run_metadata
156 rows where experiment.library_layout = "SINGLE", experiment.library_selection = "other" and experiment.library_strategy = "RNA-Seq"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 60 | 60 | DRR032764 | DRX029570 | DRS049969 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 100 individuals | Dr shield 2 | SAMD00028161 | sample name:Dr shield 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:shield|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028161 | DRX029570 | Dr shield 2 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028161 | 3644397900.0 | 36443979.0 | DRR032764 | 0:100 1:0 | A:986071173;C:842367218;G:837686080;T:978236607;N:36822 | 100 | 0 | 986071173 | 842367218 | 837686080 | 978236607 | 36822 | DRX029570 | DRS049969 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.92419 | 0.08269 | 0.75558 | 0.47863 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Gastrula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 61 | 61 | DRR032763 | DRX029569 | DRS049968 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 100 individuals | Dr shield 1 | SAMD00028160 | sample name:Dr shield 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:shield|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028160 | DRX029569 | Dr shield 1 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028160 | 3834622000.0 | 38346220.0 | DRR032763 | 0:100 1:0 | A:1043352851;C:880011834;G:876775415;T:1034444253;N:37647 | 100 | 0 | 1043352851 | 880011834 | 876775415 | 1034444253 | 37647 | DRX029569 | DRS049968 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.92305 | 0.09126 | 0.75481 | 0.47587 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Gastrula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 62 | 62 | DRR032762 | DRX029568 | DRS049967 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 50 individuals | Dr prime5 6 3 | SAMD00028159 | sample name:Dr prime5 6 3|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:prime5 6|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028159 | DRX029568 | Dr prime5 6 3 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028159 | 3903332800.0 | 39033328.0 | DRR032762 | 0:100 1:0 | A:1050045822;C:908538410;G:900588661;T:1044116537;N:43370 | 100 | 0 | 1050045822 | 908538410 | 900588661 | 1044116537 | 43370 | DRX029568 | DRS049967 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.92761 | 0.07976 | 0.69126 | 0.46568 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Undetermined | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 63 | 63 | DRR032761 | DRX029567 | DRS049966 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 50 individuals | Dr prime5 6 2 | SAMD00028158 | sample name:Dr prime5 6 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:prime5 6|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028158 | DRX029567 | Dr prime5 6 2 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028158 | 3678549700.0 | 36785497.0 | DRR032761 | 0:100 1:0 | A:986526644;C:857762765;G:853417738;T:980801764;N:40789 | 100 | 0 | 986526644 | 857762765 | 853417738 | 980801764 | 40789 | DRX029567 | DRS049966 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.92689 | 0.07872 | 0.6928 | 0.46577 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Undetermined | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 64 | 64 | DRR032760 | DRX029566 | DRS049965 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 50 individuals | Dr prime5 6 1 | SAMD00028157 | sample name:Dr prime5 6 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:prime5 6|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028157 | DRX029566 | Dr prime5 6 1 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028157 | 3863129500.0 | 38631295.0 | DRR032760 | 0:100 1:0 | A:1035240477;C:901625010;G:895370149;T:1030851937;N:41927 | 100 | 0 | 1035240477 | 901625010 | 895370149 | 1030851937 | 41927 | DRX029566 | DRS049965 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.92337 | 0.07522 | 0.69315 | 0.46516 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Undetermined | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 65 | 65 | DRR032759 | DRX029565 | DRS049964 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 50 individuals | Dr prime25 2 | SAMD00028156 | sample name:Dr prime25 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:prime25|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028156 | DRX029565 | Dr prime25 2 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028156 | 3750136100.0 | 37501361.0 | DRR032759 | 0:100 1:0 | A:1013528040;C:866734984;G:862431819;T:1007403208;N:38049 | 100 | 0 | 1013528040 | 866734984 | 862431819 | 1007403208 | 38049 | DRX029565 | DRS049964 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.92019 | 0.09079 | 0.68304 | 0.47083 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Undetermined | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 66 | 66 | DRR032758 | DRX029564 | DRS049963 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 50 individuals | Dr prime25 1 | SAMD00028155 | sample name:Dr prime25 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:prime25|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028155 | DRX029564 | Dr prime25 1 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028155 | 3544862700.0 | 35448627.0 | DRR032758 | 0:100 1:0 | A:952135895;C:825841753;G:821757889;T:945087927;N:39236 | 100 | 0 | 952135895 | 825841753 | 821757889 | 945087927 | 39236 | DRX029564 | DRS049963 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.92229 | 0.08344 | 0.68525 | 0.466 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Undetermined | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 67 | 67 | DRR032757 | DRX029563 | DRS049962 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 97 individuals | Dr bud 2 | SAMD00028154 | sample name:Dr bud 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:bud|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028154 | DRX029563 | Dr bud 2 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028154 | 4104778200.0 | 41047782.0 | DRR032757 | 0:100 1:0 | A:1116316188;C:944738800;G:936257056;T:1107423486;N:42670 | 100 | 0 | 1116316188 | 944738800 | 936257056 | 1107423486 | 42670 | DRX029563 | DRS049962 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.92945 | 0.10493 | 0.73407 | 0.47824 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Undetermined | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 68 | 68 | DRR032756 | DRX029562 | DRS049961 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 100 individuals | Dr bud 1 | SAMD00028153 | sample name:Dr bud 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:bud|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028153 | DRX029562 | Dr bud 1 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028153 | 4540291000.0 | 45402910.0 | DRR032756 | 0:100 1:0 | A:1237914068;C:1042346110;G:1033172731;T:1226799791;N:58300 | 100 | 0 | 1237914068 | 1042346110 | 1033172731 | 1226799791 | 58300 | DRX029562 | DRS049961 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.92628 | 0.10478 | 0.7391 | 0.46461 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Undetermined | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 69 | 69 | DRR032755 | DRX029561 | DRS049960 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 100 individuals | Dr 90epiboly 2 | SAMD00028152 | sample name:Dr 90epiboly 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:90epiboly|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028152 | DRX029561 | Dr 90epiboly 2 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028152 | 3572358600.0 | 35723586.0 | DRR032755 | 0:100 1:0 | A:971653450;C:821326559;G:816855636;T:962477457;N:45498 | 100 | 0 | 971653450 | 821326559 | 816855636 | 962477457 | 45498 | DRX029561 | DRS049960 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.92485 | 0.10642 | 0.74213 | 0.47012 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Gastrula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 70 | 70 | DRR032754 | DRX029560 | DRS049959 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 100 individuals | Dr 90epiboly 1 | SAMD00028151 | sample name:Dr 90epiboly 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:90epiboly|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028151 | DRX029560 | Dr 90epiboly 1 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028151 | 3423980500.0 | 34239805.0 | DRR032754 | 0:100 1:0 | A:933088185;C:785251613;G:780911148;T:924686406;N:43148 | 100 | 0 | 933088185 | 785251613 | 780911148 | 924686406 | 43148 | DRX029560 | DRS049959 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.92436 | 0.10881 | 0.74255 | 0.47068 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Gastrula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 71 | 71 | DRR032753 | DRX029559 | DRS049958 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 114 individuals | Dr 8cell 2 | SAMD00028150 | sample name:Dr 8cell 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:8cell|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028150 | DRX029559 | Dr 8cell 2 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028150 | 3708921900.0 | 37089219.0 | DRR032753 | 0:100 1:0 | A:985502141;C:874161613;G:869551685;T:979663686;N:42775 | 100 | 0 | 985502141 | 874161613 | 869551685 | 979663686 | 42775 | DRX029559 | DRS049958 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.93329 | 0.02366 | 0.78896 | 0.47447 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 72 | 72 | DRR032752 | DRX029558 | DRS049957 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 96 individuals | Dr 8cell 1 | SAMD00028149 | sample name:Dr 8cell 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:8cell|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028149 | DRX029558 | Dr 8cell 1 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028149 | 3666991200.0 | 36669912.0 | DRR032752 | 0:100 1:0 | A:976118513;C:862559696;G:858017821;T:970254302;N:40868 | 100 | 0 | 976118513 | 862559696 | 858017821 | 970254302 | 40868 | DRX029558 | DRS049957 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.934 | 0.02403 | 0.78877 | 0.46902 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 73 | 73 | DRR032751 | DRX029557 | DRS049956 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 100 individuals | Dr 75epiboly 2 | SAMD00028148 | sample name:Dr 75epiboly 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:75epiboly|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028148 | DRX029557 | Dr 75epiboly 2 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028148 | 3252021500.0 | 32520215.0 | DRR032751 | 0:100 1:0 | A:885527595;C:746750899;G:742907892;T:876794123;N:40991 | 100 | 0 | 885527595 | 746750899 | 742907892 | 876794123 | 40991 | DRX029557 | DRS049956 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.92594 | 0.10181 | 0.74862 | 0.47789 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Gastrula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 74 | 74 | DRR032750 | DRX029556 | DRS049955 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 100 individuals | Dr 75epiboly 1 | SAMD00028147 | sample name:Dr 75epiboly 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:75epiboly|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028147 | DRX029556 | Dr 75epiboly 1 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028147 | 3785053700.0 | 37850537.0 | DRR032750 | 0:100 1:0 | A:1029014798;C:870946157;G:867537069;T:1017508684;N:46992 | 100 | 0 | 1029014798 | 870946157 | 867537069 | 1017508684 | 46992 | DRX029556 | DRS049955 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.92346 | 0.10046 | 0.74921 | 0.47295 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Gastrula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 75 | 75 | DRR032749 | DRX029555 | DRS049954 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 50 individuals | Dr 72h 2 | SAMD00028146 | sample name:Dr 72h 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:72h Protruding mouth|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028146 | DRX029555 | Dr 72h 2 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028146 | 3429795800.0 | 34297958.0 | DRR032749 | 0:100 1:0 | A:928062015;C:792470305;G:786930881;T:922296289;N:36310 | 100 | 0 | 928062015 | 792470305 | 786930881 | 922296289 | 36310 | DRX029555 | DRS049954 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.91821 | 0.09774 | 0.65437 | 0.46443 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 76 | 76 | DRR032748 | DRX029554 | DRS049953 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 50 individuals | Dr 72h 1 | SAMD00028145 | sample name:Dr 72h 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:72h Protruding mouth|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028145 | DRX029554 | Dr 72h 1 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028145 | 3897194500.0 | 38971945.0 | DRR032748 | 0:100 1:0 | A:1050989414;C:903225496;G:895783177;T:1047153493;N:42920 | 100 | 0 | 1050989414 | 903225496 | 895783177 | 1047153493 | 42920 | DRX029554 | DRS049953 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.92211 | 0.09393 | 0.65486 | 0.45971 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 77 | 77 | DRR032747 | DRX029553 | DRS049952 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 50 individuals | Dr 6somite 2 | SAMD00028144 | sample name:Dr 6somite 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:6somite|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028144 | DRX029553 | Dr 6somite 2 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028144 | 3704431000.0 | 37044310.0 | DRR032747 | 0:100 1:0 | A:1001844161;C:856702913;G:850695568;T:995148798;N:39560 | 100 | 0 | 1001844161 | 856702913 | 850695568 | 995148798 | 39560 | DRX029553 | DRS049952 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.92633 | 0.09211 | 0.72107 | 0.47195 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Segmentation | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 78 | 78 | DRR032746 | DRX029552 | DRS049951 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 50 individuals | Dr 6somite 1 | SAMD00028143 | sample name:Dr 6somite 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:6somite|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028143 | DRX029552 | Dr 6somite 1 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028143 | 3529311900.0 | 35293119.0 | DRR032746 | 0:100 1:0 | A:953957996;C:816824469;G:811403696;T:947089530;N:36209 | 100 | 0 | 953957996 | 816824469 | 811403696 | 947089530 | 36209 | DRX029552 | DRS049951 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.92437 | 0.09257 | 0.72113 | 0.47004 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Segmentation | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 79 | 79 | DRR032745 | DRX029551 | DRS049950 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 50 individuals | Dr 60h 2 | SAMD00028142 | sample name:Dr 60h 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:60h Pec fin|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028142 | DRX029551 | Dr 60h 2 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028142 | 3875337000.0 | 38753370.0 | DRR032745 | 0:100 1:0 | A:1042558903;C:899892111;G:896867583;T:1035981420;N:36983 | 100 | 0 | 1042558903 | 899892111 | 896867583 | 1035981420 | 36983 | DRX029551 | DRS049950 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.91891 | 0.09445 | 0.66156 | 0.45564 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Hatching | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 80 | 80 | DRR032744 | DRX029550 | DRS049949 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 50 individuals | Dr 60h 1 | SAMD00028141 | sample name:Dr 60h 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:60h Pec fin|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028141 | DRX029550 | Dr 60h 1 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028141 | 3538468200.0 | 35384682.0 | DRR032744 | 0:100 1:0 | A:960664313;C:812459988;G:809014008;T:956295205;N:34686 | 100 | 0 | 960664313 | 812459988 | 809014008 | 956295205 | 34686 | DRX029550 | DRS049949 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.91388 | 0.10346 | 0.66076 | 0.45203 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Hatching | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 81 | 81 | DRR032743 | DRX029549 | DRS049948 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 50 individuals | Dr 5day 3 | SAMD00028140 | sample name:Dr 5day 3|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:5day|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028140 | DRX029549 | Dr 5day 3 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028140 | 3884716000.0 | 38847160.0 | DRR032743 | 0:100 1:0 | A:1040550584;C:905663425;G:904247323;T:1034215019;N:39649 | 100 | 0 | 1040550584 | 905663425 | 904247323 | 1034215019 | 39649 | DRX029549 | DRS049948 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.92219 | 0.08287 | 0.65863 | 0.47377 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 82 | 82 | DRR032742 | DRX029548 | DRS049947 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 50 individuals | Dr 5day 2 | SAMD00028139 | sample name:Dr 5day 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:5day|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028139 | DRX029548 | Dr 5day 2 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028139 | 3893708700.0 | 38937087.0 | DRR032742 | 0:100 1:0 | A:1050850168;C:899863467;G:897224776;T:1045729184;N:41105 | 100 | 0 | 1050850168 | 899863467 | 897224776 | 1045729184 | 41105 | DRX029548 | DRS049947 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.91671 | 0.0991 | 0.65161 | 0.47454 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 83 | 83 | DRR032741 | DRX029547 | DRS049946 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 50 individuals | Dr 5day 1 | SAMD00028138 | sample name:Dr 5day 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:5day|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028138 | DRX029547 | Dr 5day 1 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028138 | 3807570600.0 | 38075706.0 | DRR032741 | 0:100 1:0 | A:1022590228;C:884655401;G:882546091;T:1017737883;N:40997 | 100 | 0 | 1022590228 | 884655401 | 882546091 | 1017737883 | 40997 | DRX029547 | DRS049946 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.9182 | 0.09442 | 0.65525 | 0.46661 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 84 | 84 | DRR032740 | DRX029546 | DRS049945 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 50 individuals | Dr 48h 2 | SAMD00028137 | sample name:Dr 48h 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:48h Long pec|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028137 | DRX029546 | Dr 48h 2 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028137 | 3702804700.0 | 37028047.0 | DRR032740 | 0:100 1:0 | A:993931475;C:862403562;G:857808891;T:988623734;N:37038 | 100 | 0 | 993931475 | 862403562 | 857808891 | 988623734 | 37038 | DRX029546 | DRS049945 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.92508 | 0.08526 | 0.68349 | 0.45769 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Hatching | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 85 | 85 | DRR032739 | DRX029545 | DRS049944 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 50 individuals | Dr 48h 1 | SAMD00028136 | sample name:Dr 48h 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:48h Long pec|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028136 | DRX029545 | Dr 48h 1 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028136 | 3980240400.0 | 39802404.0 | DRR032739 | 0:100 1:0 | A:1070497788;C:925240883;G:920038728;T:1064422474;N:40527 | 100 | 0 | 1070497788 | 925240883 | 920038728 | 1064422474 | 40527 | DRX029545 | DRS049944 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.92349 | 0.08681 | 0.67874 | 0.46565 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Hatching | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 86 | 86 | DRR032738 | DRX029544 | DRS049943 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 100 individuals | Dr 32cell 2 | SAMD00028135 | sample name:Dr 32cell 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:32cell|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028135 | DRX029544 | Dr 32cell 2 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028135 | 3678713000.0 | 36787130.0 | DRR032738 | 0:100 1:0 | A:981005900;C:863203049;G:859660640;T:974807835;N:35576 | 100 | 0 | 981005900 | 863203049 | 859660640 | 974807835 | 35576 | DRX029544 | DRS049943 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.93302 | 0.02468 | 0.77441 | 0.47485 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 87 | 87 | DRR032737 | DRX029543 | DRS049942 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 95 individuals | Dr 32cell 1 | SAMD00028134 | sample name:Dr 32cell 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:32cell|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028134 | DRX029543 | Dr 32cell 1 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028134 | 3870906500.0 | 38709065.0 | DRR032737 | 0:100 1:0 | A:1030407751;C:909948718;G:905608620;T:1024897443;N:43968 | 100 | 0 | 1030407751 | 909948718 | 905608620 | 1024897443 | 43968 | DRX029543 | DRS049942 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.93364 | 0.02484 | 0.77307 | 0.47588 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 88 | 88 | DRR032736 | DRX029542 | DRS049941 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 100 individuals | Dr zfs:0000015 2 | SAMD00028133 | sample name:Dr zfs:0000015 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:zfs:0000015|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028133 | DRX029542 | Dr zfs:0000015 2 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028133 | 3129028500.0 | 31290285.0 | DRR032736 | 0:100 1:0 | A:849515903;C:721550282;G:717777586;T:840154982;N:29747 | 100 | 0 | 849515903 | 721550282 | 717777586 | 840154982 | 29747 | DRX029542 | DRS049941 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.92724 | 0.07971 | 0.74657 | 0.47796 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Blastula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 89 | 89 | DRR032735 | DRX029541 | DRS049940 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 100 individuals | Dr zfs:0000015 1 | SAMD00028132 | sample name:Dr zfs:0000015 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:zfs:0000015|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028132 | DRX029541 | Dr zfs:0000015 1 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028132 | 4310219700.0 | 43102197.0 | DRR032735 | 0:100 1:0 | A:1169701983;C:993241399;G:986263558;T:1160969083;N:43677 | 100 | 0 | 1169701983 | 993241399 | 986263558 | 1160969083 | 43677 | DRX029541 | DRS049940 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.92609 | 0.07773 | 0.74349 | 0.47849 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Blastula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 90 | 90 | DRR032734 | DRX029540 | DRS049939 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 107 individuals | Dr 2cell 2 | SAMD00028131 | sample name:Dr 2cell 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:2cell|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028131 | DRX029540 | Dr 2cell 2 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028131 | 3687517000.0 | 36875170.0 | DRR032734 | 0:100 1:0 | A:975272080;C:873518282;G:869743434;T:968941851;N:41353 | 100 | 0 | 975272080 | 873518282 | 869743434 | 968941851 | 41353 | DRX029540 | DRS049939 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.93204 | 0.02088 | 0.81639 | 0.47553 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 91 | 91 | DRR032733 | DRX029539 | DRS049938 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 108 individuals | Dr 2cell 1 | SAMD00028130 | sample name:Dr 2cell 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:2cell|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028130 | DRX029539 | Dr 2cell 1 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028130 | 4156651100.0 | 41566511.0 | DRR032733 | 0:100 1:0 | A:1099943617;C:985498415;G:978884426;T:1092278665;N:45977 | 100 | 0 | 1099943617 | 985498415 | 978884426 | 1092278665 | 45977 | DRX029539 | DRS049938 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.93452 | 0.02198 | 0.81197 | 0.47342 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 92 | 92 | DRR032732 | DRX029538 | DRS049937 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 80 individuals | Dr 14somite 3 | SAMD00028129 | sample name:Dr 14somite 3|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:14somite|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028129 | DRX029538 | Dr 14somite 3 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028129 | 3734610500.0 | 37346105.0 | DRR032732 | 0:100 1:0 | A:1009418541;C:863710067;G:858061383;T:1003378800;N:41709 | 100 | 0 | 1009418541 | 863710067 | 858061383 | 1003378800 | 41709 | DRX029538 | DRS049937 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.92401 | 0.08815 | 0.70816 | 0.46602 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Segmentation | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 93 | 93 | DRR032731 | DRX029537 | DRS049936 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 80 individuals | Dr 14somite 2 | SAMD00028128 | sample name:Dr 14somite 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:14somite|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028128 | DRX029537 | Dr 14somite 2 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028128 | 3715174200.0 | 37151742.0 | DRR032731 | 0:100 1:0 | A:1000703508;C:862290629;G:858173468;T:993968396;N:38199 | 100 | 0 | 1000703508 | 862290629 | 858173468 | 993968396 | 38199 | DRX029537 | DRS049936 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.92491 | 0.0819 | 0.71068 | 0.46957 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Segmentation | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 94 | 94 | DRR032730 | DRX029536 | DRS049935 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 80 individuals | Dr 14somite 1 | SAMD00028127 | sample name:Dr 14somite 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:14somite|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028127 | DRX029536 | Dr 14somite 1 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028127 | 3744386000.0 | 37443860.0 | DRR032730 | 0:100 1:0 | A:1014537326;C:864070910;G:859190201;T:1006549502;N:38061 | 100 | 0 | 1014537326 | 864070910 | 859190201 | 1006549502 | 38061 | DRX029536 | DRS049935 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.92378 | 0.08957 | 0.7068 | 0.47493 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Segmentation | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 9719 | 9719 | ERR3842000 | ERX3854562 | ERS4268611 | ERP116106 | PRJEB33323 | Deconstructing the individual steps of vertebrate translation initiation | ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 | Other | In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03 | Shield 4Ei | SAMEA6504165 | Computational Biology Unit | ENA FIRST PUBLIC:2020 03 27T17:05:06Z|ENA LAST UPDATE:2020 01 27T16:04:35Z|External Id:SAMEA6504165|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:05:06Z|INSDC last update:2020 01 27T16:04:35Z|INSDC status:public|Submitter Id:Shield 4Ei|common name:zebrafish|sample name:Shield 4Ei|scientific name:Danio rerio | NextSeq 500 sequencing | ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:406 10 | Shield 4Ei | OTHER | RNA Seq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | ERP116106 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14 | 1435748376.0 | 18891426.0 | ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 10 | 0:76 | A:489056518;C:372290023;G:393663734;T:180723629;N:14472 | 76 | 489056518 | 372290023 | 393663734 | 180723629 | 14472 | ERX3854562 | ERS4268611 | ERA2359305 | Computational Biology Unit|European Nucleotide Archive | Computational Biology Unit | 1 | 0.11942 | 0.03394 | 0.98971 | 0.62271 | 76 | B | usable mapping rate | illumina | nextseq | unknown | other | unknown | bulk | unknown | unknown | Unknown | 2019-07-03 | Gastrula | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||||
| 9720 | 9720 | ERR3841999 | ERX3854561 | ERS3556006 | ERP116106 | PRJEB33323 | Deconstructing the individual steps of vertebrate translation initiation | ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 | Other | In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03 | Shield 3 | SAMEA5752547 | Computational Biology Unit | ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752547|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:10|common name:zebrafish|dev stage:Shield|sample name:10|scientific name:Danio rerio | NextSeq 500 sequencing | ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:406 9 | Shield 3 | OTHER | RNA Seq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | ERP116106 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14 | 1168482976.0 | 15374776.0 | ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 9 | 0:76 | A:516070340;C:238363428;G:268806793;T:145231087;N:11328 | 76 | 516070340 | 238363428 | 268806793 | 145231087 | 11328 | ERX3854561 | ERS3556006 | ERA2359305 | Computational Biology Unit|European Nucleotide Archive | Computational Biology Unit | 1 | 0.22586 | 0.10275 | 0.97281 | 0.47683 | 76 | B | usable mapping rate | illumina | nextseq | unknown | other | unknown | bulk | unknown | unknown | Unknown | 2019-07-03 | Gastrula | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||||
| 9721 | 9721 | ERR3841998 | ERX3854560 | ERS3556007 | ERP116106 | PRJEB33323 | Deconstructing the individual steps of vertebrate translation initiation | ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 | Other | In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03 | Shield 4150NT | SAMEA5752548 | Computational Biology Unit | ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752548|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:11|common name:zebrafish|dev stage:Shield|sample name:11|scientific name:Danio rerio | NextSeq 500 sequencing | ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:406 8 | Shield 150NT | OTHER | RNA Seq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | ERP116106 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14 | 1188343980.0 | 15636105.0 | ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 8 | 0:76 | A:580658556;C:223116826;G:260847322;T:123709681;N:11595 | 76 | 580658556 | 223116826 | 260847322 | 123709681 | 11595 | ERX3854560 | ERS3556007 | ERA2359305 | Computational Biology Unit|European Nucleotide Archive | Computational Biology Unit | 1 | 0.27037 | 0.13972 | 0.97392 | 0.39459 | 76 | B | usable mapping rate | illumina | nextseq | unknown | other | unknown | bulk | unknown | unknown | Unknown | 2019-07-03 | Gastrula | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||||
| 9722 | 9722 | ERR3841997 | ERX3854559 | ERS3556004 | ERP116106 | PRJEB33323 | Deconstructing the individual steps of vertebrate translation initiation | ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 | Other | In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03 | Shield 1 | SAMEA5752545 | Computational Biology Unit | ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752545|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:8|common name:zebrafish|dev stage:Shield|sample name:8|scientific name:Danio rerio | NextSeq 500 sequencing | ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:406 7 | Shield 1 | OTHER | RNA Seq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | ERP116106 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14 | 1278891444.0 | 16827519.0 | ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 7 | 0:76 | A:571738369;C:256385478;G:295145281;T:155610082;N:12234 | 76 | 571738369 | 256385478 | 295145281 | 155610082 | 12234 | ERX3854559 | ERS3556004 | ERA2359305 | Computational Biology Unit|European Nucleotide Archive | Computational Biology Unit | 1 | 0.23116 | 0.11137 | 0.97932 | 0.45978 | 76 | B | usable mapping rate | illumina | nextseq | unknown | other | unknown | bulk | unknown | unknown | Unknown | 2019-07-03 | Gastrula | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||||
| 9723 | 9723 | ERR3841996 | ERX3854558 | ERS3556001 | ERP116106 | PRJEB33323 | Deconstructing the individual steps of vertebrate translation initiation | ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 | Other | In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03 | Sphere 3 | SAMEA5752542 | Computational Biology Unit | ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752542|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:5|common name:zebrafish|dev stage:Sphere|sample name:5|scientific name:Danio rerio | NextSeq 500 sequencing | ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:406 6 | Sphere 3 | OTHER | RNA Seq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | ERP116106 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14 | 1439954368.0 | 18946768.0 | ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 6 | 0:76 | A:669362698;C:280496524;G:316727778;T:173353505;N:13863 | 76 | 669362698 | 280496524 | 316727778 | 173353505 | 13863 | ERX3854558 | ERS3556001 | ERA2359305 | Computational Biology Unit|European Nucleotide Archive | Computational Biology Unit | 1 | 0.26155 | 0.12068 | 0.96915 | 0.45719 | 76 | B | usable mapping rate | illumina | nextseq | unknown | other | unknown | bulk | unknown | unknown | Unknown | 2019-07-03 | Blastula | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||||
| 9724 | 9724 | ERR3841995 | ERX3854557 | ERS3556000 | ERP116106 | PRJEB33323 | Deconstructing the individual steps of vertebrate translation initiation | ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 | Other | In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03 | Sphere 2 | SAMEA5752541 | Computational Biology Unit | ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752541|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:4|common name:zebrafish|dev stage:Sphere|sample name:4|scientific name:Danio rerio | NextSeq 500 sequencing | ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:406 5 | Sphere 2 | OTHER | RNA Seq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | ERP116106 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14 | 1592272200.0 | 20950950.0 | ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 5 | 0:76 | A:757507948;C:308394094;G:342142775;T:184211881;N:15502 | 76 | 757507948 | 308394094 | 342142775 | 184211881 | 15502 | ERX3854557 | ERS3556000 | ERA2359305 | Computational Biology Unit|European Nucleotide Archive | Computational Biology Unit | 1 | 0.22483 | 0.10923 | 0.97646 | 0.49458 | 76 | B | usable mapping rate | illumina | nextseq | unknown | other | unknown | bulk | unknown | unknown | Unknown | 2019-07-03 | Blastula | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||||
| 9725 | 9725 | ERR3841994 | ERX3854556 | ERS3555999 | ERP116106 | PRJEB33323 | Deconstructing the individual steps of vertebrate translation initiation | ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 | Other | In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03 | Sphere 1 | SAMEA5752540 | Computational Biology Unit | ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752540|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:3|common name:zebrafish|dev stage:Sphere|sample name:3|scientific name:Danio rerio | NextSeq 500 sequencing | ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:406 4 | Sphere 1 | OTHER | RNA Seq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | ERP116106 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14 | 1332363676.0 | 17531101.0 | ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 4 | 0:76 | A:529354355;C:299445923;G:318745973;T:184804260;N:13165 | 76 | 529354355 | 299445923 | 318745973 | 184804260 | 13165 | ERX3854556 | ERS3555999 | ERA2359305 | Computational Biology Unit|European Nucleotide Archive | Computational Biology Unit | 1 | 0.21197 | 0.0829 | 0.98196 | 0.55753 | 76 | B | usable mapping rate | illumina | nextseq | unknown | other | unknown | bulk | unknown | unknown | Unknown | 2019-07-03 | Blastula | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||||
| 9726 | 9726 | ERR3841993 | ERX3854555 | ERS3555998 | ERP116106 | PRJEB33323 | Deconstructing the individual steps of vertebrate translation initiation | ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 | Other | In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03 | 64 cell 2 | SAMEA5752539 | Computational Biology Unit | ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752539|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:2|common name:zebrafish|dev stage:64 cell|sample name:2|scientific name:Danio rerio | NextSeq 500 sequencing | ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:406 3 | 64 cell 3 | OTHER | RNA Seq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | ERP116106 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14 | 1579307816.0 | 20780366.0 | ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 3 | 0:76 | A:589876602;C:380048242;G:392473318;T:216893826;N:15828 | 76 | 589876602 | 380048242 | 392473318 | 216893826 | 15828 | ERX3854555 | ERS3555998 | ERA2359305 | Computational Biology Unit|European Nucleotide Archive | Computational Biology Unit | 1 | 0.15411 | 0.04564 | 0.97883 | 0.55376 | 76 | B | usable mapping rate | illumina | nextseq | unknown | other | unknown | bulk | unknown | unknown | Unknown | 2019-07-03 | Cleavage | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||||
| 9727 | 9727 | ERR3841992 | ERX3854554 | ERS3556003 | ERP116106 | PRJEB33323 | Deconstructing the individual steps of vertebrate translation initiation | ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 | Other | In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03 | 64 cell 4Ei 10 | SAMEA5752544 | Computational Biology Unit | ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752544|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:7|common name:zebrafish|dev stage:64 cell|sample name:7|scientific name:Danio rerio | NextSeq 500 sequencing | ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:406 2 | 64 cell 4Ei | OTHER | RNA Seq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | ERP116106 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14 | 1213585480.0 | 15968230.0 | ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 2 | 0:76 | A:548456563;C:244465528;G:271963808;T:148687764;N:11817 | 76 | 548456563 | 244465528 | 271963808 | 148687764 | 11817 | ERX3854554 | ERS3556003 | ERA2359305 | Computational Biology Unit|European Nucleotide Archive | Computational Biology Unit | 1 | 0.21973 | 0.10926 | 0.97419 | 0.44348 | 76 | B | usable mapping rate | illumina | nextseq | unknown | other | unknown | bulk | unknown | unknown | Unknown | 2019-07-03 | Cleavage | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||||
| 9728 | 9728 | ERR3841991 | ERX3854553 | ERS3555997 | ERP116106 | PRJEB33323 | Deconstructing the individual steps of vertebrate translation initiation | ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 | Other | In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03 | 64 cell 1 | SAMEA5752538 | Computational Biology Unit | ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752538|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:1|common name:zebrafish|dev stage:64 cell|sample name:1|scientific name:Danio rerio | NextSeq 500 sequencing | ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:405 1 | 64 cell 1 | OTHER | RNA Seq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | ERP116106 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14 | 1494930944.0 | 19670144.0 | ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 1 | 0:76 | A:543017836;C:366974203;G:367027373;T:217896401;N:15131 | 76 | 543017836 | 366974203 | 367027373 | 217896401 | 15131 | ERX3854553 | ERS3555997 | ERA2359305 | Computational Biology Unit|European Nucleotide Archive | Computational Biology Unit | 1 | 0.2544 | 0.08957 | 0.96568 | 0.55681 | 76 | B | usable mapping rate | illumina | nextseq | unknown | other | unknown | bulk | unknown | unknown | Unknown | 2019-07-03 | Cleavage | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||||
| 10214 | 10214 | ERR6617900 | ERX6244443 | ERS7291130 | ERP131213 | PRJEB46978 | Nano3P seq: transcriptome wide analysis of gene expression and tail dynamics using end capture nanopore sequencing | ena-STUDY-CENTER FOR GENOMIC REGULATION (CRG)-12-08-2021-14:48:52:906-1159 | Other | Nano3P seq is a simple and robust method to accurately estimate transcript levels tail lengths and tail nucleotide composition information in full length individual reads with minimal library preparation biases both in the coding and non coding transcriptome. | ENA FIRST PUBLIC:2023 12 28|ENA LAST UPDATE:2023 12 28 | PolyA selected dRNA sequenced zebrafish 4hpf RNA | Zebrafish 4hpf dRNA | SAMEA9568396 | CENTER FOR GENOMIC REGULATION (CRG) | ENA FIRST PUBLIC:2023 12 28T01:07:30Z|ENA LAST UPDATE:2023 12 28T01:07:30Z|External Id:SAMEA9568396|INSDC center name:CENTER FOR GENOMIC REGULATION CRG|INSDC first public:2023 12 28T01:07:30Z|INSDC last update:2023 12 28T01:07:30Z|INSDC status:public|Submitter Id:Zebrafish 4hpf dRNA1|common name:zebrafish|sample name:Zebrafish 4hpf dRNA1|scientific name:Danio rerio | MinION sequencing | ena EXPERIMENT CENTER FOR GENOMIC REGULATION CRG 03 09 2021 14:33:13:450 1 | dRNA Zebrafish | Direct RNA Sequencing | Direct RNA Sequencing | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | OXFORD_NANOPORE | MinION | ERP131213 | MinION sequencing | ENA FIRST PUBLIC:2023 12 28|ENA LAST UPDATE:2023 12 28 | Zebrafish_4hpf_dRNA.fast5.tar.gz | nanopore | 772304625.0 | 897768.0 | ena RUN CENTER FOR GENOMIC REGULATION CRG 03 09 2021 14:33:13:450 1 | 0:860.25 | A:224977035;C:165273397;G:156659356;T:225394837;N:0 | 860 | 224977035 | 165273397 | 156659356 | 225394837 | 0 | ERX6244443 | ERS7291130 | ERA5995143 | CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive | CENTER FOR GENOMIC REGULATION (CRG) | 1 | 0.5 | 0.0 | 0.99997 | 1.0 | 962 | T | long read | ont | ont | full_length | poly_a | unknown | bulk | unknown | unknown | Spain | 2023-12-28 | Blastula | Embryo | Undetermined | Embryo Imprecise | |||||||||||||||||||||
| 11042 | 11042 | ERR9839781 | ERX9385638 | ERS12199238 | ERP138294 | PRJEB53494 | Nano3P seq: transcriptome wide analysis of gene expression and tail dynamics using end capture nanopore cDNA sequencing | 94bf5509-4622-4d5f-b7c5-6a14bdfac340 | Other | RNA polyadenylation plays a central role in RNA maturation fate and stability. In response to developmental cues polyA tail lengths can vary affecting the translation efficiency and stability of mRNAs. Here we develop Nanopore three prime end capture sequencing Nano3P seq a novel method that relies on nanopore cDNA sequencing to simultaneously quantify RNA abundance tail composition and tail length dynamics at per read resolution. By employing a template switching based sequencing protocol Nano3P seq can sequence any given RNA molecule from its three prime end regardless of its polyadenylation status without xxx need for PCR amplification or ligation of RNA adapters. We demonstrate that Nano3P seq captures a wide diversity of RNA biotypes providing quantitative estimates of RNA abundance and tail lengths in mRNA lncRNA sn/snoRNA scaRNA and rRNA molecules. We find that in addition to mRNA and lncRNA polyA tails can be identified in 16S mitochondrial rRNA in both mouse and zebrafish models. Moreover we show that mRNA tail lengths are dynamically regulated during vertebrate embryogenesis at an isoform specific level correlating with mRNA decay. Finally we identify non A bases within polyA tails of various lengths and reveal their distribution during vertebrate embryogenesis. Overall Nano3P seq is a simple and robust method for accurately estimating transcript levels tail lengths and tail composition heterogeneity in individual reads with minimal library preparation biases both in the coding and non coding transcriptome. | ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10 | Zebrafish Ribodepleted RNA 2hpf 4hpf 6hpf | Zebrafish Ribodepleted Rep3 | SAMEA110100413 | CENTER FOR GENOMIC REGULATION (CRG) | ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10|External Id:SAMEA110100413|INSDC center alias:CENTER FOR GENOMIC REGULATION CRG|INSDC center name:CENTER FOR GENOMIC REGULATION CRG|INSDC first public:2022 10 10T00:20:53Z|INSDC last update:2022 10 10T00:20:53Z|INSDC status:public|Submitter Id:Zebrafish Ribodepleted Rep3|common name:zebrafish|sample name:Zebrafish Ribodepleted Rep3 | MinION sequencing | ena EXPERIMENT TAB 13 06 2022 16:07:52:807 817 | cDNA897892 ZFRDR3 | 1 | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | OXFORD_NANOPORE | MinION | ERP138294 | MinION sequencing | ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10 | cDNA897892_ZFRDR3.tar.gz | nanopore | 848659575.0 | 587586.0 | ena RUN TAB 13 06 2022 16:07:52:808 818 | 0:1444.32 | A:210205014;C:186527780;G:188214279;T:263712502;N:0 | 1444 | 210205014 | 186527780 | 188214279 | 263712502 | 0 | ERX9385638 | ERS12199238 | ERA15547404 | CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive | CENTER FOR GENOMIC REGULATION (CRG) | ont | ont | 3prime | poly_a | unknown | bulk | unknown | unknown | Spain | 2022-10-10 | Multi-stage | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||||||||||
| 11043 | 11043 | ERR9839780 | ERX9385637 | ERS12199237 | ERP138294 | PRJEB53494 | Nano3P seq: transcriptome wide analysis of gene expression and tail dynamics using end capture nanopore cDNA sequencing | 94bf5509-4622-4d5f-b7c5-6a14bdfac340 | Other | RNA polyadenylation plays a central role in RNA maturation fate and stability. In response to developmental cues polyA tail lengths can vary affecting the translation efficiency and stability of mRNAs. Here we develop Nanopore three prime end capture sequencing Nano3P seq a novel method that relies on nanopore cDNA sequencing to simultaneously quantify RNA abundance tail composition and tail length dynamics at per read resolution. By employing a template switching based sequencing protocol Nano3P seq can sequence any given RNA molecule from its three prime end regardless of its polyadenylation status without xxx need for PCR amplification or ligation of RNA adapters. We demonstrate that Nano3P seq captures a wide diversity of RNA biotypes providing quantitative estimates of RNA abundance and tail lengths in mRNA lncRNA sn/snoRNA scaRNA and rRNA molecules. We find that in addition to mRNA and lncRNA polyA tails can be identified in 16S mitochondrial rRNA in both mouse and zebrafish models. Moreover we show that mRNA tail lengths are dynamically regulated during vertebrate embryogenesis at an isoform specific level correlating with mRNA decay. Finally we identify non A bases within polyA tails of various lengths and reveal their distribution during vertebrate embryogenesis. Overall Nano3P seq is a simple and robust method for accurately estimating transcript levels tail lengths and tail composition heterogeneity in individual reads with minimal library preparation biases both in the coding and non coding transcriptome. | ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10 | Zebrafish Ribodepleted RNA 2hpf 4hpf 6hpf | Zebrafish Ribodepleted Rep2 | SAMEA110100412 | CENTER FOR GENOMIC REGULATION (CRG) | ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10|External Id:SAMEA110100412|INSDC center alias:CENTER FOR GENOMIC REGULATION CRG|INSDC center name:CENTER FOR GENOMIC REGULATION CRG|INSDC first public:2022 10 10T00:20:53Z|INSDC last update:2022 10 10T00:20:53Z|INSDC status:public|Submitter Id:Zebrafish Ribodepleted Rep2|common name:zebrafish|sample name:Zebrafish Ribodepleted Rep2 | MinION sequencing | ena EXPERIMENT TAB 13 06 2022 16:07:52:807 815 | cDNA123791 ZFRDR2 | 1 | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | OXFORD_NANOPORE | MinION | ERP138294 | MinION sequencing | ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10 | cDNA123791_ZFRDR2.tar.gz | nanopore | 2229275175.0 | 1955617.0 | ena RUN TAB 13 06 2022 16:07:52:807 816 | 0:1139.93 | A:533543922;C:498938137;G:515833119;T:680959997;N:0 | 1139 | 533543922 | 498938137 | 515833119 | 680959997 | 0 | ERX9385637 | ERS12199237 | ERA15547404 | CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive | CENTER FOR GENOMIC REGULATION (CRG) | ont | ont | 3prime | poly_a | unknown | bulk | unknown | unknown | Spain | 2022-10-10 | Multi-stage | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||||||||||
| 11044 | 11044 | ERR9839779 | ERX9385636 | ERS12199236 | ERP138294 | PRJEB53494 | Nano3P seq: transcriptome wide analysis of gene expression and tail dynamics using end capture nanopore cDNA sequencing | 94bf5509-4622-4d5f-b7c5-6a14bdfac340 | Other | RNA polyadenylation plays a central role in RNA maturation fate and stability. In response to developmental cues polyA tail lengths can vary affecting the translation efficiency and stability of mRNAs. Here we develop Nanopore three prime end capture sequencing Nano3P seq a novel method that relies on nanopore cDNA sequencing to simultaneously quantify RNA abundance tail composition and tail length dynamics at per read resolution. By employing a template switching based sequencing protocol Nano3P seq can sequence any given RNA molecule from its three prime end regardless of its polyadenylation status without xxx need for PCR amplification or ligation of RNA adapters. We demonstrate that Nano3P seq captures a wide diversity of RNA biotypes providing quantitative estimates of RNA abundance and tail lengths in mRNA lncRNA sn/snoRNA scaRNA and rRNA molecules. We find that in addition to mRNA and lncRNA polyA tails can be identified in 16S mitochondrial rRNA in both mouse and zebrafish models. Moreover we show that mRNA tail lengths are dynamically regulated during vertebrate embryogenesis at an isoform specific level correlating with mRNA decay. Finally we identify non A bases within polyA tails of various lengths and reveal their distribution during vertebrate embryogenesis. Overall Nano3P seq is a simple and robust method for accurately estimating transcript levels tail lengths and tail composition heterogeneity in individual reads with minimal library preparation biases both in the coding and non coding transcriptome. | ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10 | Zebrafish Ribodepleted RNA 2hpf 4hpf 6hpf | Zebrafish Ribodepleted Rep1 | SAMEA110100411 | CENTER FOR GENOMIC REGULATION (CRG) | ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10|External Id:SAMEA110100411|INSDC center alias:CENTER FOR GENOMIC REGULATION CRG|INSDC center name:CENTER FOR GENOMIC REGULATION CRG|INSDC first public:2022 10 10T00:20:53Z|INSDC last update:2022 10 10T00:20:53Z|INSDC status:public|Submitter Id:Zebrafish Ribodepleted Rep1|common name:zebrafish|sample name:Zebrafish Ribodepleted Rep1 | MinION sequencing | ena EXPERIMENT TAB 13 06 2022 16:07:52:807 813 | cDNA786327 ZFRDR1 | 1 | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | OXFORD_NANOPORE | MinION | ERP138294 | MinION sequencing | ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10 | cDNA786327_ZFRDR1.tar.gz | nanopore | 1900613556.0 | 1660167.0 | ena RUN TAB 13 06 2022 16:07:52:807 814 | 0:1144.83 | A:473050820;C:438054520;G:425169743;T:564338473;N:0 | 1144 | 473050820 | 438054520 | 425169743 | 564338473 | 0 | ERX9385636 | ERS12199236 | ERA15547404 | CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive | CENTER FOR GENOMIC REGULATION (CRG) | ont | ont | 3prime | poly_a | unknown | bulk | unknown | unknown | Spain | 2022-10-10 | Multi-stage | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||||||||||
| 11045 | 11045 | ERR9839778 | ERX9385635 | ERS12199235 | ERP138294 | PRJEB53494 | Nano3P seq: transcriptome wide analysis of gene expression and tail dynamics using end capture nanopore cDNA sequencing | 94bf5509-4622-4d5f-b7c5-6a14bdfac340 | Other | RNA polyadenylation plays a central role in RNA maturation fate and stability. In response to developmental cues polyA tail lengths can vary affecting the translation efficiency and stability of mRNAs. Here we develop Nanopore three prime end capture sequencing Nano3P seq a novel method that relies on nanopore cDNA sequencing to simultaneously quantify RNA abundance tail composition and tail length dynamics at per read resolution. By employing a template switching based sequencing protocol Nano3P seq can sequence any given RNA molecule from its three prime end regardless of its polyadenylation status without xxx need for PCR amplification or ligation of RNA adapters. We demonstrate that Nano3P seq captures a wide diversity of RNA biotypes providing quantitative estimates of RNA abundance and tail lengths in mRNA lncRNA sn/snoRNA scaRNA and rRNA molecules. We find that in addition to mRNA and lncRNA polyA tails can be identified in 16S mitochondrial rRNA in both mouse and zebrafish models. Moreover we show that mRNA tail lengths are dynamically regulated during vertebrate embryogenesis at an isoform specific level correlating with mRNA decay. Finally we identify non A bases within polyA tails of various lengths and reveal their distribution during vertebrate embryogenesis. Overall Nano3P seq is a simple and robust method for accurately estimating transcript levels tail lengths and tail composition heterogeneity in individual reads with minimal library preparation biases both in the coding and non coding transcriptome. | ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10 | Zebrafish PolyA Selected RNA 4hpf | Zebrafish pA selected | SAMEA110100410 | CENTER FOR GENOMIC REGULATION (CRG) | ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10|External Id:SAMEA110100410|INSDC center alias:CENTER FOR GENOMIC REGULATION CRG|INSDC center name:CENTER FOR GENOMIC REGULATION CRG|INSDC first public:2022 10 10T00:20:53Z|INSDC last update:2022 10 10T00:20:53Z|INSDC status:public|Submitter Id:Zebrafish pA selected|common name:zebrafish|sample name:Zebrafish pA selected | MinION sequencing | ena EXPERIMENT TAB 13 06 2022 16:07:52:807 811 | cDNA852361 ZFPA4R1 | 1 | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | OXFORD_NANOPORE | MinION | ERP138294 | MinION sequencing | ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10 | cDNA852361_ZFPA4R1.tar.gz | nanopore | 348224822.0 | 233101.0 | ena RUN TAB 13 06 2022 16:07:52:807 812 | 0:1493.88 | A:88963756;C:76104775;G:73909507;T:109246784;N:0 | 1493 | 88963756 | 76104775 | 73909507 | 109246784 | 0 | ERX9385635 | ERS12199235 | ERA15547404 | CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive | CENTER FOR GENOMIC REGULATION (CRG) | 1 | 0.34147 | 0.26829 | 0.99993 | 0.16666 | 1537 | T | long read | ont | ont | 3prime | poly_a | unknown | bulk | unknown | unknown | Spain | 2022-10-10 | Blastula | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||
| 30658 | 30658 | SRR28054753 | SRX23704452 | SRS20534448 | SRP491086 | PRJNA1078753 | Integrated mRNA and miRNA sequencing analyses unveil the underlying mechanism of tobacco pollutant induced developmental toxicity in zebrafish embryos | PRJNA1078753 | Other | Tobacco pollutants are prevalent in the environment leading to inadvertent exposure of pregnant females. Studies of these pollutants' toxic effects on development have not fully elucidated the potential underlying mechanisms. Therefore in this study we aim at investigate the developmental toxicity induced by cigarette smoke extract CSE at concentrations of 0.25% 1% and 2.5% using a zebrafish embryo toxicity test and integrated transcriptomic analysis of microRNA miRNA and messenger RNA mRNA. The findings revealed that CSE caused developmental toxicity including increased mortality and decreased incubation rate in a dose dependent manner. Moreover CSE induced malformations and apoptosis specifically in the head and heart of zebrafish larvae. We used mRNA and miRNA sequencing analyses to compare changes in the expression of genes and miRNAs in zebrafish larvae. The bioinformatics analysis indicates that the mechanism underlying CSE induced developmental toxicity was associated with genetic repair impairment apoptosis disorder and lipid metabolism disturbance. The enrichment analysis and RT qPCR show that the ctsba gene plays a crucial function in embryo developmental apoptosis and the fads2 gene mainly regulates lipid metabolic toxicity. The results of this study improve the understanding of CSE induced developmental toxicity in zebrafish embryos and contribute insights into the formulation of novel preventive strategies against tobacco pollutants during early embryonic development. | S21K1230 | library ID:H 3|title:High 3|library strategy:OTHER|library source:METATRANSCRIPTIOMIC|library selection:other|library layout:paired|platform:ILLUMINA|instrument model:RNA seq|filetype:fastq|filename:S21K1230 rep1 1 URNA S74 L003 R1 001.fastq|filename2:S21K1230 rep1 1 URNA S74 L003 R2 001.fastq|host:missing|isolation source:missing|collection date:missing|geographic location:missing|latitude and longitude:missing|age:missing|breed:missing|cultivar:missing|dev stage:missing|ecotype:missing|isolate:missing|sex:missing|strain:missing|tissue:missing|BioSampleModel:Model organism or animal | High 3 | H 3 | H 3 | missing | RNA-Seq | METATRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina NovaSeq 6000 | SRP491086 | S21K1230_rep1_1_URNA_S74_L003_R1_001.fastq.gz S21K1230_rep1_1_URNA_S74_L003_R2_001.fastq.gz | fastq fastq | 6117817800.0 | 20392726.0 | S21K1230 rep1 1 URNA S74 L003 R1 001.fastq.gz | 0:150 1:150 | A:1635728688;C:1405168032;G:1464072107;T:1612834762;N:14211 | 150 | 150 | 1635728688 | 1405168032 | 1464072107 | 1612834762 | 14211 | SRX23704452 | SRS20534448 | SRA1806456 | The Second Affiliated Hospital of Shantou University Medical College|Department of Burns and Plastic Surgery | The Second Affiliated Hospital of Shantou University Medical College | B | B | biological fallback assumption | illumina | novaseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | China | 2024-02-22 | Undetermined | Multi-stage | Undetermined | Undetermined | ||||||||||||||||||||||||||||||||
| 36265 | 36265 | SRR058073 | SRX022206 | SRS084221 | SRP002640 | PRJNA128943 | Expanding the MicroRNA Targeting Code: A Novel Type of Site with Centered Pairing | GSE22068 | Other | We present “centered sites ” a class of microRNA target sites that lacks both perfect seed pairing and three prime compensatory pairing and instead has 11–12 contiguous Watson–Crick pairs to the center of the microRNA. In elevated Mg2+ centered sites impart mRNA cleavage but in cells centered sites repress protein output without xxx Agronaute catalyzed cleavage. Our study also identified novel extensively paired sites that are cleavage substrates in cultured cells and human brain. This expanded repertoire of cleavage targets and the identification of the centered site type help explain why central regions of many microRNAs are evolutionarily conserved. Overall design: To study centered sites and identify miRNA cleavage targets mRNA degradomes were sequenced from human brain and HeLa cells and smallRNAs were sequenced from human brain and zebrafish embryo at 24 hpf. Replicates were combined before the analysis. Fastq files are not available for GSM548638 and GSM548639. | pubmed:20620952 | Zebrafish Embryo small RNAs | GSM548640 | source name:Embryo Cells|data type:small RNAs|tissue:embryo | Zebrafish Embryo small RNAs | Small RNA sequences from same total RNA samples were mapped to the human genome hg18 requiring a perfect match and reads co localizing to annotated miRNA loci miRBase version 11.0 were counted. sequence reads are summarized as frequency counts | Embryo Cells | The small RNA cDNA libraries were made as described Grimson et al. 2008 except for the three prime adaptor ligation which was five prime adenylated pTCGTATGCCGTCTTCTGCTTGidT. For a detailed protocol see http://web.wi.mit.edu/bartel/pub/protocols.html. | data type:small RNAs|tissue:embryo | GSM548640 | GSM548640: Zebrafish Embryo small RNAs | GSM548640: Zebrafish Embryo small RNAs | GSM548640: Zebrafish Embryo small RNAs | 1 | GEO Accession:GSM548640 | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina Genome Analyzer | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP002640 | quality book char:@|quality scoring system:log odds | Zebrafish_embryo_24h.fastq | fastq | 62213148.0 | 1728143.0 | GSM548640 1 | 0:36 | A:13550515;C:14269249;G:15670049;T:18673533;N:49802 | 36 | 13550515 | 14269249 | 15670049 | 18673533 | 49802 | SRX022206 | SRS084221 | SRA020539 | GEO | Bartel lab, Whitehead Institute | 1 | 0.02298 | 0.02186 | 0.9988 | 0.3246 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2010-06-01 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 36285 | 36285 | SRR363985 | SRX105298 | SRS270141 | SRP009275 | PRJNA148581 | Hen1 analysis in zebrafish | GSE33582 | Transcriptome Analysis | small RNA libraries from wild type and Hen1 mutant testes were made with either polyA tailing VASAGFPHen1minus/plus or adapter ligation Hen1Testis and WTTestis and sequenced on an Illumina GAII platform. Overall design: RNA was isolated from total testis tissue of both Hen1 wildtype and Hen1 mutant animals. post size selection from gel the small RNA libraries wre made. | pubmed:20859253 | wildtype ligation | GSM830247 | source name:testis|strain:TL|genotype/variation:Hen1 wildtype|tissue:testis|small rna library prep method:adapter ligation | wildtype ligation | three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the zebrafish genome Zv8 | testis | Small RNAs in the size range of 19 31 bases were excised from a denaturing gel. Adaptors were ligated to the five prime and three prime ends of the isolated RNA and the product was converted to cDNA using a primer on the three prime adaptor. post 15 cycles PCR amplification of the library the product was gel purified and sequenced on a Solexa platform. | strain:TL|genotype/variation:Hen1 wildtype|tissue:testis|small rna library prep method:adapter ligation | GSM830247 | GSM830247: wildtype ligation | GSM830247: wildtype ligation | GSM830247: wildtype ligation | 1 | GEO Accession:GSM830247 | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina Genome Analyzer II | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>46</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP009275 | read name barcode proc directive:ignore | WTTESTIS.fastq | fastq | 395791130.0 | 8604155.0 | GSM830247 1 | 0:46 | A:79045664;C:90489917;G:99082007;T:127024229;N:149313 | 46 | 79045664 | 90489917 | 99082007 | 127024229 | 149313 | SRX105298 | SRS270141 | SRA047996 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.00021 | 0.00015 | 0.99989 | 0.0 | 46 | T | under 1.2% mapping rate | illumina | early_illumina | 5prime | poly_a | unknown | bulk | unknown | unknown | Netherlands | 2011-11-09 | Undetermined | Undetermined | Gonad | Reproductive System | |||||||||||||||||
| 36286 | 36286 | SRR363984 | SRX105297 | SRS270140 | SRP009275 | PRJNA148581 | Hen1 analysis in zebrafish | GSE33582 | Transcriptome Analysis | small RNA libraries from wild type and Hen1 mutant testes were made with either polyA tailing VASAGFPHen1minus/plus or adapter ligation Hen1Testis and WTTestis and sequenced on an Illumina GAII platform. Overall design: RNA was isolated from total testis tissue of both Hen1 wildtype and Hen1 mutant animals. post size selection from gel the small RNA libraries wre made. | pubmed:20859253 | hen1 mutant ligation | GSM830246 | source name:testis|strain:TL|genotype/variation:Hen1 mutant|tissue:testis|small rna library prep method:adapter ligation | hen1 mutant ligation | three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the zebrafish genome Zv8 | testis | Small RNAs in the size range of 19 31 bases were excised from a denaturing gel. Adaptors were ligated to the five prime and three prime ends of the isolated RNA and the product was converted to cDNA using a primer on the three prime adaptor. post 15 cycles PCR amplification of the library the product was gel purified and sequenced on a Solexa platform. | strain:TL|genotype/variation:Hen1 mutant|tissue:testis|small rna library prep method:adapter ligation | GSM830246 | GSM830246: hen1 mutant ligation | GSM830246: hen1 mutant ligation | GSM830246: hen1 mutant ligation | 1 | GEO Accession:GSM830246 | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina Genome Analyzer II | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>46</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP009275 | read name barcode proc directive:ignore | HEN1TESTIS.fastq | fastq | 440876374.0 | 9584269.0 | GSM830246 1 | 0:46 | A:91693980;C:99515953;G:105634029;T:143841954;N:190458 | 46 | 91693980 | 99515953 | 105634029 | 143841954 | 190458 | SRX105297 | SRS270140 | SRA047996 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.00039 | 0.00033 | 0.99995 | 0.0 | 46 | T | under 1.2% mapping rate | illumina | early_illumina | 5prime | poly_a | unknown | bulk | unknown | unknown | Netherlands | 2011-11-09 | Undetermined | Undetermined | Gonad | Reproductive System | |||||||||||||||||
| 36287 | 36287 | SRR363983 | SRX105296 | SRS270139 | SRP009275 | PRJNA148581 | Hen1 analysis in zebrafish | GSE33582 | Transcriptome Analysis | small RNA libraries from wild type and Hen1 mutant testes were made with either polyA tailing VASAGFPHen1minus/plus or adapter ligation Hen1Testis and WTTestis and sequenced on an Illumina GAII platform. Overall design: RNA was isolated from total testis tissue of both Hen1 wildtype and Hen1 mutant animals. post size selection from gel the small RNA libraries wre made. | pubmed:20859253 | wildtype polyA | GSM830245 | source name:testis|strain:TL|genotype/variation:Hen1 wildtype|tissue:testis|small rna library prep method:polyA tailing | wildtype polyA | three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the zebrafish genome Zv8 | testis | Small RNAs in the size range of 19 31 bases were excised from a denaturing gel. RNA was polyA tailed using polyA polymerase followed by ligation of a RNA adaptor to the five prime phosphate of the small RNAs. First strand cDNA synthesis was performed using an oligodT linker primer and M MLV RNase H reverse transcriptase. post amplification the cDNA was sent for sequencing on an Illumina/Solexa platform. | strain:TL|genotype/variation:Hen1 wildtype|tissue:testis|small rna library prep method:polyA tailing | GSM830245 | GSM830245: wildtype polyA | GSM830245: wildtype polyA | GSM830245: wildtype polyA | 1 | GEO Accession:GSM830245 | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina Genome Analyzer II | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>44</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP009275 | read name barcode proc directive:ignore | VASAGFPHEN1plusMALE.fastq | fastq | 167344144.0 | 3803276.0 | GSM830245 1 | 0:44 | A:87935982;C:21182538;G:19081938;T:34474815;N:4668871 | 44 | 87935982 | 21182538 | 19081938 | 34474815 | 4668871 | SRX105296 | SRS270139 | SRA047996 | GEO | European Research Institute for the Biology of Ageing, University Medical Center Groningen | 1 | 0.06642 | 0.05042 | 0.99226 | 0.38346 | 44 | B | usable mapping rate | illumina | early_illumina | unknown | poly_a | unknown | bulk | unknown | unknown | Netherlands | 2011-11-09 | Undetermined | Undetermined | Gonad | Reproductive System | |||||||||||||||||
| 36617 | 36617 | SRR941753 | SRX326770 | SRS463196 | SRP027598 | PRJNA187413 | Danio rerio strain:EK Transcriptome or Gene expression | PRJNA187413 | Transcriptome Analysis | Gene expression across the anteroposterior axis of the zebrafish pectoral fin. | tissue comprising posterior most 2 fin rays | Posterior pectoral fin replicate 2 | Pos2 | strain:EK|isolate:4|age:6 Month|sex:female | RNA seq posterior pectoral fin replicate 2 | Pectoral Posterior 2 | 1 | 1 | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>50</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP027598 | Pos_R2.fastq | fastq | 2119489050.0 | 42389781.0 | Pos R2 | 0:50 | A:551122430;C:507870866;G:499494183;T:555469321;N:5532250 | 50 | 551122430 | 507870866 | 499494183 | 555469321 | 5532250 | SRX326770 | SRS463196 | SRA065677 | Duke Cell Biology|Poss | Poss Lab, Duke Cell Biology | 1 | 0.90238 | 0.08924 | 0.71303 | 0.43405 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | United States | 2013-07-19 | Adult | Adult | Fin | Surface Structure | |||||||||||||||||||||||||
| 36618 | 36618 | SRR941754 | SRX326769 | SRS463195 | SRP027598 | PRJNA187413 | Danio rerio strain:EK Transcriptome or Gene expression | PRJNA187413 | Transcriptome Analysis | Gene expression across the anteroposterior axis of the zebrafish pectoral fin. | tissue comprising posterior most 2 fin rays | Posterior pectoral fin replicate 1 | Pos1 | strain:EK|isolate:3|age:6 Month|sex:female | RNA seq posterior pectoral fin replicate 1 | Pectoral Fin Posterior 1 | 1 | 1 | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>50</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP027598 | 1839141950.0 | 36782839.0 | Pos R1 | 0:50 | A:461313296;C:455413049;G:451484067;T:466101993;N:4829545 | 50 | 461313296 | 455413049 | 451484067 | 466101993 | 4829545 | SRX326769 | SRS463195 | SRA065677 | Duke Cell Biology|Poss | Poss Lab, Duke Cell Biology | 1 | 0.91205 | 0.06923 | 0.71656 | 0.42651 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | United States | 2013-07-19 | Adult | Adult | Fin | Surface Structure | |||||||||||||||||||||||||||
| 36619 | 36619 | SRR941751 | SRX326756 | SRS463187 | SRP027598 | PRJNA187413 | Danio rerio strain:EK Transcriptome or Gene expression | PRJNA187413 | Transcriptome Analysis | Gene expression across the anteroposterior axis of the zebrafish pectoral fin. | tissue comprising anterior most 2 fin rays | Anterior pectoral fin replicate 2 | Ant2 | strain:EK|isolate:2|age:6 Month|sex:female | RNA seq anterior pectoral fin replicate 2 | Pectoral Fin Anterior 2 | 1 | 1 | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>50</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP027598 | Ant_R2.fastq | fastq | 2146396250.0 | 42927925.0 | Ant R2 | 0:50 | A:562140204;C:509390346;G:501995610;T:567232459;N:5637631 | 50 | 562140204 | 509390346 | 501995610 | 567232459 | 5637631 | SRX326756 | SRS463187 | SRA065677 | Duke Cell Biology|Poss | Poss Lab, Duke Cell Biology | 1 | 0.89956 | 0.09279 | 0.70997 | 0.44847 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | United States | 2013-07-19 | Adult | Adult | Fin | Surface Structure | |||||||||||||||||||||||||
| 36620 | 36620 | SRR941749 | SRX326754 | SRS463185 | SRP027598 | PRJNA187413 | Danio rerio strain:EK Transcriptome or Gene expression | PRJNA187413 | Transcriptome Analysis | Gene expression across the anteroposterior axis of the zebrafish pectoral fin. | tissue comprising anterior most 2 fin rays | Anterior pectoral fin replicate 1 | Ant1 | strain:EK|isolate:1|age:6 Month|sex:female | RNA seq anterior pectoral fin replicate 1 | Pectoral Fin Anterior 1 | 1 | 1 | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>50</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP027598 | Ant_R1.fastq | fastq | 2178096950.0 | 43561939.0 | Ant R1 | 0:50 | A:568580441;C:517705965;G:509551928;T:576519788;N:5738828 | 50 | 568580441 | 517705965 | 509551928 | 576519788 | 5738828 | SRX326754 | SRS463185 | SRA065677 | Duke Cell Biology|Poss | Poss Lab, Duke Cell Biology | 1 | 0.89833 | 0.08959 | 0.71494 | 0.44088 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | United States | 2013-07-19 | Adult | Adult | Fin | Surface Structure | |||||||||||||||||||||||||
| 40214 | 40214 | SRR2982513 | SRX1471725 | SRS1197481 | SRP067139 | PRJNA305418 | RiboZero mRNA seq across zebrafish development for study of uORFs | PRJNA305418 | Other | Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values. | 48hpf | AG00751 mrna r0 48h | strain:TUAB|age:48hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal | AG00751 mrna r0 48h | 48h mRNA R0 | 1 | Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP067139 | AG00751_SEQ0112_R1.fastq.gz | fastq | 1859082512.0 | 24461612.0 | 48h mRNA R0 run1 | 0:76 | A:488142494;C:422062452;G:411293722;T:537489879;N:93965 | 76 | 488142494 | 422062452 | 411293722 | 537489879 | 93965 | SRX1471725 | SRS1197481 | SRA314809 | Yale University|Giraldez Lab | Yale University | 1 | 0.8583 | 0.37297 | 0.6956 | 0.46541 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | trueseq | bulk | unknown | unknown | United States | 2015-12-08 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 40215 | 40215 | SRR2982514 | SRX1471724 | SRS1197482 | SRP067139 | PRJNA305418 | RiboZero mRNA seq across zebrafish development for study of uORFs | PRJNA305418 | Other | Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values. | 24hpf | AG00750 mrna r0 24h | strain:TUAB|age:24hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal | AG00750 mrna r0 24h | 24h mRNA R0 | 1 | Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP067139 | AG00750_SEQ0114_R1.fastq.gz | fastq | 2124277824.0 | 27951024.0 | 24h mRNA R0 run1 | 0:76 | A:537946274;C:496576029;G:477023623;T:612576823;N:155075 | 76 | 537946274 | 496576029 | 477023623 | 612576823 | 155075 | SRX1471724 | SRS1197482 | SRA314809 | Yale University|Giraldez Lab | Yale University | 1 | 0.86054 | 0.27207 | 0.69877 | 0.47063 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | trueseq | bulk | unknown | unknown | United States | 2015-12-08 | Pharyngula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 40216 | 40216 | SRR2982511 | SRX1471723 | SRS1197479 | SRP067139 | PRJNA305418 | RiboZero mRNA seq across zebrafish development for study of uORFs | PRJNA305418 | Other | Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values. | 12hpf | AG00434 mrna r0 12h | strain:TUAB|age:12hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal | AG00434 mrna r0 12h | 12h mRNA R0 | 1 | Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP067139 | AG00434_SEQ0071_R1.fastq.gz | fastq | 1990422368.0 | 26189768.0 | 12h mRNA R0 run1 | 0:76 | A:512242204;C:469314942;G:452176134;T:556618667;N:70421 | 76 | 512242204 | 469314942 | 452176134 | 556618667 | 70421 | SRX1471723 | SRS1197479 | SRA314809 | Yale University|Giraldez Lab | Yale University | 1 | 0.88085 | 0.297 | 0.71711 | 0.46053 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | trueseq | bulk | unknown | unknown | United States | 2015-12-08 | Segmentation | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 40217 | 40217 | SRR2982512 | SRX1471722 | SRS1197480 | SRP067139 | PRJNA305418 | RiboZero mRNA seq across zebrafish development for study of uORFs | PRJNA305418 | Other | Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values. | 5hpf | AG00749 mrna r0 5h | strain:TUAB|age:5hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal | AG00749 mrna r0 5h | 5h mRNA R0 | 1 | Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP067139 | AG00749_SEQ0114_R1.fastq.gz | fastq | 3163721996.0 | 41627921.0 | 5h mRNA R0 run1 | 0:76 | A:724093110;C:806620205;G:798759186;T:834042462;N:207033 | 76 | 724093110 | 806620205 | 798759186 | 834042462 | 207033 | SRX1471722 | SRS1197480 | SRA314809 | Yale University|Giraldez Lab | Yale University | 1 | 0.75274 | 0.23572 | 0.75448 | 0.47885 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | trueseq | bulk | unknown | unknown | United States | 2015-12-08 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 40218 | 40218 | SRR2982510 | SRX1471511 | SRS1197399 | SRP067139 | PRJNA305418 | RiboZero mRNA seq across zebrafish development for study of uORFs | PRJNA305418 | Other | Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values. | 2hpf | AG00244 mrna r0 2h | strain:TUAB|age:2hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal | AG00244 mrna r0 2h | 2h mRNA R0 | 1 | Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP067139 | AG00244_SEQ0039_R1.fastq.gz | fastq | 1010085524.0 | 13290599.0 | 2h mRNA R0 run1 | 0:76 | A:196715560;C:309406513;G:286228000;T:217670217;N:65234 | 76 | 196715560 | 309406513 | 286228000 | 217670217 | 65234 | SRX1471511 | SRS1197399 | SRA314809 | Yale University|Giraldez Lab | Yale University | 1 | 0.89974 | 0.14215 | 0.79488 | 0.72171 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | trueseq | bulk | unknown | unknown | United States | 2015-12-08 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 43402 | 43402 | SRR5931544 | SRX3091819 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397969 | 397969 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4755826950.0 | 31705513.0 | D 500 1 2.fq.gz | 0:0 1:150 | A:1274207449;C:1094727902;G:1122524378;T:1264331427;N:35794 | 0 | 150 | 1274207449 | 1094727902 | 1122524378 | 1264331427 | 35794 | SRX3091819 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.91191 | 0.10926 | 0.68341 | 0.47196 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43403 | 43403 | SRR5931545 | SRX3091818 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397968 | 397968 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4755826950.0 | 31705513.0 | D 500 1 1.fq.gz | 0:150 1:0 | A:1276129214;C:1100761964;G:1115345594;T:1263574047;N:16131 | 150 | 0 | 1276129214 | 1100761964 | 1115345594 | 1263574047 | 16131 | SRX3091818 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.91044 | 0.10895 | 0.67659 | 0.46952 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43404 | 43404 | SRR5931546 | SRX3091817 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397967 | 397967 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4584658950.0 | 30564393.0 | D 50 3 2.fq.gz | 0:0 1:150 | A:1214232270;C:1065003267;G:1091428812;T:1213867330;N:127271 | 0 | 150 | 1214232270 | 1065003267 | 1091428812 | 1213867330 | 127271 | SRX3091817 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.92229 | 0.10554 | 0.68667 | 0.4535 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43405 | 43405 | SRR5931547 | SRX3091816 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397966 | 397966 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4584658950.0 | 30564393.0 | D 50 3 1.fq.gz | 0:150 1:0 | A:1219702088;C:1067643780;G:1085480895;T:1211806100;N:26087 | 150 | 0 | 1219702088 | 1067643780 | 1085480895 | 1211806100 | 26087 | SRX3091816 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.92126 | 0.10598 | 0.68398 | 0.44901 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43406 | 43406 | SRR5931548 | SRX3091815 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397973 | 397973 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4705867200.0 | 31372448.0 | D 500 3 2.fq.gz | 0:0 1:150 | A:1240294141;C:1111008282;G:1125861755;T:1228667971;N:35051 | 0 | 150 | 1240294141 | 1111008282 | 1125861755 | 1228667971 | 35051 | SRX3091815 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.92297 | 0.09739 | 0.6856 | 0.47451 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43407 | 43407 | SRR5931549 | SRX3091814 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397972 | 397972 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4705867200.0 | 31372448.0 | D 500 3 1.fq.gz | 0:150 1:0 | A:1241514886;C:1108723884;G:1123339576;T:1232273510;N:15344 | 150 | 0 | 1241514886 | 1108723884 | 1123339576 | 1232273510 | 15344 | SRX3091814 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.92062 | 0.09796 | 0.67856 | 0.47388 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43408 | 43408 | SRR5931550 | SRX3091813 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397971 | 397971 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4750951350.0 | 31673009.0 | D 500 2 2.fq.gz | 0:0 1:150 | A:1286144024;C:1079544004;G:1112952985;T:1272274928;N:35409 | 0 | 150 | 1286144024 | 1079544004 | 1112952985 | 1272274928 | 35409 | SRX3091813 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.90446 | 0.13747 | 0.68639 | 0.46726 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43409 | 43409 | SRR5931551 | SRX3091812 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397970 | 397970 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4750951350.0 | 31673009.0 | D 500 2 1.fq.gz | 0:150 1:0 | A:1287515334;C:1090783234;G:1101469034;T:1271168008;N:15740 | 150 | 0 | 1287515334 | 1090783234 | 1101469034 | 1271168008 | 15740 | SRX3091812 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.90214 | 0.13756 | 0.68158 | 0.46719 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43410 | 43410 | SRR5931552 | SRX3091811 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | without xxx | 397957 | 397957 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4071934650.0 | 27146231.0 | CK 1 2.fq.gz | 0:0 1:150 | A:1052229682;C:975525985;G:991345538;T:1052207035;N:626410 | 0 | 150 | 1052229682 | 975525985 | 991345538 | 1052207035 | 626410 | SRX3091811 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.93603 | 0.0589 | 0.71492 | 0.48298 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43411 | 43411 | SRR5931553 | SRX3091810 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | without xxx | 397956 | 397956 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4071934650.0 | 27146231.0 | CK 1 1.fq.gz | 0:150 1:0 | A:1057694098;C:975549420;G:988477956;T:1049766896;N:446280 | 150 | 0 | 1057694098 | 975549420 | 988477956 | 1049766896 | 446280 | SRX3091810 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.93688 | 0.05854 | 0.7091 | 0.48309 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43412 | 43412 | SRR5931554 | SRX3091809 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | without xxx | 397959 | 397959 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4343291550.0 | 28955277.0 | CK 2 2.fq.gz | 0:0 1:150 | A:1153253014;C:1007267471;G:1028912357;T:1153739160;N:119548 | 0 | 150 | 1153253014 | 1007267471 | 1028912357 | 1153739160 | 119548 | SRX3091809 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.9209 | 0.11211 | 0.68649 | 0.45293 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43413 | 43413 | SRR5931555 | SRX3091808 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | without xxx | 397958 | 397958 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4343291550.0 | 28955277.0 | CK 2 1.fq.gz | 0:150 1:0 | A:1157702407;C:1008975846;G:1024287434;T:1151988746;N:337117 | 150 | 0 | 1157702407 | 1008975846 | 1024287434 | 1151988746 | 337117 | SRX3091808 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.91946 | 0.11191 | 0.6828 | 0.45241 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43414 | 43414 | SRR5931556 | SRX3091807 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | without xxx | 397961 | 397961 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4518061050.0 | 30120407.0 | CK 3 2.fq.gz | 0:0 1:150 | A:1188586431;C:1058258572;G:1080153332;T:1190907666;N:155049 | 0 | 150 | 1188586431 | 1058258572 | 1080153332 | 1190907666 | 155049 | SRX3091807 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.92512 | 0.09744 | 0.69085 | 0.45772 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43415 | 43415 | SRR5931557 | SRX3091806 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | without xxx | 397960 | 397960 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4518061050.0 | 30120407.0 | CK 3 1.fq.gz | 0:150 1:0 | A:1195164171;C:1059996453;G:1074722334;T:1188143044;N:35048 | 150 | 0 | 1195164171 | 1059996453 | 1074722334 | 1188143044 | 35048 | SRX3091806 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.9249 | 0.09772 | 0.68562 | 0.45606 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43416 | 43416 | SRR5931558 | SRX3091805 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397963 | 397963 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4572900600.0 | 30486004.0 | D 50 1 2.fq.gz | 0:0 1:150 | A:1218364634;C:1054987971;G:1079106780;T:1220261884;N:179331 | 0 | 150 | 1218364634 | 1054987971 | 1079106780 | 1220261884 | 179331 | SRX3091805 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.91953 | 0.11512 | 0.68722 | 0.45056 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43417 | 43417 | SRR5931559 | SRX3091804 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397962 | 397962 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4572900600.0 | 30486004.0 | D 50 1 1.fq.gz | 0:150 1:0 | A:1223844243;C:1057030107;G:1074694968;T:1217286959;N:44323 | 150 | 0 | 1223844243 | 1057030107 | 1074694968 | 1217286959 | 44323 | SRX3091804 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.91779 | 0.1149 | 0.68258 | 0.46006 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43418 | 43418 | SRR5931560 | SRX3091803 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397965 | 397965 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4595232150.0 | 30634881.0 | D 50 2 2.fq.gz | 0:0 1:150 | A:1225033548;C:1062169088;G:1082021478;T:1225833369;N:174667 | 0 | 150 | 1225033548 | 1062169088 | 1082021478 | 1225833369 | 174667 | SRX3091803 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.91827 | 0.11697 | 0.68511 | 0.44407 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43419 | 43419 | SRR5931561 | SRX3091802 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397964 | 397964 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4595232150.0 | 30634881.0 | D 50 2 1.fq.gz | 0:150 1:0 | A:1231719851;C:1064618233;G:1076698645;T:1222155912;N:39509 | 150 | 0 | 1231719851 | 1064618233 | 1076698645 | 1222155912 | 39509 | SRX3091802 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||||||||
| 52210 | 52210 | SRR9021058 | SRX5799154 | SRS4730324 | SRP195685 | PRJNA541367 | Global transcriptomic analysis of zebrafish glucagon receptor mutant | PRJNA541367 | Other | We performed RNA sequencing RNA seq analysis of whole fish to provide a comprehensive view of its global transcriptomic regulation in this study. | WT 1 | replicate:biological replicate 1|strain:AB|age:7 days|sex:not applicable|tissue:total|BioSampleModel:Model organism or animal | Diano rerio transcriptome | WT 1 20190506 1 | WT 1 20190506 1 | RNA seq of WT Diano rerio | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | BGISEQ | BGISEQ-500 | SRP195685 | loader:fastq load.py | WT1.1.fq | fastq | 1094498950.0 | 21889979.0 | WT1.1.fq | 0:50 | A:291195764;C:255539280;G:262638316;T:284737693;N:387897 | 50 | 291195764 | 255539280 | 262638316 | 284737693 | 387897 | SRX5799154 | SRS4730324 | SRA883435 | Xiamen University|School of Pharmaceutical Sciences | Xiamen University | 1 | 0.94195 | 0.09713 | 0.66689 | 0.47749 | 50 | B | usable mapping rate | bgi | bgi | unknown | random_priming | unknown | bulk | unknown | unknown | China | 2020-01-18 | Larval | Larval | Undetermined | Undetermined | |||||||||||||||||||||||||||
| 52211 | 52211 | SRR9021059 | SRX5799153 | SRS4730323 | SRP195685 | PRJNA541367 | Global transcriptomic analysis of zebrafish glucagon receptor mutant | PRJNA541367 | Other | We performed RNA sequencing RNA seq analysis of whole fish to provide a comprehensive view of its global transcriptomic regulation in this study. | WT 2 | replicate:biological replicate 2|strain:AB|age:7 days|sex:not applicable|tissue:total|BioSampleModel:Model organism or animal | Diano rerio transcriptome | WT 2 20190506 2 | WT 2 20190506 2 | RNA seq of WT Diano rerio | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | BGISEQ | BGISEQ-500 | SRP195685 | loader:fastq load.py | WT2.1.fq | fastq | 1095133200.0 | 21902664.0 | WT2.1.fq | 0:50 | A:290594757;C:255644044;G:259681140;T:288014102;N:1199157 | 50 | 290594757 | 255644044 | 259681140 | 288014102 | 1199157 | SRX5799153 | SRS4730323 | SRA883435 | Xiamen University|School of Pharmaceutical Sciences | Xiamen University | 1 | 0.93368 | 0.09166 | 0.67085 | 0.46523 | 50 | B | usable mapping rate | bgi | bgi | unknown | random_priming | unknown | bulk | unknown | unknown | China | 2020-01-18 | Larval | Larval | Undetermined | Undetermined | |||||||||||||||||||||||||||
| 52212 | 52212 | SRR9021060 | SRX5799152 | SRS4730322 | SRP195685 | PRJNA541367 | Global transcriptomic analysis of zebrafish glucagon receptor mutant | PRJNA541367 | Other | We performed RNA sequencing RNA seq analysis of whole fish to provide a comprehensive view of its global transcriptomic regulation in this study. | WT 3 | replicate:biological replicate 3|strain:AB|age:7 days|sex:not applicable|tissue:total|BioSampleModel:Model organism or animal | Diano rerio transcriptome | WT 3 20190506 3 | WT 3 20190506 3 | RNA seq of WT Diano rerio | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | BGISEQ | BGISEQ-500 | SRP195685 | loader:fastq load.py | WT3.1.fq | fastq | 1096083900.0 | 21921678.0 | WT3.1.fq | 0:50 | A:290332094;C:256993500;G:263043956;T:285349722;N:364628 | 50 | 290332094 | 256993500 | 263043956 | 285349722 | 364628 | SRX5799152 | SRS4730322 | SRA883435 | Xiamen University|School of Pharmaceutical Sciences | Xiamen University | 1 | 0.94147 | 0.10157 | 0.66135 | 0.47301 | 50 | B | usable mapping rate | bgi | bgi | unknown | random_priming | unknown | bulk | unknown | unknown | China | 2020-01-18 | Larval | Larval | Undetermined | Undetermined | |||||||||||||||||||||||||||
| 52213 | 52213 | SRR9021061 | SRX5799151 | SRS4730320 | SRP195685 | PRJNA541367 | Global transcriptomic analysis of zebrafish glucagon receptor mutant | PRJNA541367 | Other | We performed RNA sequencing RNA seq analysis of whole fish to provide a comprehensive view of its global transcriptomic regulation in this study. | gcgr 1 | replicate:biological replicate 1|strain:AB|age:7 days|sex:not applicable|tissue:total|BioSampleModel:Model organism or animal | Diano rerio transcriptome | gcgr 1 20190506 1 | gcgr 1 20190506 1 | RNA seq of Diano rerio with gcgr mutant | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | BGISEQ | BGISEQ-500 | SRP195685 | loader:fastq load.py | gcgr1.1.fq | fastq | 1096307200.0 | 21926144.0 | gcgr1.1.fq | 0:50 | A:288839446;C:258297625;G:264630675;T:284199738;N:339716 | 50 | 288839446 | 258297625 | 264630675 | 284199738 | 339716 | SRX5799151 | SRS4730320 | SRA883435 | Xiamen University|School of Pharmaceutical Sciences | Xiamen University | 1 | 0.94131 | 0.09307 | 0.67574 | 0.46993 | 50 | B | usable mapping rate | bgi | bgi | unknown | random_priming | unknown | bulk | unknown | unknown | China | 2020-01-18 | Larval | Larval | Undetermined | Undetermined | |||||||||||||||||||||||||||
| 52214 | 52214 | SRR9021062 | SRX5799150 | SRS4730321 | SRP195685 | PRJNA541367 | Global transcriptomic analysis of zebrafish glucagon receptor mutant | PRJNA541367 | Other | We performed RNA sequencing RNA seq analysis of whole fish to provide a comprehensive view of its global transcriptomic regulation in this study. | gcgr 2 | replicate:biological replicate 2|strain:AB|age:7 days|sex:not applicable|tissue:total|BioSampleModel:Model organism or animal | Diano rerio transcriptome | gcgr 2 20190506 2 | gcgr 2 20190506 2 | RNA seq of Diano rerio with gcgr mutant | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | BGISEQ | BGISEQ-500 | SRP195685 | loader:fastq load.py | gcgr2.1.fq | fastq | 1094410100.0 | 21888202.0 | gcgr2.1.fq | 0:50 | A:290062779;C:256358687;G:264488431;T:282812212;N:687991 | 50 | 290062779 | 256358687 | 264488431 | 282812212 | 687991 | SRX5799150 | SRS4730321 | SRA883435 | Xiamen University|School of Pharmaceutical Sciences | Xiamen University | 1 | 0.94074 | 0.09337 | 0.67633 | 0.46861 | 50 | B | usable mapping rate | bgi | bgi | unknown | random_priming | unknown | bulk | unknown | unknown | China | 2020-01-18 | Larval | Larval | Undetermined | Undetermined | |||||||||||||||||||||||||||
| 52215 | 52215 | SRR9021063 | SRX5799149 | SRS4730319 | SRP195685 | PRJNA541367 | Global transcriptomic analysis of zebrafish glucagon receptor mutant | PRJNA541367 | Other | We performed RNA sequencing RNA seq analysis of whole fish to provide a comprehensive view of its global transcriptomic regulation in this study. | gcgr 3 | replicate:biological replicate 3|strain:AB|age:7 days|sex:not applicable|tissue:total|BioSampleModel:Model organism or animal | Diano rerio transcriptome | gcgr 3 20190506 3 | gcgr 3 20190506 3 | RNA seq of Diano rerio with gcgr mutant | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | BGISEQ | BGISEQ-500 | SRP195685 | loader:fastq load.py | gcgr3.1.fq | fastq | 1094284800.0 | 21885696.0 | gcgr3.1.fq | 0:50 | A:289313514;C:257096636;G:264011408;T:283143600;N:719642 | 50 | 289313514 | 257096636 | 264011408 | 283143600 | 719642 | SRX5799149 | SRS4730319 | SRA883435 | Xiamen University|School of Pharmaceutical Sciences | Xiamen University | 1 | 0.94222 | 0.09557 | 0.67521 | 0.46664 | 50 | B | usable mapping rate | bgi | bgi | unknown | random_priming | unknown | bulk | unknown | unknown | China | 2020-01-18 | Larval | Larval | Undetermined | Undetermined | |||||||||||||||||||||||||||
| 62981 | 62981 | SRR13559185 | SRX9957470 | SRS8131854 | SRP303451 | PRJNA695140 | Zebrafish caloric restriction | PRJNA695140 | Other | Using Zebrafish Danio rerio as a model organism for aquaculture we investigated the impact of caloric restriction CR on growth gut morphology and gene expression. | 100% feeding group replicate 2 | CR 100perc 2 | strain:AB Strain|dev stage:3 mpf|sex:pooled male and female|tissue:Intestine|treatment:100% feeding|replicate:biological replicate 2|BioSampleModel:Model organism or animal | RNA Seq of Danio rerio: 100% feeding | CR 100perc 2 | CR 100perc 2 | Stranded Total RNA Sample Preparation kit using Low Sample LS Protocol. Ribosomal RNA was depleted using Ribo Zero Gold kit. | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | SRP303451 | CR_100perc_2_S10_R1_001.fastq.gz | fastq | 1797322363.0 | 23790604.0 | CR 100perc 2 S10 R1 001.fastq.gz | 0:75.55 1:0 | A:430558741;C:468161000;G:471226375;T:427297574;N:78673 | 75 | 0 | 430558741 | 468161000 | 471226375 | 427297574 | 78673 | SRX9957470 | SRS8131854 | SRA1188331 | Temasek Life Sciences Laboratory|Reproductive Genomics Group | Temasek Life Sciences Laboratory | 1 | 0.65722 | 0.19871 | 0.82339 | 0.66254 | 76 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | Singapore | 2021-01-27 | Adult | Adult | Gut | Digestive System | ||||||||||||||||||||||||||
| 62982 | 62982 | SRR13559186 | SRX9957469 | SRS8131853 | SRP303451 | PRJNA695140 | Zebrafish caloric restriction | PRJNA695140 | Other | Using Zebrafish Danio rerio as a model organism for aquaculture we investigated the impact of caloric restriction CR on growth gut morphology and gene expression. | 100% feeding group replicate 1 | CR 100perc 1 | strain:AB Strain|dev stage:3 mpf|sex:pooled male and female|tissue:Intestine|treatment:100% feeding|replicate:biological replicate 1|BioSampleModel:Model organism or animal | RNA Seq of Danio rerio: 100% feeding | CR 100perc 1 | CR 100perc 1 | Stranded Total RNA Sample Preparation kit using Low Sample LS Protocol. Ribosomal RNA was depleted using Ribo Zero Gold kit. | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | SRP303451 | CR_100perc_1_S9_R1_001.fastq.gz | fastq | 1534720214.0 | 20317497.0 | CR 100perc 1 S9 R1 001.fastq.gz | 0:75.54 1:0 | A:375776426;C:394418295;G:367506580;T:396953400;N:65513 | 75 | 0 | 375776426 | 394418295 | 367506580 | 396953400 | 65513 | SRX9957469 | SRS8131853 | SRA1188331 | Temasek Life Sciences Laboratory|Reproductive Genomics Group | Temasek Life Sciences Laboratory | 1 | 0.84461 | 0.26652 | 0.76717 | 0.62282 | 76 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | Singapore | 2021-01-27 | Adult | Adult | Gut | Digestive System | ||||||||||||||||||||||||||
| 62983 | 62983 | SRR13559187 | SRX9957468 | SRS8131852 | SRP303451 | PRJNA695140 | Zebrafish caloric restriction | PRJNA695140 | Other | Using Zebrafish Danio rerio as a model organism for aquaculture we investigated the impact of caloric restriction CR on growth gut morphology and gene expression. | 85% feeding group replicate 4 | CR 85perc 4 | strain:AB Strain|dev stage:3 mpf|sex:pooled male and female|tissue:Intestine|treatment:85% feeding|replicate:biological replicate 4|BioSampleModel:Model organism or animal | RNA Seq of Danio rerio: 85% feeding | CR 85perc 4 | CR 85perc 4 | Stranded Total RNA Sample Preparation kit using Low Sample LS Protocol. Ribosomal RNA was depleted using Ribo Zero Gold kit. | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | SRP303451 | CR_85perc_4_S8_R1_001.fastq.gz | fastq | 1916818437.0 | 25373905.0 | CR 85perc 4 S8 R1 001.fastq.gz | 0:75.54 1:0 | A:488054788;C:475184415;G:443451608;T:510046224;N:81402 | 75 | 0 | 488054788 | 475184415 | 443451608 | 510046224 | 81402 | SRX9957468 | SRS8131852 | SRA1188331 | Temasek Life Sciences Laboratory|Reproductive Genomics Group | Temasek Life Sciences Laboratory | 1 | 0.92737 | 0.2783 | 0.75909 | 0.57435 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | Singapore | 2021-01-27 | Adult | Adult | Gut | Digestive System | ||||||||||||||||||||||||||
| 62984 | 62984 | SRR13559188 | SRX9957467 | SRS8131851 | SRP303451 | PRJNA695140 | Zebrafish caloric restriction | PRJNA695140 | Other | Using Zebrafish Danio rerio as a model organism for aquaculture we investigated the impact of caloric restriction CR on growth gut morphology and gene expression. | 85% feeding group replicate 3 | CR 85perc 3 | strain:AB Strain|dev stage:3 mpf|sex:pooled male and female|tissue:Intestine|treatment:85% feeding|replicate:biological replicate 3|BioSampleModel:Model organism or animal | RNA Seq of Danio rerio: 85% feeding | CR 85perc 3 | CR 85perc 3 | Stranded Total RNA Sample Preparation kit using Low Sample LS Protocol. Ribosomal RNA was depleted using Ribo Zero Gold kit. | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | SRP303451 | CR_85perc_3_S7_R1_001.fastq.gz | fastq | 1843871333.0 | 24411281.0 | CR 85perc 3 S7 R1 001.fastq.gz | 0:75.53 1:0 | A:441643488;C:487987766;G:446957305;T:467206076;N:76698 | 75 | 0 | 441643488 | 487987766 | 446957305 | 467206076 | 76698 | SRX9957467 | SRS8131851 | SRA1188331 | Temasek Life Sciences Laboratory|Reproductive Genomics Group | Temasek Life Sciences Laboratory | 1 | 0.91984 | 0.25275 | 0.77565 | 0.65163 | 74 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | Singapore | 2021-01-27 | Adult | Adult | Gut | Digestive System | ||||||||||||||||||||||||||
| 62985 | 62985 | SRR13559189 | SRX9957466 | SRS8131850 | SRP303451 | PRJNA695140 | Zebrafish caloric restriction | PRJNA695140 | Other | Using Zebrafish Danio rerio as a model organism for aquaculture we investigated the impact of caloric restriction CR on growth gut morphology and gene expression. | 85% feeding group replicate 2 | CR 85perc 2 | strain:AB Strain|dev stage:3 mpf|sex:pooled male and female|tissue:Intestine|treatment:85% feeding|replicate:biological replicate 2|BioSampleModel:Model organism or animal | RNA Seq of Danio rerio: 85% feeding | CR 85perc 2 | CR 85perc 2 | Stranded Total RNA Sample Preparation kit using Low Sample LS Protocol. Ribosomal RNA was depleted using Ribo Zero Gold kit. | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | SRP303451 | CR_85perc_2_S6_R1_001.fastq.gz | fastq | 2063663358.0 | 27321356.0 | CR 85perc 2 S6 R1 001.fastq.gz | 0:75.53 1:0 | A:495156958;C:545615457;G:490454848;T:532349272;N:86823 | 75 | 0 | 495156958 | 545615457 | 490454848 | 532349272 | 86823 | SRX9957466 | SRS8131850 | SRA1188331 | Temasek Life Sciences Laboratory|Reproductive Genomics Group | Temasek Life Sciences Laboratory | 1 | 0.92542 | 0.29093 | 0.77743 | 0.62803 | 76 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | Singapore | 2021-01-27 | Adult | Adult | Gut | Digestive System | ||||||||||||||||||||||||||
| 62986 | 62986 | SRR13559190 | SRX9957465 | SRS8131849 | SRP303451 | PRJNA695140 | Zebrafish caloric restriction | PRJNA695140 | Other | Using Zebrafish Danio rerio as a model organism for aquaculture we investigated the impact of caloric restriction CR on growth gut morphology and gene expression. | 85% feeding group replicate 1 | CR 85perc 1 | strain:AB Strain|dev stage:3 mpf|sex:pooled male and female|tissue:Intestine|treatment:85% feeding|replicate:biological replicate 1|BioSampleModel:Model organism or animal | RNA Seq of Danio rerio: 85% feeding | CR 85perc 1 | CR 85perc 1 | Stranded Total RNA Sample Preparation kit using Low Sample LS Protocol. Ribosomal RNA was depleted using Ribo Zero Gold kit. | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | SRP303451 | CR_85perc_1_S5_R1_001.fastq.gz | fastq | 1987823280.0 | 26313964.0 | CR 85perc 1 S5 R1 001.fastq.gz | 0:75.54 1:0 | A:489253658;C:511031006;G:469881720;T:517571925;N:84971 | 75 | 0 | 489253658 | 511031006 | 469881720 | 517571925 | 84971 | SRX9957465 | SRS8131849 | SRA1188331 | Temasek Life Sciences Laboratory|Reproductive Genomics Group | Temasek Life Sciences Laboratory | 1 | 0.91539 | 0.26469 | 0.75154 | 0.62387 | 73 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | Singapore | 2021-01-27 | Adult | Adult | Gut | Digestive System | ||||||||||||||||||||||||||
| 62987 | 62987 | SRR13559191 | SRX9957464 | SRS8131848 | SRP303451 | PRJNA695140 | Zebrafish caloric restriction | PRJNA695140 | Other | Using Zebrafish Danio rerio as a model organism for aquaculture we investigated the impact of caloric restriction CR on growth gut morphology and gene expression. | 70% feeding group replicate 4 | CR 70perc 4 | strain:AB Strain|dev stage:3 mpf|sex:pooled male and female|tissue:Intestine|treatment:70% feeding|replicate:biological replicate 4|BioSampleModel:Model organism or animal | RNA Seq of Danio rerio: 70% feeding | CR 70perc 4 | CR 70perc 4 | Stranded Total RNA Sample Preparation kit using Low Sample LS Protocol. Ribosomal RNA was depleted using Ribo Zero Gold kit. | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | SRP303451 | CR_70perc_4_S4_R1_001.fastq.gz | fastq | 1692306421.0 | 22402714.0 | CR 70perc 4 S4 R1 001.fastq.gz | 0:75.54 1:0 | A:416831282;C:431623148;G:400872189;T:442907940;N:71862 | 75 | 0 | 416831282 | 431623148 | 400872189 | 442907940 | 71862 | SRX9957464 | SRS8131848 | SRA1188331 | Temasek Life Sciences Laboratory|Reproductive Genomics Group | Temasek Life Sciences Laboratory | 1 | 0.91284 | 0.27717 | 0.75702 | 0.58936 | 76 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | Singapore | 2021-01-27 | Adult | Adult | Gut | Digestive System | ||||||||||||||||||||||||||
| 62988 | 62988 | SRR13559192 | SRX9957463 | SRS8131847 | SRP303451 | PRJNA695140 | Zebrafish caloric restriction | PRJNA695140 | Other | Using Zebrafish Danio rerio as a model organism for aquaculture we investigated the impact of caloric restriction CR on growth gut morphology and gene expression. | 70% feeding group replicate 3 | CR 70perc 3 | strain:AB Strain|dev stage:3 mpf|sex:pooled male and female|tissue:Intestine|treatment:70% feeding|replicate:biological replicate 3|BioSampleModel:Model organism or animal | RNA Seq of Danio rerio: 70% feeding | CR 70perc 3 | CR 70perc 3 | Stranded Total RNA Sample Preparation kit using Low Sample LS Protocol. Ribosomal RNA was depleted using Ribo Zero Gold kit. | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | SRP303451 | CR_70perc_3_S3_R1_001.fastq.gz | fastq | 1743481023.0 | 23079781.0 | CR 70perc 3 S3 R1 001.fastq.gz | 0:75.54 1:0 | A:440529322;C:430386534;G:405191664;T:467297560;N:75943 | 75 | 0 | 440529322 | 430386534 | 405191664 | 467297560 | 75943 | SRX9957463 | SRS8131847 | SRA1188331 | Temasek Life Sciences Laboratory|Reproductive Genomics Group | Temasek Life Sciences Laboratory | 1 | 0.92679 | 0.30032 | 0.7446 | 0.60383 | 76 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | Singapore | 2021-01-27 | Adult | Adult | Gut | Digestive System | ||||||||||||||||||||||||||
| 62989 | 62989 | SRR13559193 | SRX9957462 | SRS8131846 | SRP303451 | PRJNA695140 | Zebrafish caloric restriction | PRJNA695140 | Other | Using Zebrafish Danio rerio as a model organism for aquaculture we investigated the impact of caloric restriction CR on growth gut morphology and gene expression. | 100% feeding group replicate 4 | CR 100perc 4 | strain:AB Strain|dev stage:3 mpf|sex:pooled male and female|tissue:Intestine|treatment:100% feeding|replicate:biological replicate 4|BioSampleModel:Model organism or animal | RNA Seq of Danio rerio: 100% feeding | CR 100perc 4 | CR 100perc 4 | Stranded Total RNA Sample Preparation kit using Low Sample LS Protocol. Ribosomal RNA was depleted using Ribo Zero Gold kit. | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | SRP303451 | CR_100perc_4_S12_R1_001.fastq.gz | fastq | 2065187112.0 | 27339493.0 | CR 100perc 4 S12 R1 001.fastq.gz | 0:75.54 1:0 | A:518989032;C:519066920;G:484077687;T:542966004;N:87469 | 75 | 0 | 518989032 | 519066920 | 484077687 | 542966004 | 87469 | SRX9957462 | SRS8131846 | SRA1188331 | Temasek Life Sciences Laboratory|Reproductive Genomics Group | Temasek Life Sciences Laboratory | 1 | 0.92848 | 0.28327 | 0.75371 | 0.58973 | 76 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | Singapore | 2021-01-27 | Adult | Adult | Gut | Digestive System | ||||||||||||||||||||||||||
| 62990 | 62990 | SRR13559194 | SRX9957461 | SRS8131845 | SRP303451 | PRJNA695140 | Zebrafish caloric restriction | PRJNA695140 | Other | Using Zebrafish Danio rerio as a model organism for aquaculture we investigated the impact of caloric restriction CR on growth gut morphology and gene expression. | 100% feeding group replicate 3 | CR 100perc 3 | strain:AB Strain|dev stage:3 mpf|sex:pooled male and female|tissue:Intestine|treatment:100% feeding|replicate:biological replicate 3|BioSampleModel:Model organism or animal | RNA Seq of Danio rerio: 100% feeding | CR 100perc 3 | CR 100perc 3 | Stranded Total RNA Sample Preparation kit using Low Sample LS Protocol. Ribosomal RNA was depleted using Ribo Zero Gold kit. | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | SRP303451 | CR_100perc_3_S11_R1_001.fastq.gz | fastq | 2335163022.0 | 30913920.0 | CR 100perc 3 S11 R1 001.fastq.gz | 0:75.54 1:0 | A:569133042;C:607012551;G:552359956;T:606558343;N:99130 | 75 | 0 | 569133042 | 607012551 | 552359956 | 606558343 | 99130 | SRX9957461 | SRS8131845 | SRA1188331 | Temasek Life Sciences Laboratory|Reproductive Genomics Group | Temasek Life Sciences Laboratory | 1 | 0.92688 | 0.27391 | 0.75732 | 0.64476 | 76 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | Singapore | 2021-01-27 | Adult | Adult | Gut | Digestive System | ||||||||||||||||||||||||||
| 62991 | 62991 | SRR13559195 | SRX9957460 | SRS8131844 | SRP303451 | PRJNA695140 | Zebrafish caloric restriction | PRJNA695140 | Other | Using Zebrafish Danio rerio as a model organism for aquaculture we investigated the impact of caloric restriction CR on growth gut morphology and gene expression. | 70% feeding group replicate 2 | CR 70perc 2 | strain:AB Strain|dev stage:3 mpf|sex:pooled male and female|tissue:Intestine|treatment:70% feeding|replicate:biological replicate 2|BioSampleModel:Model organism or animal | RNA Seq of Danio rerio: 70% feeding | CR 70perc 2 | CR 70perc 2 | Stranded Total RNA Sample Preparation kit using Low Sample LS Protocol. Ribosomal RNA was depleted using Ribo Zero Gold kit. | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | SRP303451 | CR_70perc_2_S2_R1_001.fastq.gz | fastq | 1994514321.0 | 26408108.0 | CR 70perc 2 S2 R1 001.fastq.gz | 0:75.53 1:0 | A:466027349;C:539707204;G:492197318;T:496496054;N:86396 | 75 | 0 | 466027349 | 539707204 | 492197318 | 496496054 | 86396 | SRX9957460 | SRS8131844 | SRA1188331 | Temasek Life Sciences Laboratory|Reproductive Genomics Group | Temasek Life Sciences Laboratory | 1 | 0.94608 | 0.26334 | 0.78084 | 0.65761 | 76 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | Singapore | 2021-01-27 | Adult | Adult | Gut | Digestive System | ||||||||||||||||||||||||||
| 62992 | 62992 | SRR13559196 | SRX9957459 | SRS8131843 | SRP303451 | PRJNA695140 | Zebrafish caloric restriction | PRJNA695140 | Other | Using Zebrafish Danio rerio as a model organism for aquaculture we investigated the impact of caloric restriction CR on growth gut morphology and gene expression. | 70% feeding group replicate 1 | CR 70perc 1 | strain:AB Strain|dev stage:3 mpf|sex:pooled male and female|tissue:Intestine|treatment:70% feeding|replicate:biological replicate 1|BioSampleModel:Model organism or animal | RNA Seq of Danio rerio: 70% feeding | CR 70perc 1 | CR 70perc 1 | Stranded Total RNA Sample Preparation kit using Low Sample LS Protocol. Ribosomal RNA was depleted using Ribo Zero Gold kit. | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | SRP303451 | CR_70perc_1_S1_R1_001.fastq.gz | fastq | 1514616148.0 | 20051359.0 | CR 70perc 1 S1 R1 001.fastq.gz | 0:75.54 1:0 | A:361412841;C:396741800;G:366909734;T:389486382;N:65391 | 75 | 0 | 361412841 | 396741800 | 366909734 | 389486382 | 65391 | SRX9957459 | SRS8131843 | SRA1188331 | Temasek Life Sciences Laboratory|Reproductive Genomics Group | Temasek Life Sciences Laboratory | 1 | 0.91894 | 0.27365 | 0.75941 | 0.62958 | 76 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | Singapore | 2021-01-27 | Adult | Adult | Gut | Digestive System |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;