251357     SS.3_Control.fq.gz fastq 801765339.0 15720889.0 GSM4369100 r1 0:51 1:0 A:188213764;C:176265401;G:220274116;T:216937235;N:74823 51 0     188213764 176265401 220274116 216937235 74823 SRX7830288 SRS6240967 SRA1050374 GEO Centre for Immunity, Infection and Evolution 1 0.49039   0.09948   0.98794   0.53195   51   B   usable mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2020-03-03 Larval Larval Undetermined Undetermined
57162 57162 SRR11218056 SRX7830287 SRS6240966 SRP251357 PRJNA609915 Small RNAs in anti tuberculosis drug induced liver injury GSE146260 Transcriptome Analysis The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.       SS 2PY GSM4369099   tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA SS 2PY The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b "GTTCAGAGTTCTACAGTCCGACGATC" b "TGGAATTCTCGGGTGCCAAGG" b "GATCGTCGGACTGTAGAACTCTGAAC" b "CCTTGGCACCCGAGAATTCCA" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample PYR 5dpf larvae Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample; Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA GSM4369099 GSM4369099: SS 2PY; Danio rerio; ncRNA Seq GSM4369099   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4369099 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251357     SS.2_PYR.fq.gz fastq 574313805.0 11261055.0 GSM4369099 r1 0:51 1:0 A:135292244;C:131200630;G:155228609;T:152535200;N:57122 51 0     135292244 131200630 155228609 152535200 57122 SRX7830287 SRS6240966 SRA1050374 GEO Centre for Immunity, Infection and Evolution 1 0.66365   0.11507   0.98687   0.51107   51   B   usable mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2020-03-03 Larval Larval Undetermined Undetermined
57163 57163 SRR11218055 SRX7830286 SRS6240965 SRP251357 PRJNA609915 Small RNAs in anti tuberculosis drug induced liver injury GSE146260 Transcriptome Analysis The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.       SS 2IN GSM4369098   tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA SS 2IN The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b "GTTCAGAGTTCTACAGTCCGACGATC" b "TGGAATTCTCGGGTGCCAAGG" b "GATCGTCGGACTGTAGAACTCTGAAC" b "CCTTGGCACCCGAGAATTCCA" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample INH 5dpf larvae Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample; Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA GSM4369098 GSM4369098: SS 2IN; Danio rerio; ncRNA Seq GSM4369098   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4369098 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251357     SS.2_INH.fq.gz fastq 807418230.0 15831730.0 GSM4369098 r1 0:51 1:0 A:190588465;C:176108754;G:219052662;T:221586329;N:82020 51 0     190588465 176108754 219052662 221586329 82020 SRX7830286 SRS6240965 SRA1050374 GEO Centre for Immunity, Infection and Evolution 1 0.47844   0.10981   0.98723   0.54721   51   B   usable mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2020-03-03 Larval Larval Undetermined Undetermined
57164 57164 SRR11218054 SRX7830285 SRS6240964 SRP251357 PRJNA609915 Small RNAs in anti tuberculosis drug induced liver injury GSE146260 Transcriptome Analysis The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.       SS 2Co GSM4369097   tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA SS 2Co The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b "GTTCAGAGTTCTACAGTCCGACGATC" b "TGGAATTCTCGGGTGCCAAGG" b "GATCGTCGGACTGTAGAACTCTGAAC" b "CCTTGGCACCCGAGAATTCCA" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample Control 5dpf larvae Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample; Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA GSM4369097 GSM4369097: SS 2Co; Danio rerio; ncRNA Seq GSM4369097   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4369097 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251357     SS.2_Control.fq.gz fastq 932774037.0 18289687.0 GSM4369097 r1 0:51 1:0 A:218099260;C:200897948;G:257769791;T:255915444;N:91594 51 0     218099260 200897948 257769791 255915444 91594 SRX7830285 SRS6240964 SRA1050374 GEO Centre for Immunity, Infection and Evolution 1 0.42164   0.09363   0.98746   0.53483   51   B   usable mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2020-03-03 Larval Larval Undetermined Undetermined
57165 57165 SRR11218053 SRX7830284 SRS6240963 SRP251357 PRJNA609915 Small RNAs in anti tuberculosis drug induced liver injury GSE146260 Transcriptome Analysis The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.       SS 1PY GSM4369096   tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA SS 1PY The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b "GTTCAGAGTTCTACAGTCCGACGATC" b "TGGAATTCTCGGGTGCCAAGG" b "GATCGTCGGACTGTAGAACTCTGAAC" b "CCTTGGCACCCGAGAATTCCA" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample PYR 5dpf larvae Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample; Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA GSM4369096 GSM4369096: SS 1PY; Danio rerio; ncRNA Seq GSM4369096   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4369096 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251357     SS.1_PYR.fq.gz fastq 616504422.0 12088322.0 GSM4369096 r1 0:51 1:0 A:145443705;C:140693898;G:166974890;T:163330321;N:61608 51 0     145443705 140693898 166974890 163330321 61608 SRX7830284 SRS6240963 SRA1050374 GEO Centre for Immunity, Infection and Evolution 1 0.65536   0.11483   0.9867   0.53016   51   B   usable mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2020-03-03 Larval Larval Undetermined Undetermined
57166 57166 SRR11218052 SRX7830283 SRS6240962 SRP251357 PRJNA609915 Small RNAs in anti tuberculosis drug induced liver injury GSE146260 Transcriptome Analysis The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.       SS 1IN GSM4369095   tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA SS 1IN The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b "GTTCAGAGTTCTACAGTCCGACGATC" b "TGGAATTCTCGGGTGCCAAGG" b "GATCGTCGGACTGTAGAACTCTGAAC" b "CCTTGGCACCCGAGAATTCCA" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample INH 5dpf larvae Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample; Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA GSM4369095 GSM4369095: SS 1IN; Danio rerio; ncRNA Seq GSM4369095   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4369095 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251357     SS.1_INH.fq.gz fastq 837218142.0 16416042.0 GSM4369095 r1 0:51 1:0 A:194291608;C:181525851;G:230886112;T:230433107;N:81464 51 0     194291608 181525851 230886112 230433107 81464 SRX7830283 SRS6240962 SRA1050374 GEO Centre for Immunity, Infection and Evolution 1 0.41653   0.09487   0.9877   0.54467   51   B   usable mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2020-03-03 Larval Larval Undetermined Undetermined
57167 57167 SRR11218051 SRX7830282 SRS6240961 SRP251357 PRJNA609915 Small RNAs in anti tuberculosis drug induced liver injury GSE146260 Transcriptome Analysis The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.       SS 1Co GSM4369094   tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA SS 1Co The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b "GTTCAGAGTTCTACAGTCCGACGATC" b "TGGAATTCTCGGGTGCCAAGG" b "GATCGTCGGACTGTAGAACTCTGAAC" b "CCTTGGCACCCGAGAATTCCA" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample Control 5dpf larvae Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample; Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. Zebrafish Danio rerio were maintained at 28.5 °C developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA GSM4369094 GSM4369094: SS 1Co; Danio rerio; ncRNA Seq GSM4369094   1 Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. GEO Accession:GSM4369094 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 550   SRP251357     SS.1_Control.fq.gz fastq 346638432.0 6796832.0 GSM4369094 r1 0:51 1:0 A:80463778;C:81241478;G:96669917;T:88228518;N:34741 51 0     80463778 81241478 96669917 88228518 34741 SRX7830282 SRS6240961 SRA1050374 GEO Centre for Immunity, Infection and Evolution 1 0.66922   0.07698   0.98829   0.52033   51   B   usable mapping rate illumina nextseq unknown size_fractionation unknown bulk unknown unknown   United States 2020-03-03 Larval Larval Undetermined Undetermined

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;