metadata: run_metadata: 699 rows where experiment.library_layout = "SINGLE", experiment.library_selection = "cDNA" and tissue

699 rows where experiment.library_layout = "SINGLE", experiment.library_selection = "cDNA" and tissue_curation = "Heart"

descending

Link	rowid ▼	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.title	sample.alias	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.study_ref	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.nofeature_rate.mate1	seqdetective.sparsity.mate1	seqdetective.pos_strand_rate.mate1	seqdetective.readlen.mate1	seqdetective.judgement.mate1	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
25170	25170	SRR25661605	SRX21387413	SRS18627977	SRP455520	PRJNA1006302	The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes	GSE241049	Transcriptome Analysis	To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.		pubmed:39658721	hand2 FLD+/? 20 hpf CMs rep3	GSM7714404	source name:embryonic heart\|tissue:embryonic heart\|cell type:cardiomyocytes\|genotype:sibling WT of hand2 mutants\|treatment:sorted cells by FACS\|geo loc name:missing\|collection date:missing	hand2 FLD+/? 20 hpf CMs rep3	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts	embryonic heart		miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		tissue:embryonic heart\|cell type:cardiomyocytes\|genotype:sibling WT of hand2 mutants\|treatment:sorted cells by FACS	GSM7714404	GSM7714404: hand2 FLD+/? 20 hpf CMs rep3; Danio rerio; RNA Seq	GSM7714404 r1	GSM7714404	1	miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP455520	loader:fastq load.py	E22_3458_Yanli_HT_Lib_WT_het_3_R1.fastq.gz	fastq	2441736984.0	34141777.0	GSM7714404 r1	0:71.52	A:706186414;C:496261994;G:526176364;T:713112212;N:0	71	706186414	496261994	526176364	713112212	0	SRX21387413	SRS18627977	SRA1694205	MPI for heart and lung research	MPI for heart and lung research	1	0.9026	0.15816	0.76278	0.44042	72	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Germany	2023-08-17	Segmentation	Embryo	Heart	Cardiovascular System
25171	25171	SRR25661606	SRX21387412	SRS18627976	SRP455520	PRJNA1006302	The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes	GSE241049	Transcriptome Analysis	To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.		pubmed:39658721	hand2 FLD+/? 20 hpf CMs rep2	GSM7714403	source name:embryonic heart\|tissue:embryonic heart\|cell type:cardiomyocytes\|genotype:sibling WT of hand2 mutants\|treatment:sorted cells by FACS\|geo loc name:missing\|collection date:missing	hand2 FLD+/? 20 hpf CMs rep2	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts	embryonic heart		miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		tissue:embryonic heart\|cell type:cardiomyocytes\|genotype:sibling WT of hand2 mutants\|treatment:sorted cells by FACS	GSM7714403	GSM7714403: hand2 FLD+/? 20 hpf CMs rep2; Danio rerio; RNA Seq	GSM7714403 r1	GSM7714403	1	miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP455520	loader:fastq load.py	E22_3458_Yanli_HT_Lib_WT_het_2_R1.fastq.gz	fastq	2185611269.0	30558084.0	GSM7714403 r1	0:71.52	A:612617675;C:458632518;G:474458738;T:639902338;N:0	71	612617675	458632518	474458738	639902338	0	SRX21387412	SRS18627976	SRA1694205	MPI for heart and lung research	MPI for heart and lung research	1	0.90042	0.14005	0.75424	0.44277	72	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Germany	2023-08-17	Segmentation	Embryo	Heart	Cardiovascular System
25172	25172	SRR25661607	SRX21387411	SRS18627975	SRP455520	PRJNA1006302	The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes	GSE241049	Transcriptome Analysis	To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.		pubmed:39658721	hand2 FLD+/? 20 hpf CMs rep1	GSM7714402	source name:embryonic heart\|tissue:embryonic heart\|cell type:cardiomyocytes\|genotype:sibling WT of hand2 mutants\|treatment:sorted cells by FACS\|geo loc name:missing\|collection date:missing	hand2 FLD+/? 20 hpf CMs rep1	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts	embryonic heart		miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		tissue:embryonic heart\|cell type:cardiomyocytes\|genotype:sibling WT of hand2 mutants\|treatment:sorted cells by FACS	GSM7714402	GSM7714402: hand2 FLD+/? 20 hpf CMs rep1; Danio rerio; RNA Seq	GSM7714402 r1	GSM7714402	1	miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP455520	loader:fastq load.py	E22_3458_Yanli_HT_Lib_WT_het_1_R1.fastq.gz	fastq	2291884894.0	32043147.0	GSM7714402 r1	0:71.52	A:635094975;C:489594953;G:499909828;T:667285138;N:0	71	635094975	489594953	499909828	667285138	0	SRX21387411	SRS18627975	SRA1694205	MPI for heart and lung research	MPI for heart and lung research	1	0.90883	0.14288	0.75331	0.44459	71	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Germany	2023-08-17	Segmentation	Embryo	Heart	Cardiovascular System
25173	25173	SRR25661608	SRX21387410	SRS18627974	SRP455520	PRJNA1006302	The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes	GSE241049	Transcriptome Analysis	To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.		pubmed:39658721	WT 20 hpf CMs rep3	GSM7714401	source name:embryonic heart\|tissue:embryonic heart\|cell type:cardiomyocytes\|genotype:sibling WT of hand2 OE\|treatment:sorted cells by FACS\|geo loc name:missing\|collection date:missing	WT 20 hpf CMs rep3	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts	embryonic heart		miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		tissue:embryonic heart\|cell type:cardiomyocytes\|genotype:sibling WT of hand2 OE\|treatment:sorted cells by FACS	GSM7714401	GSM7714401: WT 20 hpf CMs rep3; Danio rerio; RNA Seq	GSM7714401 r1	GSM7714401	1	miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP455520	loader:fastq load.py	E22_3458_Yanli_HT_Lib_WT_CMs_3_R1.fastq.gz	fastq	2268251602.0	31717610.0	GSM7714401 r1	0:71.51	A:637196241;C:477782543;G:497683941;T:655588877;N:0	71	637196241	477782543	497683941	655588877	0	SRX21387410	SRS18627974	SRA1694205	MPI for heart and lung research	MPI for heart and lung research	1	0.90026	0.13291	0.78707	0.40811	71	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Germany	2023-08-17	Segmentation	Embryo	Heart	Cardiovascular System
25174	25174	SRR25661609	SRX21387409	SRS18627973	SRP455520	PRJNA1006302	The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes	GSE241049	Transcriptome Analysis	To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.		pubmed:39658721	WT 20 hpf CMs rep2	GSM7714400	source name:embryonic heart\|tissue:embryonic heart\|cell type:cardiomyocytes\|genotype:sibling WT of hand2 OE\|treatment:sorted cells by FACS\|geo loc name:missing\|collection date:missing	WT 20 hpf CMs rep2	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts	embryonic heart		miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		tissue:embryonic heart\|cell type:cardiomyocytes\|genotype:sibling WT of hand2 OE\|treatment:sorted cells by FACS	GSM7714400	GSM7714400: WT 20 hpf CMs rep2; Danio rerio; RNA Seq	GSM7714400 r1	GSM7714400	1	miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP455520	loader:fastq load.py	E22_3458_Yanli_HT_Lib_WT_CMs_2_R1.fastq.gz	fastq	2195524610.0	30700033.0	GSM7714400 r1	0:71.52	A:615401741;C:462686936;G:481135567;T:636300366;N:0	71	615401741	462686936	481135567	636300366	0	SRX21387409	SRS18627973	SRA1694205	MPI for heart and lung research	MPI for heart and lung research	1	0.90323	0.1476	0.78744	0.41728	72	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Germany	2023-08-17	Segmentation	Embryo	Heart	Cardiovascular System
25175	25175	SRR25661610	SRX21387408	SRS18627972	SRP455520	PRJNA1006302	The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes	GSE241049	Transcriptome Analysis	To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.		pubmed:39658721	WT 20 hpf CMs rep1	GSM7714399	source name:embryonic heart\|tissue:embryonic heart\|cell type:cardiomyocytes\|genotype:sibling WT of hand2 OE\|treatment:sorted cells by FACS\|geo loc name:missing\|collection date:missing	WT 20 hpf CMs rep1	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts	embryonic heart		miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		tissue:embryonic heart\|cell type:cardiomyocytes\|genotype:sibling WT of hand2 OE\|treatment:sorted cells by FACS	GSM7714399	GSM7714399: WT 20 hpf CMs rep1; Danio rerio; RNA Seq	GSM7714399 r1	GSM7714399	1	miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP455520	loader:fastq load.py	E22_3458_Yanli_HT_Lib_WT_CMs_1_R1.fastq.gz	fastq	2258160684.0	31576661.0	GSM7714399 r1	0:71.51	A:641254288;C:471580136;G:491501482;T:653824778;N:0	71	641254288	471580136	491501482	653824778	0	SRX21387408	SRS18627972	SRA1694205	MPI for heart and lung research	MPI for heart and lung research	1	0.9	0.13993	0.78445	0.40575	72	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Germany	2023-08-17	Segmentation	Embryo	Heart	Cardiovascular System
25176	25176	SRR25661611	SRX21387407	SRS18627971	SRP455520	PRJNA1006302	The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes	GSE241049	Transcriptome Analysis	To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.		pubmed:39658721	hand2 OE 20 hpf CMs rep3	GSM7714398	source name:embryonic heart\|tissue:embryonic heart\|cell type:cardiomyocytes\|genotype:overexpression hand2 in myocardium\|treatment:sorted cells by FACS\|geo loc name:missing\|collection date:missing	hand2 OE 20 hpf CMs rep3	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts	embryonic heart		miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		tissue:embryonic heart\|cell type:cardiomyocytes\|genotype:overexpression hand2 in myocardium\|treatment:sorted cells by FACS	GSM7714398	GSM7714398: hand2 OE 20 hpf CMs rep3; Danio rerio; RNA Seq	GSM7714398 r1	GSM7714398	1	miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP455520	loader:fastq load.py	E22_3458_Yanli_HT_Lib_OE_CMs_3_R1.fastq.gz	fastq	1886569909.0	26380170.0	GSM7714398 r1	0:71.51	A:534874421;C:392168718;G:411533838;T:547992932;N:0	71	534874421	392168718	411533838	547992932	0	SRX21387407	SRS18627971	SRA1694205	MPI for heart and lung research	MPI for heart and lung research	1	0.89968	0.14763	0.77881	0.42601	72	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Germany	2023-08-17	Segmentation	Embryo	Heart	Cardiovascular System
25177	25177	SRR25661612	SRX21387406	SRS18627970	SRP455520	PRJNA1006302	The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes	GSE241049	Transcriptome Analysis	To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.		pubmed:39658721	hand2 OE 20 hpf CMs rep2	GSM7714397	source name:embryonic heart\|tissue:embryonic heart\|cell type:cardiomyocytes\|genotype:overexpression hand2 in myocardium\|treatment:sorted cells by FACS\|geo loc name:missing\|collection date:missing	hand2 OE 20 hpf CMs rep2	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts	embryonic heart		miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		tissue:embryonic heart\|cell type:cardiomyocytes\|genotype:overexpression hand2 in myocardium\|treatment:sorted cells by FACS	GSM7714397	GSM7714397: hand2 OE 20 hpf CMs rep2; Danio rerio; RNA Seq	GSM7714397 r1	GSM7714397	1	miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP455520	loader:fastq load.py	E22_3458_Yanli_HT_Lib_OE_CMs_2_R1.fastq.gz	fastq	2197151812.0	30722639.0	GSM7714397 r1	0:71.52	A:617116635;C:461951919;G:481371246;T:636712012;N:0	71	617116635	461951919	481371246	636712012	0	SRX21387406	SRS18627970	SRA1694205	MPI for heart and lung research	MPI for heart and lung research	1	0.90877	0.14744	0.77191	0.42845	72	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Germany	2023-08-17	Segmentation	Embryo	Heart	Cardiovascular System
25178	25178	SRR25661613	SRX21387405	SRS18627969	SRP455520	PRJNA1006302	The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes	GSE241049	Transcriptome Analysis	To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.		pubmed:39658721	hand2 OE 20 hpf CMs rep1	GSM7714396	source name:embryonic heart\|tissue:embryonic heart\|cell type:cardiomyocytes\|genotype:overexpression hand2 in myocardium\|treatment:sorted cells by FACS\|geo loc name:missing\|collection date:missing	hand2 OE 20 hpf CMs rep1	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts	embryonic heart		miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		tissue:embryonic heart\|cell type:cardiomyocytes\|genotype:overexpression hand2 in myocardium\|treatment:sorted cells by FACS	GSM7714396	GSM7714396: hand2 OE 20 hpf CMs rep1; Danio rerio; RNA Seq	GSM7714396 r1	GSM7714396	1	miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP455520	loader:fastq load.py	E22_3458_Yanli_HT_Lib_OE_CMs_1_R1.fastq.gz	fastq	1773398936.0	24797998.0	GSM7714396 r1	0:71.51	A:495618212;C:375438077;G:390377060;T:511965587;N:0	71	495618212	375438077	390377060	511965587	0	SRX21387405	SRS18627969	SRA1694205	MPI for heart and lung research	MPI for heart and lung research	1	0.90769	0.1387	0.7768	0.42096	72	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Germany	2023-08-17	Segmentation	Embryo	Heart	Cardiovascular System
25179	25179	SRR25661614	SRX21387404	SRS18627968	SRP455520	PRJNA1006302	The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes	GSE241049	Transcriptome Analysis	To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.		pubmed:39658721	hand2 FLD / 20 hpf CMs rep3	GSM7714395	source name:embryonic heart\|tissue:embryonic heart\|cell type:cardiomyocytes\|genotype:hand2 mutant\|treatment:sorted cells by FACS\|geo loc name:missing\|collection date:missing	hand2 FLD / 20 hpf CMs rep3	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts	embryonic heart		miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		tissue:embryonic heart\|cell type:cardiomyocytes\|genotype:hand2 mutant\|treatment:sorted cells by FACS	GSM7714395	GSM7714395: hand2 FLD / 20 hpf CMs rep3; Danio rerio; RNA Seq	GSM7714395 r1	GSM7714395	1	miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP455520	loader:fastq load.py	E22_3458_Yanli_HT_Lib_Mut_3_R1.fastq.gz	fastq	2179400259.0	30471965.0	GSM7714395 r1	0:71.52	A:600555691;C:468535203;G:483122661;T:627186704;N:0	71	600555691	468535203	483122661	627186704	0	SRX21387404	SRS18627968	SRA1694205	MPI for heart and lung research	MPI for heart and lung research	1	0.91581	0.12256	0.75209	0.43413	71	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Germany	2023-08-17	Segmentation	Embryo	Heart	Cardiovascular System
25180	25180	SRR25661615	SRX21387403	SRS18627967	SRP455520	PRJNA1006302	The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes	GSE241049	Transcriptome Analysis	To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.		pubmed:39658721	hand2 FLD / 20 hpf CMs rep2	GSM7714394	source name:embryonic heart\|tissue:embryonic heart\|cell type:cardiomyocytes\|genotype:hand2 mutant\|treatment:sorted cells by FACS\|geo loc name:missing\|collection date:missing	hand2 FLD / 20 hpf CMs rep2	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts	embryonic heart		miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		tissue:embryonic heart\|cell type:cardiomyocytes\|genotype:hand2 mutant\|treatment:sorted cells by FACS	GSM7714394	GSM7714394: hand2 FLD / 20 hpf CMs rep2; Danio rerio; RNA Seq	GSM7714394 r1	GSM7714394	1	miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP455520	loader:fastq load.py	E22_3458_Yanli_HT_Lib_Mut_2_R1.fastq.gz	fastq	2340991168.0	32733068.0	GSM7714394 r1	0:71.52	A:647423337;C:500120073;G:514803152;T:678644606;N:0	71	647423337	500120073	514803152	678644606	0	SRX21387403	SRS18627967	SRA1694205	MPI for heart and lung research	MPI for heart and lung research	1	0.91231	0.12561	0.75118	0.44445	71	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Germany	2023-08-17	Segmentation	Embryo	Heart	Cardiovascular System
25181	25181	SRR25661616	SRX21387402	SRS18627966	SRP455520	PRJNA1006302	The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes	GSE241049	Transcriptome Analysis	To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.		pubmed:39658721	hand2 FLD / 20 hpf CMs rep1	GSM7714393	source name:embryonic heart\|tissue:embryonic heart\|cell type:cardiomyocytes\|genotype:hand2 mutant\|treatment:sorted cells by FACS\|geo loc name:missing\|collection date:missing	hand2 FLD / 20 hpf CMs rep1	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts	embryonic heart		miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		tissue:embryonic heart\|cell type:cardiomyocytes\|genotype:hand2 mutant\|treatment:sorted cells by FACS	GSM7714393	GSM7714393: hand2 FLD / 20 hpf CMs rep1; Danio rerio; RNA Seq	GSM7714393 r1	GSM7714393	1	miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP455520	loader:fastq load.py	E22_3458_Yanli_HT_Lib_Mut_1_R1.fastq.gz	fastq	2727863036.0	38140997.0	GSM7714393 r1	0:71.52	A:760867462;C:577539041;G:596986102;T:792470431;N:0	71	760867462	577539041	596986102	792470431	0	SRX21387402	SRS18627966	SRA1694205	MPI for heart and lung research	MPI for heart and lung research	1	0.91175	0.1342	0.75282	0.44063	72	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Germany	2023-08-17	Segmentation	Embryo	Heart	Cardiovascular System
25196	25196	SRR25685540	SRX21410747	SRS18649229	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	Hmga1a overexpression sample 4	GSM7717538	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	Hmga1a overexpression sample 4	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717538	GSM7717538: Hmga1a overexpression sample 4; Danio rerio; RNA Seq	GSM7717538 r1	GSM7717538	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L001_OE4_cbc.fastq.gz	fastq	373009260.0	6216821.0	GSM7717538 r1	0:60	A:154344754;C:67291339;G:55785796;T:95519920;N:67451	60	154344754	67291339	55785796	95519920	67451	SRX21410747	SRS18649229	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.89552	0.06993	0.9276	0.58138	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25197	25197	SRR25685541	SRX21410747	SRS18649229	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	Hmga1a overexpression sample 4	GSM7717538	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	Hmga1a overexpression sample 4	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717538	GSM7717538: Hmga1a overexpression sample 4; Danio rerio; RNA Seq	GSM7717538 r1	GSM7717538	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L002_OE4_cbc.fastq.gz	fastq	362301060.0	6038351.0	GSM7717538 r2	0:60	A:106180158;C:75387781;G:73886850;T:106761396;N:84875	60	106180158	75387781	73886850	106761396	84875	SRX21410747	SRS18649229	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.89159	0.06701	0.87081	0.62237	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25198	25198	SRR25685542	SRX21410747	SRS18649229	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	Hmga1a overexpression sample 4	GSM7717538	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	Hmga1a overexpression sample 4	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717538	GSM7717538: Hmga1a overexpression sample 4; Danio rerio; RNA Seq	GSM7717538 r1	GSM7717538	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L003_OE4_cbc.fastq.gz	fastq	384538200.0	6408970.0	GSM7717538 r3	0:60	A:113163070;C:80510291;G:76775008;T:114062728;N:27103	60	113163070	80510291	76775008	114062728	27103	SRX21410747	SRS18649229	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.90032	0.06985	0.87008	0.61631	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25199	25199	SRR25685543	SRX21410747	SRS18649229	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	Hmga1a overexpression sample 4	GSM7717538	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	Hmga1a overexpression sample 4	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717538	GSM7717538: Hmga1a overexpression sample 4; Danio rerio; RNA Seq	GSM7717538 r1	GSM7717538	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L004_OE4_cbc.fastq.gz	fastq	369674700.0	6161245.0	GSM7717538 r4	0:60	A:108130666;C:76988468;G:75491768;T:109027980;N:35818	60	108130666	76988468	75491768	109027980	35818	SRX21410747	SRS18649229	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.89622	0.06895	0.86854	0.61464	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25200	25200	SRR25685544	SRX21410746	SRS18649228	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	Hmga1a overexpression sample 3	GSM7717537	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	Hmga1a overexpression sample 3	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717537	GSM7717537: Hmga1a overexpression sample 3; Danio rerio; RNA Seq	GSM7717537 r1	GSM7717537	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L001_OE3_cbc.fastq.gz	fastq	172977180.0	2882953.0	GSM7717537 r1	0:60	A:75387211;C:31808233;G:24071421;T:41679068;N:31247	60	75387211	31808233	24071421	41679068	31247	SRX21410746	SRS18649228	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.88458	0.06987	0.92788	0.58263	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25201	25201	SRR25685545	SRX21410746	SRS18649228	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	Hmga1a overexpression sample 3	GSM7717537	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	Hmga1a overexpression sample 3	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717537	GSM7717537: Hmga1a overexpression sample 3; Danio rerio; RNA Seq	GSM7717537 r1	GSM7717537	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L002_OE3_cbc.fastq.gz	fastq	168370020.0	2806167.0	GSM7717537 r2	0:60	A:49447288;C:35622124;G:34182575;T:49078813;N:39220	60	49447288	35622124	34182575	49078813	39220	SRX21410746	SRS18649228	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.88366	0.06639	0.87519	0.43134	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25202	25202	SRR25685546	SRX21410746	SRS18649228	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	Hmga1a overexpression sample 3	GSM7717537	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	Hmga1a overexpression sample 3	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717537	GSM7717537: Hmga1a overexpression sample 3; Danio rerio; RNA Seq	GSM7717537 r1	GSM7717537	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L003_OE3_cbc.fastq.gz	fastq	177341340.0	2955689.0	GSM7717537 r3	0:60	A:52304623;C:37759158;G:35264433;T:52000964;N:12162	60	52304623	37759158	35264433	52000964	12162	SRX21410746	SRS18649228	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.8907	0.06795	0.87405	0.57596	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25203	25203	SRR25685547	SRX21410746	SRS18649228	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	Hmga1a overexpression sample 3	GSM7717537	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	Hmga1a overexpression sample 3	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717537	GSM7717537: Hmga1a overexpression sample 3; Danio rerio; RNA Seq	GSM7717537 r1	GSM7717537	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L004_OE3_cbc.fastq.gz	fastq	172482600.0	2874710.0	GSM7717537 r4	0:60	A:50610545;C:36521080;G:35043934;T:50291237;N:15804	60	50610545	36521080	35043934	50291237	15804	SRX21410746	SRS18649228	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.88558	0.06686	0.87373	0.57425	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25204	25204	SRR25685548	SRX21410745	SRS18649227	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	Hmga1a overexpression sample 2	GSM7717536	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	Hmga1a overexpression sample 2	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717536	GSM7717536: Hmga1a overexpression sample 2; Danio rerio; RNA Seq	GSM7717536 r1	GSM7717536	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L001_OE2_cbc.fastq.gz	fastq	420273960.0	7004566.0	GSM7717536 r1	0:60	A:172608345;C:77102289;G:65053968;T:105434207;N:75151	60	172608345	77102289	65053968	105434207	75151	SRX21410745	SRS18649227	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.90654	0.06306	0.92904	0.38886	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25205	25205	SRR25685549	SRX21410745	SRS18649227	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	Hmga1a overexpression sample 2	GSM7717536	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	Hmga1a overexpression sample 2	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717536	GSM7717536: Hmga1a overexpression sample 2; Danio rerio; RNA Seq	GSM7717536 r1	GSM7717536	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L002_OE2_cbc.fastq.gz	fastq	408658800.0	6810980.0	GSM7717536 r2	0:60	A:118741152;C:85204554;G:86928543;T:117687807;N:96744	60	118741152	85204554	86928543	117687807	96744	SRX21410745	SRS18649227	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.90277	0.06298	0.87302	0.66727	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25206	25206	SRR25685550	SRX21410745	SRS18649227	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	Hmga1a overexpression sample 2	GSM7717536	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	Hmga1a overexpression sample 2	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717536	GSM7717536: Hmga1a overexpression sample 2; Danio rerio; RNA Seq	GSM7717536 r1	GSM7717536	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L003_OE2_cbc.fastq.gz	fastq	433893360.0	7231556.0	GSM7717536 r3	0:60	A:126666020;C:91068379;G:90449908;T:125677088;N:31965	60	126666020	91068379	90449908	125677088	31965	SRX21410745	SRS18649227	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.90833	0.06364	0.87351	0.66644	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25207	25207	SRR25685551	SRX21410745	SRS18649227	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	Hmga1a overexpression sample 2	GSM7717536	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	Hmga1a overexpression sample 2	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717536	GSM7717536: Hmga1a overexpression sample 2; Danio rerio; RNA Seq	GSM7717536 r1	GSM7717536	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L004_OE2_cbc.fastq.gz	fastq	418311900.0	6971865.0	GSM7717536 r4	0:60	A:121375806;C:87324728;G:89011817;T:120559021;N:40528	60	121375806	87324728	89011817	120559021	40528	SRX21410745	SRS18649227	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.90583	0.06349	0.87156	0.36876	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25208	25208	SRR25685552	SRX21410744	SRS18649226	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	Hmga1a overexpression sample 1	GSM7717535	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	Hmga1a overexpression sample 1	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717535	GSM7717535: Hmga1a overexpression sample 1; Danio rerio; RNA Seq	GSM7717535 r1	GSM7717535	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L001_OE1_cbc.fastq.gz	fastq	219019680.0	3650328.0	GSM7717535 r1	0:60	A:89205341;C:39777204;G:33514473;T:56486057;N:36605	60	89205341	39777204	33514473	56486057	36605	SRX21410744	SRS18649226	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.89316	0.08503	0.92125	0.51486	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25209	25209	SRR25685553	SRX21410744	SRS18649226	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	Hmga1a overexpression sample 1	GSM7717535	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	Hmga1a overexpression sample 1	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717535	GSM7717535: Hmga1a overexpression sample 1; Danio rerio; RNA Seq	GSM7717535 r1	GSM7717535	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L002_OE1_cbc.fastq.gz	fastq	213035040.0	3550584.0	GSM7717535 r2	0:60	A:60747442;C:44096249;G:44275929;T:63866231;N:49189	60	60747442	44096249	44275929	63866231	49189	SRX21410744	SRS18649226	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.89017	0.08631	0.86543	0.52632	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25210	25210	SRR25685554	SRX21410744	SRS18649226	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	Hmga1a overexpression sample 1	GSM7717535	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	Hmga1a overexpression sample 1	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717535	GSM7717535: Hmga1a overexpression sample 1; Danio rerio; RNA Seq	GSM7717535 r1	GSM7717535	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L003_OE1_cbc.fastq.gz	fastq	226019460.0	3766991.0	GSM7717535 r3	0:60	A:64732665;C:47081812;G:46018051;T:68171208;N:15724	60	64732665	47081812	46018051	68171208	15724	SRX21410744	SRS18649226	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.89632	0.08716	0.86661	0.54361	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25211	25211	SRR25685555	SRX21410744	SRS18649226	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	Hmga1a overexpression sample 1	GSM7717535	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	Hmga1a overexpression sample 1	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:Hmga1a overexpression\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717535	GSM7717535: Hmga1a overexpression sample 1; Danio rerio; RNA Seq	GSM7717535 r1	GSM7717535	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L004_OE1_cbc.fastq.gz	fastq	217742460.0	3629041.0	GSM7717535 r4	0:60	A:61973072;C:45113665;G:45294805;T:65339336;N:21582	60	61973072	45113665	45294805	65339336	21582	SRX21410744	SRS18649226	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.89237	0.08517	0.86454	0.54639	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25212	25212	SRR25685556	SRX21410743	SRS18649225	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	control sample 4	GSM7717534	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	control sample 4	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717534	GSM7717534: control sample 4; Danio rerio; RNA Seq	GSM7717534 r1	GSM7717534	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L001_Ctrl4_cbc.fastq.gz	fastq	242809260.0	4046821.0	GSM7717534 r1	0:60	A:101286554;C:44368173;G:36112695;T:60997635;N:44203	60	101286554	44368173	36112695	60997635	44203	SRX21410743	SRS18649225	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.87519	0.14838	0.9362	0.79824	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25213	25213	SRR25685557	SRX21410743	SRS18649225	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	control sample 4	GSM7717534	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	control sample 4	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717534	GSM7717534: control sample 4; Danio rerio; RNA Seq	GSM7717534 r1	GSM7717534	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L002_Ctrl4_cbc.fastq.gz	fastq	235587720.0	3926462.0	GSM7717534 r2	0:60	A:71954218;C:50127333;G:45371371;T:68077780;N:57018	60	71954218	50127333	45371371	68077780	57018	SRX21410743	SRS18649225	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.8759	0.14468	0.88075	0.74532	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25214	25214	SRR25685558	SRX21410743	SRS18649225	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	control sample 4	GSM7717534	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	control sample 4	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717534	GSM7717534: control sample 4; Danio rerio; RNA Seq	GSM7717534 r1	GSM7717534	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L003_Ctrl4_cbc.fastq.gz	fastq	248320680.0	4138678.0	GSM7717534 r3	0:60	A:76188968;C:53138643;G:46699955;T:72274599;N:18515	60	76188968	53138643	46699955	72274599	18515	SRX21410743	SRS18649225	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.88396	0.1471	0.87864	0.74275	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25215	25215	SRR25685559	SRX21410743	SRS18649225	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	control sample 4	GSM7717534	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	control sample 4	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717534	GSM7717534: control sample 4; Danio rerio; RNA Seq	GSM7717534 r1	GSM7717534	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L004_Ctrl4_cbc.fastq.gz	fastq	239678820.0	3994647.0	GSM7717534 r4	0:60	A:73122694;C:51017089;G:46184519;T:69330703;N:23815	60	73122694	51017089	46184519	69330703	23815	SRX21410743	SRS18649225	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.88113	0.14666	0.88045	0.79921	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25216	25216	SRR25685560	SRX21410742	SRS18649224	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	control sample 3	GSM7717533	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	control sample 3	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717533	GSM7717533: control sample 3; Danio rerio; RNA Seq	GSM7717533 r1	GSM7717533	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L001_Ctrl3_cbc.fastq.gz	fastq	164862000.0	2747700.0	GSM7717533 r1	0:60	A:67317722;C:30175032;G:25320195;T:42019155;N:29896	60	67317722	30175032	25320195	42019155	29896	SRX21410742	SRS18649224	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.8874	0.16231	0.93513	0.45903	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25217	25217	SRR25685561	SRX21410742	SRS18649224	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	control sample 3	GSM7717533	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	control sample 3	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717533	GSM7717533: control sample 3; Danio rerio; RNA Seq	GSM7717533 r1	GSM7717533	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L002_Ctrl3_cbc.fastq.gz	fastq	159878880.0	2664648.0	GSM7717533 r2	0:60	A:48277840;C:33800190;G:31556276;T:46206979;N:37595	60	48277840	33800190	31556276	46206979	37595	SRX21410742	SRS18649224	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.8874	0.15941	0.88038	0.79589	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25218	25218	SRR25685562	SRX21410742	SRS18649224	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	control sample 3	GSM7717533	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	control sample 3	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717533	GSM7717533: control sample 3; Danio rerio; RNA Seq	GSM7717533 r1	GSM7717533	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L003_Ctrl3_cbc.fastq.gz	fastq	169506240.0	2825104.0	GSM7717533 r3	0:60	A:51435401;C:36027782;G:32684721;T:49346338;N:11998	60	51435401	36027782	32684721	49346338	11998	SRX21410742	SRS18649224	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.89554	0.16117	0.87947	0.795	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25219	25219	SRR25685563	SRX21410742	SRS18649224	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	control sample 3	GSM7717533	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	control sample 3	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717533	GSM7717533: control sample 3; Danio rerio; RNA Seq	GSM7717533 r1	GSM7717533	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L004_Ctrl3_cbc.fastq.gz	fastq	163347840.0	2722464.0	GSM7717533 r4	0:60	A:49253957;C:34538564;G:32268358;T:47272095;N:14866	60	49253957	34538564	32268358	47272095	14866	SRX21410742	SRS18649224	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.89252	0.15956	0.8784	0.79732	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25220	25220	SRR25685564	SRX21410741	SRS18649223	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	control sample 2	GSM7717532	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	control sample 2	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717532	GSM7717532: control sample 2; Danio rerio; RNA Seq	GSM7717532 r1	GSM7717532	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L001_Ctrl2_cbc.fastq.gz	fastq	19885560.0	331426.0	GSM7717532 r1	0:60	A:8615440;C:3592607;G:2886695;T:4787767;N:3051	60	8615440	3592607	2886695	4787767	3051	SRX21410741	SRS18649223	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.84848	0.13671	0.96136	0.84253	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25221	25221	SRR25685565	SRX21410741	SRS18649223	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	control sample 2	GSM7717532	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	control sample 2	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717532	GSM7717532: control sample 2; Danio rerio; RNA Seq	GSM7717532 r1	GSM7717532	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L002_Ctrl2_cbc.fastq.gz	fastq	19226760.0	320446.0	GSM7717532 r2	0:60	A:5898378;C:4022375;G:3854218;T:5447181;N:4608	60	5898378	4022375	3854218	5447181	4608	SRX21410741	SRS18649223	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.84542	0.13731	0.94004	0.38758	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25222	25222	SRR25685566	SRX21410741	SRS18649223	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	control sample 2	GSM7717532	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	control sample 2	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717532	GSM7717532: control sample 2; Danio rerio; RNA Seq	GSM7717532 r1	GSM7717532	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L003_Ctrl2_cbc.fastq.gz	fastq	20360520.0	339342.0	GSM7717532 r3	0:60	A:6273552;C:4289098;G:3982791;T:5813710;N:1369	60	6273552	4289098	3982791	5813710	1369	SRX21410741	SRS18649223	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.85213	0.13819	0.93929	0.83913	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25223	25223	SRR25685567	SRX21410741	SRS18649223	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	control sample 2	GSM7717532	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	control sample 2	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717532	GSM7717532: control sample 2; Danio rerio; RNA Seq	GSM7717532 r1	GSM7717532	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L004_Ctrl2_cbc.fastq.gz	fastq	19742340.0	329039.0	GSM7717532 r4	0:60	A:6042722;C:4140425;G:3955209;T:5601961;N:2023	60	6042722	4140425	3955209	5601961	2023	SRX21410741	SRS18649223	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.84722	0.13682	0.93933	0.83301	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25224	25224	SRR25685568	SRX21410740	SRS18649222	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	control sample 1	GSM7717531	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	control sample 1	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717531	GSM7717531: control sample 1; Danio rerio; RNA Seq	GSM7717531 r1	GSM7717531	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L001_Ctrl1_cbc.fastq.gz	fastq	296163420.0	4936057.0	GSM7717531 r1	0:60	A:121966307;C:53233433;G:44972413;T:75936522;N:54745	60	121966307	53233433	44972413	75936522	54745	SRX21410740	SRS18649222	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.88546	0.17055	0.92681	0.76028	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25225	25225	SRR25685569	SRX21410740	SRS18649222	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	control sample 1	GSM7717531	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	control sample 1	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717531	GSM7717531: control sample 1; Danio rerio; RNA Seq	GSM7717531 r1	GSM7717531	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L002_Ctrl1_cbc.fastq.gz	fastq	287707980.0	4795133.0	GSM7717531 r2	0:60	A:87738683;C:59468794;G:56448494;T:83984130;N:67879	60	87738683	59468794	56448494	83984130	67879	SRX21410740	SRS18649222	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.88284	0.16626	0.86561	0.74308	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25226	25226	SRR25685570	SRX21410740	SRS18649222	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	control sample 1	GSM7717531	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	control sample 1	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717531	GSM7717531: control sample 1; Danio rerio; RNA Seq	GSM7717531 r1	GSM7717531	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L003_Ctrl1_cbc.fastq.gz	fastq	303833460.0	5063891.0	GSM7717531 r3	0:60	A:93092013;C:63221167;G:58235370;T:89262119;N:22791	60	93092013	63221167	58235370	89262119	22791	SRX21410740	SRS18649222	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.89102	0.16657	0.86336	0.75396	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25227	25227	SRR25685571	SRX21410740	SRS18649222	SRP455779	PRJNA1006658	Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]	GSE241157	Transcriptome Analysis	The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3 7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.	parent bioproject:PRJNA1006653	pubmed:39747457	control sample 1	GSM7717531	source name:adult heart\|tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen\|geo loc name:missing\|collection date:missing	control sample 1	FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts	adult heart	zebrafish were treated with tamoxifen to induce Hmga1a overexpression	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		tissue:adult heart\|genotype 1:cmlc2:dsred\|genotype 2:control\|cell type:cardiomyocytes\|treatment:14 days post tamoxifen	GSM7717531	GSM7717531: control sample 1; Danio rerio; RNA Seq	GSM7717531 r1	GSM7717531	1	Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP455779		HUB-PN-b004_HHHK2BGXN_S1_L004_Ctrl1_cbc.fastq.gz	fastq	293865840.0	4897764.0	GSM7717531 r4	0:60	A:89531768;C:60796725;G:57688758;T:85819485;N:29104	60	89531768	60796725	57688758	85819485	29104	SRX21410740	SRS18649222	SRA1695358	Jeroen Bakkers, Hubrecht Institute	Jeroen Bakkers, Hubrecht Institute	1	0.88911	0.16498	0.86145	0.75653	60	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	Netherlands	2023-08-18	Adult	Adult	Heart	Cardiovascular System
25320	25320	SRR25810878	SRX21533024	SRS18745490	SRP457576	PRJNA1010780	Effect of egr3 knockout on gene expression of dissected zebrafish hearts	GSE241935	Transcriptome Analysis	To screen for Egr3 targets mediating cardiac valve development we assessed gene expression on dissected hearts of egr3 mutants and wild type siblings. Overall design: To evaluate the transcriptional differences underlying the egr3 mutant phenotype we conducted a bulk RNA seq analysis in dissected zebrafish hearts at 48 hpf. We dissected 20 hearts for each biological duplicate of egr3 mutant and wild type sibling samples in cold DMEM with 10% FBS. Total RNA was isolated using the miRNeasy micro Kit Qiagen 217084 followed by on column DNase digestion DNase Free DNase Set Qiagen 79254 and final elution was performed in 12µl of RNase free water. Analysis of the obtained reads confirmed the 11bp deletion in the mutant samples. 1. Boezio G. L. M. et al. The developing epicardium regulates cardiac chamber morphogenesis by promoting cardiomyocyte growth. Dis Model Mech 16 2023. https://doi.org:10.1242/dmm.049571		pubmed:38748804	egr3 wild type siblings 2	GSM7745909	source name:Heart\|tissue:Heart\|genotype:bns577+/+\|geo loc name:missing\|collection date:missing	egr3 wild type siblings 2	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Aligned reads were filtered to remove: duplicates with Picard 2.27.1 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.2 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The raw count matrix was normalized with DESeq2 version 1.30.1 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2 and batch corrected using CountClust each biological replicate = one batch Dey K et al. Visualizing the structure of RNA seq expression data using grade of membership models. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Assembly: danRer11 Supplementary files format and content: libryr size notmalize amd batch corrected counts	Heart		Total RNA was isolated using the miRNeasy micro Kit Qiagen 217084 followed by on column DNase digestion DNase Free DNase Set Qiagen 79254 and final elution was performed in 12μl of RNase free water 10ng total RNA was used for SMART Seq® v4 Ultra® Low Input RNA Kit Takara Bio.		tissue:Heart\|genotype:bns577+/+	GSM7745909	GSM7745909: egr3 wild type siblings 2; Danio rerio; RNA Seq	GSM7745909 r1	GSM7745909	1	Total RNA was isolated using the miRNeasy micro Kit Qiagen 217084 followed by on column DNase digestion DNase Free DNase Set Qiagen 79254 and final elution was performed in 12μl of RNase free water 10ng total RNA was used for SMART Seq® v4 Ultra® Low Input RNA Kit Takara Bio.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP457576	loader:fastq load.py	E22_3626_Lib_Agatha_egr3_WT2_R1.fastq.gz	fastq	3473319384.0	49279465.0	GSM7745909 r1	0:70.48	A:943794847;C:792135324;G:792042625;T:945083925;N:262663	70	943794847	792135324	792042625	945083925	262663	SRX21533024	SRS18745490	SRA1702458	MPI for heart and lung research	MPI for heart and lung research	1	0.68549	0.04588	0.76865	0.44964	71	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Germany	2023-08-30	Undetermined	Undetermined	Heart	Cardiovascular System
25321	25321	SRR25810879	SRX21533023	SRS18745489	SRP457576	PRJNA1010780	Effect of egr3 knockout on gene expression of dissected zebrafish hearts	GSE241935	Transcriptome Analysis	To screen for Egr3 targets mediating cardiac valve development we assessed gene expression on dissected hearts of egr3 mutants and wild type siblings. Overall design: To evaluate the transcriptional differences underlying the egr3 mutant phenotype we conducted a bulk RNA seq analysis in dissected zebrafish hearts at 48 hpf. We dissected 20 hearts for each biological duplicate of egr3 mutant and wild type sibling samples in cold DMEM with 10% FBS. Total RNA was isolated using the miRNeasy micro Kit Qiagen 217084 followed by on column DNase digestion DNase Free DNase Set Qiagen 79254 and final elution was performed in 12µl of RNase free water. Analysis of the obtained reads confirmed the 11bp deletion in the mutant samples. 1. Boezio G. L. M. et al. The developing epicardium regulates cardiac chamber morphogenesis by promoting cardiomyocyte growth. Dis Model Mech 16 2023. https://doi.org:10.1242/dmm.049571		pubmed:38748804	egr3 wild type siblings 1	GSM7745908	source name:Heart\|tissue:Heart\|genotype:bns577+/+\|geo loc name:missing\|collection date:missing	egr3 wild type siblings 1	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Aligned reads were filtered to remove: duplicates with Picard 2.27.1 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.2 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The raw count matrix was normalized with DESeq2 version 1.30.1 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2 and batch corrected using CountClust each biological replicate = one batch Dey K et al. Visualizing the structure of RNA seq expression data using grade of membership models. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Assembly: danRer11 Supplementary files format and content: libryr size notmalize amd batch corrected counts	Heart		Total RNA was isolated using the miRNeasy micro Kit Qiagen 217084 followed by on column DNase digestion DNase Free DNase Set Qiagen 79254 and final elution was performed in 12μl of RNase free water 10ng total RNA was used for SMART Seq® v4 Ultra® Low Input RNA Kit Takara Bio.		tissue:Heart\|genotype:bns577+/+	GSM7745908	GSM7745908: egr3 wild type siblings 1; Danio rerio; RNA Seq	GSM7745908 r1	GSM7745908	1	Total RNA was isolated using the miRNeasy micro Kit Qiagen 217084 followed by on column DNase digestion DNase Free DNase Set Qiagen 79254 and final elution was performed in 12μl of RNase free water 10ng total RNA was used for SMART Seq® v4 Ultra® Low Input RNA Kit Takara Bio.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP457576	loader:fastq load.py	E22_3626_Lib_Agatha_egr3_WT1_R1.fastq.gz	fastq	3909248616.0	55045571.0	GSM7745908 r1	0:71.02	A:1048107387;C:905014546;G:907455489;T:1048528690;N:142504	71	1048107387	905014546	907455489	1048528690	142504	SRX21533023	SRS18745489	SRA1702458	MPI for heart and lung research	MPI for heart and lung research	1	0.94958	0.06298	0.74819	0.45762	72	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Germany	2023-08-30	Undetermined	Undetermined	Heart	Cardiovascular System
25322	25322	SRR25810880	SRX21533022	SRS18745488	SRP457576	PRJNA1010780	Effect of egr3 knockout on gene expression of dissected zebrafish hearts	GSE241935	Transcriptome Analysis	To screen for Egr3 targets mediating cardiac valve development we assessed gene expression on dissected hearts of egr3 mutants and wild type siblings. Overall design: To evaluate the transcriptional differences underlying the egr3 mutant phenotype we conducted a bulk RNA seq analysis in dissected zebrafish hearts at 48 hpf. We dissected 20 hearts for each biological duplicate of egr3 mutant and wild type sibling samples in cold DMEM with 10% FBS. Total RNA was isolated using the miRNeasy micro Kit Qiagen 217084 followed by on column DNase digestion DNase Free DNase Set Qiagen 79254 and final elution was performed in 12µl of RNase free water. Analysis of the obtained reads confirmed the 11bp deletion in the mutant samples. 1. Boezio G. L. M. et al. The developing epicardium regulates cardiac chamber morphogenesis by promoting cardiomyocyte growth. Dis Model Mech 16 2023. https://doi.org:10.1242/dmm.049571		pubmed:38748804	egr3 mutants 2	GSM7745907	source name:Heart\|tissue:Heart\|genotype:bns577 / \|geo loc name:missing\|collection date:missing	egr3 mutants 2	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Aligned reads were filtered to remove: duplicates with Picard 2.27.1 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.2 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The raw count matrix was normalized with DESeq2 version 1.30.1 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2 and batch corrected using CountClust each biological replicate = one batch Dey K et al. Visualizing the structure of RNA seq expression data using grade of membership models. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Assembly: danRer11 Supplementary files format and content: libryr size notmalize amd batch corrected counts	Heart		Total RNA was isolated using the miRNeasy micro Kit Qiagen 217084 followed by on column DNase digestion DNase Free DNase Set Qiagen 79254 and final elution was performed in 12μl of RNase free water 10ng total RNA was used for SMART Seq® v4 Ultra® Low Input RNA Kit Takara Bio.		tissue:Heart\|genotype:bns577 /	GSM7745907	GSM7745907: egr3 mutants 2; Danio rerio; RNA Seq	GSM7745907 r1	GSM7745907	1	Total RNA was isolated using the miRNeasy micro Kit Qiagen 217084 followed by on column DNase digestion DNase Free DNase Set Qiagen 79254 and final elution was performed in 12μl of RNase free water 10ng total RNA was used for SMART Seq® v4 Ultra® Low Input RNA Kit Takara Bio.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP457576	loader:fastq load.py	E22_3626_Lib_Agatha_egr3_Mut2_R1.fastq.gz	fastq	3432675258.0	48483287.0	GSM7745907 r1	0:70.80	A:925832958;C:788551205;G:790129536;T:927993012;N:168547	70	925832958	788551205	790129536	927993012	168547	SRX21533022	SRS18745488	SRA1702458	MPI for heart and lung research	MPI for heart and lung research	1	0.75652	0.04046	0.76455	0.46333	72	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Germany	2023-08-30	Undetermined	Undetermined	Heart	Cardiovascular System
25323	25323	SRR25810881	SRX21533021	SRS18745487	SRP457576	PRJNA1010780	Effect of egr3 knockout on gene expression of dissected zebrafish hearts	GSE241935	Transcriptome Analysis	To screen for Egr3 targets mediating cardiac valve development we assessed gene expression on dissected hearts of egr3 mutants and wild type siblings. Overall design: To evaluate the transcriptional differences underlying the egr3 mutant phenotype we conducted a bulk RNA seq analysis in dissected zebrafish hearts at 48 hpf. We dissected 20 hearts for each biological duplicate of egr3 mutant and wild type sibling samples in cold DMEM with 10% FBS. Total RNA was isolated using the miRNeasy micro Kit Qiagen 217084 followed by on column DNase digestion DNase Free DNase Set Qiagen 79254 and final elution was performed in 12µl of RNase free water. Analysis of the obtained reads confirmed the 11bp deletion in the mutant samples. 1. Boezio G. L. M. et al. The developing epicardium regulates cardiac chamber morphogenesis by promoting cardiomyocyte growth. Dis Model Mech 16 2023. https://doi.org:10.1242/dmm.049571		pubmed:38748804	egr3 mutants 1	GSM7745906	source name:Heart\|tissue:Heart\|genotype:bns577 / \|geo loc name:missing\|collection date:missing	egr3 mutants 1	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Aligned reads were filtered to remove: duplicates with Picard 2.27.1 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.2 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The raw count matrix was normalized with DESeq2 version 1.30.1 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2 and batch corrected using CountClust each biological replicate = one batch Dey K et al. Visualizing the structure of RNA seq expression data using grade of membership models. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Assembly: danRer11 Supplementary files format and content: libryr size notmalize amd batch corrected counts	Heart		Total RNA was isolated using the miRNeasy micro Kit Qiagen 217084 followed by on column DNase digestion DNase Free DNase Set Qiagen 79254 and final elution was performed in 12μl of RNase free water 10ng total RNA was used for SMART Seq® v4 Ultra® Low Input RNA Kit Takara Bio.		tissue:Heart\|genotype:bns577 /	GSM7745906	GSM7745906: egr3 mutants 1; Danio rerio; RNA Seq	GSM7745906 r1	GSM7745906	1	Total RNA was isolated using the miRNeasy micro Kit Qiagen 217084 followed by on column DNase digestion DNase Free DNase Set Qiagen 79254 and final elution was performed in 12μl of RNase free water 10ng total RNA was used for SMART Seq® v4 Ultra® Low Input RNA Kit Takara Bio.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP457576	loader:fastq load.py	E22_3626_Lib_Agatha_egr3_Mut1_R1.fastq.gz	fastq	3838969347.0	54545950.0	GSM7745906 r1	0:70.38	A:1016913415;C:902500250;G:903033204;T:1016194618;N:327860	70	1016913415	902500250	903033204	1016194618	327860	SRX21533021	SRS18745487	SRA1702458	MPI for heart and lung research	MPI for heart and lung research	1	0.9511	0.05017	0.75341	0.47152	72	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Germany	2023-08-30	Undetermined	Undetermined	Heart	Cardiovascular System
29086	29086	SRR27015250	SRX22707800	SRS19700101	SRP475323	PRJNA1047551	Identification of genes important during atrial myocardial morphogenesis	GSE249149	Transcriptome Analysis	Atrial cardiomyocytes undergo complex cellular behaviours post 72 hpf to build muscle structures. We aimed to identify the genes involved during this process and therefore we seqeunced the RNA from 48 hpf and 72 hpf atrial cardiomyocytes to uncover changes in the transcirptome that might regulate or trigger atrial morphogenesis post 72 hpf. Overall design: Comparative gene expression profiling analysis of RNA seq data for 48 hpf and 72 hpf wild type zebrafish atrial cardiomyocytes.		pubmed:39289341	Wild type zebrafish atrial cardiomyocytes 72 hpf rep 3	GSM7927521	source name:embryonic heart\|tissue:embryonic heart\|cell type:cardiomyocyte\|genotype:wild type\|treatment:72 hpf loc name:missing\|collection date:missing	Wild type zebrafish atrial cardiomyocytes 72 hpf rep 3	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Bolger et al. Trimmomatic: a flexible trimmer for Illumina sequence data. Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 3.0.0 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.4 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Assembly: danRer11 Supplementary files format and content: count matrix	embryonic heart		miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		tissue:embryonic heart\|cell type:cardiomyocyte\|genotype:wild type\|treatment:72 hpf	GSM7927521	GSM7927521: Wild type zebrafish atrial cardiomyocytes 72 hpf rep 3; Danio rerio; RNA Seq	GSM7927521 r1	GSM7927521	1	miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP475323	loader:fastq load.py	dst226_zbrf_clt___ACrdmct-age___72h_b03_t01_m01_R1.fastq.gz	fastq	1709509823.0	28403358.0	GSM7927521 r1	0:60.19	A:400293032;C:330429588;G:326652799;T:383291002;N:268843402	60	400293032	330429588	326652799	383291002	268843402	SRX22707800	SRS19700101	SRA1761360	MPI for heart and lung research	MPI for heart and lung research	1	0.90079	0.0827	0.81406	0.64557	35	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Germany	2023-12-01	Larval	Larval	Heart	Cardiovascular System
29087	29087	SRR27015251	SRX22707799	SRS19700100	SRP475323	PRJNA1047551	Identification of genes important during atrial myocardial morphogenesis	GSE249149	Transcriptome Analysis	Atrial cardiomyocytes undergo complex cellular behaviours post 72 hpf to build muscle structures. We aimed to identify the genes involved during this process and therefore we seqeunced the RNA from 48 hpf and 72 hpf atrial cardiomyocytes to uncover changes in the transcirptome that might regulate or trigger atrial morphogenesis post 72 hpf. Overall design: Comparative gene expression profiling analysis of RNA seq data for 48 hpf and 72 hpf wild type zebrafish atrial cardiomyocytes.		pubmed:39289341	Wild type zebrafish atrial cardiomyocytes 72 hpf rep 2	GSM7927520	source name:embryonic heart\|tissue:embryonic heart\|cell type:cardiomyocyte\|genotype:wild type\|treatment:72 hpf loc name:missing\|collection date:missing	Wild type zebrafish atrial cardiomyocytes 72 hpf rep 2	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Bolger et al. Trimmomatic: a flexible trimmer for Illumina sequence data. Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 3.0.0 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.4 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Assembly: danRer11 Supplementary files format and content: count matrix	embryonic heart		miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		tissue:embryonic heart\|cell type:cardiomyocyte\|genotype:wild type\|treatment:72 hpf	GSM7927520	GSM7927520: Wild type zebrafish atrial cardiomyocytes 72 hpf rep 2; Danio rerio; RNA Seq	GSM7927520 r1	GSM7927520	1	miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP475323	loader:fastq load.py	dst226_zbrf_clt___ACrdmct-age___72h_b02_t01_m01_R1.fastq.gz	fastq	1740891025.0	28211981.0	GSM7927520 r1	0:61.71	A:419094150;C:347792831;G:345450108;T:407537501;N:221016435	61	419094150	347792831	345450108	407537501	221016435	SRX22707799	SRS19700100	SRA1761360	MPI for heart and lung research	MPI for heart and lung research	1	0.90091	0.13293	0.78464	0.54281	69	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Germany	2023-12-01	Larval	Larval	Heart	Cardiovascular System
29088	29088	SRR27015252	SRX22707798	SRS19700099	SRP475323	PRJNA1047551	Identification of genes important during atrial myocardial morphogenesis	GSE249149	Transcriptome Analysis	Atrial cardiomyocytes undergo complex cellular behaviours post 72 hpf to build muscle structures. We aimed to identify the genes involved during this process and therefore we seqeunced the RNA from 48 hpf and 72 hpf atrial cardiomyocytes to uncover changes in the transcirptome that might regulate or trigger atrial morphogenesis post 72 hpf. Overall design: Comparative gene expression profiling analysis of RNA seq data for 48 hpf and 72 hpf wild type zebrafish atrial cardiomyocytes.		pubmed:39289341	Wild type zebrafish atrial cardiomyocytes 72 hpf rep 1	GSM7927519	source name:embryonic heart\|tissue:embryonic heart\|cell type:cardiomyocyte\|genotype:wild type\|treatment:72 hpf loc name:missing\|collection date:missing	Wild type zebrafish atrial cardiomyocytes 72 hpf rep 1	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Bolger et al. Trimmomatic: a flexible trimmer for Illumina sequence data. Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 3.0.0 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.4 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Assembly: danRer11 Supplementary files format and content: count matrix	embryonic heart		miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		tissue:embryonic heart\|cell type:cardiomyocyte\|genotype:wild type\|treatment:72 hpf	GSM7927519	GSM7927519: Wild type zebrafish atrial cardiomyocytes 72 hpf rep 1; Danio rerio; RNA Seq	GSM7927519 r1	GSM7927519	1	miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP475323	loader:fastq load.py	dst226_zbrf_clt___ACrdmct-age___72h_b01_t01_m01_R1.fastq.gz	fastq	1930552948.0	30996774.0	GSM7927519 r1	0:62.28	A:468769814;C:389869994;G:387622687;T:454801262;N:229489191	62	468769814	389869994	387622687	454801262	229489191	SRX22707798	SRS19700099	SRA1761360	MPI for heart and lung research	MPI for heart and lung research	1	0.90465	0.10656	0.79586	0.55674	72	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Germany	2023-12-01	Larval	Larval	Heart	Cardiovascular System
29089	29089	SRR27015253	SRX22707797	SRS19700098	SRP475323	PRJNA1047551	Identification of genes important during atrial myocardial morphogenesis	GSE249149	Transcriptome Analysis	Atrial cardiomyocytes undergo complex cellular behaviours post 72 hpf to build muscle structures. We aimed to identify the genes involved during this process and therefore we seqeunced the RNA from 48 hpf and 72 hpf atrial cardiomyocytes to uncover changes in the transcirptome that might regulate or trigger atrial morphogenesis post 72 hpf. Overall design: Comparative gene expression profiling analysis of RNA seq data for 48 hpf and 72 hpf wild type zebrafish atrial cardiomyocytes.		pubmed:39289341	Wild type zebrafish atrial cardiomyocytes 48 hpf rep 3	GSM7927518	source name:embryonic heart\|tissue:embryonic heart\|cell type:cardiomyocyte\|genotype:wild type\|treatment:48 hpf loc name:missing\|collection date:missing	Wild type zebrafish atrial cardiomyocytes 48 hpf rep 3	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Bolger et al. Trimmomatic: a flexible trimmer for Illumina sequence data. Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 3.0.0 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.4 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Assembly: danRer11 Supplementary files format and content: count matrix	embryonic heart		miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		tissue:embryonic heart\|cell type:cardiomyocyte\|genotype:wild type\|treatment:48 hpf	GSM7927518	GSM7927518: Wild type zebrafish atrial cardiomyocytes 48 hpf rep 3; Danio rerio; RNA Seq	GSM7927518 r1	GSM7927518	1	miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP475323	loader:fastq load.py	dst226_zbrf_clt___ACrdmct-age___48h_b03_t01_m01_R1.fastq.gz	fastq	2161847345.0	35921817.0	GSM7927518 r1	0:60.18	A:505467877;C:418329045;G:416403136;T:483063599;N:338583688	60	505467877	418329045	416403136	483063599	338583688	SRX22707797	SRS19700098	SRA1761360	MPI for heart and lung research	MPI for heart and lung research	1	0.89532	0.08355	0.82012	0.68413	35	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Germany	2023-12-01	Hatching	Embryo	Heart	Cardiovascular System
29090	29090	SRR27015254	SRX22707796	SRS19700097	SRP475323	PRJNA1047551	Identification of genes important during atrial myocardial morphogenesis	GSE249149	Transcriptome Analysis	Atrial cardiomyocytes undergo complex cellular behaviours post 72 hpf to build muscle structures. We aimed to identify the genes involved during this process and therefore we seqeunced the RNA from 48 hpf and 72 hpf atrial cardiomyocytes to uncover changes in the transcirptome that might regulate or trigger atrial morphogenesis post 72 hpf. Overall design: Comparative gene expression profiling analysis of RNA seq data for 48 hpf and 72 hpf wild type zebrafish atrial cardiomyocytes.		pubmed:39289341	Wild type zebrafish atrial cardiomyocytes 48 hpf rep 2	GSM7927517	source name:embryonic heart\|tissue:embryonic heart\|cell type:cardiomyocyte\|genotype:wild type\|treatment:48 hpf loc name:missing\|collection date:missing	Wild type zebrafish atrial cardiomyocytes 48 hpf rep 2	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Bolger et al. Trimmomatic: a flexible trimmer for Illumina sequence data. Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 3.0.0 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.4 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Assembly: danRer11 Supplementary files format and content: count matrix	embryonic heart		miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		tissue:embryonic heart\|cell type:cardiomyocyte\|genotype:wild type\|treatment:48 hpf	GSM7927517	GSM7927517: Wild type zebrafish atrial cardiomyocytes 48 hpf rep 2; Danio rerio; RNA Seq	GSM7927517 r1	GSM7927517	1	miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP475323	loader:fastq load.py	dst226_zbrf_clt___ACrdmct-age___48h_b02_t01_m01_R1.fastq.gz	fastq	2065547064.0	31863833.0	GSM7927517 r1	0:64.82	A:530497695;C:434164388;G:434118538;T:518043928;N:148722515	64	530497695	434164388	434118538	518043928	148722515	SRX22707796	SRS19700097	SRA1761360	MPI for heart and lung research	MPI for heart and lung research	1	0.91772	0.17863	0.76828	0.49567	72	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Germany	2023-12-01	Hatching	Embryo	Heart	Cardiovascular System
29091	29091	SRR27015255	SRX22707795	SRS19700096	SRP475323	PRJNA1047551	Identification of genes important during atrial myocardial morphogenesis	GSE249149	Transcriptome Analysis	Atrial cardiomyocytes undergo complex cellular behaviours post 72 hpf to build muscle structures. We aimed to identify the genes involved during this process and therefore we seqeunced the RNA from 48 hpf and 72 hpf atrial cardiomyocytes to uncover changes in the transcirptome that might regulate or trigger atrial morphogenesis post 72 hpf. Overall design: Comparative gene expression profiling analysis of RNA seq data for 48 hpf and 72 hpf wild type zebrafish atrial cardiomyocytes.		pubmed:39289341	Wild type zebrafish atrial cardiomyocytes 48 hpf rep 1	GSM7927516	source name:embryonic heart\|tissue:embryonic heart\|cell type:cardiomyocyte\|genotype:wild type\|treatment:48 hpf loc name:missing\|collection date:missing	Wild type zebrafish atrial cardiomyocytes 48 hpf rep 1	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Bolger et al. Trimmomatic: a flexible trimmer for Illumina sequence data. Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 3.0.0 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.4 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Assembly: danRer11 Supplementary files format and content: count matrix	embryonic heart		miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		tissue:embryonic heart\|cell type:cardiomyocyte\|genotype:wild type\|treatment:48 hpf	GSM7927516	GSM7927516: Wild type zebrafish atrial cardiomyocytes 48 hpf rep 1; Danio rerio; RNA Seq	GSM7927516 r1	GSM7927516	1	miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP475323	loader:fastq load.py	dst226_zbrf_clt___ACrdmct-age___48h_b01_t01_m01_R1.fastq.gz	fastq	1619268089.0	24941754.0	GSM7927516 r1	0:64.92	A:410578311;C:344485123;G:343852178;T:401558739;N:118793738	64	410578311	344485123	343852178	401558739	118793738	SRX22707795	SRS19700096	SRA1761360	MPI for heart and lung research	MPI for heart and lung research	1	0.91693	0.13175	0.77082	0.47511	72	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Germany	2023-12-01	Hatching	Embryo	Heart	Cardiovascular System
29145	29145	SRR32025076	SRX27375413	SRS23810876	SRP476805	PRJNA1050594	Early mechanisms of aortic failure in a zebrafish model for thoracic aortic dissection and rupture	GSE249792	Transcriptome Analysis	Thoracic aortic dissection TAD is associated with a high mortality rate. Despite the existence of different mouse models for TAD the underlying disease mechanisms remain elusive. Treatment options are limited and mainly consist of surgical repair at critical diameters as current pharmacological interventions are unable to stop disease progression. In humans loss of function LOF of SMAD3 and SMAD6 impair vascular homeostasis increasing the risk for TAD. We developed a zebrafish model for thoracic aortic dissection/rupture by targeting both ohnologs of smad3 and smad6. We discovered an increased diameter of the ventral aorta in smad3a / ;smad3b / double knockout zebrafish larvae while smad6a / ;smad6b / double knockout zebrafish have a reduced diameter associated with early mortality. Surprisingly the smad3a / ;smad3b / ;smad6a / ;smad6b / quadruple knockout qKO zebrafish model is viable and survives to maturity although exposure to stress leads to sudden death. Histological analysis of the adult ventral aorta showed medial elastolysis and aortic dissections and ruptures at sites exposed to high hemodynamic stress. RNA sequencing of qKO larvae indicated a profile of reduced negative regulation of proteolysis and upregulation of melanogenesis a previously unaddressed pathway in this pathology. We confirmed that pharmacological modulation of tyrosinase has an effect on aortic morphology. Our study shows that dysregulation of SMAD3/6 dependent signaling has an important impact on thoracic aortic homeostasis and that using the qKO zebrafish model thus far the only known model of aortic dissection and rupture in this species can identify novel pathophysiological pathways leading to TAD. Overall design: For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. One experiment was performed using TruSeq. RNA sequencing was performed on five pools each containing five smad3a / ;smad3b / ;smad6a / ;smad6b / quadruple knockout qKO zebrafish or wt control cou…			qKO 5 biol rep 1 adult aorta 3 aortas pooled	GSM8741276	source name:pool of 3 adult aortas and bulbus arteriosus\|tissue:pool of 3 adult aortas and bulbus arteriosus\|genotype:qKO\|geo loc name:missing\|collection date:missing	qKO 5 biol rep 1 adult aorta 3 aortas pooled	Raw read QC: UMI and spacer were removed using UMI tools v1.1.4 resulting in raw reads with a remaining length of 65 nt. Raw sequencing reads were inspected using FastQC v0.12.1 for their quality and length. Putative contaminations were checked using FastQ Screen v0.15.3 and a set of genomes of common lab organisms. Read quality based on phred scores is good. Contamination screening reveals that the reads do not map exclusively to any of the other tested organisms. Limited cross mapping to other organisms is normal and caused by homology between organisms. Adapter and quality trimming: Adaptor trimming was done using cutadapt v4.9 with added filtering of reads containing ambiguities or not passing the phred score threshold of 20. The quality of the remaining read pairs was checked using FastQC Read mapping and feature counting: For each sample trimmed reads were mapped on the zebrafish genome GRCz11 ENSEMBL release 112 using the splice aware STAR v2.7.10a mapper. UMI based deduplication of mapped reads was done with UMI tools v1.1.4. Feature counting at the gene and transcript isoform level was done using rsem calculate expression RSEM v1.3.3. Raw counts for all samples are available as an Excel file. We used the gene level counts for all subsequent analyses. Differential gene expression: Assembly: GRCz11 Supplementary files format and content: Raw counts for all samples are avialable as an Excel file: all samples raw feature counts.xlsx	pool of 3 adult aortas and bulbus arteriosus		For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. For each sample a sequencing library was constructed starting from 16 ng input RNA using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD for Illumina Lexogen and the UMI Second Strand Synthesis Module for QuantSeq FWD Illumina Read 1. This incorporates a unique molecular identifier UMI in the first 6 nucleotides of each read allowing to identify PCR duplicates and eliminate amplification bias. The libraries were sequenced as single read 75 on an Aviti device Element Biosciences.	Embryos were grown at 27°C in E3 medium with methylene blue until 5 dpf dpf. At 1 dpf and 3 dpf medium was refreshed. For adults zebrafish were housed at the zebrafish facility Ghent in semi closed recirculating housing systems ZebTEC and WTU systems Tecniplast at a constant temperature 27 28°C pH 7 5 conductivity 550µS and light dark cycle 14/10. Zebrafish were fed every day with dry food Gemma Micro and with artemia Ocean Nutrition.	tissue:pool of 3 adult aortas and bulbus arteriosus\|genotype:qKO	GSM8741276	GSM8741276: qKO 5 biol rep 1 adult aorta 3 aortas pooled; Danio rerio; RNA Seq	GSM8741276 r1	GSM8741276	1	For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. For each sample a sequencing library was constructed starting from 16 ng input RNA using the QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen and the UMI Second Strand Synthesis Module for QuantSeq FWD Illumina Read 1. This incorporates a unique molecular identifier UMI in the first 6 nucleotides of each read allowing to identify PCR duplicates and eliminate amplification bias. The libraries were sequenced as single read 75 on an Aviti device Element Biosciences.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ELEMENT	Element AVITI	SRP476805		10_qKO_B9_R1.fastq.gz	fastq	1749103950.0	23321386.0	GSM8741276 r1	0:75	A:608737363;C:302455983;G:338119173;T:499492171;N:299260	75	608737363	302455983	338119173	499492171	299260	SRX27375413	SRS23810876	SRA2053000	Callewaert Lab, Biomolecular medicine, Ghent University	Callewaert Lab, Biomolecular medicine, Ghent University							B	usable mapping rate	element	element	3prime	cdna_unspecified	lexogen	bulk	unknown	unknown	Belgium	2025-01-16	Multi-stage	Multi-stage	Heart	Cardiovascular System
29146	29146	SRR32025077	SRX27375412	SRS23810877	SRP476805	PRJNA1050594	Early mechanisms of aortic failure in a zebrafish model for thoracic aortic dissection and rupture	GSE249792	Transcriptome Analysis	Thoracic aortic dissection TAD is associated with a high mortality rate. Despite the existence of different mouse models for TAD the underlying disease mechanisms remain elusive. Treatment options are limited and mainly consist of surgical repair at critical diameters as current pharmacological interventions are unable to stop disease progression. In humans loss of function LOF of SMAD3 and SMAD6 impair vascular homeostasis increasing the risk for TAD. We developed a zebrafish model for thoracic aortic dissection/rupture by targeting both ohnologs of smad3 and smad6. We discovered an increased diameter of the ventral aorta in smad3a / ;smad3b / double knockout zebrafish larvae while smad6a / ;smad6b / double knockout zebrafish have a reduced diameter associated with early mortality. Surprisingly the smad3a / ;smad3b / ;smad6a / ;smad6b / quadruple knockout qKO zebrafish model is viable and survives to maturity although exposure to stress leads to sudden death. Histological analysis of the adult ventral aorta showed medial elastolysis and aortic dissections and ruptures at sites exposed to high hemodynamic stress. RNA sequencing of qKO larvae indicated a profile of reduced negative regulation of proteolysis and upregulation of melanogenesis a previously unaddressed pathway in this pathology. We confirmed that pharmacological modulation of tyrosinase has an effect on aortic morphology. Our study shows that dysregulation of SMAD3/6 dependent signaling has an important impact on thoracic aortic homeostasis and that using the qKO zebrafish model thus far the only known model of aortic dissection and rupture in this species can identify novel pathophysiological pathways leading to TAD. Overall design: For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. One experiment was performed using TruSeq. RNA sequencing was performed on five pools each containing five smad3a / ;smad3b / ;smad6a / ;smad6b / quadruple knockout qKO zebrafish or wt control cou…			qKO 4 biol rep 1 adult aorta 3 aortas pooled	GSM8741275	source name:pool of 3 adult aortas and bulbus arteriosus\|tissue:pool of 3 adult aortas and bulbus arteriosus\|genotype:qKO\|geo loc name:missing\|collection date:missing	qKO 4 biol rep 1 adult aorta 3 aortas pooled	Raw read QC: UMI and spacer were removed using UMI tools v1.1.4 resulting in raw reads with a remaining length of 65 nt. Raw sequencing reads were inspected using FastQC v0.12.1 for their quality and length. Putative contaminations were checked using FastQ Screen v0.15.3 and a set of genomes of common lab organisms. Read quality based on phred scores is good. Contamination screening reveals that the reads do not map exclusively to any of the other tested organisms. Limited cross mapping to other organisms is normal and caused by homology between organisms. Adapter and quality trimming: Adaptor trimming was done using cutadapt v4.9 with added filtering of reads containing ambiguities or not passing the phred score threshold of 20. The quality of the remaining read pairs was checked using FastQC Read mapping and feature counting: For each sample trimmed reads were mapped on the zebrafish genome GRCz11 ENSEMBL release 112 using the splice aware STAR v2.7.10a mapper. UMI based deduplication of mapped reads was done with UMI tools v1.1.4. Feature counting at the gene and transcript isoform level was done using rsem calculate expression RSEM v1.3.3. Raw counts for all samples are available as an Excel file. We used the gene level counts for all subsequent analyses. Differential gene expression: Assembly: GRCz11 Supplementary files format and content: Raw counts for all samples are avialable as an Excel file: all samples raw feature counts.xlsx	pool of 3 adult aortas and bulbus arteriosus		For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. For each sample a sequencing library was constructed starting from 16 ng input RNA using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD for Illumina Lexogen and the UMI Second Strand Synthesis Module for QuantSeq FWD Illumina Read 1. This incorporates a unique molecular identifier UMI in the first 6 nucleotides of each read allowing to identify PCR duplicates and eliminate amplification bias. The libraries were sequenced as single read 75 on an Aviti device Element Biosciences.	Embryos were grown at 27°C in E3 medium with methylene blue until 5 dpf dpf. At 1 dpf and 3 dpf medium was refreshed. For adults zebrafish were housed at the zebrafish facility Ghent in semi closed recirculating housing systems ZebTEC and WTU systems Tecniplast at a constant temperature 27 28°C pH 7 5 conductivity 550µS and light dark cycle 14/10. Zebrafish were fed every day with dry food Gemma Micro and with artemia Ocean Nutrition.	tissue:pool of 3 adult aortas and bulbus arteriosus\|genotype:qKO	GSM8741275	GSM8741275: qKO 4 biol rep 1 adult aorta 3 aortas pooled; Danio rerio; RNA Seq	GSM8741275 r1	GSM8741275	1	For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. For each sample a sequencing library was constructed starting from 16 ng input RNA using the QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen and the UMI Second Strand Synthesis Module for QuantSeq FWD Illumina Read 1. This incorporates a unique molecular identifier UMI in the first 6 nucleotides of each read allowing to identify PCR duplicates and eliminate amplification bias. The libraries were sequenced as single read 75 on an Aviti device Element Biosciences.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ELEMENT	Element AVITI	SRP476805		9_qKO_A9_R1.fastq.gz	fastq	1391151150.0	18548682.0	GSM8741275 r1	0:75	A:493715157;C:235480005;G:265878909;T:395857913;N:219166	75	493715157	235480005	265878909	395857913	219166	SRX27375412	SRS23810877	SRA2053000	Callewaert Lab, Biomolecular medicine, Ghent University	Callewaert Lab, Biomolecular medicine, Ghent University							B	usable mapping rate	element	element	3prime	cdna_unspecified	lexogen	bulk	unknown	unknown	Belgium	2025-01-16	Multi-stage	Multi-stage	Heart	Cardiovascular System
29147	29147	SRR32025078	SRX27375411	SRS23810875	SRP476805	PRJNA1050594	Early mechanisms of aortic failure in a zebrafish model for thoracic aortic dissection and rupture	GSE249792	Transcriptome Analysis	Thoracic aortic dissection TAD is associated with a high mortality rate. Despite the existence of different mouse models for TAD the underlying disease mechanisms remain elusive. Treatment options are limited and mainly consist of surgical repair at critical diameters as current pharmacological interventions are unable to stop disease progression. In humans loss of function LOF of SMAD3 and SMAD6 impair vascular homeostasis increasing the risk for TAD. We developed a zebrafish model for thoracic aortic dissection/rupture by targeting both ohnologs of smad3 and smad6. We discovered an increased diameter of the ventral aorta in smad3a / ;smad3b / double knockout zebrafish larvae while smad6a / ;smad6b / double knockout zebrafish have a reduced diameter associated with early mortality. Surprisingly the smad3a / ;smad3b / ;smad6a / ;smad6b / quadruple knockout qKO zebrafish model is viable and survives to maturity although exposure to stress leads to sudden death. Histological analysis of the adult ventral aorta showed medial elastolysis and aortic dissections and ruptures at sites exposed to high hemodynamic stress. RNA sequencing of qKO larvae indicated a profile of reduced negative regulation of proteolysis and upregulation of melanogenesis a previously unaddressed pathway in this pathology. We confirmed that pharmacological modulation of tyrosinase has an effect on aortic morphology. Our study shows that dysregulation of SMAD3/6 dependent signaling has an important impact on thoracic aortic homeostasis and that using the qKO zebrafish model thus far the only known model of aortic dissection and rupture in this species can identify novel pathophysiological pathways leading to TAD. Overall design: For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. One experiment was performed using TruSeq. RNA sequencing was performed on five pools each containing five smad3a / ;smad3b / ;smad6a / ;smad6b / quadruple knockout qKO zebrafish or wt control cou…			qKO 3 biol rep 1 adult aorta 3 aortas pooled	GSM8741274	source name:pool of 3 adult aortas and bulbus arteriosus\|tissue:pool of 3 adult aortas and bulbus arteriosus\|genotype:qKO\|geo loc name:missing\|collection date:missing	qKO 3 biol rep 1 adult aorta 3 aortas pooled	Raw read QC: UMI and spacer were removed using UMI tools v1.1.4 resulting in raw reads with a remaining length of 65 nt. Raw sequencing reads were inspected using FastQC v0.12.1 for their quality and length. Putative contaminations were checked using FastQ Screen v0.15.3 and a set of genomes of common lab organisms. Read quality based on phred scores is good. Contamination screening reveals that the reads do not map exclusively to any of the other tested organisms. Limited cross mapping to other organisms is normal and caused by homology between organisms. Adapter and quality trimming: Adaptor trimming was done using cutadapt v4.9 with added filtering of reads containing ambiguities or not passing the phred score threshold of 20. The quality of the remaining read pairs was checked using FastQC Read mapping and feature counting: For each sample trimmed reads were mapped on the zebrafish genome GRCz11 ENSEMBL release 112 using the splice aware STAR v2.7.10a mapper. UMI based deduplication of mapped reads was done with UMI tools v1.1.4. Feature counting at the gene and transcript isoform level was done using rsem calculate expression RSEM v1.3.3. Raw counts for all samples are available as an Excel file. We used the gene level counts for all subsequent analyses. Differential gene expression: Assembly: GRCz11 Supplementary files format and content: Raw counts for all samples are avialable as an Excel file: all samples raw feature counts.xlsx	pool of 3 adult aortas and bulbus arteriosus		For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. For each sample a sequencing library was constructed starting from 16 ng input RNA using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD for Illumina Lexogen and the UMI Second Strand Synthesis Module for QuantSeq FWD Illumina Read 1. This incorporates a unique molecular identifier UMI in the first 6 nucleotides of each read allowing to identify PCR duplicates and eliminate amplification bias. The libraries were sequenced as single read 75 on an Aviti device Element Biosciences.	Embryos were grown at 27°C in E3 medium with methylene blue until 5 dpf dpf. At 1 dpf and 3 dpf medium was refreshed. For adults zebrafish were housed at the zebrafish facility Ghent in semi closed recirculating housing systems ZebTEC and WTU systems Tecniplast at a constant temperature 27 28°C pH 7 5 conductivity 550µS and light dark cycle 14/10. Zebrafish were fed every day with dry food Gemma Micro and with artemia Ocean Nutrition.	tissue:pool of 3 adult aortas and bulbus arteriosus\|genotype:qKO	GSM8741274	GSM8741274: qKO 3 biol rep 1 adult aorta 3 aortas pooled; Danio rerio; RNA Seq	GSM8741274 r1	GSM8741274	1	For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. For each sample a sequencing library was constructed starting from 16 ng input RNA using the QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen and the UMI Second Strand Synthesis Module for QuantSeq FWD Illumina Read 1. This incorporates a unique molecular identifier UMI in the first 6 nucleotides of each read allowing to identify PCR duplicates and eliminate amplification bias. The libraries were sequenced as single read 75 on an Aviti device Element Biosciences.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ELEMENT	Element AVITI	SRP476805		8_qKO_H8_R1.fastq.gz	fastq	1548693000.0	20649240.0	GSM8741274 r1	0:75	A:546086416;C:265907989;G:302995102;T:433434795;N:268698	75	546086416	265907989	302995102	433434795	268698	SRX27375411	SRS23810875	SRA2053000	Callewaert Lab, Biomolecular medicine, Ghent University	Callewaert Lab, Biomolecular medicine, Ghent University							B	usable mapping rate	element	element	3prime	cdna_unspecified	lexogen	bulk	unknown	unknown	Belgium	2025-01-16	Multi-stage	Multi-stage	Heart	Cardiovascular System
29148	29148	SRR32025079	SRX27375410	SRS23810873	SRP476805	PRJNA1050594	Early mechanisms of aortic failure in a zebrafish model for thoracic aortic dissection and rupture	GSE249792	Transcriptome Analysis	Thoracic aortic dissection TAD is associated with a high mortality rate. Despite the existence of different mouse models for TAD the underlying disease mechanisms remain elusive. Treatment options are limited and mainly consist of surgical repair at critical diameters as current pharmacological interventions are unable to stop disease progression. In humans loss of function LOF of SMAD3 and SMAD6 impair vascular homeostasis increasing the risk for TAD. We developed a zebrafish model for thoracic aortic dissection/rupture by targeting both ohnologs of smad3 and smad6. We discovered an increased diameter of the ventral aorta in smad3a / ;smad3b / double knockout zebrafish larvae while smad6a / ;smad6b / double knockout zebrafish have a reduced diameter associated with early mortality. Surprisingly the smad3a / ;smad3b / ;smad6a / ;smad6b / quadruple knockout qKO zebrafish model is viable and survives to maturity although exposure to stress leads to sudden death. Histological analysis of the adult ventral aorta showed medial elastolysis and aortic dissections and ruptures at sites exposed to high hemodynamic stress. RNA sequencing of qKO larvae indicated a profile of reduced negative regulation of proteolysis and upregulation of melanogenesis a previously unaddressed pathway in this pathology. We confirmed that pharmacological modulation of tyrosinase has an effect on aortic morphology. Our study shows that dysregulation of SMAD3/6 dependent signaling has an important impact on thoracic aortic homeostasis and that using the qKO zebrafish model thus far the only known model of aortic dissection and rupture in this species can identify novel pathophysiological pathways leading to TAD. Overall design: For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. One experiment was performed using TruSeq. RNA sequencing was performed on five pools each containing five smad3a / ;smad3b / ;smad6a / ;smad6b / quadruple knockout qKO zebrafish or wt control cou…			qKO 2 biol rep 1 adult aorta 3 aortas pooled	GSM8741273	source name:pool of 3 adult aortas and bulbus arteriosus\|tissue:pool of 3 adult aortas and bulbus arteriosus\|genotype:qKO\|geo loc name:missing\|collection date:missing	qKO 2 biol rep 1 adult aorta 3 aortas pooled	Raw read QC: UMI and spacer were removed using UMI tools v1.1.4 resulting in raw reads with a remaining length of 65 nt. Raw sequencing reads were inspected using FastQC v0.12.1 for their quality and length. Putative contaminations were checked using FastQ Screen v0.15.3 and a set of genomes of common lab organisms. Read quality based on phred scores is good. Contamination screening reveals that the reads do not map exclusively to any of the other tested organisms. Limited cross mapping to other organisms is normal and caused by homology between organisms. Adapter and quality trimming: Adaptor trimming was done using cutadapt v4.9 with added filtering of reads containing ambiguities or not passing the phred score threshold of 20. The quality of the remaining read pairs was checked using FastQC Read mapping and feature counting: For each sample trimmed reads were mapped on the zebrafish genome GRCz11 ENSEMBL release 112 using the splice aware STAR v2.7.10a mapper. UMI based deduplication of mapped reads was done with UMI tools v1.1.4. Feature counting at the gene and transcript isoform level was done using rsem calculate expression RSEM v1.3.3. Raw counts for all samples are available as an Excel file. We used the gene level counts for all subsequent analyses. Differential gene expression: Assembly: GRCz11 Supplementary files format and content: Raw counts for all samples are avialable as an Excel file: all samples raw feature counts.xlsx	pool of 3 adult aortas and bulbus arteriosus		For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. For each sample a sequencing library was constructed starting from 16 ng input RNA using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD for Illumina Lexogen and the UMI Second Strand Synthesis Module for QuantSeq FWD Illumina Read 1. This incorporates a unique molecular identifier UMI in the first 6 nucleotides of each read allowing to identify PCR duplicates and eliminate amplification bias. The libraries were sequenced as single read 75 on an Aviti device Element Biosciences.	Embryos were grown at 27°C in E3 medium with methylene blue until 5 dpf dpf. At 1 dpf and 3 dpf medium was refreshed. For adults zebrafish were housed at the zebrafish facility Ghent in semi closed recirculating housing systems ZebTEC and WTU systems Tecniplast at a constant temperature 27 28°C pH 7 5 conductivity 550µS and light dark cycle 14/10. Zebrafish were fed every day with dry food Gemma Micro and with artemia Ocean Nutrition.	tissue:pool of 3 adult aortas and bulbus arteriosus\|genotype:qKO	GSM8741273	GSM8741273: qKO 2 biol rep 1 adult aorta 3 aortas pooled; Danio rerio; RNA Seq	GSM8741273 r1	GSM8741273	1	For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. For each sample a sequencing library was constructed starting from 16 ng input RNA using the QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen and the UMI Second Strand Synthesis Module for QuantSeq FWD Illumina Read 1. This incorporates a unique molecular identifier UMI in the first 6 nucleotides of each read allowing to identify PCR duplicates and eliminate amplification bias. The libraries were sequenced as single read 75 on an Aviti device Element Biosciences.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ELEMENT	Element AVITI	SRP476805		7_qKO_G8_R1.fastq.gz	fastq	1420837575.0	18944501.0	GSM8741273 r1	0:75	A:505066296;C:237130175;G:277345211;T:401058536;N:237357	75	505066296	237130175	277345211	401058536	237357	SRX27375410	SRS23810873	SRA2053000	Callewaert Lab, Biomolecular medicine, Ghent University	Callewaert Lab, Biomolecular medicine, Ghent University							B	usable mapping rate	element	element	3prime	cdna_unspecified	lexogen	bulk	unknown	unknown	Belgium	2025-01-16	Multi-stage	Multi-stage	Heart	Cardiovascular System
29149	29149	SRR32025080	SRX27375409	SRS23810874	SRP476805	PRJNA1050594	Early mechanisms of aortic failure in a zebrafish model for thoracic aortic dissection and rupture	GSE249792	Transcriptome Analysis	Thoracic aortic dissection TAD is associated with a high mortality rate. Despite the existence of different mouse models for TAD the underlying disease mechanisms remain elusive. Treatment options are limited and mainly consist of surgical repair at critical diameters as current pharmacological interventions are unable to stop disease progression. In humans loss of function LOF of SMAD3 and SMAD6 impair vascular homeostasis increasing the risk for TAD. We developed a zebrafish model for thoracic aortic dissection/rupture by targeting both ohnologs of smad3 and smad6. We discovered an increased diameter of the ventral aorta in smad3a / ;smad3b / double knockout zebrafish larvae while smad6a / ;smad6b / double knockout zebrafish have a reduced diameter associated with early mortality. Surprisingly the smad3a / ;smad3b / ;smad6a / ;smad6b / quadruple knockout qKO zebrafish model is viable and survives to maturity although exposure to stress leads to sudden death. Histological analysis of the adult ventral aorta showed medial elastolysis and aortic dissections and ruptures at sites exposed to high hemodynamic stress. RNA sequencing of qKO larvae indicated a profile of reduced negative regulation of proteolysis and upregulation of melanogenesis a previously unaddressed pathway in this pathology. We confirmed that pharmacological modulation of tyrosinase has an effect on aortic morphology. Our study shows that dysregulation of SMAD3/6 dependent signaling has an important impact on thoracic aortic homeostasis and that using the qKO zebrafish model thus far the only known model of aortic dissection and rupture in this species can identify novel pathophysiological pathways leading to TAD. Overall design: For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. One experiment was performed using TruSeq. RNA sequencing was performed on five pools each containing five smad3a / ;smad3b / ;smad6a / ;smad6b / quadruple knockout qKO zebrafish or wt control cou…			qKO 1 biol rep 1 adult aorta 3 aortas pooled	GSM8741272	source name:pool of 3 adult aortas and bulbus arteriosus\|tissue:pool of 3 adult aortas and bulbus arteriosus\|genotype:qKO\|geo loc name:missing\|collection date:missing	qKO 1 biol rep 1 adult aorta 3 aortas pooled	Raw read QC: UMI and spacer were removed using UMI tools v1.1.4 resulting in raw reads with a remaining length of 65 nt. Raw sequencing reads were inspected using FastQC v0.12.1 for their quality and length. Putative contaminations were checked using FastQ Screen v0.15.3 and a set of genomes of common lab organisms. Read quality based on phred scores is good. Contamination screening reveals that the reads do not map exclusively to any of the other tested organisms. Limited cross mapping to other organisms is normal and caused by homology between organisms. Adapter and quality trimming: Adaptor trimming was done using cutadapt v4.9 with added filtering of reads containing ambiguities or not passing the phred score threshold of 20. The quality of the remaining read pairs was checked using FastQC Read mapping and feature counting: For each sample trimmed reads were mapped on the zebrafish genome GRCz11 ENSEMBL release 112 using the splice aware STAR v2.7.10a mapper. UMI based deduplication of mapped reads was done with UMI tools v1.1.4. Feature counting at the gene and transcript isoform level was done using rsem calculate expression RSEM v1.3.3. Raw counts for all samples are available as an Excel file. We used the gene level counts for all subsequent analyses. Differential gene expression: Assembly: GRCz11 Supplementary files format and content: Raw counts for all samples are avialable as an Excel file: all samples raw feature counts.xlsx	pool of 3 adult aortas and bulbus arteriosus		For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. For each sample a sequencing library was constructed starting from 16 ng input RNA using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD for Illumina Lexogen and the UMI Second Strand Synthesis Module for QuantSeq FWD Illumina Read 1. This incorporates a unique molecular identifier UMI in the first 6 nucleotides of each read allowing to identify PCR duplicates and eliminate amplification bias. The libraries were sequenced as single read 75 on an Aviti device Element Biosciences.	Embryos were grown at 27°C in E3 medium with methylene blue until 5 dpf dpf. At 1 dpf and 3 dpf medium was refreshed. For adults zebrafish were housed at the zebrafish facility Ghent in semi closed recirculating housing systems ZebTEC and WTU systems Tecniplast at a constant temperature 27 28°C pH 7 5 conductivity 550µS and light dark cycle 14/10. Zebrafish were fed every day with dry food Gemma Micro and with artemia Ocean Nutrition.	tissue:pool of 3 adult aortas and bulbus arteriosus\|genotype:qKO	GSM8741272	GSM8741272: qKO 1 biol rep 1 adult aorta 3 aortas pooled; Danio rerio; RNA Seq	GSM8741272 r1	GSM8741272	1	For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. For each sample a sequencing library was constructed starting from 16 ng input RNA using the QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen and the UMI Second Strand Synthesis Module for QuantSeq FWD Illumina Read 1. This incorporates a unique molecular identifier UMI in the first 6 nucleotides of each read allowing to identify PCR duplicates and eliminate amplification bias. The libraries were sequenced as single read 75 on an Aviti device Element Biosciences.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ELEMENT	Element AVITI	SRP476805		6_qKO_F8_R1.fastq.gz	fastq	1486031025.0	19813747.0	GSM8741272 r1	0:75	A:520876345;C:250796628;G:293184034;T:420907913;N:266105	75	520876345	250796628	293184034	420907913	266105	SRX27375409	SRS23810874	SRA2053000	Callewaert Lab, Biomolecular medicine, Ghent University	Callewaert Lab, Biomolecular medicine, Ghent University							B	usable mapping rate	element	element	3prime	cdna_unspecified	lexogen	bulk	unknown	unknown	Belgium	2025-01-16	Multi-stage	Multi-stage	Heart	Cardiovascular System
29150	29150	SRR32025081	SRX27375408	SRS23810872	SRP476805	PRJNA1050594	Early mechanisms of aortic failure in a zebrafish model for thoracic aortic dissection and rupture	GSE249792	Transcriptome Analysis	Thoracic aortic dissection TAD is associated with a high mortality rate. Despite the existence of different mouse models for TAD the underlying disease mechanisms remain elusive. Treatment options are limited and mainly consist of surgical repair at critical diameters as current pharmacological interventions are unable to stop disease progression. In humans loss of function LOF of SMAD3 and SMAD6 impair vascular homeostasis increasing the risk for TAD. We developed a zebrafish model for thoracic aortic dissection/rupture by targeting both ohnologs of smad3 and smad6. We discovered an increased diameter of the ventral aorta in smad3a / ;smad3b / double knockout zebrafish larvae while smad6a / ;smad6b / double knockout zebrafish have a reduced diameter associated with early mortality. Surprisingly the smad3a / ;smad3b / ;smad6a / ;smad6b / quadruple knockout qKO zebrafish model is viable and survives to maturity although exposure to stress leads to sudden death. Histological analysis of the adult ventral aorta showed medial elastolysis and aortic dissections and ruptures at sites exposed to high hemodynamic stress. RNA sequencing of qKO larvae indicated a profile of reduced negative regulation of proteolysis and upregulation of melanogenesis a previously unaddressed pathway in this pathology. We confirmed that pharmacological modulation of tyrosinase has an effect on aortic morphology. Our study shows that dysregulation of SMAD3/6 dependent signaling has an important impact on thoracic aortic homeostasis and that using the qKO zebrafish model thus far the only known model of aortic dissection and rupture in this species can identify novel pathophysiological pathways leading to TAD. Overall design: For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. One experiment was performed using TruSeq. RNA sequencing was performed on five pools each containing five smad3a / ;smad3b / ;smad6a / ;smad6b / quadruple knockout qKO zebrafish or wt control cou…			control 5 biol rep 1 adult aorta 3 aortas pooled	GSM8741271	source name:pool of 3 adult aortas and bulbus arteriosus\|tissue:pool of 3 adult aortas and bulbus arteriosus\|genotype:wt control\|geo loc name:missing\|collection date:missing	control 5 biol rep 1 adult aorta 3 aortas pooled	Raw read QC: UMI and spacer were removed using UMI tools v1.1.4 resulting in raw reads with a remaining length of 65 nt. Raw sequencing reads were inspected using FastQC v0.12.1 for their quality and length. Putative contaminations were checked using FastQ Screen v0.15.3 and a set of genomes of common lab organisms. Read quality based on phred scores is good. Contamination screening reveals that the reads do not map exclusively to any of the other tested organisms. Limited cross mapping to other organisms is normal and caused by homology between organisms. Adapter and quality trimming: Adaptor trimming was done using cutadapt v4.9 with added filtering of reads containing ambiguities or not passing the phred score threshold of 20. The quality of the remaining read pairs was checked using FastQC Read mapping and feature counting: For each sample trimmed reads were mapped on the zebrafish genome GRCz11 ENSEMBL release 112 using the splice aware STAR v2.7.10a mapper. UMI based deduplication of mapped reads was done with UMI tools v1.1.4. Feature counting at the gene and transcript isoform level was done using rsem calculate expression RSEM v1.3.3. Raw counts for all samples are available as an Excel file. We used the gene level counts for all subsequent analyses. Differential gene expression: Assembly: GRCz11 Supplementary files format and content: Raw counts for all samples are avialable as an Excel file: all samples raw feature counts.xlsx	pool of 3 adult aortas and bulbus arteriosus		For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. For each sample a sequencing library was constructed starting from 16 ng input RNA using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD for Illumina Lexogen and the UMI Second Strand Synthesis Module for QuantSeq FWD Illumina Read 1. This incorporates a unique molecular identifier UMI in the first 6 nucleotides of each read allowing to identify PCR duplicates and eliminate amplification bias. The libraries were sequenced as single read 75 on an Aviti device Element Biosciences.	Embryos were grown at 27°C in E3 medium with methylene blue until 5 dpf dpf. At 1 dpf and 3 dpf medium was refreshed. For adults zebrafish were housed at the zebrafish facility Ghent in semi closed recirculating housing systems ZebTEC and WTU systems Tecniplast at a constant temperature 27 28°C pH 7 5 conductivity 550µS and light dark cycle 14/10. Zebrafish were fed every day with dry food Gemma Micro and with artemia Ocean Nutrition.	tissue:pool of 3 adult aortas and bulbus arteriosus\|genotype:wt control	GSM8741271	GSM8741271: control 5 biol rep 1 adult aorta 3 aortas pooled; Danio rerio; RNA Seq	GSM8741271 r1	GSM8741271	1	For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. For each sample a sequencing library was constructed starting from 16 ng input RNA using the QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen and the UMI Second Strand Synthesis Module for QuantSeq FWD Illumina Read 1. This incorporates a unique molecular identifier UMI in the first 6 nucleotides of each read allowing to identify PCR duplicates and eliminate amplification bias. The libraries were sequenced as single read 75 on an Aviti device Element Biosciences.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ELEMENT	Element AVITI	SRP476805		5_wt_control_E8_R1.fastq.gz	fastq	1415975175.0	18879669.0	GSM8741271 r1	0:75	A:499498659;C:237283969;G:278581269;T:400389063;N:222215	75	499498659	237283969	278581269	400389063	222215	SRX27375408	SRS23810872	SRA2053000	Callewaert Lab, Biomolecular medicine, Ghent University	Callewaert Lab, Biomolecular medicine, Ghent University							B	usable mapping rate	element	element	3prime	cdna_unspecified	lexogen	bulk	unknown	unknown	Belgium	2025-01-16	Multi-stage	Multi-stage	Heart	Cardiovascular System
29151	29151	SRR32025082	SRX27375407	SRS23810871	SRP476805	PRJNA1050594	Early mechanisms of aortic failure in a zebrafish model for thoracic aortic dissection and rupture	GSE249792	Transcriptome Analysis	Thoracic aortic dissection TAD is associated with a high mortality rate. Despite the existence of different mouse models for TAD the underlying disease mechanisms remain elusive. Treatment options are limited and mainly consist of surgical repair at critical diameters as current pharmacological interventions are unable to stop disease progression. In humans loss of function LOF of SMAD3 and SMAD6 impair vascular homeostasis increasing the risk for TAD. We developed a zebrafish model for thoracic aortic dissection/rupture by targeting both ohnologs of smad3 and smad6. We discovered an increased diameter of the ventral aorta in smad3a / ;smad3b / double knockout zebrafish larvae while smad6a / ;smad6b / double knockout zebrafish have a reduced diameter associated with early mortality. Surprisingly the smad3a / ;smad3b / ;smad6a / ;smad6b / quadruple knockout qKO zebrafish model is viable and survives to maturity although exposure to stress leads to sudden death. Histological analysis of the adult ventral aorta showed medial elastolysis and aortic dissections and ruptures at sites exposed to high hemodynamic stress. RNA sequencing of qKO larvae indicated a profile of reduced negative regulation of proteolysis and upregulation of melanogenesis a previously unaddressed pathway in this pathology. We confirmed that pharmacological modulation of tyrosinase has an effect on aortic morphology. Our study shows that dysregulation of SMAD3/6 dependent signaling has an important impact on thoracic aortic homeostasis and that using the qKO zebrafish model thus far the only known model of aortic dissection and rupture in this species can identify novel pathophysiological pathways leading to TAD. Overall design: For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. One experiment was performed using TruSeq. RNA sequencing was performed on five pools each containing five smad3a / ;smad3b / ;smad6a / ;smad6b / quadruple knockout qKO zebrafish or wt control cou…			control 4 biol rep 1 adult aorta 3 aortas pooled	GSM8741270	source name:pool of 3 adult aortas and bulbus arteriosus\|tissue:pool of 3 adult aortas and bulbus arteriosus\|genotype:wt control\|geo loc name:missing\|collection date:missing	control 4 biol rep 1 adult aorta 3 aortas pooled	Raw read QC: UMI and spacer were removed using UMI tools v1.1.4 resulting in raw reads with a remaining length of 65 nt. Raw sequencing reads were inspected using FastQC v0.12.1 for their quality and length. Putative contaminations were checked using FastQ Screen v0.15.3 and a set of genomes of common lab organisms. Read quality based on phred scores is good. Contamination screening reveals that the reads do not map exclusively to any of the other tested organisms. Limited cross mapping to other organisms is normal and caused by homology between organisms. Adapter and quality trimming: Adaptor trimming was done using cutadapt v4.9 with added filtering of reads containing ambiguities or not passing the phred score threshold of 20. The quality of the remaining read pairs was checked using FastQC Read mapping and feature counting: For each sample trimmed reads were mapped on the zebrafish genome GRCz11 ENSEMBL release 112 using the splice aware STAR v2.7.10a mapper. UMI based deduplication of mapped reads was done with UMI tools v1.1.4. Feature counting at the gene and transcript isoform level was done using rsem calculate expression RSEM v1.3.3. Raw counts for all samples are available as an Excel file. We used the gene level counts for all subsequent analyses. Differential gene expression: Assembly: GRCz11 Supplementary files format and content: Raw counts for all samples are avialable as an Excel file: all samples raw feature counts.xlsx	pool of 3 adult aortas and bulbus arteriosus		For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. For each sample a sequencing library was constructed starting from 16 ng input RNA using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD for Illumina Lexogen and the UMI Second Strand Synthesis Module for QuantSeq FWD Illumina Read 1. This incorporates a unique molecular identifier UMI in the first 6 nucleotides of each read allowing to identify PCR duplicates and eliminate amplification bias. The libraries were sequenced as single read 75 on an Aviti device Element Biosciences.	Embryos were grown at 27°C in E3 medium with methylene blue until 5 dpf dpf. At 1 dpf and 3 dpf medium was refreshed. For adults zebrafish were housed at the zebrafish facility Ghent in semi closed recirculating housing systems ZebTEC and WTU systems Tecniplast at a constant temperature 27 28°C pH 7 5 conductivity 550µS and light dark cycle 14/10. Zebrafish were fed every day with dry food Gemma Micro and with artemia Ocean Nutrition.	tissue:pool of 3 adult aortas and bulbus arteriosus\|genotype:wt control	GSM8741270	GSM8741270: control 4 biol rep 1 adult aorta 3 aortas pooled; Danio rerio; RNA Seq	GSM8741270 r1	GSM8741270	1	For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. For each sample a sequencing library was constructed starting from 16 ng input RNA using the QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen and the UMI Second Strand Synthesis Module for QuantSeq FWD Illumina Read 1. This incorporates a unique molecular identifier UMI in the first 6 nucleotides of each read allowing to identify PCR duplicates and eliminate amplification bias. The libraries were sequenced as single read 75 on an Aviti device Element Biosciences.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ELEMENT	Element AVITI	SRP476805		4_wt_control_D8_R1.fastq.gz	fastq	1448565375.0	19314205.0	GSM8741270 r1	0:75	A:515361139;C:240035739;G:286658162;T:406262131;N:248204	75	515361139	240035739	286658162	406262131	248204	SRX27375407	SRS23810871	SRA2053000	Callewaert Lab, Biomolecular medicine, Ghent University	Callewaert Lab, Biomolecular medicine, Ghent University							B	usable mapping rate	element	element	3prime	cdna_unspecified	lexogen	bulk	unknown	unknown	Belgium	2025-01-16	Multi-stage	Multi-stage	Heart	Cardiovascular System
29152	29152	SRR32025083	SRX27375406	SRS23810870	SRP476805	PRJNA1050594	Early mechanisms of aortic failure in a zebrafish model for thoracic aortic dissection and rupture	GSE249792	Transcriptome Analysis	Thoracic aortic dissection TAD is associated with a high mortality rate. Despite the existence of different mouse models for TAD the underlying disease mechanisms remain elusive. Treatment options are limited and mainly consist of surgical repair at critical diameters as current pharmacological interventions are unable to stop disease progression. In humans loss of function LOF of SMAD3 and SMAD6 impair vascular homeostasis increasing the risk for TAD. We developed a zebrafish model for thoracic aortic dissection/rupture by targeting both ohnologs of smad3 and smad6. We discovered an increased diameter of the ventral aorta in smad3a / ;smad3b / double knockout zebrafish larvae while smad6a / ;smad6b / double knockout zebrafish have a reduced diameter associated with early mortality. Surprisingly the smad3a / ;smad3b / ;smad6a / ;smad6b / quadruple knockout qKO zebrafish model is viable and survives to maturity although exposure to stress leads to sudden death. Histological analysis of the adult ventral aorta showed medial elastolysis and aortic dissections and ruptures at sites exposed to high hemodynamic stress. RNA sequencing of qKO larvae indicated a profile of reduced negative regulation of proteolysis and upregulation of melanogenesis a previously unaddressed pathway in this pathology. We confirmed that pharmacological modulation of tyrosinase has an effect on aortic morphology. Our study shows that dysregulation of SMAD3/6 dependent signaling has an important impact on thoracic aortic homeostasis and that using the qKO zebrafish model thus far the only known model of aortic dissection and rupture in this species can identify novel pathophysiological pathways leading to TAD. Overall design: For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. One experiment was performed using TruSeq. RNA sequencing was performed on five pools each containing five smad3a / ;smad3b / ;smad6a / ;smad6b / quadruple knockout qKO zebrafish or wt control cou…			control 3 biol rep 1 adult aorta 3 aortas pooled	GSM8741269	source name:pool of 3 adult aortas and bulbus arteriosus\|tissue:pool of 3 adult aortas and bulbus arteriosus\|genotype:wt control\|geo loc name:missing\|collection date:missing	control 3 biol rep 1 adult aorta 3 aortas pooled	Raw read QC: UMI and spacer were removed using UMI tools v1.1.4 resulting in raw reads with a remaining length of 65 nt. Raw sequencing reads were inspected using FastQC v0.12.1 for their quality and length. Putative contaminations were checked using FastQ Screen v0.15.3 and a set of genomes of common lab organisms. Read quality based on phred scores is good. Contamination screening reveals that the reads do not map exclusively to any of the other tested organisms. Limited cross mapping to other organisms is normal and caused by homology between organisms. Adapter and quality trimming: Adaptor trimming was done using cutadapt v4.9 with added filtering of reads containing ambiguities or not passing the phred score threshold of 20. The quality of the remaining read pairs was checked using FastQC Read mapping and feature counting: For each sample trimmed reads were mapped on the zebrafish genome GRCz11 ENSEMBL release 112 using the splice aware STAR v2.7.10a mapper. UMI based deduplication of mapped reads was done with UMI tools v1.1.4. Feature counting at the gene and transcript isoform level was done using rsem calculate expression RSEM v1.3.3. Raw counts for all samples are available as an Excel file. We used the gene level counts for all subsequent analyses. Differential gene expression: Assembly: GRCz11 Supplementary files format and content: Raw counts for all samples are avialable as an Excel file: all samples raw feature counts.xlsx	pool of 3 adult aortas and bulbus arteriosus		For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. For each sample a sequencing library was constructed starting from 16 ng input RNA using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD for Illumina Lexogen and the UMI Second Strand Synthesis Module for QuantSeq FWD Illumina Read 1. This incorporates a unique molecular identifier UMI in the first 6 nucleotides of each read allowing to identify PCR duplicates and eliminate amplification bias. The libraries were sequenced as single read 75 on an Aviti device Element Biosciences.	Embryos were grown at 27°C in E3 medium with methylene blue until 5 dpf dpf. At 1 dpf and 3 dpf medium was refreshed. For adults zebrafish were housed at the zebrafish facility Ghent in semi closed recirculating housing systems ZebTEC and WTU systems Tecniplast at a constant temperature 27 28°C pH 7 5 conductivity 550µS and light dark cycle 14/10. Zebrafish were fed every day with dry food Gemma Micro and with artemia Ocean Nutrition.	tissue:pool of 3 adult aortas and bulbus arteriosus\|genotype:wt control	GSM8741269	GSM8741269: control 3 biol rep 1 adult aorta 3 aortas pooled; Danio rerio; RNA Seq	GSM8741269 r1	GSM8741269	1	For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. For each sample a sequencing library was constructed starting from 16 ng input RNA using the QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen and the UMI Second Strand Synthesis Module for QuantSeq FWD Illumina Read 1. This incorporates a unique molecular identifier UMI in the first 6 nucleotides of each read allowing to identify PCR duplicates and eliminate amplification bias. The libraries were sequenced as single read 75 on an Aviti device Element Biosciences.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ELEMENT	Element AVITI	SRP476805		3_wt_control_C8_R1.fastq.gz	fastq	1171513275.0	15620177.0	GSM8741269 r1	0:75	A:417371801;C:198042286;G:227929434;T:328006138;N:163616	75	417371801	198042286	227929434	328006138	163616	SRX27375406	SRS23810870	SRA2053000	Callewaert Lab, Biomolecular medicine, Ghent University	Callewaert Lab, Biomolecular medicine, Ghent University							B	usable mapping rate	element	element	3prime	cdna_unspecified	lexogen	bulk	unknown	unknown	Belgium	2025-01-16	Multi-stage	Multi-stage	Heart	Cardiovascular System
29153	29153	SRR32025084	SRX27375405	SRS23810869	SRP476805	PRJNA1050594	Early mechanisms of aortic failure in a zebrafish model for thoracic aortic dissection and rupture	GSE249792	Transcriptome Analysis	Thoracic aortic dissection TAD is associated with a high mortality rate. Despite the existence of different mouse models for TAD the underlying disease mechanisms remain elusive. Treatment options are limited and mainly consist of surgical repair at critical diameters as current pharmacological interventions are unable to stop disease progression. In humans loss of function LOF of SMAD3 and SMAD6 impair vascular homeostasis increasing the risk for TAD. We developed a zebrafish model for thoracic aortic dissection/rupture by targeting both ohnologs of smad3 and smad6. We discovered an increased diameter of the ventral aorta in smad3a / ;smad3b / double knockout zebrafish larvae while smad6a / ;smad6b / double knockout zebrafish have a reduced diameter associated with early mortality. Surprisingly the smad3a / ;smad3b / ;smad6a / ;smad6b / quadruple knockout qKO zebrafish model is viable and survives to maturity although exposure to stress leads to sudden death. Histological analysis of the adult ventral aorta showed medial elastolysis and aortic dissections and ruptures at sites exposed to high hemodynamic stress. RNA sequencing of qKO larvae indicated a profile of reduced negative regulation of proteolysis and upregulation of melanogenesis a previously unaddressed pathway in this pathology. We confirmed that pharmacological modulation of tyrosinase has an effect on aortic morphology. Our study shows that dysregulation of SMAD3/6 dependent signaling has an important impact on thoracic aortic homeostasis and that using the qKO zebrafish model thus far the only known model of aortic dissection and rupture in this species can identify novel pathophysiological pathways leading to TAD. Overall design: For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. One experiment was performed using TruSeq. RNA sequencing was performed on five pools each containing five smad3a / ;smad3b / ;smad6a / ;smad6b / quadruple knockout qKO zebrafish or wt control cou…			control 2 biol rep 1 adult aorta 3 aortas pooled	GSM8741268	source name:pool of 3 adult aortas and bulbus arteriosus\|tissue:pool of 3 adult aortas and bulbus arteriosus\|genotype:wt control\|geo loc name:missing\|collection date:missing	control 2 biol rep 1 adult aorta 3 aortas pooled	Raw read QC: UMI and spacer were removed using UMI tools v1.1.4 resulting in raw reads with a remaining length of 65 nt. Raw sequencing reads were inspected using FastQC v0.12.1 for their quality and length. Putative contaminations were checked using FastQ Screen v0.15.3 and a set of genomes of common lab organisms. Read quality based on phred scores is good. Contamination screening reveals that the reads do not map exclusively to any of the other tested organisms. Limited cross mapping to other organisms is normal and caused by homology between organisms. Adapter and quality trimming: Adaptor trimming was done using cutadapt v4.9 with added filtering of reads containing ambiguities or not passing the phred score threshold of 20. The quality of the remaining read pairs was checked using FastQC Read mapping and feature counting: For each sample trimmed reads were mapped on the zebrafish genome GRCz11 ENSEMBL release 112 using the splice aware STAR v2.7.10a mapper. UMI based deduplication of mapped reads was done with UMI tools v1.1.4. Feature counting at the gene and transcript isoform level was done using rsem calculate expression RSEM v1.3.3. Raw counts for all samples are available as an Excel file. We used the gene level counts for all subsequent analyses. Differential gene expression: Assembly: GRCz11 Supplementary files format and content: Raw counts for all samples are avialable as an Excel file: all samples raw feature counts.xlsx	pool of 3 adult aortas and bulbus arteriosus		For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. For each sample a sequencing library was constructed starting from 16 ng input RNA using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD for Illumina Lexogen and the UMI Second Strand Synthesis Module for QuantSeq FWD Illumina Read 1. This incorporates a unique molecular identifier UMI in the first 6 nucleotides of each read allowing to identify PCR duplicates and eliminate amplification bias. The libraries were sequenced as single read 75 on an Aviti device Element Biosciences.	Embryos were grown at 27°C in E3 medium with methylene blue until 5 dpf dpf. At 1 dpf and 3 dpf medium was refreshed. For adults zebrafish were housed at the zebrafish facility Ghent in semi closed recirculating housing systems ZebTEC and WTU systems Tecniplast at a constant temperature 27 28°C pH 7 5 conductivity 550µS and light dark cycle 14/10. Zebrafish were fed every day with dry food Gemma Micro and with artemia Ocean Nutrition.	tissue:pool of 3 adult aortas and bulbus arteriosus\|genotype:wt control	GSM8741268	GSM8741268: control 2 biol rep 1 adult aorta 3 aortas pooled; Danio rerio; RNA Seq	GSM8741268 r1	GSM8741268	1	For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. For each sample a sequencing library was constructed starting from 16 ng input RNA using the QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen and the UMI Second Strand Synthesis Module for QuantSeq FWD Illumina Read 1. This incorporates a unique molecular identifier UMI in the first 6 nucleotides of each read allowing to identify PCR duplicates and eliminate amplification bias. The libraries were sequenced as single read 75 on an Aviti device Element Biosciences.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ELEMENT	Element AVITI	SRP476805		2_wt_control_B8_R1.fastq.gz	fastq	1379973000.0	18399640.0	GSM8741268 r1	0:75	A:487735196;C:232122567;G:270442978;T:389464154;N:208105	75	487735196	232122567	270442978	389464154	208105	SRX27375405	SRS23810869	SRA2053000	Callewaert Lab, Biomolecular medicine, Ghent University	Callewaert Lab, Biomolecular medicine, Ghent University							B	usable mapping rate	element	element	3prime	cdna_unspecified	lexogen	bulk	unknown	unknown	Belgium	2025-01-16	Multi-stage	Multi-stage	Heart	Cardiovascular System
29154	29154	SRR32025085	SRX27375404	SRS23810868	SRP476805	PRJNA1050594	Early mechanisms of aortic failure in a zebrafish model for thoracic aortic dissection and rupture	GSE249792	Transcriptome Analysis	Thoracic aortic dissection TAD is associated with a high mortality rate. Despite the existence of different mouse models for TAD the underlying disease mechanisms remain elusive. Treatment options are limited and mainly consist of surgical repair at critical diameters as current pharmacological interventions are unable to stop disease progression. In humans loss of function LOF of SMAD3 and SMAD6 impair vascular homeostasis increasing the risk for TAD. We developed a zebrafish model for thoracic aortic dissection/rupture by targeting both ohnologs of smad3 and smad6. We discovered an increased diameter of the ventral aorta in smad3a / ;smad3b / double knockout zebrafish larvae while smad6a / ;smad6b / double knockout zebrafish have a reduced diameter associated with early mortality. Surprisingly the smad3a / ;smad3b / ;smad6a / ;smad6b / quadruple knockout qKO zebrafish model is viable and survives to maturity although exposure to stress leads to sudden death. Histological analysis of the adult ventral aorta showed medial elastolysis and aortic dissections and ruptures at sites exposed to high hemodynamic stress. RNA sequencing of qKO larvae indicated a profile of reduced negative regulation of proteolysis and upregulation of melanogenesis a previously unaddressed pathway in this pathology. We confirmed that pharmacological modulation of tyrosinase has an effect on aortic morphology. Our study shows that dysregulation of SMAD3/6 dependent signaling has an important impact on thoracic aortic homeostasis and that using the qKO zebrafish model thus far the only known model of aortic dissection and rupture in this species can identify novel pathophysiological pathways leading to TAD. Overall design: For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. One experiment was performed using TruSeq. RNA sequencing was performed on five pools each containing five smad3a / ;smad3b / ;smad6a / ;smad6b / quadruple knockout qKO zebrafish or wt control cou…			control 1 biol rep 1 adult aorta 3 aortas pooled	GSM8741267	source name:pool of 3 adult aortas and bulbus arteriosus\|tissue:pool of 3 adult aortas and bulbus arteriosus\|genotype:wt control\|geo loc name:missing\|collection date:missing	control 1 biol rep 1 adult aorta 3 aortas pooled	Raw read QC: UMI and spacer were removed using UMI tools v1.1.4 resulting in raw reads with a remaining length of 65 nt. Raw sequencing reads were inspected using FastQC v0.12.1 for their quality and length. Putative contaminations were checked using FastQ Screen v0.15.3 and a set of genomes of common lab organisms. Read quality based on phred scores is good. Contamination screening reveals that the reads do not map exclusively to any of the other tested organisms. Limited cross mapping to other organisms is normal and caused by homology between organisms. Adapter and quality trimming: Adaptor trimming was done using cutadapt v4.9 with added filtering of reads containing ambiguities or not passing the phred score threshold of 20. The quality of the remaining read pairs was checked using FastQC Read mapping and feature counting: For each sample trimmed reads were mapped on the zebrafish genome GRCz11 ENSEMBL release 112 using the splice aware STAR v2.7.10a mapper. UMI based deduplication of mapped reads was done with UMI tools v1.1.4. Feature counting at the gene and transcript isoform level was done using rsem calculate expression RSEM v1.3.3. Raw counts for all samples are available as an Excel file. We used the gene level counts for all subsequent analyses. Differential gene expression: Assembly: GRCz11 Supplementary files format and content: Raw counts for all samples are avialable as an Excel file: all samples raw feature counts.xlsx	pool of 3 adult aortas and bulbus arteriosus		For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. For each sample a sequencing library was constructed starting from 16 ng input RNA using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD for Illumina Lexogen and the UMI Second Strand Synthesis Module for QuantSeq FWD Illumina Read 1. This incorporates a unique molecular identifier UMI in the first 6 nucleotides of each read allowing to identify PCR duplicates and eliminate amplification bias. The libraries were sequenced as single read 75 on an Aviti device Element Biosciences.	Embryos were grown at 27°C in E3 medium with methylene blue until 5 dpf dpf. At 1 dpf and 3 dpf medium was refreshed. For adults zebrafish were housed at the zebrafish facility Ghent in semi closed recirculating housing systems ZebTEC and WTU systems Tecniplast at a constant temperature 27 28°C pH 7 5 conductivity 550µS and light dark cycle 14/10. Zebrafish were fed every day with dry food Gemma Micro and with artemia Ocean Nutrition.	tissue:pool of 3 adult aortas and bulbus arteriosus\|genotype:wt control	GSM8741267	GSM8741267: control 1 biol rep 1 adult aorta 3 aortas pooled; Danio rerio; RNA Seq	GSM8741267 r1	GSM8741267	1	For RNA extraction the Rneasy® minikit Qiagen; Hilden Germany was used following manufacturers guidelines. For each sample a sequencing library was constructed starting from 16 ng input RNA using the QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen and the UMI Second Strand Synthesis Module for QuantSeq FWD Illumina Read 1. This incorporates a unique molecular identifier UMI in the first 6 nucleotides of each read allowing to identify PCR duplicates and eliminate amplification bias. The libraries were sequenced as single read 75 on an Aviti device Element Biosciences.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ELEMENT	Element AVITI	SRP476805		1_wt_control_A8_R1.fastq.gz	fastq	1068193125.0	14242575.0	GSM8741267 r1	0:75	A:379776425;C:179521683;G:209337737;T:299415096;N:142184	75	379776425	179521683	209337737	299415096	142184	SRX27375404	SRS23810868	SRA2053000	Callewaert Lab, Biomolecular medicine, Ghent University	Callewaert Lab, Biomolecular medicine, Ghent University							B	usable mapping rate	element	element	3prime	cdna_unspecified	lexogen	bulk	unknown	unknown	Belgium	2025-01-16	Multi-stage	Multi-stage	Heart	Cardiovascular System
29569	29569	SRR27368685	SRX23045203	SRS20006222	SRP480346	PRJNA1057908	An in vivo repertoire of zebrafish cardiomyocyte specific cis regulatory elements [RNA Seq]	GSE252151	Transcriptome Analysis	cis Regulatory elements cREs are essential for the spatio temporal control of gene expression during development and disease. However cRE activity is highly dependent on cell and tissue type. The developing heart is composed of several cell types predominantly cardiomyocytes. Therefore cardiomyocytes specific modelling is required to understand the cis regulation of the developing heart. Zebrafish are an ideal model to study heart development as they share a number of physiological features with the human heart during development. Therefore we present a comprehensive cardiomyocyte specific repertoire of cREs isolated from zebrafish larvae. This data combines live transcriptomics and epigenetic profiling providing insights into cREs and their associated genes involved in heart development. We further perform a transgenic reporter assay for the identified cREs of bmp10 and popdc2 genes validating these genomic regions as cardiac regulatory elements. We share this comprehensive reproducible cardiomyocyte specific cRE resource as an interrogable web tool for understanding the epigenetic and transcriptomic mechanisms underlying heart development and emergence of congenital heart defects. Overall design: Cardiomyocytes were isolated from the Tgmyl7::GFP zebrafish transgenic line. Larvae were collected 72 hpf GFP positive 30 000 cells n=3 biological replicates and GFP negative cells 500 000 cells n=3 biological replicates were collected and RNA sequencing was performed on these samples.	parent bioproject:PRJNA1057890		500kGFPneg6 Non cardiomyocytes	GSM7995233	source name:Heart\|tissue:Heart\|cell line:Primary cells\|cell type:Non cardiomyocytes\|genotype:Tgmyl7::GFP\|gfp status:GFPneg\|treatment:Control\|geo loc name:missing\|collection date:missing	500kGFPneg6 Non cardiomyocytes	FASTQ files were quality trimmed for overrepresented sequences using Cutadapt version 1.16 Martin 2011. The files were then processed for mapping and obtaining read counts with RNAsik Tsyganov et al 2018 using default parameters. There were two sets of counts obtained the first were the reads mapped to genome Zv9 and the second to genome Zv10. Read counts obtained from mapping to Zv10 were used for RNA seq analysis and visualizations. Read counts obtained from mapping to Zv9 were used for RNA seq analysis to obtain a set of DEGs and were then used to overlap with the genes associated to peaks of the ChIP seq data sets. Assembly: Zv9 Zv10 Supplementary files format and content: txt.gz: compressed tab delimited text files include count values for each sample	Heart		RNA extraction was performed using the RNEasy Plus Micro Kit Qiagen according to the instructions provided in the manual. Integrity of the extracted RNA was assessed with BioAnalyzer Agilent and the concentration was measured with Qubit Q32866 Qubit™ RNA HS Assay Kit Q32852 ThermoFisher Scientific. RNA libraries were prepared for sequencing using standard Illumina protocols		tissue:Heart\|cell line:Primary cells\|cell type:Non cardiomyocytes\|genotype:Tgmyl7::GFP\|gfp status:GFPneg\|treatment:Control	GSM7995233	GSM7995233: 500kGFPneg6 Non cardiomyocytes; Danio rerio; RNA Seq	GSM7995233 r1	GSM7995233	1	RNA extraction was performed using the RNEasy Plus Micro Kit Qiagen according to the instructions provided in the manual. Integrity of the extracted RNA was assessed with BioAnalyzer Agilent and the concentration was measured with Qubit Q32866 Qubit™ RNA HS Assay Kit Q32852 ThermoFisher Scientific. RNA libraries were prepared for sequencing using standard Illumina protocols		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 3000	SRP480346		500kGFPneg6_S42_L008_R1_001.fastq.gz	fastq	527477356.0	10449387.0	GSM7995233 r1	0:50.48	A:141759410;C:113279303;G:116384028;T:155860577;N:194038	50	141759410	113279303	116384028	155860577	194038	SRX23045203	SRS20006222	SRA1776396	Australian Regenerative Medicine Institute, Monash University	Australian Regenerative Medicine Institute, Monash University	1	0.79175	0.2711	0.7587	0.61924	51	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Australia	2023-12-27	Undetermined	Larval	Heart	Cardiovascular System
29570	29570	SRR27368686	SRX23045202	SRS20006221	SRP480346	PRJNA1057908	An in vivo repertoire of zebrafish cardiomyocyte specific cis regulatory elements [RNA Seq]	GSE252151	Transcriptome Analysis	cis Regulatory elements cREs are essential for the spatio temporal control of gene expression during development and disease. However cRE activity is highly dependent on cell and tissue type. The developing heart is composed of several cell types predominantly cardiomyocytes. Therefore cardiomyocytes specific modelling is required to understand the cis regulation of the developing heart. Zebrafish are an ideal model to study heart development as they share a number of physiological features with the human heart during development. Therefore we present a comprehensive cardiomyocyte specific repertoire of cREs isolated from zebrafish larvae. This data combines live transcriptomics and epigenetic profiling providing insights into cREs and their associated genes involved in heart development. We further perform a transgenic reporter assay for the identified cREs of bmp10 and popdc2 genes validating these genomic regions as cardiac regulatory elements. We share this comprehensive reproducible cardiomyocyte specific cRE resource as an interrogable web tool for understanding the epigenetic and transcriptomic mechanisms underlying heart development and emergence of congenital heart defects. Overall design: Cardiomyocytes were isolated from the Tgmyl7::GFP zebrafish transgenic line. Larvae were collected 72 hpf GFP positive 30 000 cells n=3 biological replicates and GFP negative cells 500 000 cells n=3 biological replicates were collected and RNA sequencing was performed on these samples.	parent bioproject:PRJNA1057890		500kGFPneg5 Non cardiomyocytes	GSM7995232	source name:Heart\|tissue:Heart\|cell line:Primary cells\|cell type:Non cardiomyocytes\|genotype:Tgmyl7::GFP\|gfp status:GFPneg\|treatment:Control\|geo loc name:missing\|collection date:missing	500kGFPneg5 Non cardiomyocytes	FASTQ files were quality trimmed for overrepresented sequences using Cutadapt version 1.16 Martin 2011. The files were then processed for mapping and obtaining read counts with RNAsik Tsyganov et al 2018 using default parameters. There were two sets of counts obtained the first were the reads mapped to genome Zv9 and the second to genome Zv10. Read counts obtained from mapping to Zv10 were used for RNA seq analysis and visualizations. Read counts obtained from mapping to Zv9 were used for RNA seq analysis to obtain a set of DEGs and were then used to overlap with the genes associated to peaks of the ChIP seq data sets. Assembly: Zv9 Zv10 Supplementary files format and content: txt.gz: compressed tab delimited text files include count values for each sample	Heart		RNA extraction was performed using the RNEasy Plus Micro Kit Qiagen according to the instructions provided in the manual. Integrity of the extracted RNA was assessed with BioAnalyzer Agilent and the concentration was measured with Qubit Q32866 Qubit™ RNA HS Assay Kit Q32852 ThermoFisher Scientific. RNA libraries were prepared for sequencing using standard Illumina protocols		tissue:Heart\|cell line:Primary cells\|cell type:Non cardiomyocytes\|genotype:Tgmyl7::GFP\|gfp status:GFPneg\|treatment:Control	GSM7995232	GSM7995232: 500kGFPneg5 Non cardiomyocytes; Danio rerio; RNA Seq	GSM7995232 r1	GSM7995232	1	RNA extraction was performed using the RNEasy Plus Micro Kit Qiagen according to the instructions provided in the manual. Integrity of the extracted RNA was assessed with BioAnalyzer Agilent and the concentration was measured with Qubit Q32866 Qubit™ RNA HS Assay Kit Q32852 ThermoFisher Scientific. RNA libraries were prepared for sequencing using standard Illumina protocols		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 3000	SRP480346		500kGFPneg5_S41_L008_R1_001.fastq.gz	fastq	3356204764.0	66511806.0	GSM7995232 r1	0:50.46	A:860342578;C:766593257;G:774473426;T:953992775;N:802728	50	860342578	766593257	774473426	953992775	802728	SRX23045202	SRS20006221	SRA1776396	Australian Regenerative Medicine Institute, Monash University	Australian Regenerative Medicine Institute, Monash University	1	0.70469	0.23332	0.76992	0.62712	51	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Australia	2023-12-27	Undetermined	Larval	Heart	Cardiovascular System
29571	29571	SRR27368687	SRX23045201	SRS20006220	SRP480346	PRJNA1057908	An in vivo repertoire of zebrafish cardiomyocyte specific cis regulatory elements [RNA Seq]	GSE252151	Transcriptome Analysis	cis Regulatory elements cREs are essential for the spatio temporal control of gene expression during development and disease. However cRE activity is highly dependent on cell and tissue type. The developing heart is composed of several cell types predominantly cardiomyocytes. Therefore cardiomyocytes specific modelling is required to understand the cis regulation of the developing heart. Zebrafish are an ideal model to study heart development as they share a number of physiological features with the human heart during development. Therefore we present a comprehensive cardiomyocyte specific repertoire of cREs isolated from zebrafish larvae. This data combines live transcriptomics and epigenetic profiling providing insights into cREs and their associated genes involved in heart development. We further perform a transgenic reporter assay for the identified cREs of bmp10 and popdc2 genes validating these genomic regions as cardiac regulatory elements. We share this comprehensive reproducible cardiomyocyte specific cRE resource as an interrogable web tool for understanding the epigenetic and transcriptomic mechanisms underlying heart development and emergence of congenital heart defects. Overall design: Cardiomyocytes were isolated from the Tgmyl7::GFP zebrafish transgenic line. Larvae were collected 72 hpf GFP positive 30 000 cells n=3 biological replicates and GFP negative cells 500 000 cells n=3 biological replicates were collected and RNA sequencing was performed on these samples.	parent bioproject:PRJNA1057890		500kGFPneg4 Non cardiomyocytes	GSM7995231	source name:Heart\|tissue:Heart\|cell line:Primary cells\|cell type:Non cardiomyocytes\|genotype:Tgmyl7::GFP\|gfp status:GFPneg\|treatment:Control\|geo loc name:missing\|collection date:missing	500kGFPneg4 Non cardiomyocytes	FASTQ files were quality trimmed for overrepresented sequences using Cutadapt version 1.16 Martin 2011. The files were then processed for mapping and obtaining read counts with RNAsik Tsyganov et al 2018 using default parameters. There were two sets of counts obtained the first were the reads mapped to genome Zv9 and the second to genome Zv10. Read counts obtained from mapping to Zv10 were used for RNA seq analysis and visualizations. Read counts obtained from mapping to Zv9 were used for RNA seq analysis to obtain a set of DEGs and were then used to overlap with the genes associated to peaks of the ChIP seq data sets. Assembly: Zv9 Zv10 Supplementary files format and content: txt.gz: compressed tab delimited text files include count values for each sample	Heart		RNA extraction was performed using the RNEasy Plus Micro Kit Qiagen according to the instructions provided in the manual. Integrity of the extracted RNA was assessed with BioAnalyzer Agilent and the concentration was measured with Qubit Q32866 Qubit™ RNA HS Assay Kit Q32852 ThermoFisher Scientific. RNA libraries were prepared for sequencing using standard Illumina protocols		tissue:Heart\|cell line:Primary cells\|cell type:Non cardiomyocytes\|genotype:Tgmyl7::GFP\|gfp status:GFPneg\|treatment:Control	GSM7995231	GSM7995231: 500kGFPneg4 Non cardiomyocytes; Danio rerio; RNA Seq	GSM7995231 r1	GSM7995231	1	RNA extraction was performed using the RNEasy Plus Micro Kit Qiagen according to the instructions provided in the manual. Integrity of the extracted RNA was assessed with BioAnalyzer Agilent and the concentration was measured with Qubit Q32866 Qubit™ RNA HS Assay Kit Q32852 ThermoFisher Scientific. RNA libraries were prepared for sequencing using standard Illumina protocols		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 3000	SRP480346		500kGFPneg4_S40_L008_R1_001.fastq.gz	fastq	3075367681.0	60986692.0	GSM7995231 r1	0:50.43	A:807059039;C:682279458;G:696326840;T:888937765;N:764579	50	807059039	682279458	696326840	888937765	764579	SRX23045201	SRS20006220	SRA1776396	Australian Regenerative Medicine Institute, Monash University	Australian Regenerative Medicine Institute, Monash University	1	0.74255	0.26699	0.76786	0.63053	50	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Australia	2023-12-27	Undetermined	Larval	Heart	Cardiovascular System
29572	29572	SRR27368688	SRX23045200	SRS20006219	SRP480346	PRJNA1057908	An in vivo repertoire of zebrafish cardiomyocyte specific cis regulatory elements [RNA Seq]	GSE252151	Transcriptome Analysis	cis Regulatory elements cREs are essential for the spatio temporal control of gene expression during development and disease. However cRE activity is highly dependent on cell and tissue type. The developing heart is composed of several cell types predominantly cardiomyocytes. Therefore cardiomyocytes specific modelling is required to understand the cis regulation of the developing heart. Zebrafish are an ideal model to study heart development as they share a number of physiological features with the human heart during development. Therefore we present a comprehensive cardiomyocyte specific repertoire of cREs isolated from zebrafish larvae. This data combines live transcriptomics and epigenetic profiling providing insights into cREs and their associated genes involved in heart development. We further perform a transgenic reporter assay for the identified cREs of bmp10 and popdc2 genes validating these genomic regions as cardiac regulatory elements. We share this comprehensive reproducible cardiomyocyte specific cRE resource as an interrogable web tool for understanding the epigenetic and transcriptomic mechanisms underlying heart development and emergence of congenital heart defects. Overall design: Cardiomyocytes were isolated from the Tgmyl7::GFP zebrafish transgenic line. Larvae were collected 72 hpf GFP positive 30 000 cells n=3 biological replicates and GFP negative cells 500 000 cells n=3 biological replicates were collected and RNA sequencing was performed on these samples.	parent bioproject:PRJNA1057890		30kGFPpos3 Cardiomyocytes	GSM7995230	source name:Heart\|tissue:Heart\|cell line:Primary cells\|cell type:Cardiomyocytes\|genotype:Tgmyl7::GFP\|gfp status:GFPpos\|treatment:Control\|geo loc name:missing\|collection date:missing	30kGFPpos3 Cardiomyocytes	FASTQ files were quality trimmed for overrepresented sequences using Cutadapt version 1.16 Martin 2011. The files were then processed for mapping and obtaining read counts with RNAsik Tsyganov et al 2018 using default parameters. There were two sets of counts obtained the first were the reads mapped to genome Zv9 and the second to genome Zv10. Read counts obtained from mapping to Zv10 were used for RNA seq analysis and visualizations. Read counts obtained from mapping to Zv9 were used for RNA seq analysis to obtain a set of DEGs and were then used to overlap with the genes associated to peaks of the ChIP seq data sets. Assembly: Zv9 Zv10 Supplementary files format and content: txt.gz: compressed tab delimited text files include count values for each sample	Heart		RNA extraction was performed using the RNEasy Plus Micro Kit Qiagen according to the instructions provided in the manual. Integrity of the extracted RNA was assessed with BioAnalyzer Agilent and the concentration was measured with Qubit Q32866 Qubit™ RNA HS Assay Kit Q32852 ThermoFisher Scientific. RNA libraries were prepared for sequencing using standard Illumina protocols		tissue:Heart\|cell line:Primary cells\|cell type:Cardiomyocytes\|genotype:Tgmyl7::GFP\|gfp status:GFPpos\|treatment:Control	GSM7995230	GSM7995230: 30kGFPpos3 Cardiomyocytes; Danio rerio; RNA Seq	GSM7995230 r1	GSM7995230	1	RNA extraction was performed using the RNEasy Plus Micro Kit Qiagen according to the instructions provided in the manual. Integrity of the extracted RNA was assessed with BioAnalyzer Agilent and the concentration was measured with Qubit Q32866 Qubit™ RNA HS Assay Kit Q32852 ThermoFisher Scientific. RNA libraries were prepared for sequencing using standard Illumina protocols		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 3000	SRP480346		30kGFPpos3_S39_L008_R1_001.fastq.gz	fastq	2938808771.0	58361915.0	GSM7995230 r1	0:50.35	A:533261626;C:883704329;G:825929620;T:694986734;N:926462	50	533261626	883704329	825929620	694986734	926462	SRX23045200	SRS20006219	SRA1776396	Australian Regenerative Medicine Institute, Monash University	Australian Regenerative Medicine Institute, Monash University	1	0.12924	0.05415	0.92034	0.70896	51	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Australia	2023-12-27	Undetermined	Larval	Heart	Cardiovascular System
29573	29573	SRR27368689	SRX23045199	SRS20006218	SRP480346	PRJNA1057908	An in vivo repertoire of zebrafish cardiomyocyte specific cis regulatory elements [RNA Seq]	GSE252151	Transcriptome Analysis	cis Regulatory elements cREs are essential for the spatio temporal control of gene expression during development and disease. However cRE activity is highly dependent on cell and tissue type. The developing heart is composed of several cell types predominantly cardiomyocytes. Therefore cardiomyocytes specific modelling is required to understand the cis regulation of the developing heart. Zebrafish are an ideal model to study heart development as they share a number of physiological features with the human heart during development. Therefore we present a comprehensive cardiomyocyte specific repertoire of cREs isolated from zebrafish larvae. This data combines live transcriptomics and epigenetic profiling providing insights into cREs and their associated genes involved in heart development. We further perform a transgenic reporter assay for the identified cREs of bmp10 and popdc2 genes validating these genomic regions as cardiac regulatory elements. We share this comprehensive reproducible cardiomyocyte specific cRE resource as an interrogable web tool for understanding the epigenetic and transcriptomic mechanisms underlying heart development and emergence of congenital heart defects. Overall design: Cardiomyocytes were isolated from the Tgmyl7::GFP zebrafish transgenic line. Larvae were collected 72 hpf GFP positive 30 000 cells n=3 biological replicates and GFP negative cells 500 000 cells n=3 biological replicates were collected and RNA sequencing was performed on these samples.	parent bioproject:PRJNA1057890		30kGFPpos2 Cardiomyocytes	GSM7995229	source name:Heart\|tissue:Heart\|cell line:Primary cells\|cell type:Cardiomyocytes\|genotype:Tgmyl7::GFP\|gfp status:GFPpos\|treatment:Control\|geo loc name:missing\|collection date:missing	30kGFPpos2 Cardiomyocytes	FASTQ files were quality trimmed for overrepresented sequences using Cutadapt version 1.16 Martin 2011. The files were then processed for mapping and obtaining read counts with RNAsik Tsyganov et al 2018 using default parameters. There were two sets of counts obtained the first were the reads mapped to genome Zv9 and the second to genome Zv10. Read counts obtained from mapping to Zv10 were used for RNA seq analysis and visualizations. Read counts obtained from mapping to Zv9 were used for RNA seq analysis to obtain a set of DEGs and were then used to overlap with the genes associated to peaks of the ChIP seq data sets. Assembly: Zv9 Zv10 Supplementary files format and content: txt.gz: compressed tab delimited text files include count values for each sample	Heart		RNA extraction was performed using the RNEasy Plus Micro Kit Qiagen according to the instructions provided in the manual. Integrity of the extracted RNA was assessed with BioAnalyzer Agilent and the concentration was measured with Qubit Q32866 Qubit™ RNA HS Assay Kit Q32852 ThermoFisher Scientific. RNA libraries were prepared for sequencing using standard Illumina protocols		tissue:Heart\|cell line:Primary cells\|cell type:Cardiomyocytes\|genotype:Tgmyl7::GFP\|gfp status:GFPpos\|treatment:Control	GSM7995229	GSM7995229: 30kGFPpos2 Cardiomyocytes; Danio rerio; RNA Seq	GSM7995229 r1	GSM7995229	1	RNA extraction was performed using the RNEasy Plus Micro Kit Qiagen according to the instructions provided in the manual. Integrity of the extracted RNA was assessed with BioAnalyzer Agilent and the concentration was measured with Qubit Q32866 Qubit™ RNA HS Assay Kit Q32852 ThermoFisher Scientific. RNA libraries were prepared for sequencing using standard Illumina protocols		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 3000	SRP480346		30kGFPpos2_S38_L008_R1_001.fastq.gz	fastq	3006409096.0	59645543.0	GSM7995229 r1	0:50.40	A:560839480;C:885691877;G:830121593;T:728932219;N:823927	50	560839480	885691877	830121593	728932219	823927	SRX23045199	SRS20006218	SRA1776396	Australian Regenerative Medicine Institute, Monash University	Australian Regenerative Medicine Institute, Monash University	1	0.17805	0.06115	0.89769	0.68731	49	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Australia	2023-12-27	Undetermined	Larval	Heart	Cardiovascular System
29574	29574	SRR27368690	SRX23045198	SRS20006217	SRP480346	PRJNA1057908	An in vivo repertoire of zebrafish cardiomyocyte specific cis regulatory elements [RNA Seq]	GSE252151	Transcriptome Analysis	cis Regulatory elements cREs are essential for the spatio temporal control of gene expression during development and disease. However cRE activity is highly dependent on cell and tissue type. The developing heart is composed of several cell types predominantly cardiomyocytes. Therefore cardiomyocytes specific modelling is required to understand the cis regulation of the developing heart. Zebrafish are an ideal model to study heart development as they share a number of physiological features with the human heart during development. Therefore we present a comprehensive cardiomyocyte specific repertoire of cREs isolated from zebrafish larvae. This data combines live transcriptomics and epigenetic profiling providing insights into cREs and their associated genes involved in heart development. We further perform a transgenic reporter assay for the identified cREs of bmp10 and popdc2 genes validating these genomic regions as cardiac regulatory elements. We share this comprehensive reproducible cardiomyocyte specific cRE resource as an interrogable web tool for understanding the epigenetic and transcriptomic mechanisms underlying heart development and emergence of congenital heart defects. Overall design: Cardiomyocytes were isolated from the Tgmyl7::GFP zebrafish transgenic line. Larvae were collected 72 hpf GFP positive 30 000 cells n=3 biological replicates and GFP negative cells 500 000 cells n=3 biological replicates were collected and RNA sequencing was performed on these samples.	parent bioproject:PRJNA1057890		30kGFPpos1 Cardiomyocytes	GSM7995228	source name:Heart\|tissue:Heart\|cell line:Primary cells\|cell type:Cardiomyocytes\|genotype:Tgmyl7::GFP\|gfp status:GFPpos\|treatment:Control\|geo loc name:missing\|collection date:missing	30kGFPpos1 Cardiomyocytes	FASTQ files were quality trimmed for overrepresented sequences using Cutadapt version 1.16 Martin 2011. The files were then processed for mapping and obtaining read counts with RNAsik Tsyganov et al 2018 using default parameters. There were two sets of counts obtained the first were the reads mapped to genome Zv9 and the second to genome Zv10. Read counts obtained from mapping to Zv10 were used for RNA seq analysis and visualizations. Read counts obtained from mapping to Zv9 were used for RNA seq analysis to obtain a set of DEGs and were then used to overlap with the genes associated to peaks of the ChIP seq data sets. Assembly: Zv9 Zv10 Supplementary files format and content: txt.gz: compressed tab delimited text files include count values for each sample	Heart		RNA extraction was performed using the RNEasy Plus Micro Kit Qiagen according to the instructions provided in the manual. Integrity of the extracted RNA was assessed with BioAnalyzer Agilent and the concentration was measured with Qubit Q32866 Qubit™ RNA HS Assay Kit Q32852 ThermoFisher Scientific. RNA libraries were prepared for sequencing using standard Illumina protocols		tissue:Heart\|cell line:Primary cells\|cell type:Cardiomyocytes\|genotype:Tgmyl7::GFP\|gfp status:GFPpos\|treatment:Control	GSM7995228	GSM7995228: 30kGFPpos1 Cardiomyocytes; Danio rerio; RNA Seq	GSM7995228 r1	GSM7995228	1	RNA extraction was performed using the RNEasy Plus Micro Kit Qiagen according to the instructions provided in the manual. Integrity of the extracted RNA was assessed with BioAnalyzer Agilent and the concentration was measured with Qubit Q32866 Qubit™ RNA HS Assay Kit Q32852 ThermoFisher Scientific. RNA libraries were prepared for sequencing using standard Illumina protocols		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 3000	SRP480346		30kGFPpos1_S37_L008_R1_001.fastq.gz	fastq	3254639839.0	64665631.0	GSM7995228 r1	0:50.33	A:545193535;C:1023804678;G:938318027;T:746302007;N:1021592	50	545193535	1023804678	938318027	746302007	1021592	SRX23045198	SRS20006217	SRA1776396	Australian Regenerative Medicine Institute, Monash University	Australian Regenerative Medicine Institute, Monash University	1	0.05453	0.01921	0.9643	0.78064	49	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Australia	2023-12-27	Undetermined	Larval	Heart	Cardiovascular System
30512	30512	SRR27764782	SRX23429747	SRS20284188	SRP486526	PRJNA1070616	Cox7a1 mediated CIV dimerization impacts skeletal muscle physiology and cardiac injury response	GSE254466	Transcriptome Analysis	The oxidative phosphorylation OXPHOS system is dynamic and the respiratory complexes RCs coexist with super assembled quaternary structures called supercomplexes SCs. How assembly occurs and the physiological role of supercomplex assembly is still under intensive investigation. The Cox7a family member Cox7a2l also known as Scaf1 promotes CIII CIV super assembly and energetic efficiency in zebrafish mice and humans. Here we studied the role of a second member of the Cox7a family Cox7a1 in SC assembly and striated muscle physiology. We found that this protein drives CIV homodimer formation which increases CIV activity. The substantial reduction in CIV2 formation led to a profound metabolic rearrangement with a consequent non pathological loss of skeletal muscle performance. Ablation of Cox7a1 also rewired heart metabolism. Already in homeostatic conditions cox7a1 / hearts revealed a pro regenerative metabolic profile. While overall cardiac function was not affected the absence of Cox7a1 altered the cardiac regenerative response. The effects of cox7a1 and cox7a2l loss of function on skeletal muscle and myocardium physiology and injury response were not identical revealing that there is a high specificity of Cox7a isoform in controlling OXPHOS assembly and striated muscle metabolism. While in both cases overall OXPHOS activity is modified the loss of CIII CIV heterodimer formation or CIV homodimer formation have very distinct metabolic and physiological consequences highlighting the complexity of OXPHOS function and the importance of cox7a1 in striated muscle maturation. Overall design: Adult zebrafish hearts for cox7a1 / mutants and wildtype siblings were cryoinjured. 7 xxx post injury the cardiac ventrilces were extracted and RNA was extracted for RNA seq. 4 pools each comprising 5 ventricles were sequenced per condition.		pubmed:38701784	Cardiac ventricle cox7a1 / replicate 4	GSM8042779	source name:Cardiac Ventricle\|tissue:Cardiac Ventricle\|genotype:Cox7a mut\|treatment:7days post cryoinjury\|geo loc name:missing\|collection date:missing	Cardiac ventricle cox7a1 / replicate 4	Data were quality checked with Fastqc and Multiqc Sequences were trimmed with fastp 2 pass alignment was performed with STAR Aligner reads were dounted using featurecounts Normalization and downstream analysis including differential expression analysis was performed in R Assembly: GRCz11 v109 Ensembl Supplementary files format and content: feature counts tab seprated values	Cardiac Ventricle		4 pools each comprising 5 ventricles were sequenced per condition. Libraries for RNA seq were prepared using the "NEBNext Ultra II Directional RNA library prep Kit for Illumina" following manufacturer´s protocol		tissue:Cardiac Ventricle\|genotype:Cox7a mut\|treatment:7days post cryoinjury	GSM8042779	GSM8042779: Cardiac ventricle cox7a1 / replicate 4; Danio rerio; RNA Seq	GSM8042779 r1	GSM8042779	1	4 pools each comprising 5 ventricles were sequenced per condition. Libraries for RNA seq were prepared using the "NEBNext Ultra II Directional RNA library prep Kit for Illumina" following manufacturer´s protocol		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP486526		KO_10_Directional_S8_R1_001.fastq.gz	fastq	8619450300.0	86194503.0	GSM8042779 r1	0:100	A:2183264320;C:2042597849;G:2002385828;T:2389908983;N:1293320	100	2183264320	2042597849	2002385828	2389908983	1293320	SRX23429747	SRS20284188	SRA1793874	University of Bern	University of Bern							B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	nebnext	bulk	unknown	unknown	Switzerland	2024-01-29	Undetermined	Adult	Heart	Cardiovascular System
30513	30513	SRR27764783	SRX23429746	SRS20284187	SRP486526	PRJNA1070616	Cox7a1 mediated CIV dimerization impacts skeletal muscle physiology and cardiac injury response	GSE254466	Transcriptome Analysis	The oxidative phosphorylation OXPHOS system is dynamic and the respiratory complexes RCs coexist with super assembled quaternary structures called supercomplexes SCs. How assembly occurs and the physiological role of supercomplex assembly is still under intensive investigation. The Cox7a family member Cox7a2l also known as Scaf1 promotes CIII CIV super assembly and energetic efficiency in zebrafish mice and humans. Here we studied the role of a second member of the Cox7a family Cox7a1 in SC assembly and striated muscle physiology. We found that this protein drives CIV homodimer formation which increases CIV activity. The substantial reduction in CIV2 formation led to a profound metabolic rearrangement with a consequent non pathological loss of skeletal muscle performance. Ablation of Cox7a1 also rewired heart metabolism. Already in homeostatic conditions cox7a1 / hearts revealed a pro regenerative metabolic profile. While overall cardiac function was not affected the absence of Cox7a1 altered the cardiac regenerative response. The effects of cox7a1 and cox7a2l loss of function on skeletal muscle and myocardium physiology and injury response were not identical revealing that there is a high specificity of Cox7a isoform in controlling OXPHOS assembly and striated muscle metabolism. While in both cases overall OXPHOS activity is modified the loss of CIII CIV heterodimer formation or CIV homodimer formation have very distinct metabolic and physiological consequences highlighting the complexity of OXPHOS function and the importance of cox7a1 in striated muscle maturation. Overall design: Adult zebrafish hearts for cox7a1 / mutants and wildtype siblings were cryoinjured. 7 xxx post injury the cardiac ventrilces were extracted and RNA was extracted for RNA seq. 4 pools each comprising 5 ventricles were sequenced per condition.		pubmed:38701784	Cardiac ventricle cox7a1 / replicate 3	GSM8042778	source name:Cardiac Ventricle\|tissue:Cardiac Ventricle\|genotype:Cox7a mut\|treatment:7days post cryoinjury\|geo loc name:missing\|collection date:missing	Cardiac ventricle cox7a1 / replicate 3	Data were quality checked with Fastqc and Multiqc Sequences were trimmed with fastp 2 pass alignment was performed with STAR Aligner reads were dounted using featurecounts Normalization and downstream analysis including differential expression analysis was performed in R Assembly: GRCz11 v109 Ensembl Supplementary files format and content: feature counts tab seprated values	Cardiac Ventricle		4 pools each comprising 5 ventricles were sequenced per condition. Libraries for RNA seq were prepared using the "NEBNext Ultra II Directional RNA library prep Kit for Illumina" following manufacturer´s protocol		tissue:Cardiac Ventricle\|genotype:Cox7a mut\|treatment:7days post cryoinjury	GSM8042778	GSM8042778: Cardiac ventricle cox7a1 / replicate 3; Danio rerio; RNA Seq	GSM8042778 r1	GSM8042778	1	4 pools each comprising 5 ventricles were sequenced per condition. Libraries for RNA seq were prepared using the "NEBNext Ultra II Directional RNA library prep Kit for Illumina" following manufacturer´s protocol		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP486526		KO_9_Directional_S7_R1_001.fastq.gz	fastq	6466746100.0	64667461.0	GSM8042778 r1	0:100	A:1708351950;C:1464168743;G:1452219209;T:1841033764;N:972434	100	1708351950	1464168743	1452219209	1841033764	972434	SRX23429746	SRS20284187	SRA1793874	University of Bern	University of Bern							B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	nebnext	bulk	unknown	unknown	Switzerland	2024-01-29	Undetermined	Adult	Heart	Cardiovascular System
30514	30514	SRR27764784	SRX23429745	SRS20284186	SRP486526	PRJNA1070616	Cox7a1 mediated CIV dimerization impacts skeletal muscle physiology and cardiac injury response	GSE254466	Transcriptome Analysis	The oxidative phosphorylation OXPHOS system is dynamic and the respiratory complexes RCs coexist with super assembled quaternary structures called supercomplexes SCs. How assembly occurs and the physiological role of supercomplex assembly is still under intensive investigation. The Cox7a family member Cox7a2l also known as Scaf1 promotes CIII CIV super assembly and energetic efficiency in zebrafish mice and humans. Here we studied the role of a second member of the Cox7a family Cox7a1 in SC assembly and striated muscle physiology. We found that this protein drives CIV homodimer formation which increases CIV activity. The substantial reduction in CIV2 formation led to a profound metabolic rearrangement with a consequent non pathological loss of skeletal muscle performance. Ablation of Cox7a1 also rewired heart metabolism. Already in homeostatic conditions cox7a1 / hearts revealed a pro regenerative metabolic profile. While overall cardiac function was not affected the absence of Cox7a1 altered the cardiac regenerative response. The effects of cox7a1 and cox7a2l loss of function on skeletal muscle and myocardium physiology and injury response were not identical revealing that there is a high specificity of Cox7a isoform in controlling OXPHOS assembly and striated muscle metabolism. While in both cases overall OXPHOS activity is modified the loss of CIII CIV heterodimer formation or CIV homodimer formation have very distinct metabolic and physiological consequences highlighting the complexity of OXPHOS function and the importance of cox7a1 in striated muscle maturation. Overall design: Adult zebrafish hearts for cox7a1 / mutants and wildtype siblings were cryoinjured. 7 xxx post injury the cardiac ventrilces were extracted and RNA was extracted for RNA seq. 4 pools each comprising 5 ventricles were sequenced per condition.		pubmed:38701784	Cardiac ventricle cox7a1 / replicate 2	GSM8042777	source name:Cardiac Ventricle\|tissue:Cardiac Ventricle\|genotype:Cox7a mut\|treatment:7days post cryoinjury\|geo loc name:missing\|collection date:missing	Cardiac ventricle cox7a1 / replicate 2	Data were quality checked with Fastqc and Multiqc Sequences were trimmed with fastp 2 pass alignment was performed with STAR Aligner reads were dounted using featurecounts Normalization and downstream analysis including differential expression analysis was performed in R Assembly: GRCz11 v109 Ensembl Supplementary files format and content: feature counts tab seprated values	Cardiac Ventricle		4 pools each comprising 5 ventricles were sequenced per condition. Libraries for RNA seq were prepared using the "NEBNext Ultra II Directional RNA library prep Kit for Illumina" following manufacturer´s protocol		tissue:Cardiac Ventricle\|genotype:Cox7a mut\|treatment:7days post cryoinjury	GSM8042777	GSM8042777: Cardiac ventricle cox7a1 / replicate 2; Danio rerio; RNA Seq	GSM8042777 r1	GSM8042777	1	4 pools each comprising 5 ventricles were sequenced per condition. Libraries for RNA seq were prepared using the "NEBNext Ultra II Directional RNA library prep Kit for Illumina" following manufacturer´s protocol		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP486526		KO_8_Directional_S6_R1_001.fastq.gz	fastq	6766795300.0	67667953.0	GSM8042777 r1	0:100	A:1803038642;C:1540664299;G:1518741633;T:1903355305;N:995421	100	1803038642	1540664299	1518741633	1903355305	995421	SRX23429745	SRS20284186	SRA1793874	University of Bern	University of Bern							B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	nebnext	bulk	unknown	unknown	Switzerland	2024-01-29	Undetermined	Adult	Heart	Cardiovascular System
30515	30515	SRR27764785	SRX23429744	SRS20284185	SRP486526	PRJNA1070616	Cox7a1 mediated CIV dimerization impacts skeletal muscle physiology and cardiac injury response	GSE254466	Transcriptome Analysis	The oxidative phosphorylation OXPHOS system is dynamic and the respiratory complexes RCs coexist with super assembled quaternary structures called supercomplexes SCs. How assembly occurs and the physiological role of supercomplex assembly is still under intensive investigation. The Cox7a family member Cox7a2l also known as Scaf1 promotes CIII CIV super assembly and energetic efficiency in zebrafish mice and humans. Here we studied the role of a second member of the Cox7a family Cox7a1 in SC assembly and striated muscle physiology. We found that this protein drives CIV homodimer formation which increases CIV activity. The substantial reduction in CIV2 formation led to a profound metabolic rearrangement with a consequent non pathological loss of skeletal muscle performance. Ablation of Cox7a1 also rewired heart metabolism. Already in homeostatic conditions cox7a1 / hearts revealed a pro regenerative metabolic profile. While overall cardiac function was not affected the absence of Cox7a1 altered the cardiac regenerative response. The effects of cox7a1 and cox7a2l loss of function on skeletal muscle and myocardium physiology and injury response were not identical revealing that there is a high specificity of Cox7a isoform in controlling OXPHOS assembly and striated muscle metabolism. While in both cases overall OXPHOS activity is modified the loss of CIII CIV heterodimer formation or CIV homodimer formation have very distinct metabolic and physiological consequences highlighting the complexity of OXPHOS function and the importance of cox7a1 in striated muscle maturation. Overall design: Adult zebrafish hearts for cox7a1 / mutants and wildtype siblings were cryoinjured. 7 xxx post injury the cardiac ventrilces were extracted and RNA was extracted for RNA seq. 4 pools each comprising 5 ventricles were sequenced per condition.		pubmed:38701784	Cardiac ventricle cox7a1 / replicate 1	GSM8042776	source name:Cardiac Ventricle\|tissue:Cardiac Ventricle\|genotype:Cox7a mut\|treatment:7days post cryoinjury\|geo loc name:missing\|collection date:missing	Cardiac ventricle cox7a1 / replicate 1	Data were quality checked with Fastqc and Multiqc Sequences were trimmed with fastp 2 pass alignment was performed with STAR Aligner reads were dounted using featurecounts Normalization and downstream analysis including differential expression analysis was performed in R Assembly: GRCz11 v109 Ensembl Supplementary files format and content: feature counts tab seprated values	Cardiac Ventricle		4 pools each comprising 5 ventricles were sequenced per condition. Libraries for RNA seq were prepared using the "NEBNext Ultra II Directional RNA library prep Kit for Illumina" following manufacturer´s protocol		tissue:Cardiac Ventricle\|genotype:Cox7a mut\|treatment:7days post cryoinjury	GSM8042776	GSM8042776: Cardiac ventricle cox7a1 / replicate 1; Danio rerio; RNA Seq	GSM8042776 r1	GSM8042776	1	4 pools each comprising 5 ventricles were sequenced per condition. Libraries for RNA seq were prepared using the "NEBNext Ultra II Directional RNA library prep Kit for Illumina" following manufacturer´s protocol		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP486526		KO_7_Directional_S5_R1_001.fastq.gz	fastq	5583049300.0	55830493.0	GSM8042776 r1	0:100	A:1479820662;C:1265599242;G:1251078421;T:1585727832;N:823143	100	1479820662	1265599242	1251078421	1585727832	823143	SRX23429744	SRS20284185	SRA1793874	University of Bern	University of Bern							B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	nebnext	bulk	unknown	unknown	Switzerland	2024-01-29	Undetermined	Adult	Heart	Cardiovascular System
30516	30516	SRR27764786	SRX23429743	SRS20284184	SRP486526	PRJNA1070616	Cox7a1 mediated CIV dimerization impacts skeletal muscle physiology and cardiac injury response	GSE254466	Transcriptome Analysis	The oxidative phosphorylation OXPHOS system is dynamic and the respiratory complexes RCs coexist with super assembled quaternary structures called supercomplexes SCs. How assembly occurs and the physiological role of supercomplex assembly is still under intensive investigation. The Cox7a family member Cox7a2l also known as Scaf1 promotes CIII CIV super assembly and energetic efficiency in zebrafish mice and humans. Here we studied the role of a second member of the Cox7a family Cox7a1 in SC assembly and striated muscle physiology. We found that this protein drives CIV homodimer formation which increases CIV activity. The substantial reduction in CIV2 formation led to a profound metabolic rearrangement with a consequent non pathological loss of skeletal muscle performance. Ablation of Cox7a1 also rewired heart metabolism. Already in homeostatic conditions cox7a1 / hearts revealed a pro regenerative metabolic profile. While overall cardiac function was not affected the absence of Cox7a1 altered the cardiac regenerative response. The effects of cox7a1 and cox7a2l loss of function on skeletal muscle and myocardium physiology and injury response were not identical revealing that there is a high specificity of Cox7a isoform in controlling OXPHOS assembly and striated muscle metabolism. While in both cases overall OXPHOS activity is modified the loss of CIII CIV heterodimer formation or CIV homodimer formation have very distinct metabolic and physiological consequences highlighting the complexity of OXPHOS function and the importance of cox7a1 in striated muscle maturation. Overall design: Adult zebrafish hearts for cox7a1 / mutants and wildtype siblings were cryoinjured. 7 xxx post injury the cardiac ventrilces were extracted and RNA was extracted for RNA seq. 4 pools each comprising 5 ventricles were sequenced per condition.		pubmed:38701784	Cardiac ventricle wt sibling replicate 4	GSM8042775	source name:Cardiac Ventricle\|tissue:Cardiac Ventricle\|genotype:WT\|treatment:7days post cryoinjury\|geo loc name:missing\|collection date:missing	Cardiac ventricle wt sibling replicate 4	Data were quality checked with Fastqc and Multiqc Sequences were trimmed with fastp 2 pass alignment was performed with STAR Aligner reads were dounted using featurecounts Normalization and downstream analysis including differential expression analysis was performed in R Assembly: GRCz11 v109 Ensembl Supplementary files format and content: feature counts tab seprated values	Cardiac Ventricle		4 pools each comprising 5 ventricles were sequenced per condition. Libraries for RNA seq were prepared using the "NEBNext Ultra II Directional RNA library prep Kit for Illumina" following manufacturer´s protocol		tissue:Cardiac Ventricle\|genotype:WT\|treatment:7days post cryoinjury	GSM8042775	GSM8042775: Cardiac ventricle wt sibling replicate 4; Danio rerio; RNA Seq	GSM8042775 r1	GSM8042775	1	4 pools each comprising 5 ventricles were sequenced per condition. Libraries for RNA seq were prepared using the "NEBNext Ultra II Directional RNA library prep Kit for Illumina" following manufacturer´s protocol		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP486526		WT_5_Directional_S4_R1_001.fastq.gz	fastq	6851217800.0	68512178.0	GSM8042775 r1	0:100	A:1837112549;C:1539284911;G:1515596368;T:1958221274;N:1002698	100	1837112549	1539284911	1515596368	1958221274	1002698	SRX23429743	SRS20284184	SRA1793874	University of Bern	University of Bern							B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	nebnext	bulk	unknown	unknown	Switzerland	2024-01-29	Undetermined	Adult	Heart	Cardiovascular System
30517	30517	SRR27764787	SRX23429742	SRS20284183	SRP486526	PRJNA1070616	Cox7a1 mediated CIV dimerization impacts skeletal muscle physiology and cardiac injury response	GSE254466	Transcriptome Analysis	The oxidative phosphorylation OXPHOS system is dynamic and the respiratory complexes RCs coexist with super assembled quaternary structures called supercomplexes SCs. How assembly occurs and the physiological role of supercomplex assembly is still under intensive investigation. The Cox7a family member Cox7a2l also known as Scaf1 promotes CIII CIV super assembly and energetic efficiency in zebrafish mice and humans. Here we studied the role of a second member of the Cox7a family Cox7a1 in SC assembly and striated muscle physiology. We found that this protein drives CIV homodimer formation which increases CIV activity. The substantial reduction in CIV2 formation led to a profound metabolic rearrangement with a consequent non pathological loss of skeletal muscle performance. Ablation of Cox7a1 also rewired heart metabolism. Already in homeostatic conditions cox7a1 / hearts revealed a pro regenerative metabolic profile. While overall cardiac function was not affected the absence of Cox7a1 altered the cardiac regenerative response. The effects of cox7a1 and cox7a2l loss of function on skeletal muscle and myocardium physiology and injury response were not identical revealing that there is a high specificity of Cox7a isoform in controlling OXPHOS assembly and striated muscle metabolism. While in both cases overall OXPHOS activity is modified the loss of CIII CIV heterodimer formation or CIV homodimer formation have very distinct metabolic and physiological consequences highlighting the complexity of OXPHOS function and the importance of cox7a1 in striated muscle maturation. Overall design: Adult zebrafish hearts for cox7a1 / mutants and wildtype siblings were cryoinjured. 7 xxx post injury the cardiac ventrilces were extracted and RNA was extracted for RNA seq. 4 pools each comprising 5 ventricles were sequenced per condition.		pubmed:38701784	Cardiac ventricle wt sibling replicate 3	GSM8042774	source name:Cardiac Ventricle\|tissue:Cardiac Ventricle\|genotype:WT\|treatment:7days post cryoinjury\|geo loc name:missing\|collection date:missing	Cardiac ventricle wt sibling replicate 3	Data were quality checked with Fastqc and Multiqc Sequences were trimmed with fastp 2 pass alignment was performed with STAR Aligner reads were dounted using featurecounts Normalization and downstream analysis including differential expression analysis was performed in R Assembly: GRCz11 v109 Ensembl Supplementary files format and content: feature counts tab seprated values	Cardiac Ventricle		4 pools each comprising 5 ventricles were sequenced per condition. Libraries for RNA seq were prepared using the "NEBNext Ultra II Directional RNA library prep Kit for Illumina" following manufacturer´s protocol		tissue:Cardiac Ventricle\|genotype:WT\|treatment:7days post cryoinjury	GSM8042774	GSM8042774: Cardiac ventricle wt sibling replicate 3; Danio rerio; RNA Seq	GSM8042774 r1	GSM8042774	1	4 pools each comprising 5 ventricles were sequenced per condition. Libraries for RNA seq were prepared using the "NEBNext Ultra II Directional RNA library prep Kit for Illumina" following manufacturer´s protocol		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP486526		WT_3_Directional_S3_R1_001.fastq.gz	fastq	7036251700.0	70362517.0	GSM8042774 r1	0:100	A:1881612688;C:1574593657;G:1570342252;T:2008668471;N:1034632	100	1881612688	1574593657	1570342252	2008668471	1034632	SRX23429742	SRS20284183	SRA1793874	University of Bern	University of Bern							B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	nebnext	bulk	unknown	unknown	Switzerland	2024-01-29	Undetermined	Adult	Heart	Cardiovascular System
30518	30518	SRR27764788	SRX23429741	SRS20284182	SRP486526	PRJNA1070616	Cox7a1 mediated CIV dimerization impacts skeletal muscle physiology and cardiac injury response	GSE254466	Transcriptome Analysis	The oxidative phosphorylation OXPHOS system is dynamic and the respiratory complexes RCs coexist with super assembled quaternary structures called supercomplexes SCs. How assembly occurs and the physiological role of supercomplex assembly is still under intensive investigation. The Cox7a family member Cox7a2l also known as Scaf1 promotes CIII CIV super assembly and energetic efficiency in zebrafish mice and humans. Here we studied the role of a second member of the Cox7a family Cox7a1 in SC assembly and striated muscle physiology. We found that this protein drives CIV homodimer formation which increases CIV activity. The substantial reduction in CIV2 formation led to a profound metabolic rearrangement with a consequent non pathological loss of skeletal muscle performance. Ablation of Cox7a1 also rewired heart metabolism. Already in homeostatic conditions cox7a1 / hearts revealed a pro regenerative metabolic profile. While overall cardiac function was not affected the absence of Cox7a1 altered the cardiac regenerative response. The effects of cox7a1 and cox7a2l loss of function on skeletal muscle and myocardium physiology and injury response were not identical revealing that there is a high specificity of Cox7a isoform in controlling OXPHOS assembly and striated muscle metabolism. While in both cases overall OXPHOS activity is modified the loss of CIII CIV heterodimer formation or CIV homodimer formation have very distinct metabolic and physiological consequences highlighting the complexity of OXPHOS function and the importance of cox7a1 in striated muscle maturation. Overall design: Adult zebrafish hearts for cox7a1 / mutants and wildtype siblings were cryoinjured. 7 xxx post injury the cardiac ventrilces were extracted and RNA was extracted for RNA seq. 4 pools each comprising 5 ventricles were sequenced per condition.		pubmed:38701784	Cardiac ventricle wt sibling replicate 2	GSM8042773	source name:Cardiac Ventricle\|tissue:Cardiac Ventricle\|genotype:WT\|treatment:7days post cryoinjury\|geo loc name:missing\|collection date:missing	Cardiac ventricle wt sibling replicate 2	Data were quality checked with Fastqc and Multiqc Sequences were trimmed with fastp 2 pass alignment was performed with STAR Aligner reads were dounted using featurecounts Normalization and downstream analysis including differential expression analysis was performed in R Assembly: GRCz11 v109 Ensembl Supplementary files format and content: feature counts tab seprated values	Cardiac Ventricle		4 pools each comprising 5 ventricles were sequenced per condition. Libraries for RNA seq were prepared using the "NEBNext Ultra II Directional RNA library prep Kit for Illumina" following manufacturer´s protocol		tissue:Cardiac Ventricle\|genotype:WT\|treatment:7days post cryoinjury	GSM8042773	GSM8042773: Cardiac ventricle wt sibling replicate 2; Danio rerio; RNA Seq	GSM8042773 r1	GSM8042773	1	4 pools each comprising 5 ventricles were sequenced per condition. Libraries for RNA seq were prepared using the "NEBNext Ultra II Directional RNA library prep Kit for Illumina" following manufacturer´s protocol		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP486526		WT_2_Directional_S2_R1_001.fastq.gz	fastq	6856428200.0	68564282.0	GSM8042773 r1	0:100	A:1790369167;C:1572129686;G:1566120109;T:1926782247;N:1026991	100	1790369167	1572129686	1566120109	1926782247	1026991	SRX23429741	SRS20284182	SRA1793874	University of Bern	University of Bern							B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	nebnext	bulk	unknown	unknown	Switzerland	2024-01-29	Undetermined	Adult	Heart	Cardiovascular System
30519	30519	SRR27764789	SRX23429740	SRS20284181	SRP486526	PRJNA1070616	Cox7a1 mediated CIV dimerization impacts skeletal muscle physiology and cardiac injury response	GSE254466	Transcriptome Analysis	The oxidative phosphorylation OXPHOS system is dynamic and the respiratory complexes RCs coexist with super assembled quaternary structures called supercomplexes SCs. How assembly occurs and the physiological role of supercomplex assembly is still under intensive investigation. The Cox7a family member Cox7a2l also known as Scaf1 promotes CIII CIV super assembly and energetic efficiency in zebrafish mice and humans. Here we studied the role of a second member of the Cox7a family Cox7a1 in SC assembly and striated muscle physiology. We found that this protein drives CIV homodimer formation which increases CIV activity. The substantial reduction in CIV2 formation led to a profound metabolic rearrangement with a consequent non pathological loss of skeletal muscle performance. Ablation of Cox7a1 also rewired heart metabolism. Already in homeostatic conditions cox7a1 / hearts revealed a pro regenerative metabolic profile. While overall cardiac function was not affected the absence of Cox7a1 altered the cardiac regenerative response. The effects of cox7a1 and cox7a2l loss of function on skeletal muscle and myocardium physiology and injury response were not identical revealing that there is a high specificity of Cox7a isoform in controlling OXPHOS assembly and striated muscle metabolism. While in both cases overall OXPHOS activity is modified the loss of CIII CIV heterodimer formation or CIV homodimer formation have very distinct metabolic and physiological consequences highlighting the complexity of OXPHOS function and the importance of cox7a1 in striated muscle maturation. Overall design: Adult zebrafish hearts for cox7a1 / mutants and wildtype siblings were cryoinjured. 7 xxx post injury the cardiac ventrilces were extracted and RNA was extracted for RNA seq. 4 pools each comprising 5 ventricles were sequenced per condition.		pubmed:38701784	Cardiac ventricle wt sibling replicate 1	GSM8042772	source name:Cardiac Ventricle\|tissue:Cardiac Ventricle\|genotype:WT\|treatment:7days post cryoinjury\|geo loc name:missing\|collection date:missing	Cardiac ventricle wt sibling replicate 1	Data were quality checked with Fastqc and Multiqc Sequences were trimmed with fastp 2 pass alignment was performed with STAR Aligner reads were dounted using featurecounts Normalization and downstream analysis including differential expression analysis was performed in R Assembly: GRCz11 v109 Ensembl Supplementary files format and content: feature counts tab seprated values	Cardiac Ventricle		4 pools each comprising 5 ventricles were sequenced per condition. Libraries for RNA seq were prepared using the "NEBNext Ultra II Directional RNA library prep Kit for Illumina" following manufacturer´s protocol		tissue:Cardiac Ventricle\|genotype:WT\|treatment:7days post cryoinjury	GSM8042772	GSM8042772: Cardiac ventricle wt sibling replicate 1; Danio rerio; RNA Seq	GSM8042772 r1	GSM8042772	1	4 pools each comprising 5 ventricles were sequenced per condition. Libraries for RNA seq were prepared using the "NEBNext Ultra II Directional RNA library prep Kit for Illumina" following manufacturer´s protocol		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP486526		WT_1_Directional_S1_R1_001.fastq.gz	fastq	7089416800.0	70894168.0	GSM8042772 r1	0:100	A:1855346146;C:1626812736;G:1599932420;T:2006283874;N:1041624	100	1855346146	1626812736	1599932420	2006283874	1041624	SRX23429740	SRS20284181	SRA1793874	University of Bern	University of Bern							B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	nebnext	bulk	unknown	unknown	Switzerland	2024-01-29	Undetermined	Adult	Heart	Cardiovascular System
31502	31502	SRR28411462	SRX24015869	SRS20810998	SRP497025	PRJNA1090509	The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139	GSE262169	Transcriptome Analysis	The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration but many questions remain about its exact role. Here we show that MyD88 a key component of the innate immune response controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. We find in cryoinjured myd88 / ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population. Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium and increased myofibroblasts and scarring. Notably endothelial specific overexpression of myd88 reverses these neutrophil fibrotic and scarring phenotypes. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 / untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing	parent bioproject:PRJNA1090894	pubmed:39271818	injured tissue myd88+/+ 24 hpci 2	GSM8159071	source name:cardiac ventricles\|tissue:cardiac ventricles\|cell type:ventricular cells\|genotype:myd88+/+\|treatment:cardiac cryoinjury\|geo loc name:missing\|collection date:missing	injured tissue myd88+/+ 24 hpci 2	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts	cardiac ventricles	untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction	RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture’s protocol Vazyme.		tissue:cardiac ventricles\|cell type:ventricular cells\|genotype:myd88+/+\|treatment:cardiac cryoinjury	GSM8159071	GSM8159071: injured tissue myd88+/+ 24 hpci 2; Danio rerio; RNA Seq	GSM8159071 r1	GSM8159071	1	RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP497025	loader:fastq load.py	Pinelopi_WT2_24h_pci_R1.fastq.gz	fastq	2454645976.0	33159360.0	GSM8159071 r1	0:74.03	A:660213492;C:527347733;G:572126573;T:694765347;N:192831	74	660213492	527347733	572126573	694765347	192831	SRX24015869	SRS20810998	SRA1830778	MPI for heart and lung research	MPI for heart and lung research							B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	bulk	bulk	Germany	2024-03-21	Undetermined	Undetermined	Heart	Cardiovascular System
31503	31503	SRR28411463	SRX24015868	SRS20810997	SRP497025	PRJNA1090509	The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139	GSE262169	Transcriptome Analysis	The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration but many questions remain about its exact role. Here we show that MyD88 a key component of the innate immune response controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. We find in cryoinjured myd88 / ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population. Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium and increased myofibroblasts and scarring. Notably endothelial specific overexpression of myd88 reverses these neutrophil fibrotic and scarring phenotypes. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 / untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing	parent bioproject:PRJNA1090894	pubmed:39271818	injured tissue myd88+/+ 1 hpci 2	GSM8159070	source name:cardiac ventricles\|tissue:cardiac ventricles\|cell type:ventricular cells\|genotype:myd88+/+\|treatment:cardiac cryoinjury\|geo loc name:missing\|collection date:missing	injured tissue myd88+/+ 1 hpci 2	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts	cardiac ventricles	untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction	RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture’s protocol Vazyme.		tissue:cardiac ventricles\|cell type:ventricular cells\|genotype:myd88+/+\|treatment:cardiac cryoinjury	GSM8159070	GSM8159070: injured tissue myd88+/+ 1 hpci 2; Danio rerio; RNA Seq	GSM8159070 r1	GSM8159070	1	RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP497025	loader:fastq load.py	Pinelopi_WT2_1h_pci_R1.fastq.gz	fastq	2674654542.0	36003719.0	GSM8159070 r1	0:74.29	A:713621237;C:556223861;G:630990745;T:773686189;N:132510	74	713621237	556223861	630990745	773686189	132510	SRX24015868	SRS20810997	SRA1830778	MPI for heart and lung research	MPI for heart and lung research							B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	bulk	bulk	Germany	2024-03-21	Undetermined	Undetermined	Heart	Cardiovascular System
31504	31504	SRR28411464	SRX24015867	SRS20810996	SRP497025	PRJNA1090509	The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139	GSE262169	Transcriptome Analysis	The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration but many questions remain about its exact role. Here we show that MyD88 a key component of the innate immune response controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. We find in cryoinjured myd88 / ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population. Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium and increased myofibroblasts and scarring. Notably endothelial specific overexpression of myd88 reverses these neutrophil fibrotic and scarring phenotypes. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 / untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing	parent bioproject:PRJNA1090894	pubmed:39271818	ventricle myd88+/+ untouched 2	GSM8159069	source name:cardiac ventricles\|tissue:cardiac ventricles\|cell type:ventricular cells\|genotype:myd88+/+\|treatment: \|geo loc name:missing\|collection date:missing	ventricle myd88+/+ untouched 2	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts	cardiac ventricles	untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction	RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture’s protocol Vazyme.		tissue:cardiac ventricles\|cell type:ventricular cells\|genotype:myd88+/+\|treatment:	GSM8159069	GSM8159069: ventricle myd88+/+ untouched 2; Danio rerio; RNA Seq	GSM8159069 r1	GSM8159069	1	RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP497025	loader:fastq load.py	Pinelopi_WT2_0h_pci_R1.fastq.gz	fastq	2092632406.0	28163739.0	GSM8159069 r1	0:74.30	A:560190602;C:446185315;G:485011548;T:601082958;N:161983	74	560190602	446185315	485011548	601082958	161983	SRX24015867	SRS20810996	SRA1830778	MPI for heart and lung research	MPI for heart and lung research							B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	bulk	bulk	Germany	2024-03-21	Undetermined	Undetermined	Heart	Cardiovascular System
31505	31505	SRR28411465	SRX24015866	SRS20810995	SRP497025	PRJNA1090509	The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139	GSE262169	Transcriptome Analysis	The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration but many questions remain about its exact role. Here we show that MyD88 a key component of the innate immune response controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. We find in cryoinjured myd88 / ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population. Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium and increased myofibroblasts and scarring. Notably endothelial specific overexpression of myd88 reverses these neutrophil fibrotic and scarring phenotypes. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 / untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing	parent bioproject:PRJNA1090894	pubmed:39271818	injured tissue myd88+/+ 24 hpci 1	GSM8159068	source name:cardiac ventricles\|tissue:cardiac ventricles\|cell type:ventricular cells\|genotype:myd88+/+\|treatment:cardiac cryoinjury\|geo loc name:missing\|collection date:missing	injured tissue myd88+/+ 24 hpci 1	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts	cardiac ventricles	untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction	RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture’s protocol Vazyme.		tissue:cardiac ventricles\|cell type:ventricular cells\|genotype:myd88+/+\|treatment:cardiac cryoinjury	GSM8159068	GSM8159068: injured tissue myd88+/+ 24 hpci 1; Danio rerio; RNA Seq	GSM8159068 r1	GSM8159068	1	RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP497025	loader:fastq load.py	Pinelopi_WT1_24h_pci_R1.fastq.gz	fastq	1060148110.0	14341826.0	GSM8159068 r1	0:73.92	A:290655996;C:222128471;G:247491826;T:299784598;N:87219	73	290655996	222128471	247491826	299784598	87219	SRX24015866	SRS20810995	SRA1830778	MPI for heart and lung research	MPI for heart and lung research							B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	bulk	bulk	Germany	2024-03-21	Undetermined	Undetermined	Heart	Cardiovascular System
31506	31506	SRR28411466	SRX24015865	SRS20810994	SRP497025	PRJNA1090509	The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139	GSE262169	Transcriptome Analysis	The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration but many questions remain about its exact role. Here we show that MyD88 a key component of the innate immune response controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. We find in cryoinjured myd88 / ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population. Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium and increased myofibroblasts and scarring. Notably endothelial specific overexpression of myd88 reverses these neutrophil fibrotic and scarring phenotypes. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 / untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing	parent bioproject:PRJNA1090894	pubmed:39271818	injured tissue myd88+/+ 1 hpci 1	GSM8159067	source name:cardiac ventricles\|tissue:cardiac ventricles\|cell type:ventricular cells\|genotype:myd88+/+\|treatment:cardiac cryoinjury\|geo loc name:missing\|collection date:missing	injured tissue myd88+/+ 1 hpci 1	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts	cardiac ventricles	untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction	RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture’s protocol Vazyme.		tissue:cardiac ventricles\|cell type:ventricular cells\|genotype:myd88+/+\|treatment:cardiac cryoinjury	GSM8159067	GSM8159067: injured tissue myd88+/+ 1 hpci 1; Danio rerio; RNA Seq	GSM8159067 r1	GSM8159067	1	RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP497025	loader:fastq load.py	Pinelopi_WT1_1h_pci_R1.fastq.gz	fastq	2594786024.0	34913792.0	GSM8159067 r1	0:74.32	A:689702458;C:551265040;G:603307580;T:750425733;N:85213	74	689702458	551265040	603307580	750425733	85213	SRX24015865	SRS20810994	SRA1830778	MPI for heart and lung research	MPI for heart and lung research							B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	bulk	bulk	Germany	2024-03-21	Undetermined	Undetermined	Heart	Cardiovascular System
31507	31507	SRR28411467	SRX24015864	SRS20810993	SRP497025	PRJNA1090509	The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139	GSE262169	Transcriptome Analysis	The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration but many questions remain about its exact role. Here we show that MyD88 a key component of the innate immune response controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. We find in cryoinjured myd88 / ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population. Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium and increased myofibroblasts and scarring. Notably endothelial specific overexpression of myd88 reverses these neutrophil fibrotic and scarring phenotypes. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 / untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing	parent bioproject:PRJNA1090894	pubmed:39271818	ventricle myd88+/+ untouched 1	GSM8159066	source name:cardiac ventricles\|tissue:cardiac ventricles\|cell type:ventricular cells\|genotype:myd88+/+\|treatment: \|geo loc name:missing\|collection date:missing	ventricle myd88+/+ untouched 1	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts	cardiac ventricles	untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction	RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture’s protocol Vazyme.		tissue:cardiac ventricles\|cell type:ventricular cells\|genotype:myd88+/+\|treatment:	GSM8159066	GSM8159066: ventricle myd88+/+ untouched 1; Danio rerio; RNA Seq	GSM8159066 r1	GSM8159066	1	RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP497025	loader:fastq load.py	Pinelopi_WT1_0h_pci_R1.fastq.gz	fastq	2123516005.0	28595227.0	GSM8159066 r1	0:74.26	A:562046544;C:458761205;G:496224794;T:606313940;N:169522	74	562046544	458761205	496224794	606313940	169522	SRX24015864	SRS20810993	SRA1830778	MPI for heart and lung research	MPI for heart and lung research							B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	bulk	bulk	Germany	2024-03-21	Undetermined	Undetermined	Heart	Cardiovascular System
31508	31508	SRR28411468	SRX24015863	SRS20810992	SRP497025	PRJNA1090509	The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139	GSE262169	Transcriptome Analysis	The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration but many questions remain about its exact role. Here we show that MyD88 a key component of the innate immune response controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. We find in cryoinjured myd88 / ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population. Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium and increased myofibroblasts and scarring. Notably endothelial specific overexpression of myd88 reverses these neutrophil fibrotic and scarring phenotypes. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 / untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing	parent bioproject:PRJNA1090894	pubmed:39271818	injured tissue myd88 / 24 hpci 2	GSM8159065	source name:cardiac ventricles\|tissue:cardiac ventricles\|cell type:ventricular cells\|genotype:myd88 / \|treatment:cardiac cryoinjury\|geo loc name:missing\|collection date:missing	injured tissue myd88 / 24 hpci 2	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts	cardiac ventricles	untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction	RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture’s protocol Vazyme.		tissue:cardiac ventricles\|cell type:ventricular cells\|genotype:myd88 / \|treatment:cardiac cryoinjury	GSM8159065	GSM8159065: injured tissue myd88 / 24 hpci 2; Danio rerio; RNA Seq	GSM8159065 r1	GSM8159065	1	RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP497025	loader:fastq load.py	Pinelopi_Homo2_24h_pci_R1.fastq.gz	fastq	2509143345.0	33915175.0	GSM8159065 r1	0:73.98	A:669128241;C:547606289;G:587771598;T:704439682;N:197535	73	669128241	547606289	587771598	704439682	197535	SRX24015863	SRS20810992	SRA1830778	MPI for heart and lung research	MPI for heart and lung research							B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	bulk	bulk	Germany	2024-03-21	Undetermined	Undetermined	Heart	Cardiovascular System
31509	31509	SRR28411469	SRX24015862	SRS20810991	SRP497025	PRJNA1090509	The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139	GSE262169	Transcriptome Analysis	The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration but many questions remain about its exact role. Here we show that MyD88 a key component of the innate immune response controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. We find in cryoinjured myd88 / ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population. Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium and increased myofibroblasts and scarring. Notably endothelial specific overexpression of myd88 reverses these neutrophil fibrotic and scarring phenotypes. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 / untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing	parent bioproject:PRJNA1090894	pubmed:39271818	injured tissue myd88 / 1 hpci 2	GSM8159064	source name:cardiac ventricles\|tissue:cardiac ventricles\|cell type:ventricular cells\|genotype:myd88 / \|treatment:cardiac cryoinjury\|geo loc name:missing\|collection date:missing	injured tissue myd88 / 1 hpci 2	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts	cardiac ventricles	untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction	RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture’s protocol Vazyme.		tissue:cardiac ventricles\|cell type:ventricular cells\|genotype:myd88 / \|treatment:cardiac cryoinjury	GSM8159064	GSM8159064: injured tissue myd88 / 1 hpci 2; Danio rerio; RNA Seq	GSM8159064 r1	GSM8159064	1	RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP497025	loader:fastq load.py	Pinelopi_Homo2_1h_pci_R1.fastq.gz	fastq	2584847185.0	34784917.0	GSM8159064 r1	0:74.31	A:690941775;C:542509296;G:605002938;T:746301098;N:92078	74	690941775	542509296	605002938	746301098	92078	SRX24015862	SRS20810991	SRA1830778	MPI for heart and lung research	MPI for heart and lung research							B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	bulk	bulk	Germany	2024-03-21	Undetermined	Undetermined	Heart	Cardiovascular System
31510	31510	SRR28411470	SRX24015861	SRS20810990	SRP497025	PRJNA1090509	The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139	GSE262169	Transcriptome Analysis	The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration but many questions remain about its exact role. Here we show that MyD88 a key component of the innate immune response controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. We find in cryoinjured myd88 / ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population. Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium and increased myofibroblasts and scarring. Notably endothelial specific overexpression of myd88 reverses these neutrophil fibrotic and scarring phenotypes. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 / untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing	parent bioproject:PRJNA1090894	pubmed:39271818	ventricle myd88 / untouched 2	GSM8159063	source name:cardiac ventricles\|tissue:cardiac ventricles\|cell type:ventricular cells\|genotype:myd88 / \|treatment: \|geo loc name:missing\|collection date:missing	ventricle myd88 / untouched 2	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts	cardiac ventricles	untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction	RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture’s protocol Vazyme.		tissue:cardiac ventricles\|cell type:ventricular cells\|genotype:myd88 / \|treatment:	GSM8159063	GSM8159063: ventricle myd88 / untouched 2; Danio rerio; RNA Seq	GSM8159063 r1	GSM8159063	1	RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP497025	loader:fastq load.py	Pinelopi_Homo2_0h_pci_R1.fastq.gz	fastq	2178164776.0	29313471.0	GSM8159063 r1	0:74.31	A:588370831;C:457110464;G:507924919;T:624586577;N:171985	74	588370831	457110464	507924919	624586577	171985	SRX24015861	SRS20810990	SRA1830778	MPI for heart and lung research	MPI for heart and lung research							B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	bulk	bulk	Germany	2024-03-21	Undetermined	Undetermined	Heart	Cardiovascular System
31511	31511	SRR28411471	SRX24015860	SRS20810989	SRP497025	PRJNA1090509	The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139	GSE262169	Transcriptome Analysis	The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration but many questions remain about its exact role. Here we show that MyD88 a key component of the innate immune response controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. We find in cryoinjured myd88 / ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population. Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium and increased myofibroblasts and scarring. Notably endothelial specific overexpression of myd88 reverses these neutrophil fibrotic and scarring phenotypes. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 / untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing	parent bioproject:PRJNA1090894	pubmed:39271818	injured tissue myd88 / 24 hpci 1	GSM8159062	source name:cardiac ventricles\|tissue:cardiac ventricles\|cell type:ventricular cells\|genotype:myd88 / \|treatment:cardiac cryoinjury\|geo loc name:missing\|collection date:missing	injured tissue myd88 / 24 hpci 1	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts	cardiac ventricles	untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction	RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture’s protocol Vazyme.		tissue:cardiac ventricles\|cell type:ventricular cells\|genotype:myd88 / \|treatment:cardiac cryoinjury	GSM8159062	GSM8159062: injured tissue myd88 / 24 hpci 1; Danio rerio; RNA Seq	GSM8159062 r1	GSM8159062	1	RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP497025	loader:fastq load.py	Pinelopi_Homo1_24h_pci_R1.fastq.gz	fastq	2323298254.0	31332951.0	GSM8159062 r1	0:74.15	A:621931320;C:501998000;G:541224122;T:657957821;N:186991	74	621931320	501998000	541224122	657957821	186991	SRX24015860	SRS20810989	SRA1830778	MPI for heart and lung research	MPI for heart and lung research							B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	bulk	bulk	Germany	2024-03-21	Undetermined	Undetermined	Heart	Cardiovascular System
31512	31512	SRR28411472	SRX24015859	SRS20810988	SRP497025	PRJNA1090509	The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139	GSE262169	Transcriptome Analysis	The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration but many questions remain about its exact role. Here we show that MyD88 a key component of the innate immune response controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. We find in cryoinjured myd88 / ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population. Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium and increased myofibroblasts and scarring. Notably endothelial specific overexpression of myd88 reverses these neutrophil fibrotic and scarring phenotypes. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 / untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing	parent bioproject:PRJNA1090894	pubmed:39271818	injured tissue myd88 / 1 hpci 1	GSM8159061	source name:cardiac ventricles\|tissue:cardiac ventricles\|cell type:ventricular cells\|genotype:myd88 / \|treatment:cardiac cryoinjury\|geo loc name:missing\|collection date:missing	injured tissue myd88 / 1 hpci 1	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts	cardiac ventricles	untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction	RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture’s protocol Vazyme.		tissue:cardiac ventricles\|cell type:ventricular cells\|genotype:myd88 / \|treatment:cardiac cryoinjury	GSM8159061	GSM8159061: injured tissue myd88 / 1 hpci 1; Danio rerio; RNA Seq	GSM8159061 r1	GSM8159061	1	RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP497025	loader:fastq load.py	Pinelopi_Homo1_1h_pci_R1.fastq.gz	fastq	2585736865.0	34790236.0	GSM8159061 r1	0:74.32	A:679380332;C:554919862;G:604907160;T:746451941;N:77570	74	679380332	554919862	604907160	746451941	77570	SRX24015859	SRS20810988	SRA1830778	MPI for heart and lung research	MPI for heart and lung research							B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	bulk	bulk	Germany	2024-03-21	Undetermined	Undetermined	Heart	Cardiovascular System
31513	31513	SRR28411473	SRX24015858	SRS20810987	SRP497025	PRJNA1090509	The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139	GSE262169	Transcriptome Analysis	The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration but many questions remain about its exact role. Here we show that MyD88 a key component of the innate immune response controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. We find in cryoinjured myd88 / ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population. Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium and increased myofibroblasts and scarring. Notably endothelial specific overexpression of myd88 reverses these neutrophil fibrotic and scarring phenotypes. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 / untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing	parent bioproject:PRJNA1090894	pubmed:39271818	ventricle myd88 / untouched 1	GSM8159060	source name:cardiac ventricles\|tissue:cardiac ventricles\|cell type:ventricular cells\|genotype:myd88 / \|treatment: \|geo loc name:missing\|collection date:missing	ventricle myd88 / untouched 1	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts	cardiac ventricles	untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction	RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture’s protocol Vazyme.		tissue:cardiac ventricles\|cell type:ventricular cells\|genotype:myd88 / \|treatment:	GSM8159060	GSM8159060: ventricle myd88 / untouched 1; Danio rerio; RNA Seq	GSM8159060 r1	GSM8159060	1	RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP497025	loader:fastq load.py	Pinelopi_Homo1_0h_pci_R1.fastq.gz	fastq	2321007700.0	31228476.0	GSM8159060 r1	0:74.32	A:623574024;C:490503071;G:538918126;T:667825381;N:187098	74	623574024	490503071	538918126	667825381	187098	SRX24015858	SRS20810987	SRA1830778	MPI for heart and lung research	MPI for heart and lung research							B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	bulk	bulk	Germany	2024-03-21	Undetermined	Undetermined	Heart	Cardiovascular System
31896	31896	SRR28745432	SRX24311225	SRS21073227	SRP502845	PRJNA1102356	flt1 inactivation promotes zebrafish cardiac regeneration by enhancing endothelial activity and limiting the fibrotic response	GSE264406	Transcriptome Analysis	VEGFA administration has been explored as a pro angiogenic therapy for cardiovascular diseases including heart failure for several years; however many challenges remain. Here we investigate a different approach to augmenting VEGFA bioavailability one that achieves more physiological VEGFA concentrations by deleting VEGFR1/FLT1 a VEGFA decoy receptor. We find that following cryoinjury zebrafish flt1 mutant hearts display enhanced coronary revascularization and endocardial expansion increased cardiomyocyte dedifferentiation and proliferation and decreased scarring. Suppressing Vegfa signaling in flt1 mutants abrogates the beneficial effects of flt1 deletion. Transcriptomic analyses of cryoinjured flt1 mutant hearts revealed enhanced endothelial MAPK/ERK signaling and downregulation of the transcription factor gene egr3. Using genetic tools we observe egr3 upregulation in the regenerating endocardium and find that Egr3 promotes myofibroblast differentiation. These data suggest that with enhanced VEGFA bioavailability the cardiac endothelium limits myofibroblast differentiation via egr3 downregulation thereby providing a more permissive microenvironment for cardiomyocyte xxx post injury. Overall design: Comparative gene expression analysis between cryoinjured wild type zebrafish ventricles and flt1 mutant ventricles at 96 hours post cryoinjury.		pubmed:39612288	wild type heart 96 hours post cryoinjury 3	GSM8217704	source name:heart ventricle border z1 and injured area\|tissue:heart ventricle border z1 and injured area\|genotype:wild type\|treatment:cardiac cryoinjury\|geo loc name:missing\|collection date:missing	wild type heart 96 hours post cryoinjury 3	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Bolger et al. Trimmomatic: a flexible trimmer for Illumina sequence data. Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Aligned reads were filtered to remove: duplicates with Picard 3.0.0 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.4 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The raw count matrix was normalized with DESeq2 version 1.36.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: danRer11 Supplementary files format and content: library size normlized count matrix	heart ventricle border zone and injured area		A pool of 5 ventricles was used per biological replicate. Total RNA was isolated using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase Free DNase Set Qiagen 4µg of total RNA was used as input for VAHTS Stranded mRNA seq V6 Library preparation following manufacture’s protocol Vazyme.		tissue:heart ventricle border z1 and injured area\|genotype:wild type\|treatment:cardiac cryoinjury	GSM8217704	GSM8217704: wild type heart 96 hours post cryoinjury 3; Danio rerio; RNA Seq	GSM8217704 r1	GSM8217704	1	A pool of 5 ventricles was used per biological replicate. Total RNA was isolated using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase Free DNase Set Qiagen 4µg of total RNA was used as input for VAHTS Stranded mRNA seq V6 Library preparation following manufacture's protocol Vazyme.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP502845	loader:fastq load.py	E23_4173_Armaad_Lib_WT3_R1.fastq.gz	fastq	3257983192.0	47556048.0	GSM8217704 r1	0:68.51	A:848972796;C:741588101;G:760680137;T:905607069;N:1135089	68	848972796	741588101	760680137	905607069	1135089	SRX24311225	SRS21073227	SRA1849558	MPI for heart and lung research	MPI for heart and lung research	1	0.94185	0.087	0.72478	0.50388	72	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Germany	2024-04-19	Undetermined	Undetermined	Heart	Cardiovascular System
31897	31897	SRR28745433	SRX24311224	SRS21073229	SRP502845	PRJNA1102356	flt1 inactivation promotes zebrafish cardiac regeneration by enhancing endothelial activity and limiting the fibrotic response	GSE264406	Transcriptome Analysis	VEGFA administration has been explored as a pro angiogenic therapy for cardiovascular diseases including heart failure for several years; however many challenges remain. Here we investigate a different approach to augmenting VEGFA bioavailability one that achieves more physiological VEGFA concentrations by deleting VEGFR1/FLT1 a VEGFA decoy receptor. We find that following cryoinjury zebrafish flt1 mutant hearts display enhanced coronary revascularization and endocardial expansion increased cardiomyocyte dedifferentiation and proliferation and decreased scarring. Suppressing Vegfa signaling in flt1 mutants abrogates the beneficial effects of flt1 deletion. Transcriptomic analyses of cryoinjured flt1 mutant hearts revealed enhanced endothelial MAPK/ERK signaling and downregulation of the transcription factor gene egr3. Using genetic tools we observe egr3 upregulation in the regenerating endocardium and find that Egr3 promotes myofibroblast differentiation. These data suggest that with enhanced VEGFA bioavailability the cardiac endothelium limits myofibroblast differentiation via egr3 downregulation thereby providing a more permissive microenvironment for cardiomyocyte xxx post injury. Overall design: Comparative gene expression analysis between cryoinjured wild type zebrafish ventricles and flt1 mutant ventricles at 96 hours post cryoinjury.		pubmed:39612288	wild type heart 96 hours post cryoinjury 2	GSM8217703	source name:heart ventricle border z1 and injured area\|tissue:heart ventricle border z1 and injured area\|genotype:wild type\|treatment:cardiac cryoinjury\|geo loc name:missing\|collection date:missing	wild type heart 96 hours post cryoinjury 2	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Bolger et al. Trimmomatic: a flexible trimmer for Illumina sequence data. Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Aligned reads were filtered to remove: duplicates with Picard 3.0.0 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.4 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The raw count matrix was normalized with DESeq2 version 1.36.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: danRer11 Supplementary files format and content: library size normlized count matrix	heart ventricle border zone and injured area		A pool of 5 ventricles was used per biological replicate. Total RNA was isolated using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase Free DNase Set Qiagen 4µg of total RNA was used as input for VAHTS Stranded mRNA seq V6 Library preparation following manufacture’s protocol Vazyme.		tissue:heart ventricle border z1 and injured area\|genotype:wild type\|treatment:cardiac cryoinjury	GSM8217703	GSM8217703: wild type heart 96 hours post cryoinjury 2; Danio rerio; RNA Seq	GSM8217703 r1	GSM8217703	1	A pool of 5 ventricles was used per biological replicate. Total RNA was isolated using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase Free DNase Set Qiagen 4µg of total RNA was used as input for VAHTS Stranded mRNA seq V6 Library preparation following manufacture's protocol Vazyme.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP502845	loader:fastq load.py	E23_4173_Armaad_Lib_WT2_R1.fastq.gz	fastq	3864619254.0	56519751.0	GSM8217703 r1	0:68.38	A:1003402543;C:880721584;G:903469106;T:1075304136;N:1721885	68	1003402543	880721584	903469106	1075304136	1721885	SRX24311224	SRS21073229	SRA1849558	MPI for heart and lung research	MPI for heart and lung research	1	0.93928	0.08915	0.72348	0.49993	71	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Germany	2024-04-19	Undetermined	Undetermined	Heart	Cardiovascular System
31898	31898	SRR28745434	SRX24311223	SRS21073228	SRP502845	PRJNA1102356	flt1 inactivation promotes zebrafish cardiac regeneration by enhancing endothelial activity and limiting the fibrotic response	GSE264406	Transcriptome Analysis	VEGFA administration has been explored as a pro angiogenic therapy for cardiovascular diseases including heart failure for several years; however many challenges remain. Here we investigate a different approach to augmenting VEGFA bioavailability one that achieves more physiological VEGFA concentrations by deleting VEGFR1/FLT1 a VEGFA decoy receptor. We find that following cryoinjury zebrafish flt1 mutant hearts display enhanced coronary revascularization and endocardial expansion increased cardiomyocyte dedifferentiation and proliferation and decreased scarring. Suppressing Vegfa signaling in flt1 mutants abrogates the beneficial effects of flt1 deletion. Transcriptomic analyses of cryoinjured flt1 mutant hearts revealed enhanced endothelial MAPK/ERK signaling and downregulation of the transcription factor gene egr3. Using genetic tools we observe egr3 upregulation in the regenerating endocardium and find that Egr3 promotes myofibroblast differentiation. These data suggest that with enhanced VEGFA bioavailability the cardiac endothelium limits myofibroblast differentiation via egr3 downregulation thereby providing a more permissive microenvironment for cardiomyocyte xxx post injury. Overall design: Comparative gene expression analysis between cryoinjured wild type zebrafish ventricles and flt1 mutant ventricles at 96 hours post cryoinjury.		pubmed:39612288	wild type heart 96 hours post cryoinjury 1	GSM8217702	source name:heart ventricle border z1 and injured area\|tissue:heart ventricle border z1 and injured area\|genotype:wild type\|treatment:cardiac cryoinjury\|geo loc name:missing\|collection date:missing	wild type heart 96 hours post cryoinjury 1	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Bolger et al. Trimmomatic: a flexible trimmer for Illumina sequence data. Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Aligned reads were filtered to remove: duplicates with Picard 3.0.0 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.4 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The raw count matrix was normalized with DESeq2 version 1.36.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: danRer11 Supplementary files format and content: library size normlized count matrix	heart ventricle border zone and injured area		A pool of 5 ventricles was used per biological replicate. Total RNA was isolated using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase Free DNase Set Qiagen 4µg of total RNA was used as input for VAHTS Stranded mRNA seq V6 Library preparation following manufacture’s protocol Vazyme.		tissue:heart ventricle border z1 and injured area\|genotype:wild type\|treatment:cardiac cryoinjury	GSM8217702	GSM8217702: wild type heart 96 hours post cryoinjury 1; Danio rerio; RNA Seq	GSM8217702 r1	GSM8217702	1	A pool of 5 ventricles was used per biological replicate. Total RNA was isolated using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase Free DNase Set Qiagen 4µg of total RNA was used as input for VAHTS Stranded mRNA seq V6 Library preparation following manufacture's protocol Vazyme.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP502845	loader:fastq load.py	E23_4173_Armaad_Lib_WT1_R1.fastq.gz	fastq	3571478400.0	52133215.0	GSM8217702 r1	0:68.51	A:928171678;C:814216251;G:835024543;T:992630615;N:1435313	68	928171678	814216251	835024543	992630615	1435313	SRX24311223	SRS21073228	SRA1849558	MPI for heart and lung research	MPI for heart and lung research	1	0.94111	0.08647	0.72922	0.50812	42	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Germany	2024-04-19	Undetermined	Undetermined	Heart	Cardiovascular System
31899	31899	SRR28745435	SRX24311222	SRS21073226	SRP502845	PRJNA1102356	flt1 inactivation promotes zebrafish cardiac regeneration by enhancing endothelial activity and limiting the fibrotic response	GSE264406	Transcriptome Analysis	VEGFA administration has been explored as a pro angiogenic therapy for cardiovascular diseases including heart failure for several years; however many challenges remain. Here we investigate a different approach to augmenting VEGFA bioavailability one that achieves more physiological VEGFA concentrations by deleting VEGFR1/FLT1 a VEGFA decoy receptor. We find that following cryoinjury zebrafish flt1 mutant hearts display enhanced coronary revascularization and endocardial expansion increased cardiomyocyte dedifferentiation and proliferation and decreased scarring. Suppressing Vegfa signaling in flt1 mutants abrogates the beneficial effects of flt1 deletion. Transcriptomic analyses of cryoinjured flt1 mutant hearts revealed enhanced endothelial MAPK/ERK signaling and downregulation of the transcription factor gene egr3. Using genetic tools we observe egr3 upregulation in the regenerating endocardium and find that Egr3 promotes myofibroblast differentiation. These data suggest that with enhanced VEGFA bioavailability the cardiac endothelium limits myofibroblast differentiation via egr3 downregulation thereby providing a more permissive microenvironment for cardiomyocyte xxx post injury. Overall design: Comparative gene expression analysis between cryoinjured wild type zebrafish ventricles and flt1 mutant ventricles at 96 hours post cryoinjury.		pubmed:39612288	flt1 mutant heart 96 hours post cryoinjury 3	GSM8217701	source name:heart ventricle border z1 and injured area\|tissue:heart ventricle border z1 and injured area\|genotype:flt1bns29/bns29\|treatment:cardiac cryoinjury\|geo loc name:missing\|collection date:missing	flt1 mutant heart 96 hours post cryoinjury 3	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Bolger et al. Trimmomatic: a flexible trimmer for Illumina sequence data. Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Aligned reads were filtered to remove: duplicates with Picard 3.0.0 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.4 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The raw count matrix was normalized with DESeq2 version 1.36.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: danRer11 Supplementary files format and content: library size normlized count matrix	heart ventricle border zone and injured area		A pool of 5 ventricles was used per biological replicate. Total RNA was isolated using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase Free DNase Set Qiagen 4µg of total RNA was used as input for VAHTS Stranded mRNA seq V6 Library preparation following manufacture’s protocol Vazyme.		tissue:heart ventricle border z1 and injured area\|genotype:flt1bns29/bns29\|treatment:cardiac cryoinjury	GSM8217701	GSM8217701: flt1 mutant heart 96 hours post cryoinjury 3; Danio rerio; RNA Seq	GSM8217701 r1	GSM8217701	1	A pool of 5 ventricles was used per biological replicate. Total RNA was isolated using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase Free DNase Set Qiagen 4µg of total RNA was used as input for VAHTS Stranded mRNA seq V6 Library preparation following manufacture's protocol Vazyme.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP502845	loader:fastq load.py	E23_4173_Armaad_Lib_FLT_MUT3_R1.fastq.gz	fastq	4085359270.0	59673604.0	GSM8217701 r1	0:68.46	A:1050667797;C:938174838;G:953989485;T:1140941596;N:1585554	68	1050667797	938174838	953989485	1140941596	1585554	SRX24311222	SRS21073226	SRA1849558	MPI for heart and lung research	MPI for heart and lung research	1	0.94035	0.08631	0.72376	0.49828	69	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Germany	2024-04-19	Undetermined	Undetermined	Heart	Cardiovascular System
31900	31900	SRR28745436	SRX24311221	SRS21073225	SRP502845	PRJNA1102356	flt1 inactivation promotes zebrafish cardiac regeneration by enhancing endothelial activity and limiting the fibrotic response	GSE264406	Transcriptome Analysis	VEGFA administration has been explored as a pro angiogenic therapy for cardiovascular diseases including heart failure for several years; however many challenges remain. Here we investigate a different approach to augmenting VEGFA bioavailability one that achieves more physiological VEGFA concentrations by deleting VEGFR1/FLT1 a VEGFA decoy receptor. We find that following cryoinjury zebrafish flt1 mutant hearts display enhanced coronary revascularization and endocardial expansion increased cardiomyocyte dedifferentiation and proliferation and decreased scarring. Suppressing Vegfa signaling in flt1 mutants abrogates the beneficial effects of flt1 deletion. Transcriptomic analyses of cryoinjured flt1 mutant hearts revealed enhanced endothelial MAPK/ERK signaling and downregulation of the transcription factor gene egr3. Using genetic tools we observe egr3 upregulation in the regenerating endocardium and find that Egr3 promotes myofibroblast differentiation. These data suggest that with enhanced VEGFA bioavailability the cardiac endothelium limits myofibroblast differentiation via egr3 downregulation thereby providing a more permissive microenvironment for cardiomyocyte xxx post injury. Overall design: Comparative gene expression analysis between cryoinjured wild type zebrafish ventricles and flt1 mutant ventricles at 96 hours post cryoinjury.		pubmed:39612288	flt1 mutant heart 96 hours post cryoinjury 2	GSM8217700	source name:heart ventricle border z1 and injured area\|tissue:heart ventricle border z1 and injured area\|genotype:flt1bns29/bns29\|treatment:cardiac cryoinjury\|geo loc name:missing\|collection date:missing	flt1 mutant heart 96 hours post cryoinjury 2	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Bolger et al. Trimmomatic: a flexible trimmer for Illumina sequence data. Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Aligned reads were filtered to remove: duplicates with Picard 3.0.0 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.4 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The raw count matrix was normalized with DESeq2 version 1.36.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: danRer11 Supplementary files format and content: library size normlized count matrix	heart ventricle border zone and injured area		A pool of 5 ventricles was used per biological replicate. Total RNA was isolated using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase Free DNase Set Qiagen 4µg of total RNA was used as input for VAHTS Stranded mRNA seq V6 Library preparation following manufacture’s protocol Vazyme.		tissue:heart ventricle border z1 and injured area\|genotype:flt1bns29/bns29\|treatment:cardiac cryoinjury	GSM8217700	GSM8217700: flt1 mutant heart 96 hours post cryoinjury 2; Danio rerio; RNA Seq	GSM8217700 r1	GSM8217700	1	A pool of 5 ventricles was used per biological replicate. Total RNA was isolated using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase Free DNase Set Qiagen 4µg of total RNA was used as input for VAHTS Stranded mRNA seq V6 Library preparation following manufacture's protocol Vazyme.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP502845	loader:fastq load.py	E23_4173_Armaad_Lib_FLT_MUT2_R1.fastq.gz	fastq	4696922408.0	68645737.0	GSM8217700 r1	0:68.42	A:1220019708;C:1072448104;G:1106194472;T:1296618556;N:1641568	68	1220019708	1072448104	1106194472	1296618556	1641568	SRX24311221	SRS21073225	SRA1849558	MPI for heart and lung research	MPI for heart and lung research	1	0.94205	0.08792	0.72543	0.50566	72	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Germany	2024-04-19	Undetermined	Undetermined	Heart	Cardiovascular System
31901	31901	SRR28745437	SRX24311220	SRS21073224	SRP502845	PRJNA1102356	flt1 inactivation promotes zebrafish cardiac regeneration by enhancing endothelial activity and limiting the fibrotic response	GSE264406	Transcriptome Analysis	VEGFA administration has been explored as a pro angiogenic therapy for cardiovascular diseases including heart failure for several years; however many challenges remain. Here we investigate a different approach to augmenting VEGFA bioavailability one that achieves more physiological VEGFA concentrations by deleting VEGFR1/FLT1 a VEGFA decoy receptor. We find that following cryoinjury zebrafish flt1 mutant hearts display enhanced coronary revascularization and endocardial expansion increased cardiomyocyte dedifferentiation and proliferation and decreased scarring. Suppressing Vegfa signaling in flt1 mutants abrogates the beneficial effects of flt1 deletion. Transcriptomic analyses of cryoinjured flt1 mutant hearts revealed enhanced endothelial MAPK/ERK signaling and downregulation of the transcription factor gene egr3. Using genetic tools we observe egr3 upregulation in the regenerating endocardium and find that Egr3 promotes myofibroblast differentiation. These data suggest that with enhanced VEGFA bioavailability the cardiac endothelium limits myofibroblast differentiation via egr3 downregulation thereby providing a more permissive microenvironment for cardiomyocyte xxx post injury. Overall design: Comparative gene expression analysis between cryoinjured wild type zebrafish ventricles and flt1 mutant ventricles at 96 hours post cryoinjury.		pubmed:39612288	flt1 mutant heart 96 hours post cryoinjury 1	GSM8217699	source name:heart ventricle border z1 and injured area\|tissue:heart ventricle border z1 and injured area\|genotype:flt1bns29/bns29\|treatment:cardiac cryoinjury\|geo loc name:missing\|collection date:missing	flt1 mutant heart 96 hours post cryoinjury 1	Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Bolger et al. Trimmomatic: a flexible trimmer for Illumina sequence data. Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Aligned reads were filtered to remove: duplicates with Picard 3.0.0 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.4 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The raw count matrix was normalized with DESeq2 version 1.36.0 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: danRer11 Supplementary files format and content: library size normlized count matrix	heart ventricle border zone and injured area		A pool of 5 ventricles was used per biological replicate. Total RNA was isolated using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase Free DNase Set Qiagen 4µg of total RNA was used as input for VAHTS Stranded mRNA seq V6 Library preparation following manufacture’s protocol Vazyme.		tissue:heart ventricle border z1 and injured area\|genotype:flt1bns29/bns29\|treatment:cardiac cryoinjury	GSM8217699	GSM8217699: flt1 mutant heart 96 hours post cryoinjury 1; Danio rerio; RNA Seq	GSM8217699 r1	GSM8217699	1	A pool of 5 ventricles was used per biological replicate. Total RNA was isolated using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase Free DNase Set Qiagen 4µg of total RNA was used as input for VAHTS Stranded mRNA seq V6 Library preparation following manufacture's protocol Vazyme.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 2000	SRP502845	loader:fastq load.py	E23_4173_Armaad_Lib_FLT_MUT1_R1.fastq.gz	fastq	2897934017.0	42657803.0	GSM8217699 r1	0:67.93	A:749045495;C:662930035;G:683478060;T:800853726;N:1626701	67	749045495	662930035	683478060	800853726	1626701	SRX24311220	SRS21073224	SRA1849558	MPI for heart and lung research	MPI for heart and lung research	1	0.94107	0.08304	0.72579	0.50482	72	B	usable mapping rate	illumina	nextseq_v2	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Germany	2024-04-19	Undetermined	Undetermined	Heart	Cardiovascular System
36641	36641	SRR700539	SRX233125	SRS393099	SRP018538	PRJNA189226	Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos	GSE44233	Transcriptome Analysis	The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed.		pubmed:23850773	Seq15	GSM1081113	tissue:sorted cardiomyocytes\|developmental stage:24hpf\|transgenic line:tgmyl7::gfp\|experimental group:Gata4 morphant	Seq15	Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel.	sorted cardiomyocytes	Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation.	RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol.	Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish.	developmental stage:24hpf\|transgenic line:tgmyl7::gfp\|experimental group:Gata4 morphant	GSM1081113	GSM1081113: Seq15; Danio rerio; RNA Seq	GSM1081113 1		1		GEO Accession:GSM1081113	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP018538				1505008521.0	29509971.0	GSM1081113 r1	0:51	A:394410844;C:370013758;G:356489603;T:384055071;N:39245	51	394410844	370013758	356489603	384055071	39245	SRX233125	SRS393099	SRA066447	GEO	Todd Evans Lab, Cell and Developmental Biology, Weill Cornell	1	0.9123	0.07373	0.71346	0.47555	51	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	trueseq	bulk	bulk	bulk	United States	2013-02-11	Pharyngula	Embryo	Heart	Cardiovascular System
36642	36642	SRR700538	SRX233124	SRS393098	SRP018538	PRJNA189226	Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos	GSE44233	Transcriptome Analysis	The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed.		pubmed:23850773	Seq14	GSM1081112	tissue:sorted cardiomyocytes\|developmental stage:24hpf\|transgenic line:tgmyl7::gfp\|experimental group:Gata4 morphant	Seq14	Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel.	sorted cardiomyocytes	Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation.	RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol.	Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish.	developmental stage:24hpf\|transgenic line:tgmyl7::gfp\|experimental group:Gata4 morphant	GSM1081112	GSM1081112: Seq14; Danio rerio; RNA Seq	GSM1081112 1		1		GEO Accession:GSM1081112	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP018538		seq14.txt.gz	fastq	3144425502.0	61655402.0	GSM1081112 r1	0:51	A:825172912;C:756354008;G:742919584;T:819897573;N:81425	51	825172912	756354008	742919584	819897573	81425	SRX233124	SRS393098	SRA066447	GEO	Todd Evans Lab, Cell and Developmental Biology, Weill Cornell	1	0.93659	0.0806	0.73716	0.47614	51	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	trueseq	bulk	bulk	bulk	United States	2013-02-11	Pharyngula	Embryo	Heart	Cardiovascular System
36643	36643	SRR700537	SRX233123	SRS393097	SRP018538	PRJNA189226	Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos	GSE44233	Transcriptome Analysis	The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed.		pubmed:23850773	Seq11	GSM1081111	tissue:sorted cardiomyocytes\|developmental stage:24hpf\|transgenic line:tgmyl7::gfp\|experimental group:Gata4 morphant	Seq11	Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel.	sorted cardiomyocytes	Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation.	RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol.	Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish.	developmental stage:24hpf\|transgenic line:tgmyl7::gfp\|experimental group:Gata4 morphant	GSM1081111	GSM1081111: Seq11; Danio rerio; RNA Seq	GSM1081111 1		1		GEO Accession:GSM1081111	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina Genome Analyzer II	SRP018538				1364181264.0	37893924.0	GSM1081111 r1	0:36	A:362442341;C:297159061;G:406723961;T:297355968;N:499933	36	362442341	297159061	406723961	297355968	499933	SRX233123	SRS393097	SRA066447	GEO	Todd Evans Lab, Cell and Developmental Biology, Weill Cornell	1	0.67174	0.07612	0.74416	0.48016	36	B	usable mapping rate	illumina	early_illumina	full_length	random_priming	trueseq	bulk	bulk	bulk	United States	2013-02-11	Pharyngula	Embryo	Heart	Cardiovascular System
36644	36644	SRR700536	SRX233122	SRS393096	SRP018538	PRJNA189226	Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos	GSE44233	Transcriptome Analysis	The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed.		pubmed:23850773	Seq13	GSM1081110	tissue:sorted cardiomyocytes\|developmental stage:24hpf\|transgenic line:tgmyl7::gfp\|experimental group:Wildtype	Seq13	Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel.	sorted cardiomyocytes	Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation.	RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol.	Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish.	developmental stage:24hpf\|transgenic line:tgmyl7::gfp\|experimental group:Wildtype	GSM1081110	GSM1081110: Seq13; Danio rerio; RNA Seq	GSM1081110 1		1		GEO Accession:GSM1081110	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP018538		seq13.txt.gz	fastq	1693675269.0	33209319.0	GSM1081110 r1	0:51	A:443719209;C:411369010;G:404182982;T:434361031;N:43037	51	443719209	411369010	404182982	434361031	43037	SRX233122	SRS393096	SRA066447	GEO	Todd Evans Lab, Cell and Developmental Biology, Weill Cornell	1	0.91781	0.08107	0.74976	0.46528	51	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	trueseq	bulk	bulk	bulk	United States	2013-02-11	Pharyngula	Embryo	Heart	Cardiovascular System

Advanced export

JSON shape: default, array, newline-delimited

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;