run_metadata
165 rows where experiment.library_layout = "SINGLE", experiment.library_selection = "other" and tissue_curation = "Embryo Imprecise"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 36265 | 36265 | SRR058073 | SRX022206 | SRS084221 | SRP002640 | PRJNA128943 | Expanding the MicroRNA Targeting Code: A Novel Type of Site with Centered Pairing | GSE22068 | Other | We present “centered sites ” a class of microRNA target sites that lacks both perfect seed pairing and three prime compensatory pairing and instead has 11–12 contiguous Watson–Crick pairs to the center of the microRNA. In elevated Mg2+ centered sites impart mRNA cleavage but in cells centered sites repress protein output without xxx Agronaute catalyzed cleavage. Our study also identified novel extensively paired sites that are cleavage substrates in cultured cells and human brain. This expanded repertoire of cleavage targets and the identification of the centered site type help explain why central regions of many microRNAs are evolutionarily conserved. Overall design: To study centered sites and identify miRNA cleavage targets mRNA degradomes were sequenced from human brain and HeLa cells and smallRNAs were sequenced from human brain and zebrafish embryo at 24 hpf. Replicates were combined before the analysis. Fastq files are not available for GSM548638 and GSM548639. | pubmed:20620952 | Zebrafish Embryo small RNAs | GSM548640 | source name:Embryo Cells|data type:small RNAs|tissue:embryo | Zebrafish Embryo small RNAs | Small RNA sequences from same total RNA samples were mapped to the human genome hg18 requiring a perfect match and reads co localizing to annotated miRNA loci miRBase version 11.0 were counted. sequence reads are summarized as frequency counts | Embryo Cells | The small RNA cDNA libraries were made as described Grimson et al. 2008 except for the three prime adaptor ligation which was five prime adenylated pTCGTATGCCGTCTTCTGCTTGidT. For a detailed protocol see http://web.wi.mit.edu/bartel/pub/protocols.html. | data type:small RNAs|tissue:embryo | GSM548640 | GSM548640: Zebrafish Embryo small RNAs | GSM548640: Zebrafish Embryo small RNAs | GSM548640: Zebrafish Embryo small RNAs | 1 | GEO Accession:GSM548640 | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina Genome Analyzer | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP002640 | quality book char:@|quality scoring system:log odds | Zebrafish_embryo_24h.fastq | fastq | 62213148.0 | 1728143.0 | GSM548640 1 | 0:36 | A:13550515;C:14269249;G:15670049;T:18673533;N:49802 | 36 | 13550515 | 14269249 | 15670049 | 18673533 | 49802 | SRX022206 | SRS084221 | SRA020539 | GEO | Bartel lab, Whitehead Institute | 1 | 0.02298 | 0.02186 | 0.9988 | 0.3246 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2010-06-01 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40214 | 40214 | SRR2982513 | SRX1471725 | SRS1197481 | SRP067139 | PRJNA305418 | RiboZero mRNA seq across zebrafish development for study of uORFs | PRJNA305418 | Other | Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values. | 48hpf | AG00751 mrna r0 48h | strain:TUAB|age:48hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal | AG00751 mrna r0 48h | 48h mRNA R0 | 1 | Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP067139 | AG00751_SEQ0112_R1.fastq.gz | fastq | 1859082512.0 | 24461612.0 | 48h mRNA R0 run1 | 0:76 | A:488142494;C:422062452;G:411293722;T:537489879;N:93965 | 76 | 488142494 | 422062452 | 411293722 | 537489879 | 93965 | SRX1471725 | SRS1197481 | SRA314809 | Yale University|Giraldez Lab | Yale University | 1 | 0.8583 | 0.37297 | 0.6956 | 0.46541 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | trueseq | bulk | unknown | unknown | United States | 2015-12-08 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 40215 | 40215 | SRR2982514 | SRX1471724 | SRS1197482 | SRP067139 | PRJNA305418 | RiboZero mRNA seq across zebrafish development for study of uORFs | PRJNA305418 | Other | Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values. | 24hpf | AG00750 mrna r0 24h | strain:TUAB|age:24hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal | AG00750 mrna r0 24h | 24h mRNA R0 | 1 | Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP067139 | AG00750_SEQ0114_R1.fastq.gz | fastq | 2124277824.0 | 27951024.0 | 24h mRNA R0 run1 | 0:76 | A:537946274;C:496576029;G:477023623;T:612576823;N:155075 | 76 | 537946274 | 496576029 | 477023623 | 612576823 | 155075 | SRX1471724 | SRS1197482 | SRA314809 | Yale University|Giraldez Lab | Yale University | 1 | 0.86054 | 0.27207 | 0.69877 | 0.47063 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | trueseq | bulk | unknown | unknown | United States | 2015-12-08 | Pharyngula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 40216 | 40216 | SRR2982511 | SRX1471723 | SRS1197479 | SRP067139 | PRJNA305418 | RiboZero mRNA seq across zebrafish development for study of uORFs | PRJNA305418 | Other | Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values. | 12hpf | AG00434 mrna r0 12h | strain:TUAB|age:12hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal | AG00434 mrna r0 12h | 12h mRNA R0 | 1 | Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP067139 | AG00434_SEQ0071_R1.fastq.gz | fastq | 1990422368.0 | 26189768.0 | 12h mRNA R0 run1 | 0:76 | A:512242204;C:469314942;G:452176134;T:556618667;N:70421 | 76 | 512242204 | 469314942 | 452176134 | 556618667 | 70421 | SRX1471723 | SRS1197479 | SRA314809 | Yale University|Giraldez Lab | Yale University | 1 | 0.88085 | 0.297 | 0.71711 | 0.46053 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | trueseq | bulk | unknown | unknown | United States | 2015-12-08 | Segmentation | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 40217 | 40217 | SRR2982512 | SRX1471722 | SRS1197480 | SRP067139 | PRJNA305418 | RiboZero mRNA seq across zebrafish development for study of uORFs | PRJNA305418 | Other | Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values. | 5hpf | AG00749 mrna r0 5h | strain:TUAB|age:5hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal | AG00749 mrna r0 5h | 5h mRNA R0 | 1 | Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP067139 | AG00749_SEQ0114_R1.fastq.gz | fastq | 3163721996.0 | 41627921.0 | 5h mRNA R0 run1 | 0:76 | A:724093110;C:806620205;G:798759186;T:834042462;N:207033 | 76 | 724093110 | 806620205 | 798759186 | 834042462 | 207033 | SRX1471722 | SRS1197480 | SRA314809 | Yale University|Giraldez Lab | Yale University | 1 | 0.75274 | 0.23572 | 0.75448 | 0.47885 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | trueseq | bulk | unknown | unknown | United States | 2015-12-08 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 40218 | 40218 | SRR2982510 | SRX1471511 | SRS1197399 | SRP067139 | PRJNA305418 | RiboZero mRNA seq across zebrafish development for study of uORFs | PRJNA305418 | Other | Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values. | 2hpf | AG00244 mrna r0 2h | strain:TUAB|age:2hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal | AG00244 mrna r0 2h | 2h mRNA R0 | 1 | Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP067139 | AG00244_SEQ0039_R1.fastq.gz | fastq | 1010085524.0 | 13290599.0 | 2h mRNA R0 run1 | 0:76 | A:196715560;C:309406513;G:286228000;T:217670217;N:65234 | 76 | 196715560 | 309406513 | 286228000 | 217670217 | 65234 | SRX1471511 | SRS1197399 | SRA314809 | Yale University|Giraldez Lab | Yale University | 1 | 0.89974 | 0.14215 | 0.79488 | 0.72171 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | trueseq | bulk | unknown | unknown | United States | 2015-12-08 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 40249 | 40249 | SRR3038049 | SRX1494244 | SRS1217111 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | IgG iCLIP zf ZGA rep3 | GSM1976593 | tissue:zebrafish embryo|developmental stage:ZGA 1K cell stage|antibody:anti IgG|barcode sequence:NNNTGGCNN | IgG iCLIP zf ZGA rep3 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:ZGA 1K cell stage|antibody:anti IgG|barcode sequence:NNNTGGCNN | GSM1976593 | GSM1976593: IgG iCLIP zf ZGA rep3; Danio rerio; OTHER | GSM1976593 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976593 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_IgG_zebrafishembryo_wt_1K_IgGcontrol_Dr_NNNTGGCNN_20140613_L4333_4.fq.gz | fastq | 82722124.0 | 1088449.0 | GSM1976593 r1 | 0:76 | A:21959870;C:19048567;G:22289272;T:19403630;N:20785 | 76 | 21959870 | 19048567 | 22289272 | 19403630 | 20785 | SRX1494244 | SRS1217111 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.08124 | 0.02181 | 0.98591 | 0.59183 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40250 | 40250 | SRR3038048 | SRX1494243 | SRS1217112 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | IgG iCLIP zf ZGA rep2 | GSM1976592 | tissue:zebrafish embryo|developmental stage:ZGA 1K cell stage|antibody:anti IgG|barcode sequence:NNNCCACNN | IgG iCLIP zf ZGA rep2 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:ZGA 1K cell stage|antibody:anti IgG|barcode sequence:NNNCCACNN | GSM1976592 | GSM1976592: IgG iCLIP zf ZGA rep2; Danio rerio; OTHER | GSM1976592 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976592 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_IgG_zebrafishembryo_wt_1K_IgGcontrol_Dr_NNNCCACNN_20140613_L4333_2.fq.gz | fastq | 50195036.0 | 660461.0 | GSM1976592 r1 | 0:76 | A:14249581;C:12927029;G:12969451;T:10036400;N:12575 | 76 | 14249581 | 12927029 | 12969451 | 10036400 | 12575 | SRX1494243 | SRS1217112 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.25447 | 0.03871 | 0.94556 | 0.7523 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40251 | 40251 | SRR3038047 | SRX1494242 | SRS1217113 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | IgG iCLIP zf ZGA rep1 | GSM1976591 | tissue:zebrafish embryo|developmental stage:ZGA 1K cell stage|antibody:anti IgG|barcode sequence:NNNGGCGNN | IgG iCLIP zf ZGA rep1 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:ZGA 1K cell stage|antibody:anti IgG|barcode sequence:NNNGGCGNN | GSM1976591 | GSM1976591: IgG iCLIP zf ZGA rep1; Danio rerio; OTHER | GSM1976591 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976591 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_IgG_zebrafishembryo_wt_1K_IgGcontrol_Dr_NNNGGCGNN_20140613_L4333_5.fq.gz | fastq | 453449136.0 | 5966436.0 | GSM1976591 r1 | 0:76 | A:124726528;C:101139098;G:135573575;T:91900507;N:109428 | 76 | 124726528 | 101139098 | 135573575 | 91900507 | 109428 | SRX1494242 | SRS1217113 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.51353 | 0.10729 | 0.88069 | 0.7159 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40252 | 40252 | SRR3038046 | SRX1494241 | SRS1217114 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | IgG iCLIP zf preZGA rep3 | GSM1976590 | tissue:zebrafish embryo|developmental stage:preZGA 32 cell stage|antibody:anti IgG|barcode sequence:NNNTGGCNN | IgG iCLIP zf preZGA rep3 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:preZGA 32 cell stage|antibody:anti IgG|barcode sequence:NNNTGGCNN | GSM1976590 | GSM1976590: IgG iCLIP zf preZGA rep3; Danio rerio; OTHER | GSM1976590 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976590 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_IgG_Drembryo_wt_IgGcontrol_Dr_NNNTGGCNN_20130812_hnRNPA1_4.fq.gz | fastq | 600183932.0 | 7897157.0 | GSM1976590 r1 | 0:76 | A:173843237;C:131372689;G:170729621;T:124187689;N:50696 | 76 | 173843237 | 131372689 | 170729621 | 124187689 | 50696 | SRX1494241 | SRS1217114 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.14511 | 0.03659 | 0.9332 | 0.651 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40253 | 40253 | SRR3038045 | SRX1494240 | SRS1217115 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | IgG iCLIP zf preZGA rep2 | GSM1976589 | tissue:zebrafish embryo|developmental stage:preZGA 32 cell stage|antibody:anti IgG|barcode sequence:NNNCCGGNN | IgG iCLIP zf preZGA rep2 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:preZGA 32 cell stage|antibody:anti IgG|barcode sequence:NNNCCGGNN | GSM1976589 | GSM1976589: IgG iCLIP zf preZGA rep2; Danio rerio; OTHER | GSM1976589 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976589 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_IgG_Drembryo_wt_IgGcontrol_Dr_NNNCCGGNN_20130812_hnRNPA1_5.fq.gz | fastq | 612280168.0 | 8056318.0 | GSM1976589 r1 | 0:76 | A:175101988;C:144456623;G:172272609;T:120400014;N:48934 | 76 | 175101988 | 144456623 | 172272609 | 120400014 | 48934 | SRX1494240 | SRS1217115 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.05322 | 0.01649 | 0.97656 | 0.67242 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40254 | 40254 | SRR3038044 | SRX1494239 | SRS1217116 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | IgG iCLIP zf preZGA rep1 | GSM1976588 | tissue:zebrafish embryo|developmental stage:preZGA 32 cell stage|antibody:anti IgG|barcode sequence:NNNGGCGNN | IgG iCLIP zf preZGA rep1 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:preZGA 32 cell stage|antibody:anti IgG|barcode sequence:NNNGGCGNN | GSM1976588 | GSM1976588: IgG iCLIP zf preZGA rep1; Danio rerio; OTHER | GSM1976588 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976588 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_IgG_Drembryo_wt_IgGcontrol_Dr_NNNGGCGNN_20130812_hnRNPA1_1.fq-3.gz | fastq | 12806760.0 | 168510.0 | GSM1976588 r1 | 0:76 | A:3652525;C:2758781;G:3842061;T:2552042;N:1351 | 76 | 3652525 | 2758781 | 3842061 | 2552042 | 1351 | SRX1494239 | SRS1217116 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.02784 | 0.01181 | 0.99813 | 0.68217 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40255 | 40255 | SRR3038043 | SRX1494238 | SRS1217117 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | hnRNP A1 iCLIP zf ZGA rep4 | GSM1976587 | tissue:zebrafish embryo|developmental stage:ZGA 1K cell stage|antibody:anti hnRNP A1|barcode sequence:NNNGGTCNN | hnRNP A1 iCLIP zf ZGA rep4 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:ZGA 1K cell stage|antibody:anti hnRNP A1|barcode sequence:NNNGGTCNN | GSM1976587 | GSM1976587: hnRNP A1 iCLIP zf ZGA rep4; Danio rerio; OTHER | GSM1976587 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976587 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_hnRNPA1_zebrafishembryo_wt_1K_hnRNPA1_Dr_NNNGGTCNN_20140613_L4333_6.fq.gz | fastq | 2884007568.0 | 37947468.0 | GSM1976587 r1 | 0:76 | A:936463452;C:557587142;G:746595510;T:642623181;N:738283 | 76 | 936463452 | 557587142 | 746595510 | 642623181 | 738283 | SRX1494238 | SRS1217117 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.38306 | 0.08291 | 0.80568 | 0.62132 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40256 | 40256 | SRR3038042 | SRX1494237 | SRS1217118 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | hnRNP A1 iCLIP zf ZGA rep3 | GSM1976586 | tissue:zebrafish embryo|developmental stage:ZGA 1K cell stage|antibody:anti hnRNP A1|barcode sequence:NNNCAATNN | hnRNP A1 iCLIP zf ZGA rep3 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:ZGA 1K cell stage|antibody:anti hnRNP A1|barcode sequence:NNNCAATNN | GSM1976586 | GSM1976586: hnRNP A1 iCLIP zf ZGA rep3; Danio rerio; OTHER | GSM1976586 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976586 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_hnRNPA1_zebrafishembryo_wt_1K_hnRNPA1_Dr_NNNCAATNN_20140613_L4333_3.fq.gz | fastq | 3875071508.0 | 50987783.0 | GSM1976586 r1 | 0:76 | A:1328984506;C:775814536;G:956147632;T:813109146;N:1015688 | 76 | 1328984506 | 775814536 | 956147632 | 813109146 | 1015688 | SRX1494237 | SRS1217118 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.35787 | 0.0904 | 0.81874 | 0.64706 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40257 | 40257 | SRR3038041 | SRX1494236 | SRS1217119 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | hnRNP A1 iCLIP zf ZGA rep2 | GSM1976585 | tissue:zebrafish embryo|developmental stage:ZGA 1K cell stage|antibody:anti hnRNP A1|barcode sequence:NNNTTGTNN | hnRNP A1 iCLIP zf ZGA rep2 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:ZGA 1K cell stage|antibody:anti hnRNP A1|barcode sequence:NNNTTGTNN | GSM1976585 | GSM1976585: hnRNP A1 iCLIP zf ZGA rep2; Danio rerio; OTHER | GSM1976585 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976585 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_hnRNPA1_zebrafishembryo_wt_1K_hnRNPA1_Dr_NNNTTGTNN_20140613_L4333_1.fq.gz | fastq | 3482039180.0 | 45816305.0 | GSM1976585 r1 | 0:76 | A:1093877493;C:647486562;G:914636686;T:825135975;N:902464 | 76 | 1093877493 | 647486562 | 914636686 | 825135975 | 902464 | SRX1494236 | SRS1217119 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.29908 | 0.07356 | 0.83459 | 0.62976 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40258 | 40258 | SRR3038040 | SRX1494235 | SRS1217120 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | hnRNP A1 iCLIP zf ZGA rep1 | GSM1976584 | tissue:zebrafish embryo|developmental stage:ZGA 1K cell stage|antibody:anti hnRNP A1|barcode sequence:NNNGGTTNN | hnRNP A1 iCLIP zf ZGA rep1 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:ZGA 1K cell stage|antibody:anti hnRNP A1|barcode sequence:NNNGGTTNN | GSM1976584 | GSM1976584: hnRNP A1 iCLIP zf ZGA rep1; Danio rerio; OTHER | GSM1976584 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976584 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_hnRNPA1_zebrafishembryo_wt_1K_hnRNPA1_Dr_NNNGGTTNN_20140613_L4333_7.fq.gz | fastq | 3547711920.0 | 46680420.0 | GSM1976584 r1 | 0:76 | A:1105542969;C:658172853;G:958654426;T:824422930;N:918742 | 76 | 1105542969 | 658172853 | 958654426 | 824422930 | 918742 | SRX1494235 | SRS1217120 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.34257 | 0.08694 | 0.83055 | 0.64965 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40259 | 40259 | SRR3038039 | SRX1494234 | SRS1217121 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | hnRNP A1 iCLIP zf preZGA rep3 | GSM1976583 | tissue:zebrafish embryo|developmental stage:preZGA 32 cell stage|antibody:anti hnRNP A1|barcode sequence:NNNCAATNN | hnRNP A1 iCLIP zf preZGA rep3 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:preZGA 32 cell stage|antibody:anti hnRNP A1|barcode sequence:NNNCAATNN | GSM1976583 | GSM1976583: hnRNP A1 iCLIP zf preZGA rep3; Danio rerio; OTHER | GSM1976583 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976583 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_hnRNPA1_Drembryo_wt_hnRNPA1_Dr_NNNCAATNN_20130812_hnRNPA1_3.fq.gz | fastq | 1944912200.0 | 25590950.0 | GSM1976583 r1 | 0:76 | A:611172831;C:390755201;G:517844203;T:424973726;N:166239 | 76 | 611172831 | 390755201 | 517844203 | 424973726 | 166239 | SRX1494234 | SRS1217121 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.23819 | 0.06019 | 0.85318 | 0.72811 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40260 | 40260 | SRR3038038 | SRX1494233 | SRS1217122 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | hnRNP A1 iCLIP zf preZGA rep2 | GSM1976582 | tissue:zebrafish embryo|developmental stage:preZGA 32 cell stage|antibody:anti hnRNP A1|barcode sequence:NNNTTGTNN | hnRNP A1 iCLIP zf preZGA rep2 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:preZGA 32 cell stage|antibody:anti hnRNP A1|barcode sequence:NNNTTGTNN | GSM1976582 | GSM1976582: hnRNP A1 iCLIP zf preZGA rep2; Danio rerio; OTHER | GSM1976582 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976582 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_hnRNPA1_Drembryo_wt_hnRNPA1_Dr_NNNTTGTNN_20130812_hnRNPA1_6.fq.gz | fastq | 1804236124.0 | 23739949.0 | GSM1976582 r1 | 0:76 | A:520750722;C:337743522;G:499109535;T:446481275;N:151070 | 76 | 520750722 | 337743522 | 499109535 | 446481275 | 151070 | SRX1494233 | SRS1217122 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.25184 | 0.06217 | 0.85687 | 0.67912 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40261 | 40261 | SRR3038037 | SRX1494232 | SRS1217123 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | hnRNP A1 iCLIP zf preZGA rep1 | GSM1976581 | tissue:zebrafish embryo|developmental stage:preZGA 32 cell stage|antibody:anti hnRNP A1|barcode sequence:NNNGGTTNN | hnRNP A1 iCLIP zf preZGA rep1 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:preZGA 32 cell stage|antibody:anti hnRNP A1|barcode sequence:NNNGGTTNN | GSM1976581 | GSM1976581: hnRNP A1 iCLIP zf preZGA rep1; Danio rerio; OTHER | GSM1976581 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976581 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_hnRNPA1_Drembryo_wt_hnRNPA1_Dr_NNNGGTTNN_20130812_hnRNPA1_2.fq.gz | fastq | 2155200476.0 | 28357901.0 | GSM1976581 r1 | 0:76 | A:646739355;C:394864638;G:606938658;T:506474548;N:183277 | 76 | 646739355 | 394864638 | 606938658 | 506474548 | 183277 | SRX1494232 | SRS1217123 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.24207 | 0.05859 | 0.84747 | 0.70564 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 41548 | 41548 | SRR5017075 | SRX2345570 | SRS1796136 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | input shield rep2 | GSM2390028 | tissue:Embryos|developmental stage:Shield stage embryos|strain:AB wild type | input shield rep2 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:Shield stage embryos|strain:AB wild type | GSM2390028 | GSM2390028: input shield rep2; Danio rerio; RIP Seq | GSM2390028 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390028 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | input_shield_rep2.fastq.gz | fastq | 6559838034.0 | 69785511.0 | GSM2390028 r1 | 0:94 | A:1785772532;C:1552902091;G:1571407685;T:1649464013;N:291713 | 94 | 1785772532 | 1552902091 | 1571407685 | 1649464013 | 291713 | SRX2345570 | SRS1796136 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.03627 | 0.01 | 0.96676 | 0.66777 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41549 | 41549 | SRR5017074 | SRX2345569 | SRS1796134 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | input shield rep1 | GSM2390027 | tissue:Embryos|developmental stage:Shield stage embryos|strain:AB wild type | input shield rep1 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:Shield stage embryos|strain:AB wild type | GSM2390027 | GSM2390027: input shield rep1; Danio rerio; RIP Seq | GSM2390027 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390027 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | input_shield_rep1.fastq.gz | fastq | 3765873214.0 | 40062481.0 | GSM2390027 r1 | 0:94 | A:1002751444;C:902509483;G:908627718;T:951814220;N:170349 | 94 | 1002751444 | 902509483 | 908627718 | 951814220 | 170349 | SRX2345569 | SRS1796134 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.03936 | 0.01095 | 0.96518 | 0.68725 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41550 | 41550 | SRR5017073 | SRX2345568 | SRS1796132 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | ip shield rep2 | GSM2390026 | tissue:Embryos|developmental stage:Shield stage embryos|strain:AB wild type | ip shield rep2 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:Shield stage embryos|strain:AB wild type | GSM2390026 | GSM2390026: ip shield rep2; Danio rerio; RIP Seq | GSM2390026 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390026 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | ip_shield_rep2.fastq | fastq | 3855863926.0 | 41019829.0 | GSM2390026 r1 | 0:94 | A:1044010018;C:931492803;G:952890289;T:926349254;N:1121562 | 94 | 1044010018 | 931492803 | 952890289 | 926349254 | 1121562 | SRX2345568 | SRS1796132 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.03311 | 0.00481 | 0.96337 | 0.68612 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41551 | 41551 | SRR5017072 | SRX2345567 | SRS1796131 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | ip shield rep1 | GSM2390025 | tissue:Embryos|developmental stage:Shield stage embryos|strain:AB wild type | ip shield rep1 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:Shield stage embryos|strain:AB wild type | GSM2390025 | GSM2390025: ip shield rep1; Danio rerio; RIP Seq | GSM2390025 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390025 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | ip_shield_rep1.fastq.gz | fastq | 4107624502.0 | 43698133.0 | GSM2390025 r1 | 0:94 | A:1087077899;C:996101257;G:1020588721;T:1002667943;N:1188682 | 94 | 1087077899 | 996101257 | 1020588721 | 1002667943 | 1188682 | SRX2345567 | SRS1796131 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.01898 | 0.00264 | 0.97238 | 0.59809 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41552 | 41552 | SRR5017071 | SRX2345566 | SRS1796152 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | input sphere rep2 | GSM2390024 | tissue:Embryos|developmental stage:sphere stage embryos|strain:AB wild type | input sphere rep2 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:sphere stage embryos|strain:AB wild type | GSM2390024 | GSM2390024: input sphere rep2; Danio rerio; RIP Seq | GSM2390024 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390024 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | input_sphere_rep2.fastq.gz | fastq | 3684856024.0 | 39200596.0 | GSM2390024 r1 | 0:94 | A:991404019;C:883789087;G:892976599;T:916520929;N:165390 | 94 | 991404019 | 883789087 | 892976599 | 916520929 | 165390 | SRX2345566 | SRS1796152 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.03619 | 0.00867 | 0.96051 | 0.63934 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41553 | 41553 | SRR5017070 | SRX2345565 | SRS1796139 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | input sphere rep1 | GSM2390023 | tissue:Embryos|developmental stage:sphere stage embryos|strain:AB wild type | input sphere rep1 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:sphere stage embryos|strain:AB wild type | GSM2390023 | GSM2390023: input sphere rep1; Danio rerio; RIP Seq | GSM2390023 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390023 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | input_sphere_rep1.fastq.gz | fastq | 3774515574.0 | 40154421.0 | GSM2390023 r1 | 0:94 | A:1014569244;C:912257296;G:925742711;T:921776107;N:170216 | 94 | 1014569244 | 912257296 | 925742711 | 921776107 | 170216 | SRX2345565 | SRS1796139 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.04287 | 0.00892 | 0.95085 | 0.50435 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41554 | 41554 | SRR5017069 | SRX2345564 | SRS1796133 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | ip sphere rep2 | GSM2390022 | tissue:Embryos|developmental stage:sphere stage embryos|strain:AB wild type | ip sphere rep2 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:sphere stage embryos|strain:AB wild type | GSM2390022 | GSM2390022: ip sphere rep2; Danio rerio; RIP Seq | GSM2390022 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390022 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | ip_sphere_rep2.fastq.gz | fastq | 3926426624.0 | 41770496.0 | GSM2390022 r1 | 0:94 | A:1037910962;C:957162730;G:963824694;T:966381238;N:1147000 | 94 | 1037910962 | 957162730 | 963824694 | 966381238 | 1147000 | SRX2345564 | SRS1796133 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.03492 | 0.00427 | 0.95026 | 0.60529 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41555 | 41555 | SRR5017068 | SRX2345563 | SRS1796143 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | ip sphere rep1 | GSM2390021 | tissue:Embryos|developmental stage:sphere stage embryos|strain:AB wild type | ip sphere rep1 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:sphere stage embryos|strain:AB wild type | GSM2390021 | GSM2390021: ip sphere rep1; Danio rerio; RIP Seq | GSM2390021 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390021 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | ip_sphere_rep1.fastq.gz | fastq | 4185867000.0 | 44530500.0 | GSM2390021 r1 | 0:94 | A:1114959829;C:1018236207;G:1019156922;T:1032304051;N:1209991 | 94 | 1114959829 | 1018236207 | 1019156922 | 1032304051 | 1209991 | SRX2345563 | SRS1796143 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.03035 | 0.00288 | 0.94757 | 0.5787 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41556 | 41556 | SRR5017067 | SRX2345562 | SRS1796129 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | input 64cell rep2 | GSM2390020 | tissue:Embryos|developmental stage:64 cell embryos|strain:AB wild type | input 64cell rep2 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:64 cell embryos|strain:AB wild type | GSM2390020 | GSM2390020: input 64cell rep2; Danio rerio; RIP Seq | GSM2390020 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390020 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | input_64cell_rep2.fastq.gz | fastq | 3598782386.0 | 38284919.0 | GSM2390020 r1 | 0:94 | A:953869445;C:864903757;G:875832539;T:903947732;N:228913 | 94 | 953869445 | 864903757 | 875832539 | 903947732 | 228913 | SRX2345562 | SRS1796129 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.04289 | 0.00757 | 0.9418 | 0.6078 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41557 | 41557 | SRR5017066 | SRX2345561 | SRS1796141 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | input 64cell rep1 | GSM2390019 | tissue:Embryos|developmental stage:64 cell embryos|strain:AB wild type | input 64cell rep1 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:64 cell embryos|strain:AB wild type | GSM2390019 | GSM2390019: input 64cell rep1; Danio rerio; RIP Seq | GSM2390019 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390019 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | input_64cell_rep1.fastq.gz | fastq | 3538898746.0 | 37647859.0 | GSM2390019 r1 | 0:94 | A:916878511;C:870431252;G:873611680;T:877750503;N:226800 | 94 | 916878511 | 870431252 | 873611680 | 877750503 | 226800 | SRX2345561 | SRS1796141 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.03397 | 0.00616 | 0.95268 | 0.62545 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41558 | 41558 | SRR5017065 | SRX2345560 | SRS1796153 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | ip 64cell rep2 | GSM2390018 | tissue:Embryos|developmental stage:64 cell embryos|strain:AB wild type | ip 64cell rep2 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:64 cell embryos|strain:AB wild type | GSM2390018 | GSM2390018: ip 64cell rep2; Danio rerio; RIP Seq | GSM2390018 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390018 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | ip_64cell_rep2.fastq.gz | fastq | 3530677976.0 | 37560404.0 | GSM2390018 r1 | 0:94 | A:966880666;C:841411144;G:858285224;T:862983808;N:1117134 | 94 | 966880666 | 841411144 | 858285224 | 862983808 | 1117134 | SRX2345560 | SRS1796153 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.04775 | 0.00421 | 0.92845 | 0.5748 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41559 | 41559 | SRR5017064 | SRX2345559 | SRS1796135 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | ip 64cell rep1 | GSM2390017 | tissue:Embryos|developmental stage:64 cell embryos|strain:AB wild type | ip 64cell rep1 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:64 cell embryos|strain:AB wild type | GSM2390017 | GSM2390017: ip 64cell rep1; Danio rerio; RIP Seq | GSM2390017 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390017 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | ip_64cell_rep1.fastq.gz | fastq | 3912003734.0 | 41617061.0 | GSM2390017 r1 | 0:94 | A:1040276279;C:945311584;G:953598043;T:971589029;N:1228799 | 94 | 1040276279 | 945311584 | 953598043 | 971589029 | 1228799 | SRX2345559 | SRS1796135 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.03544 | 0.00268 | 0.93914 | 0.53712 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41560 | 41560 | SRR5017063 | SRX2345558 | SRS1796155 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | input 1cell rep2 | GSM2390016 | tissue:Embryos|developmental stage:1cell embryos|strain:AB wild type | input 1cell rep2 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:1cell embryos|strain:AB wild type | GSM2390016 | GSM2390016: input 1cell rep2; Danio rerio; RIP Seq | GSM2390016 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390016 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | input_1cell_rep2.fastq.gz | fastq | 3379762010.0 | 35954915.0 | GSM2390016 r1 | 0:94 | A:898920912;C:816234808;G:823428476;T:840956466;N:221348 | 94 | 898920912 | 816234808 | 823428476 | 840956466 | 221348 | SRX2345558 | SRS1796155 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.04513 | 0.00864 | 0.95085 | 0.51692 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Zygote | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41561 | 41561 | SRR5017062 | SRX2345557 | SRS1796128 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | input 1cell rep1 | GSM2390015 | tissue:Embryos|developmental stage:1cell embryos|strain:AB wild type | input 1cell rep1 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:1cell embryos|strain:AB wild type | GSM2390015 | GSM2390015: input 1cell rep1; Danio rerio; RIP Seq | GSM2390015 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390015 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | input_1cell_rep1.fastq.gz | fastq | 3650321646.0 | 38833209.0 | GSM2390015 r1 | 0:94 | A:951411355;C:878458528;G:890250453;T:929968044;N:233266 | 94 | 951411355 | 878458528 | 890250453 | 929968044 | 233266 | SRX2345557 | SRS1796128 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.03728 | 0.00668 | 0.94901 | 0.60038 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Zygote | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41562 | 41562 | SRR5017061 | SRX2345556 | SRS1796127 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | ip 1cell rep2 | GSM2390014 | tissue:Embryos|developmental stage:1cell embryos|strain:AB wild type | ip 1cell rep2 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:1cell embryos|strain:AB wild type | GSM2390014 | GSM2390014: ip 1cell rep2; Danio rerio; RIP Seq | GSM2390014 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390014 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | ip_1cell_rep2.fastq.gz | fastq | 3485432580.0 | 37079070.0 | GSM2390014 r1 | 0:94 | A:953699047;C:835179152;G:846963064;T:848487912;N:1103405 | 94 | 953699047 | 835179152 | 846963064 | 848487912 | 1103405 | SRX2345556 | SRS1796127 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.02534 | 0.00219 | 0.95891 | 0.5975 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Zygote | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41563 | 41563 | SRR5017060 | SRX2345555 | SRS1796130 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | ip 1cell rep1 | GSM2390013 | tissue:Embryos|developmental stage:1cell embryos|strain:AB wild type | ip 1cell rep1 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:1cell embryos|strain:AB wild type | GSM2390013 | GSM2390013: ip 1cell rep1; Danio rerio; RIP Seq | GSM2390013 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390013 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | ip_1cell_rep1.fastq.gz | fastq | 3610167102.0 | 38406033.0 | GSM2390013 r1 | 0:94 | A:961438376;C:875781200;G:891055201;T:880749228;N:1143097 | 94 | 961438376 | 875781200 | 891055201 | 880749228 | 1143097 | SRX2345555 | SRS1796130 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.01939 | 0.00159 | 0.96457 | 0.53652 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Zygote | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 43402 | 43402 | SRR5931544 | SRX3091819 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397969 | 397969 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4755826950.0 | 31705513.0 | D 500 1 2.fq.gz | 0:0 1:150 | A:1274207449;C:1094727902;G:1122524378;T:1264331427;N:35794 | 0 | 150 | 1274207449 | 1094727902 | 1122524378 | 1264331427 | 35794 | SRX3091819 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.91191 | 0.10926 | 0.68341 | 0.47196 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43403 | 43403 | SRR5931545 | SRX3091818 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397968 | 397968 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4755826950.0 | 31705513.0 | D 500 1 1.fq.gz | 0:150 1:0 | A:1276129214;C:1100761964;G:1115345594;T:1263574047;N:16131 | 150 | 0 | 1276129214 | 1100761964 | 1115345594 | 1263574047 | 16131 | SRX3091818 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.91044 | 0.10895 | 0.67659 | 0.46952 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43404 | 43404 | SRR5931546 | SRX3091817 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397967 | 397967 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4584658950.0 | 30564393.0 | D 50 3 2.fq.gz | 0:0 1:150 | A:1214232270;C:1065003267;G:1091428812;T:1213867330;N:127271 | 0 | 150 | 1214232270 | 1065003267 | 1091428812 | 1213867330 | 127271 | SRX3091817 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.92229 | 0.10554 | 0.68667 | 0.4535 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43405 | 43405 | SRR5931547 | SRX3091816 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397966 | 397966 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4584658950.0 | 30564393.0 | D 50 3 1.fq.gz | 0:150 1:0 | A:1219702088;C:1067643780;G:1085480895;T:1211806100;N:26087 | 150 | 0 | 1219702088 | 1067643780 | 1085480895 | 1211806100 | 26087 | SRX3091816 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.92126 | 0.10598 | 0.68398 | 0.44901 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43406 | 43406 | SRR5931548 | SRX3091815 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397973 | 397973 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4705867200.0 | 31372448.0 | D 500 3 2.fq.gz | 0:0 1:150 | A:1240294141;C:1111008282;G:1125861755;T:1228667971;N:35051 | 0 | 150 | 1240294141 | 1111008282 | 1125861755 | 1228667971 | 35051 | SRX3091815 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.92297 | 0.09739 | 0.6856 | 0.47451 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43407 | 43407 | SRR5931549 | SRX3091814 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397972 | 397972 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4705867200.0 | 31372448.0 | D 500 3 1.fq.gz | 0:150 1:0 | A:1241514886;C:1108723884;G:1123339576;T:1232273510;N:15344 | 150 | 0 | 1241514886 | 1108723884 | 1123339576 | 1232273510 | 15344 | SRX3091814 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.92062 | 0.09796 | 0.67856 | 0.47388 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43408 | 43408 | SRR5931550 | SRX3091813 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397971 | 397971 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4750951350.0 | 31673009.0 | D 500 2 2.fq.gz | 0:0 1:150 | A:1286144024;C:1079544004;G:1112952985;T:1272274928;N:35409 | 0 | 150 | 1286144024 | 1079544004 | 1112952985 | 1272274928 | 35409 | SRX3091813 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.90446 | 0.13747 | 0.68639 | 0.46726 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43409 | 43409 | SRR5931551 | SRX3091812 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397970 | 397970 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4750951350.0 | 31673009.0 | D 500 2 1.fq.gz | 0:150 1:0 | A:1287515334;C:1090783234;G:1101469034;T:1271168008;N:15740 | 150 | 0 | 1287515334 | 1090783234 | 1101469034 | 1271168008 | 15740 | SRX3091812 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.90214 | 0.13756 | 0.68158 | 0.46719 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43410 | 43410 | SRR5931552 | SRX3091811 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | without xxx | 397957 | 397957 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4071934650.0 | 27146231.0 | CK 1 2.fq.gz | 0:0 1:150 | A:1052229682;C:975525985;G:991345538;T:1052207035;N:626410 | 0 | 150 | 1052229682 | 975525985 | 991345538 | 1052207035 | 626410 | SRX3091811 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.93603 | 0.0589 | 0.71492 | 0.48298 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43411 | 43411 | SRR5931553 | SRX3091810 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | without xxx | 397956 | 397956 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4071934650.0 | 27146231.0 | CK 1 1.fq.gz | 0:150 1:0 | A:1057694098;C:975549420;G:988477956;T:1049766896;N:446280 | 150 | 0 | 1057694098 | 975549420 | 988477956 | 1049766896 | 446280 | SRX3091810 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.93688 | 0.05854 | 0.7091 | 0.48309 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43412 | 43412 | SRR5931554 | SRX3091809 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | without xxx | 397959 | 397959 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4343291550.0 | 28955277.0 | CK 2 2.fq.gz | 0:0 1:150 | A:1153253014;C:1007267471;G:1028912357;T:1153739160;N:119548 | 0 | 150 | 1153253014 | 1007267471 | 1028912357 | 1153739160 | 119548 | SRX3091809 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.9209 | 0.11211 | 0.68649 | 0.45293 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43413 | 43413 | SRR5931555 | SRX3091808 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | without xxx | 397958 | 397958 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4343291550.0 | 28955277.0 | CK 2 1.fq.gz | 0:150 1:0 | A:1157702407;C:1008975846;G:1024287434;T:1151988746;N:337117 | 150 | 0 | 1157702407 | 1008975846 | 1024287434 | 1151988746 | 337117 | SRX3091808 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.91946 | 0.11191 | 0.6828 | 0.45241 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43414 | 43414 | SRR5931556 | SRX3091807 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | without xxx | 397961 | 397961 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4518061050.0 | 30120407.0 | CK 3 2.fq.gz | 0:0 1:150 | A:1188586431;C:1058258572;G:1080153332;T:1190907666;N:155049 | 0 | 150 | 1188586431 | 1058258572 | 1080153332 | 1190907666 | 155049 | SRX3091807 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.92512 | 0.09744 | 0.69085 | 0.45772 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43415 | 43415 | SRR5931557 | SRX3091806 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | without xxx | 397960 | 397960 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4518061050.0 | 30120407.0 | CK 3 1.fq.gz | 0:150 1:0 | A:1195164171;C:1059996453;G:1074722334;T:1188143044;N:35048 | 150 | 0 | 1195164171 | 1059996453 | 1074722334 | 1188143044 | 35048 | SRX3091806 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.9249 | 0.09772 | 0.68562 | 0.45606 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43416 | 43416 | SRR5931558 | SRX3091805 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397963 | 397963 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4572900600.0 | 30486004.0 | D 50 1 2.fq.gz | 0:0 1:150 | A:1218364634;C:1054987971;G:1079106780;T:1220261884;N:179331 | 0 | 150 | 1218364634 | 1054987971 | 1079106780 | 1220261884 | 179331 | SRX3091805 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.91953 | 0.11512 | 0.68722 | 0.45056 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43417 | 43417 | SRR5931559 | SRX3091804 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397962 | 397962 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4572900600.0 | 30486004.0 | D 50 1 1.fq.gz | 0:150 1:0 | A:1223844243;C:1057030107;G:1074694968;T:1217286959;N:44323 | 150 | 0 | 1223844243 | 1057030107 | 1074694968 | 1217286959 | 44323 | SRX3091804 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.91779 | 0.1149 | 0.68258 | 0.46006 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43418 | 43418 | SRR5931560 | SRX3091803 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397965 | 397965 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4595232150.0 | 30634881.0 | D 50 2 2.fq.gz | 0:0 1:150 | A:1225033548;C:1062169088;G:1082021478;T:1225833369;N:174667 | 0 | 150 | 1225033548 | 1062169088 | 1082021478 | 1225833369 | 174667 | SRX3091803 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.91827 | 0.11697 | 0.68511 | 0.44407 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43419 | 43419 | SRR5931561 | SRX3091802 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397964 | 397964 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4595232150.0 | 30634881.0 | D 50 2 1.fq.gz | 0:150 1:0 | A:1231719851;C:1064618233;G:1076698645;T:1222155912;N:39509 | 150 | 0 | 1231719851 | 1064618233 | 1076698645 | 1222155912 | 39509 | SRX3091802 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||||||||
| 44650 | 44650 | SRR6268198 | SRX3374366 | SRS2671592 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | rep A 10h | GSM2845352 | source name:zebrafish embryos|developmental stage:10hpf|tissue:embryo | rep A 10h | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:10hpf|tissue:embryo | GSM2845352 | GSM2845352: rep A 10h; Danio rerio; OTHER | GSM2845352 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845352 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 10hpf.fastq.gz | fastq | 267594560.0 | 1672466.0 | GSM2845352 r1 | 0:160 1:0 | A:87249429;C:58556737;G:48918401;T:72845229;N:24764 | 160 | 0 | 87249429 | 58556737 | 48918401 | 72845229 | 24764 | SRX3374366 | SRS2671592 | SRA629220 | GEO | Broad Institute | 1 | 2e-05 | 0.0 | 0.99995 | 0.5 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44651 | 44651 | SRR6268197 | SRX3374365 | SRS2671591 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | rep A 8h | GSM2845351 | source name:zebrafish embryos|developmental stage:8hpf|tissue:embryo | rep A 8h | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:8hpf|tissue:embryo | GSM2845351 | GSM2845351: rep A 8h; Danio rerio; OTHER | GSM2845351 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845351 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 8hpf.fastq.gz | fastq | 277648000.0 | 1735300.0 | GSM2845351 r1 | 0:160 1:0 | A:88447999;C:60766591;G:51931752;T:76474911;N:26747 | 160 | 0 | 88447999 | 60766591 | 51931752 | 76474911 | 26747 | SRX3374365 | SRS2671591 | SRA629220 | GEO | Broad Institute | 1 | 0.0 | 0.0 | 1.0 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 44652 | 44652 | SRR6268196 | SRX3374364 | SRS2671590 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | rep A 6h.3 | GSM2845350 | source name:zebrafish embryos|developmental stage:6hpf|tissue:embryo | rep A 6h.3 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:6hpf|tissue:embryo | GSM2845350 | GSM2845350: rep A 6h.3; Danio rerio; OTHER | GSM2845350 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845350 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 6hpf.fastq.gz | fastq | 321713920.0 | 2010712.0 | GSM2845350 r1 | 0:160 1:0 | A:108106130;C:67673948;G:57401886;T:88504064;N:27892 | 160 | 0 | 108106130 | 67673948 | 57401886 | 88504064 | 27892 | SRX3374364 | SRS2671590 | SRA629220 | GEO | Broad Institute | 1 | 4e-05 | 0.0 | 0.99985 | 0.57142 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44653 | 44653 | SRR6268195 | SRX3374363 | SRS2671589 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | rep A 6h.2 | GSM2845349 | source name:zebrafish embryos|developmental stage:6hpf|tissue:embryo | rep A 6h.2 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:6hpf|tissue:embryo | GSM2845349 | GSM2845349: rep A 6h.2; Danio rerio; OTHER | GSM2845349 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845349 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 4hpf-3.fastq.gz | fastq | 469592000.0 | 2934950.0 | GSM2845349 r1 | 0:160 1:0 | A:149657114;C:104627528;G:87984247;T:127285382;N:37729 | 160 | 0 | 149657114 | 104627528 | 87984247 | 127285382 | 37729 | SRX3374363 | SRS2671589 | SRA629220 | GEO | Broad Institute | 1 | 1e-05 | 0.0 | 0.99997 | 0.0 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44654 | 44654 | SRR6268194 | SRX3374362 | SRS2671588 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | rep A 6h.1 | GSM2845348 | source name:zebrafish embryos|developmental stage:6hpf|tissue:embryo | rep A 6h.1 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:6hpf|tissue:embryo | GSM2845348 | GSM2845348: rep A 6h.1; Danio rerio; OTHER | GSM2845348 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845348 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 4hpf-2.fastq.gz | fastq | 450388640.0 | 2814929.0 | GSM2845348 r1 | 0:160 1:0 | A:143486047;C:99354304;G:85285329;T:122222711;N:40249 | 160 | 0 | 143486047 | 99354304 | 85285329 | 122222711 | 40249 | SRX3374362 | SRS2671588 | SRA629220 | GEO | Broad Institute | 1 | 3e-05 | 0.0 | 0.99991 | 0.5 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44655 | 44655 | SRR6268193 | SRX3374361 | SRS2671586 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | rep A 4h | GSM2845347 | source name:zebrafish embryos|developmental stage:4hpf|tissue:embryo | rep A 4h | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:4hpf|tissue:embryo | GSM2845347 | GSM2845347: rep A 4h; Danio rerio; OTHER | GSM2845347 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845347 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 4hpf-1.fastq.gz | fastq | 443483200.0 | 2771770.0 | GSM2845347 r1 | 0:160 1:0 | A:139383281;C:100368800;G:84425873;T:119267938;N:37308 | 160 | 0 | 139383281 | 100368800 | 84425873 | 119267938 | 37308 | SRX3374361 | SRS2671586 | SRA629220 | GEO | Broad Institute | 1 | 2e-05 | 0.0 | 0.99995 | 0.5 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44656 | 44656 | SRR6268192 | SRX3374360 | SRS2671587 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | rep A 3h | GSM2845346 | source name:zebrafish embryos|developmental stage:3hpf|tissue:embryo | rep A 3h | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:3hpf|tissue:embryo | GSM2845346 | GSM2845346: rep A 3h; Danio rerio; OTHER | GSM2845346 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845346 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 3hpf.fastq.gz | fastq | 557489280.0 | 3484308.0 | GSM2845346 r1 | 0:160 1:0 | A:174273480;C:125862121;G:107763308;T:149536497;N:53874 | 160 | 0 | 174273480 | 125862121 | 107763308 | 149536497 | 53874 | SRX3374360 | SRS2671587 | SRA629220 | GEO | Broad Institute | 1 | 6e-05 | 0.0 | 0.99981 | 0.22222 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44657 | 44657 | SRR6268191 | SRX3374359 | SRS2671600 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | rep A 2h | GSM2845345 | source name:zebrafish embryos|developmental stage:2hpf|tissue:embryo | rep A 2h | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:2hpf|tissue:embryo | GSM2845345 | GSM2845345: rep A 2h; Danio rerio; OTHER | GSM2845345 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845345 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 2hpf.fastq.gz | fastq | 530420800.0 | 3315130.0 | GSM2845345 r1 | 0:160 1:0 | A:164669564;C:122876218;G:102801422;T:140026363;N:47233 | 160 | 0 | 164669564 | 122876218 | 102801422 | 140026363 | 47233 | SRX3374359 | SRS2671600 | SRA629220 | GEO | Broad Institute | 1 | 5e-05 | 0.0 | 0.99985 | 0.71428 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44658 | 44658 | SRR6268190 | SRX3374358 | SRS2671585 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | rep A 1h | GSM2845344 | source name:zebrafish embryos|developmental stage:1hpf|tissue:embryo | rep A 1h | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:1hpf|tissue:embryo | GSM2845344 | GSM2845344: rep A 1h; Danio rerio; OTHER | GSM2845344 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845344 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 1hpf.fastq.gz | fastq | 560763840.0 | 3504774.0 | GSM2845344 r1 | 0:160 1:0 | A:175204436;C:129606168;G:108093534;T:147808098;N:51604 | 160 | 0 | 175204436 | 129606168 | 108093534 | 147808098 | 51604 | SRX3374358 | SRS2671585 | SRA629220 | GEO | Broad Institute | 1 | 2e-05 | 0.0 | 0.99995 | 0.0 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44659 | 44659 | SRR6268189 | SRX3374357 | SRS2671584 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | rep A uninjected | GSM2845343 | source name:zebrafish embryos|developmental stage:NA|tissue:embryo | rep A uninjected | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:NA|tissue:embryo | GSM2845343 | GSM2845343: rep A uninjected; Danio rerio; OTHER | GSM2845343 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845343 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | SpeI-pool.fastq.gz | fastq | 2026742240.0 | 12667139.0 | GSM2845343 r1 | 0:160 1:0 | A:625744065;C:476430927;G:385335893;T:539051959;N:179396 | 160 | 0 | 625744065 | 476430927 | 385335893 | 539051959 | 179396 | SRX3374357 | SRS2671584 | SRA629220 | GEO | Broad Institute | 1 | 4e-05 | 0.0 | 0.99987 | 0.16666 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Zygote | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44660 | 44660 | SRR6268188 | SRX3374356 | SRS2671583 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ 10h.2 | GSM2845342 | source name:zebrafish embryos|developmental stage:10hpf|tissue:embryo | techrep A+ 10h.2 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:10hpf|tissue:embryo | GSM2845342 | GSM2845342: techrep A+ 10h.2; Danio rerio; OTHER | GSM2845342 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845342 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR24_S24.fastq.gz | fastq | 152993736.0 | 910677.0 | GSM2845342 r1 | 0:168 1:0 | A:51571958;C:32339728;G:27945885;T:41135710;N:455 | 168 | 0 | 51571958 | 32339728 | 27945885 | 41135710 | 455 | SRX3374356 | SRS2671583 | SRA629220 | GEO | Broad Institute | 1 | 5e-05 | 0.0 | 0.99989 | 0.5 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44661 | 44661 | SRR6268187 | SRX3374355 | SRS2671580 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ 9h.2 | GSM2845341 | source name:zebrafish embryos|developmental stage:9hpf|tissue:embryo | techrep A+ 9h.2 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:9hpf|tissue:embryo | GSM2845341 | GSM2845341: techrep A+ 9h.2; Danio rerio; OTHER | GSM2845341 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845341 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR23_S23.fastq.gz | fastq | 170881704.0 | 1017153.0 | GSM2845341 r1 | 0:168 1:0 | A:58715337;C:35449423;G:30006312;T:46710126;N:506 | 168 | 0 | 58715337 | 35449423 | 30006312 | 46710126 | 506 | SRX3374355 | SRS2671580 | SRA629220 | GEO | Broad Institute | 1 | 2e-05 | 0.0 | 0.99995 | 0.5 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44662 | 44662 | SRR6268186 | SRX3374354 | SRS2671582 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ 8h.2 | GSM2845340 | source name:zebrafish embryos|developmental stage:8hpf|tissue:embryo | techrep A+ 8h.2 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:8hpf|tissue:embryo | GSM2845340 | GSM2845340: techrep A+ 8h.2; Danio rerio; OTHER | GSM2845340 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845340 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR22_S22.fastq.gz | fastq | 162500520.0 | 967265.0 | GSM2845340 r1 | 0:168 1:0 | A:56281233;C:33095421;G:28617222;T:44506190;N:454 | 168 | 0 | 56281233 | 33095421 | 28617222 | 44506190 | 454 | SRX3374354 | SRS2671582 | SRA629220 | GEO | Broad Institute | 1 | 2e-05 | 0.0 | 0.99995 | 1.0 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44663 | 44663 | SRR6268185 | SRX3374353 | SRS2671581 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ 7h.2 | GSM2845339 | source name:zebrafish embryos|developmental stage:7hpf|tissue:embryo | techrep A+ 7h.2 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:7hpf|tissue:embryo | GSM2845339 | GSM2845339: techrep A+ 7h.2; Danio rerio; OTHER | GSM2845339 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845339 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR21_S21.fastq.gz | fastq | 177185400.0 | 1054675.0 | GSM2845339 r1 | 0:168 1:0 | A:61487643;C:35736507;G:31141191;T:48819498;N:561 | 168 | 0 | 61487643 | 35736507 | 31141191 | 48819498 | 561 | SRX3374353 | SRS2671581 | SRA629220 | GEO | Broad Institute | 1 | 3e-05 | 0.0 | 0.99995 | 1.0 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44664 | 44664 | SRR6268184 | SRX3374352 | SRS2671579 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ 6h.2.2 | GSM2845338 | source name:zebrafish embryos|developmental stage:6hpf|tissue:embryo | techrep A+ 6h.2.2 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:6hpf|tissue:embryo | GSM2845338 | GSM2845338: techrep A+ 6h.2.2; Danio rerio; OTHER | GSM2845338 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845338 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR20_S20.fastq.gz | fastq | 182756784.0 | 1087838.0 | GSM2845338 r1 | 0:168 1:0 | A:60314822;C:39299119;G:34916612;T:48225663;N:568 | 168 | 0 | 60314822 | 39299119 | 34916612 | 48225663 | 568 | SRX3374352 | SRS2671579 | SRA629220 | GEO | Broad Institute | 1 | 2e-05 | 0.0 | 0.99997 | 0.0 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44665 | 44665 | SRR6268183 | SRX3374351 | SRS2671599 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ 6h.2.1 | GSM2845337 | source name:zebrafish embryos|developmental stage:6hpf|tissue:embryo | techrep A+ 6h.2.1 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:6hpf|tissue:embryo | GSM2845337 | GSM2845337: techrep A+ 6h.2.1; Danio rerio; OTHER | GSM2845337 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845337 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR19_S19.fastq.gz | fastq | 160068720.0 | 952790.0 | GSM2845337 r1 | 0:168 1:0 | A:55382285;C:32355561;G:29019311;T:43311149;N:414 | 168 | 0 | 55382285 | 32355561 | 29019311 | 43311149 | 414 | SRX3374351 | SRS2671599 | SRA629220 | GEO | Broad Institute | 1 | 2e-05 | 0.0 | 0.99995 | 1.0 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44666 | 44666 | SRR6268182 | SRX3374350 | SRS2671577 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ 5h.2 | GSM2845336 | source name:zebrafish embryos|developmental stage:5hpf|tissue:embryo | techrep A+ 5h.2 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:5hpf|tissue:embryo | GSM2845336 | GSM2845336: techrep A+ 5h.2; Danio rerio; OTHER | GSM2845336 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845336 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR18_S18.fastq.gz | fastq | 188186880.0 | 1120160.0 | GSM2845336 r1 | 0:168 1:0 | A:64287530;C:38206555;G:34905552;T:50786665;N:578 | 168 | 0 | 64287530 | 38206555 | 34905552 | 50786665 | 578 | SRX3374350 | SRS2671577 | SRA629220 | GEO | Broad Institute | 1 | 0.0 | 0.0 | 1.0 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 44667 | 44667 | SRR6268181 | SRX3374349 | SRS2671578 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ 4h.2 | GSM2845335 | source name:zebrafish embryos|developmental stage:4hpf|tissue:embryo | techrep A+ 4h.2 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:4hpf|tissue:embryo | GSM2845335 | GSM2845335: techrep A+ 4h.2; Danio rerio; OTHER | GSM2845335 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845335 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR17_S17.fastq.gz | fastq | 184770096.0 | 1099822.0 | GSM2845335 r1 | 0:168 1:0 | A:63618247;C:37087101;G:34147549;T:49916639;N:560 | 168 | 0 | 63618247 | 37087101 | 34147549 | 49916639 | 560 | SRX3374349 | SRS2671578 | SRA629220 | GEO | Broad Institute | 1 | 1e-05 | 0.0 | 1.0 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 44668 | 44668 | SRR6268180 | SRX3374348 | SRS2671576 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ 3h.2 | GSM2845334 | source name:zebrafish embryos|developmental stage:3hpf|tissue:embryo | techrep A+ 3h.2 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:3hpf|tissue:embryo | GSM2845334 | GSM2845334: techrep A+ 3h.2; Danio rerio; OTHER | GSM2845334 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845334 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR16_S16.fastq.gz | fastq | 196416864.0 | 1169148.0 | GSM2845334 r1 | 0:168 1:0 | A:68358077;C:39754902;G:34495844;T:53807445;N:596 | 168 | 0 | 68358077 | 39754902 | 34495844 | 53807445 | 596 | SRX3374348 | SRS2671576 | SRA629220 | GEO | Broad Institute | 1 | 2e-05 | 0.0 | 1.0 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 44669 | 44669 | SRR6268179 | SRX3374347 | SRS2671573 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ 2h.2 | GSM2845333 | source name:zebrafish embryos|developmental stage:2hpf|tissue:embryo | techrep A+ 2h.2 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:2hpf|tissue:embryo | GSM2845333 | GSM2845333: techrep A+ 2h.2; Danio rerio; OTHER | GSM2845333 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845333 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR15_S15.fastq.gz | fastq | 180869976.0 | 1076607.0 | GSM2845333 r1 | 0:168 1:0 | A:62515123;C:36752824;G:31828965;T:49772532;N:532 | 168 | 0 | 62515123 | 36752824 | 31828965 | 49772532 | 532 | SRX3374347 | SRS2671573 | SRA629220 | GEO | Broad Institute | 1 | 1e-05 | 0.0 | 0.99997 | 1.0 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44670 | 44670 | SRR6268178 | SRX3374346 | SRS2671575 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ 1h.2 | GSM2845332 | source name:zebrafish embryos|developmental stage:1hpf|tissue:embryo | techrep A+ 1h.2 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:1hpf|tissue:embryo | GSM2845332 | GSM2845332: techrep A+ 1h.2; Danio rerio; OTHER | GSM2845332 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845332 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR14_S14.fastq.gz | fastq | 122214288.0 | 727466.0 | GSM2845332 r1 | 0:168 1:0 | A:42087207;C:24870226;G:21635627;T:33620892;N:336 | 168 | 0 | 42087207 | 24870226 | 21635627 | 33620892 | 336 | SRX3374346 | SRS2671575 | SRA629220 | GEO | Broad Institute | 1 | 3e-05 | 0.0 | 0.99991 | 0.25 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44671 | 44671 | SRR6268177 | SRX3374345 | SRS2671574 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ uninjected.2 | GSM2845331 | source name:zebrafish embryos|developmental stage:NA|tissue:embryo | techrep A+ uninjected.2 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:NA|tissue:embryo | GSM2845331 | GSM2845331: techrep A+ uninjected.2; Danio rerio; OTHER | GSM2845331 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845331 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR13_S13.fastq.gz | fastq | 206761464.0 | 1230723.0 | GSM2845331 r1 | 0:168 1:0 | A:70709853;C:42141255;G:36769712;T:57139973;N:671 | 168 | 0 | 70709853 | 42141255 | 36769712 | 57139973 | 671 | SRX3374345 | SRS2671574 | SRA629220 | GEO | Broad Institute | 1 | 1e-05 | 0.0 | 1.0 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Zygote | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 44672 | 44672 | SRR6268176 | SRX3374344 | SRS2671571 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ 10h.1 | GSM2845330 | source name:zebrafish embryos|developmental stage:10hpf|tissue:embryo | techrep A+ 10h.1 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:10hpf|tissue:embryo | GSM2845330 | GSM2845330: techrep A+ 10h.1; Danio rerio; OTHER | GSM2845330 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845330 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR12_S12.fastq.gz | fastq | 183198288.0 | 1090466.0 | GSM2845330 r1 | 0:168 1:0 | A:62131603;C:37866401;G:33149583;T:50050141;N:560 | 168 | 0 | 62131603 | 37866401 | 33149583 | 50050141 | 560 | SRX3374344 | SRS2671571 | SRA629220 | GEO | Broad Institute | 1 | 0.0 | 0.0 | 1.0 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 44673 | 44673 | SRR6268175 | SRX3374343 | SRS2671572 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ 9h.1 | GSM2845329 | source name:zebrafish embryos|developmental stage:9hpf|tissue:embryo | techrep A+ 9h.1 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:9hpf|tissue:embryo | GSM2845329 | GSM2845329: techrep A+ 9h.1; Danio rerio; OTHER | GSM2845329 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845329 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR11_S11.fastq.gz | fastq | 254056656.0 | 1512242.0 | GSM2845329 r1 | 0:168 1:0 | A:85470904;C:52657639;G:46610564;T:69316784;N:765 | 168 | 0 | 85470904 | 52657639 | 46610564 | 69316784 | 765 | SRX3374343 | SRS2671572 | SRA629220 | GEO | Broad Institute | 1 | 2e-05 | 0.0 | 0.99997 | 1.0 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44674 | 44674 | SRR6268174 | SRX3374342 | SRS2671570 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ 8h.1 | GSM2845328 | source name:zebrafish embryos|developmental stage:8hpf|tissue:embryo | techrep A+ 8h.1 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:8hpf|tissue:embryo | GSM2845328 | GSM2845328: techrep A+ 8h.1; Danio rerio; OTHER | GSM2845328 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845328 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR10_S10.fastq.gz | fastq | 219042936.0 | 1303827.0 | GSM2845328 r1 | 0:168 1:0 | A:72968024;C:46155718;G:40847360;T:59071152;N:682 | 168 | 0 | 72968024 | 46155718 | 40847360 | 59071152 | 682 | SRX3374342 | SRS2671570 | SRA629220 | GEO | Broad Institute | 1 | 0.0 | 0.0 | 1.0 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 44675 | 44675 | SRR6268173 | SRX3374341 | SRS2671569 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ 7h.1 | GSM2845327 | source name:zebrafish embryos|developmental stage:7hpf|tissue:embryo | techrep A+ 7h.1 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:7hpf|tissue:embryo | GSM2845327 | GSM2845327: techrep A+ 7h.1; Danio rerio; OTHER | GSM2845327 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845327 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR09_S9.fastq.gz | fastq | 295385160.0 | 1758245.0 | GSM2845327 r1 | 0:168 1:0 | A:96898707;C:64356190;G:55256265;T:78873123;N:875 | 168 | 0 | 96898707 | 64356190 | 55256265 | 78873123 | 875 | SRX3374341 | SRS2671569 | SRA629220 | GEO | Broad Institute | 1 | 1e-05 | 0.0 | 0.99997 | 0.0 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44676 | 44676 | SRR6268172 | SRX3374340 | SRS2671568 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ 6h.1.2 | GSM2845326 | source name:zebrafish embryos|developmental stage:6hpf|tissue:embryo | techrep A+ 6h.1.2 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:6hpf|tissue:embryo | GSM2845326 | GSM2845326: techrep A+ 6h.1.2; Danio rerio; OTHER | GSM2845326 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845326 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR08_S8.fastq.gz | fastq | 200314464.0 | 1192348.0 | GSM2845326 r1 | 0:168 1:0 | A:69255469;C:40029074;G:36656767;T:54372650;N:504 | 168 | 0 | 69255469 | 40029074 | 36656767 | 54372650 | 504 | SRX3374340 | SRS2671568 | SRA629220 | GEO | Broad Institute | 1 | 0.0 | 0.0 | 1.0 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 44677 | 44677 | SRR6268171 | SRX3374339 | SRS2671567 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ 6h.1.1 | GSM2845325 | source name:zebrafish embryos|developmental stage:6hpf|tissue:embryo | techrep A+ 6h.1.1 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:6hpf|tissue:embryo | GSM2845325 | GSM2845325: techrep A+ 6h.1.1; Danio rerio; OTHER | GSM2845325 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845325 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR07_S7.fastq.gz | fastq | 178903200.0 | 1064900.0 | GSM2845325 r1 | SRX3374339 | SRS2671567 | SRA629220 | GEO | Broad Institute | 1 | 1e-05 | 0.0 | 1.0 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 44678 | 44678 | SRR6268170 | SRX3374338 | SRS2671566 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ 5h.1 | GSM2845324 | source name:zebrafish embryos|developmental stage:5hpf|tissue:embryo | techrep A+ 5h.1 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:5hpf|tissue:embryo | GSM2845324 | GSM2845324: techrep A+ 5h.1; Danio rerio; OTHER | GSM2845324 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845324 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR06_S6.fastq.gz | fastq | 190078560.0 | 1131420.0 | GSM2845324 r1 | 0:168 1:0 | A:65220545;C:38085617;G:34999757;T:51772096;N:545 | 168 | 0 | 65220545 | 38085617 | 34999757 | 51772096 | 545 | SRX3374338 | SRS2671566 | SRA629220 | GEO | Broad Institute | 1 | 2e-05 | 0.0 | 0.99997 | 1.0 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44679 | 44679 | SRR6268169 | SRX3374337 | SRS2671565 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ 4h.1 | GSM2845323 | source name:zebrafish embryos|developmental stage:4hpf|tissue:embryo | techrep A+ 4h.1 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:4hpf|tissue:embryo | GSM2845323 | GSM2845323: techrep A+ 4h.1; Danio rerio; OTHER | GSM2845323 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845323 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR05_S5.fastq.gz | fastq | 185419080.0 | 1103685.0 | GSM2845323 r1 | 0:168 1:0 | A:63320889;C:37435097;G:34226069;T:50436440;N:585 | 168 | 0 | 63320889 | 37435097 | 34226069 | 50436440 | 585 | SRX3374337 | SRS2671565 | SRA629220 | GEO | Broad Institute | 1 | 2e-05 | 0.0 | 0.99997 | 0.0 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44680 | 44680 | SRR6268168 | SRX3374336 | SRS2671564 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ 3h.1 | GSM2845322 | source name:zebrafish embryos|developmental stage:3hpf|tissue:embryo | techrep A+ 3h.1 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:3hpf|tissue:embryo | GSM2845322 | GSM2845322: techrep A+ 3h.1; Danio rerio; OTHER | GSM2845322 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845322 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR04_S4.fastq.gz | fastq | 200607960.0 | 1194095.0 | GSM2845322 r1 | 0:168 1:0 | A:68271759;C:40505856;G:37426528;T:54403219;N:598 | 168 | 0 | 68271759 | 40505856 | 37426528 | 54403219 | 598 | SRX3374336 | SRS2671564 | SRA629220 | GEO | Broad Institute | 1 | 0.0 | 0.0 | 1.0 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 44681 | 44681 | SRR6268167 | SRX3374335 | SRS2671563 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ 2h.1 | GSM2845321 | source name:zebrafish embryos|developmental stage:2hpf|tissue:embryo | techrep A+ 2h.1 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:2hpf|tissue:embryo | GSM2845321 | GSM2845321: techrep A+ 2h.1; Danio rerio; OTHER | GSM2845321 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845321 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR03_S3.fastq.gz | fastq | 225004248.0 | 1339311.0 | GSM2845321 r1 | 0:168 1:0 | A:75598393;C:46190266;G:42656101;T:60558836;N:652 | 168 | 0 | 75598393 | 46190266 | 42656101 | 60558836 | 652 | SRX3374335 | SRS2671563 | SRA629220 | GEO | Broad Institute | 1 | 1e-05 | 0.0 | 1.0 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 44682 | 44682 | SRR6268166 | SRX3374334 | SRS2671562 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ 1h.1 | GSM2845320 | source name:zebrafish embryos|developmental stage:1hpf|tissue:embryo | techrep A+ 1h.1 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:1hpf|tissue:embryo | GSM2845320 | GSM2845320: techrep A+ 1h.1; Danio rerio; OTHER | GSM2845320 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845320 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR02_S2.fastq.gz | fastq | 226517928.0 | 1348321.0 | GSM2845320 r1 | 0:168 1:0 | A:75135151;C:47160909;G:43769565;T:60451709;N:594 | 168 | 0 | 75135151 | 47160909 | 43769565 | 60451709 | 594 | SRX3374334 | SRS2671562 | SRA629220 | GEO | Broad Institute | 1 | 2e-05 | 0.0 | 0.99997 | 0.0 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44683 | 44683 | SRR6268165 | SRX3374333 | SRS2671560 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ uninjected.1 | GSM2845319 | source name:zebrafish embryos|developmental stage:NA|tissue:embryo | techrep A+ uninjected.1 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:NA|tissue:embryo | GSM2845319 | GSM2845319: techrep A+ uninjected.1; Danio rerio; OTHER | GSM2845319 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845319 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR01_S1.fastq.gz | fastq | 298586232.0 | 1777299.0 | GSM2845319 r1 | 0:168 1:0 | A:97160368;C:64341107;G:58562707;T:78521174;N:876 | 168 | 0 | 97160368 | 64341107 | 58562707 | 78521174 | 876 | SRX3374333 | SRS2671560 | SRA629220 | GEO | Broad Institute | 1 | 1e-05 | 0.0 | 0.99997 | 0.0 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Zygote | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44684 | 44684 | SRR6268164 | SRX3374332 | SRS2671561 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | biorep A+ 10h.2 | GSM2845318 | source name:zebrafish embryos|developmental stage:10hpf|tissue:embryo | biorep A+ 10h.2 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:10hpf|tissue:embryo | GSM2845318 | GSM2845318: biorep A+ 10h.2; Danio rerio; OTHER | GSM2845318 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845318 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 10hpf_S12.fastq.gz | fastq | 226568960.0 | 1416056.0 | GSM2845318 r1 | 0:160 1:0 | A:74664254;C:48098265;G:40952551;T:62847458;N:6432 | 160 | 0 | 74664254 | 48098265 | 40952551 | 62847458 | 6432 | SRX3374332 | SRS2671561 | SRA629220 | GEO | Broad Institute | 1 | 0.00023 | 2e-05 | 0.99987 | 0.87179 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44685 | 44685 | SRR6268163 | SRX3374331 | SRS2671559 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | biorep A+ 8h.2 | GSM2845317 | source name:zebrafish embryos|developmental stage:8hpf|tissue:embryo | biorep A+ 8h.2 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:8hpf|tissue:embryo | GSM2845317 | GSM2845317: biorep A+ 8h.2; Danio rerio; OTHER | GSM2845317 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845317 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 8hpf_S11.fastq.gz | fastq | 277302720.0 | 1733142.0 | GSM2845317 r1 | 0:160 1:0 | A:90214960;C:59749320;G:50838102;T:76483858;N:16480 | 160 | 0 | 90214960 | 59749320 | 50838102 | 76483858 | 16480 | SRX3374331 | SRS2671559 | SRA629220 | GEO | Broad Institute | 1 | 3e-05 | 0.0 | 0.99995 | 0.8 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44686 | 44686 | SRR6268162 | SRX3374330 | SRS2671558 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | biorep A+ 6h.2 | GSM2845316 | source name:zebrafish embryos|developmental stage:6hpf|tissue:embryo | biorep A+ 6h.2 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:6hpf|tissue:embryo | GSM2845316 | GSM2845316: biorep A+ 6h.2; Danio rerio; OTHER | GSM2845316 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845316 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 6hpf_S10.fastq.gz | fastq | 347336640.0 | 2170854.0 | GSM2845316 r1 | 0:160 1:0 | A:112549994;C:74770453;G:63347823;T:96645301;N:23069 | 160 | 0 | 112549994 | 74770453 | 63347823 | 96645301 | 23069 | SRX3374330 | SRS2671558 | SRA629220 | GEO | Broad Institute | 1 | 2e-05 | 0.0 | 0.99997 | 1.0 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44687 | 44687 | SRR6268161 | SRX3374329 | SRS2671557 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | biorep A+ 4h.2 | GSM2845315 | source name:zebrafish embryos|developmental stage:4hpf|tissue:embryo | biorep A+ 4h.2 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:4hpf|tissue:embryo | GSM2845315 | GSM2845315: biorep A+ 4h.2; Danio rerio; OTHER | GSM2845315 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845315 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 4hpf_S9.fastq.gz | fastq | 272464160.0 | 1702901.0 | GSM2845315 r1 | 0:160 1:0 | A:87175703;C:59219529;G:51399789;T:74651819;N:17320 | 160 | 0 | 87175703 | 59219529 | 51399789 | 74651819 | 17320 | SRX3374329 | SRS2671557 | SRA629220 | GEO | Broad Institute | 1 | 2e-05 | 0.0 | 0.99995 | 0.66666 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44688 | 44688 | SRR6268160 | SRX3374328 | SRS2671556 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | biorep A+ 1h.2 | GSM2845314 | source name:zebrafish embryos|developmental stage:2hpf|tissue:embryo | biorep A+ 1h.2 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:2hpf|tissue:embryo | GSM2845314 | GSM2845314: biorep A+ 1h.2; Danio rerio; OTHER | GSM2845314 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845314 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 2hpf_S8.fastq.gz | fastq | 404973760.0 | 2531086.0 | GSM2845314 r1 | 0:160 1:0 | A:129717899;C:88023529;G:76695428;T:110511560;N:25344 | 160 | 0 | 129717899 | 88023529 | 76695428 | 110511560 | 25344 | SRX3374328 | SRS2671556 | SRA629220 | GEO | Broad Institute | 1 | 3e-05 | 0.0 | 0.99993 | 0.75 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44689 | 44689 | SRR6268159 | SRX3374327 | SRS2671555 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | biorep A+ 10h.1 | GSM2845313 | source name:zebrafish embryos|developmental stage:10hpf|tissue:embryo | biorep A+ 10h.1 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:10hpf|tissue:embryo | GSM2845313 | GSM2845313: biorep A+ 10h.1; Danio rerio; OTHER | GSM2845313 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845313 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 10hpf_S5.fastq.gz | fastq | 227268480.0 | 1420428.0 | GSM2845313 r1 | 0:160 1:0 | A:75021512;C:48442427;G:40892901;T:62896619;N:15021 | 160 | 0 | 75021512 | 48442427 | 40892901 | 62896619 | 15021 | SRX3374327 | SRS2671555 | SRA629220 | GEO | Broad Institute | 1 | 9e-05 | 0.0 | 0.99991 | 0.13333 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44690 | 44690 | SRR6268158 | SRX3374326 | SRS2671554 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | biorep A+ 8h.1 | GSM2845312 | source name:zebrafish embryos|developmental stage:8hpf|tissue:embryo | biorep A+ 8h.1 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:8hpf|tissue:embryo | GSM2845312 | GSM2845312: biorep A+ 8h.1; Danio rerio; OTHER | GSM2845312 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845312 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 8hpf_S4.fastq.gz | fastq | 291498560.0 | 1821866.0 | GSM2845312 r1 | 0:160 1:0 | A:95405630;C:62095343;G:53049839;T:80929783;N:17965 | 160 | 0 | 95405630 | 62095343 | 53049839 | 80929783 | 17965 | SRX3374326 | SRS2671554 | SRA629220 | GEO | Broad Institute | 1 | 1e-05 | 0.0 | 0.99997 | 1.0 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44691 | 44691 | SRR6268157 | SRX3374325 | SRS2671553 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | biorep A+ 6h.1 | GSM2845311 | source name:zebrafish embryos|developmental stage:6hpf|tissue:embryo | biorep A+ 6h.1 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:6hpf|tissue:embryo | GSM2845311 | GSM2845311: biorep A+ 6h.1; Danio rerio; OTHER | GSM2845311 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845311 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 6hpf_S3.fastq.gz | fastq | 344362400.0 | 2152265.0 | GSM2845311 r1 | 0:160 1:0 | A:111456568;C:74861160;G:63336980;T:94686986;N:20706 | 160 | 0 | 111456568 | 74861160 | 63336980 | 94686986 | 20706 | SRX3374325 | SRS2671553 | SRA629220 | GEO | Broad Institute | 1 | 3e-05 | 0.0 | 0.99997 | 1.0 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44692 | 44692 | SRR6268156 | SRX3374324 | SRS2671598 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | biorep A+ 4h.1 | GSM2845310 | source name:zebrafish embryos|developmental stage:4hpf|tissue:embryo | biorep A+ 4h.1 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:4hpf|tissue:embryo | GSM2845310 | GSM2845310: biorep A+ 4h.1; Danio rerio; OTHER | GSM2845310 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845310 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 4hpf_S2.fastq.gz | fastq | 341290240.0 | 2133064.0 | GSM2845310 r1 | 0:160 1:0 | A:110474103;C:73498921;G:63171420;T:94123249;N:22547 | 160 | 0 | 110474103 | 73498921 | 63171420 | 94123249 | 22547 | SRX3374324 | SRS2671598 | SRA629220 | GEO | Broad Institute | 1 | 4e-05 | 0.0 | 0.99995 | 0.83333 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44693 | 44693 | SRR6268155 | SRX3374323 | SRS2671552 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | biorep A+ 2h.1 | GSM2845309 | source name:zebrafish embryos|developmental stage:2hpf|tissue:embryo | biorep A+ 2h.1 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:2hpf|tissue:embryo | GSM2845309 | GSM2845309: biorep A+ 2h.1; Danio rerio; OTHER | GSM2845309 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845309 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 2hpf_S1.fastq.gz | fastq | 370636000.0 | 2316475.0 | GSM2845309 r1 | 0:160 1:0 | A:119234673;C:80176544;G:68884386;T:102316866;N:23531 | 160 | 0 | 119234673 | 80176544 | 68884386 | 102316866 | 23531 | SRX3374323 | SRS2671552 | SRA629220 | GEO | Broad Institute | 1 | 3e-05 | 0.0 | 0.99995 | 1.0 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44694 | 44694 | SRR6268154 | SRX3374322 | SRS2671551 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | biorep A+ uninjected | GSM2845308 | source name:zebrafish embryos|developmental stage:NA|tissue:embryo | biorep A+ uninjected | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:NA|tissue:embryo | GSM2845308 | GSM2845308: biorep A+ uninjected; Danio rerio; OTHER | GSM2845308 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845308 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | pool_S7.fastq.gz | fastq | 818166560.0 | 5113541.0 | GSM2845308 r1 | 0:160 1:0 | A:256677558;C:187984574;G:154806708;T:218648792;N:48928 | 160 | 0 | 256677558 | 187984574 | 154806708 | 218648792 | 48928 | SRX3374322 | SRS2671551 | SRA629220 | GEO | Broad Institute | 1 | 8e-05 | 0.0 | 0.99975 | 0.5 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Zygote | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44695 | 44695 | SRR6268153 | SRX3374321 | SRS2671548 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | embryo A 10h | GSM2845307 | source name:zebrafish embryos|developmental stage:10hpf|tissue:embryo | embryo A 10h | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:10hpf|tissue:embryo | GSM2845307 | GSM2845307: embryo A 10h; Danio rerio; OTHER | GSM2845307 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845307 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124609 | SPE_0xA_AR10.fastq.gz | fastq | 198697400.0 | 1986974.0 | GSM2845307 r1 | 0:100 | A:67804840;C:37625181;G:37716734;T:55503500;N:47145 | 100 | 67804840 | 37625181 | 37716734 | 55503500 | 47145 | SRX3374321 | SRS2671548 | SRA629220 | GEO | Broad Institute | 1 | 4e-05 | 1e-05 | 0.99991 | 0.5 | 100 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 44696 | 44696 | SRR6268152 | SRX3374320 | SRS2671550 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | embryo A 8h | GSM2845306 | source name:zebrafish embryos|developmental stage:8hpf|tissue:embryo | embryo A 8h | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:8hpf|tissue:embryo | GSM2845306 | GSM2845306: embryo A 8h; Danio rerio; OTHER | GSM2845306 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845306 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124609 | SPE_0xA_AR09.fastq.gz | fastq | 392836100.0 | 3928361.0 | GSM2845306 r1 | 0:100 | A:137386195;C:71809820;G:72324431;T:111220224;N:95430 | 100 | 137386195 | 71809820 | 72324431 | 111220224 | 95430 | SRX3374320 | SRS2671550 | SRA629220 | GEO | Broad Institute | 1 | 3e-05 | 0.0 | 0.99991 | 0.0 | 100 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;