metadata: run_metadata: 393 rows where experiment.library_layout = "SINGLE", experiment.library_selection = "PolyA" and tissue_curation

393 rows where experiment.library_layout = "SINGLE", experiment.library_selection = "PolyA" and tissue_curation_coarse = "All anatomical structures"

descending

Link	rowid ▼	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	sample.description	sample.title	sample.alias	sample.centername	sample.attributes	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.study_ref	run.title	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.nofeature_rate.mate1	seqdetective.sparsity.mate1	seqdetective.pos_strand_rate.mate1	seqdetective.readlen.mate1	seqdetective.judgement.mate1	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
9651	9651	ERR3266392	ERX3293003	ERS3358386	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep2	SAMEA5556346	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556346\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep2 s	sponge tdr gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9pos_S2_L001_R1_001.fastq.gz	fastq	603238067.0	8014716.0	E MTAB 7846:sponge tdr gfp positive rep2 lane1	0:75.27 1:0	A:164797697;C:136552121;G:141138007;T:160737152;N:13090	75	0	164797697	136552121	141138007	160737152	13090	ERX3293003	ERS3358386	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95083	0.06432	0.71532	0.50098	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9652	9652	ERR3266393	ERX3293003	ERS3358386	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep2	SAMEA5556346	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556346\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep2 s	sponge tdr gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9pos_S2_L002_R1_001.fastq.gz	fastq	603749720.0	8021069.0	E MTAB 7846:sponge tdr gfp positive rep2 lane2	0:75.27 1:0	A:164972969;C:136661417;G:141205792;T:160896264;N:13278	75	0	164972969	136661417	141205792	160896264	13278	ERX3293003	ERS3358386	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.951	0.06542	0.71768	0.50051	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9653	9653	ERR3266394	ERX3293003	ERS3358386	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep2	SAMEA5556346	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556346\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep2 s	sponge tdr gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9pos_S2_L003_R1_001.fastq.gz	fastq	608154053.0	8079704.0	E MTAB 7846:sponge tdr gfp positive rep2 lane3	0:75.27 1:0	A:166117918;C:137731172;G:142320339;T:161970092;N:14532	75	0	166117918	137731172	142320339	161970092	14532	ERX3293003	ERS3358386	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95155	0.0657	0.71634	0.49493	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9654	9654	ERR3266395	ERX3293003	ERS3358386	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep2	SAMEA5556346	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556346\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep2 s	sponge tdr gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9pos_S2_L004_R1_001.fastq.gz	fastq	599143392.0	7959897.0	E MTAB 7846:sponge tdr gfp positive rep2 lane4	0:75.27 1:0	A:163706904;C:135622453;G:140192351;T:159605249;N:16435	75	0	163706904	135622453	140192351	159605249	16435	ERX3293003	ERS3358386	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95061	0.06431	0.71764	0.50166	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9655	9655	ERR3266388	ERX3293002	ERS3358385	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep1	SAMEA5556345	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556345\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep1 s	sponge tdr gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6pos_S4_L001_R1_001.fastq.gz	fastq	616761505.0	8202480.0	E MTAB 7846:sponge tdr gfp positive rep1 lane1	0:75.19 1:0	A:168679238;C:139548565;G:143969797;T:164545362;N:18543	75	0	168679238	139548565	143969797	164545362	18543	ERX3293002	ERS3358385	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95019	0.06806	0.7097	0.50337	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9656	9656	ERR3266389	ERX3293002	ERS3358385	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep1	SAMEA5556345	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556345\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep1 s	sponge tdr gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6pos_S4_L002_R1_001.fastq.gz	fastq	617529482.0	8212485.0	E MTAB 7846:sponge tdr gfp positive rep1 lane2	0:75.19 1:0	A:168925757;C:139655387;G:144096837;T:164831236;N:20265	75	0	168925757	139655387	144096837	164831236	20265	ERX3293002	ERS3358385	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.9492	0.06753	0.712	0.49881	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9657	9657	ERR3266390	ERX3293002	ERS3358385	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep1	SAMEA5556345	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556345\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep1 s	sponge tdr gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6pos_S4_L003_R1_001.fastq.gz	fastq	624156883.0	8300861.0	E MTAB 7846:sponge tdr gfp positive rep1 lane3	0:75.19 1:0	A:170696950;C:141302376;G:145759286;T:166377781;N:20490	75	0	170696950	141302376	145759286	166377781	20490	ERX3293002	ERS3358385	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94917	0.06724	0.71291	0.50783	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9658	9658	ERR3266391	ERX3293002	ERS3358385	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep1	SAMEA5556345	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556345\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep1 s	sponge tdr gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6pos_S4_L004_R1_001.fastq.gz	fastq	615013615.0	8179180.0	E MTAB 7846:sponge tdr gfp positive rep1 lane4	0:75.19 1:0	A:168237742;C:139106952;G:143535658;T:164110735;N:22528	75	0	168237742	139106952	143535658	164110735	22528	ERX3293002	ERS3358385	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94892	0.06723	0.71206	0.50775	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9659	9659	ERR3266384	ERX3293001	ERS3358384	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep2	SAMEA5556344	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556344\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep2 s	sponge tdr gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9neg_S1_L001_R1_001.fastq.gz	fastq	659562366.0	8762947.0	E MTAB 7846:sponge tdr gfp negative rep2 lane1	0:75.27 1:0	A:178744772;C:150091912;G:155092318;T:175619332;N:14032	75	0	178744772	150091912	155092318	175619332	14032	ERX3293001	ERS3358384	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.9517	0.06908	0.70822	0.48025	73	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9660	9660	ERR3266385	ERX3293001	ERS3358384	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep2	SAMEA5556344	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556344\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep2 s	sponge tdr gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9neg_S1_L002_R1_001.fastq.gz	fastq	658688825.0	8751176.0	E MTAB 7846:sponge tdr gfp negative rep2 lane2	0:75.27 1:0	A:178540155;C:149844100;G:154850294;T:175438757;N:15519	75	0	178540155	149844100	154850294	175438757	15519	ERX3293001	ERS3358384	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95059	0.06748	0.70806	0.48177	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9661	9661	ERR3266386	ERX3293001	ERS3358384	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep2	SAMEA5556344	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556344\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep2 s	sponge tdr gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9neg_S1_L003_R1_001.fastq.gz	fastq	665901310.0	8846927.0	E MTAB 7846:sponge tdr gfp negative rep2 lane3	0:75.27 1:0	A:180412445;C:151589489;G:156677030;T:177206192;N:16154	75	0	180412445	151589489	156677030	177206192	16154	ERX3293001	ERS3358384	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95095	0.06855	0.7082	0.4787	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9662	9662	ERR3266387	ERX3293001	ERS3358384	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep2	SAMEA5556344	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556344\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep2 s	sponge tdr gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9neg_S1_L004_R1_001.fastq.gz	fastq	655674573.0	8711278.0	E MTAB 7846:sponge tdr gfp negative rep2 lane4	0:75.27 1:0	A:177658097;C:149188009;G:154201531;T:174609176;N:17760	75	0	177658097	149188009	154201531	174609176	17760	ERX3293001	ERS3358384	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.9503	0.06838	0.70926	0.47475	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9663	9663	ERR3266380	ERX3293000	ERS3358383	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep1	SAMEA5556343	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556343\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep1 s	sponge tdr gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6neg_S3_L001_R1_001.fastq.gz	fastq	634491637.0	8440052.0	E MTAB 7846:sponge tdr gfp negative rep1 lane1	0:75.18 1:0	A:170881257;C:145535643;G:150561786;T:167495156;N:17795	75	0	170881257	145535643	150561786	167495156	17795	ERX3293000	ERS3358383	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94996	0.05672	0.70571	0.48691	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9664	9664	ERR3266381	ERX3293000	ERS3358383	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep1	SAMEA5556343	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556343\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep1 s	sponge tdr gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6neg_S3_L002_R1_001.fastq.gz	fastq	632900752.0	8418846.0	E MTAB 7846:sponge tdr gfp negative rep1 lane2	0:75.18 1:0	A:170454908;C:145141392;G:150172752;T:167112562;N:19138	75	0	170454908	145141392	150172752	167112562	19138	ERX3293000	ERS3358383	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94905	0.05627	0.70457	0.4865	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9665	9665	ERR3266382	ERX3293000	ERS3358383	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep1	SAMEA5556343	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556343\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep1 s	sponge tdr gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6neg_S3_L003_R1_001.fastq.gz	fastq	638530115.0	8494045.0	E MTAB 7846:sponge tdr gfp negative rep1 lane3	0:75.17 1:0	A:171907482;C:146526309;G:151612209;T:168464163;N:19952	75	0	171907482	146526309	151612209	168464163	19952	ERX3293000	ERS3358383	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94919	0.05578	0.70849	0.48073	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9666	9666	ERR3266383	ERX3293000	ERS3358383	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep1	SAMEA5556343	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556343\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep1 s	sponge tdr gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6neg_S3_L004_R1_001.fastq.gz	fastq	627433322.0	8346505.0	E MTAB 7846:sponge tdr gfp negative rep1 lane4	0:75.17 1:0	A:169016383;C:143886824;G:148914725;T:165593528;N:21862	75	0	169016383	143886824	148914725	165593528	21862	ERX3293000	ERS3358383	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94993	0.05721	0.7052	0.48878	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9667	9667	ERR3266376	ERX3292999	ERS3358382	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep2	SAMEA5556342	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556342\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep2 s	sponge isl gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7pos_S10_L001_R1_001.fastq.gz	fastq	618672195.0	8218047.0	E MTAB 7846:sponge isl gfp positive rep2 lane1	0:75.28 1:0	A:166422886;C:142212204;G:146857539;T:163167819;N:11747	75	0	166422886	142212204	146857539	163167819	11747	ERX3292999	ERS3358382	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94979	0.08351	0.70863	0.47581	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9668	9668	ERR3266377	ERX3292999	ERS3358382	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep2	SAMEA5556342	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556342\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep2 s	sponge isl gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7pos_S10_L002_R1_001.fastq.gz	fastq	618709102.0	8218295.0	E MTAB 7846:sponge isl gfp positive rep2 lane2	0:75.28 1:0	A:166470432;C:142189977;G:146819280;T:163216323;N:13090	75	0	166470432	142189977	146819280	163216323	13090	ERX3292999	ERS3358382	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94977	0.08255	0.70644	0.47228	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9669	9669	ERR3266378	ERX3292999	ERS3358382	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep2	SAMEA5556342	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556342\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep2 s	sponge isl gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7pos_S10_L003_R1_001.fastq.gz	fastq	625353059.0	8306375.0	E MTAB 7846:sponge isl gfp positive rep2 lane3	0:75.29 1:0	A:168233274;C:143793178;G:148510556;T:164802476;N:13575	75	0	168233274	143793178	148510556	164802476	13575	ERX3292999	ERS3358382	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95014	0.08368	0.70743	0.47846	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9670	9670	ERR3266379	ERX3292999	ERS3358382	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep2	SAMEA5556342	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556342\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep2 s	sponge isl gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7pos_S10_L004_R1_001.fastq.gz	fastq	615204990.0	8171748.0	E MTAB 7846:sponge isl gfp positive rep2 lane4	0:75.28 1:0	A:165565861;C:141380152;G:146028839;T:162214263;N:15875	75	0	165565861	141380152	146028839	162214263	15875	ERX3292999	ERS3358382	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94954	0.08233	0.70834	0.48166	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9671	9671	ERR3266372	ERX3292998	ERS3358381	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep1	SAMEA5556341	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556341\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep1 s	sponge isl gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6pos_S12_L001_R1_001.fastq.gz	fastq	626474467.0	8318996.0	E MTAB 7846:sponge isl gfp positive rep1 lane1	0:75.31 1:0	A:170186220;C:142441110;G:147048643;T:166786401;N:12093	75	0	170186220	142441110	147048643	166786401	12093	ERX3292998	ERS3358381	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94907	0.08132	0.69684	0.4736	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9672	9672	ERR3266373	ERX3292998	ERS3358381	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep1	SAMEA5556341	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556341\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep1 s	sponge isl gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6pos_S12_L002_R1_001.fastq.gz	fastq	626477579.0	8318750.0	E MTAB 7846:sponge isl gfp positive rep1 lane2	0:75.31 1:0	A:170185337;C:142396801;G:147032265;T:166850532;N:12644	75	0	170185337	142396801	147032265	166850532	12644	ERX3292998	ERS3358381	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94941	0.08253	0.6957	0.47554	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9673	9673	ERR3266374	ERX3292998	ERS3358381	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep1	SAMEA5556341	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556341\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep1 s	sponge isl gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6pos_S12_L003_R1_001.fastq.gz	fastq	632098509.0	8393388.0	E MTAB 7846:sponge isl gfp positive rep1 lane3	0:75.31 1:0	A:171699353;C:143766296;G:148442110;T:168177264;N:13486	75	0	171699353	143766296	148442110	168177264	13486	ERX3292998	ERS3358381	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94866	0.08247	0.69601	0.48009	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9674	9674	ERR3266375	ERX3292998	ERS3358381	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep1	SAMEA5556341	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556341\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep1 s	sponge isl gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6pos_S12_L004_R1_001.fastq.gz	fastq	622997479.0	8272752.0	E MTAB 7846:sponge isl gfp positive rep1 lane4	0:75.31 1:0	A:169306677;C:141586415;G:146241288;T:165847752;N:15347	75	0	169306677	141586415	146241288	165847752	15347	ERX3292998	ERS3358381	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.9483	0.08034	0.69662	0.47868	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9675	9675	ERR3266368	ERX3292997	ERS3358380	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep2	SAMEA5556340	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556340\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep2 s	sponge isl gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7neg_S9_L001_R1_001.fastq.gz	fastq	707454819.0	9395082.0	E MTAB 7846:sponge isl gfp negative rep2 lane1	0:75.30 1:0	A:194991862;C:157927850;G:163280639;T:191241488;N:12980	75	0	194991862	157927850	163280639	191241488	12980	ERX3292997	ERS3358380	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.93871	0.08926	0.70806	0.46501	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9676	9676	ERR3266369	ERX3292997	ERS3358380	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep2	SAMEA5556340	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556340\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep2 s	sponge isl gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7neg_S9_L002_R1_001.fastq.gz	fastq	704791838.0	9359668.0	E MTAB 7846:sponge isl gfp negative rep2 lane2	0:75.30 1:0	A:194317422;C:157276895;G:162624670;T:190558322;N:14529	75	0	194317422	157276895	162624670	190558322	14529	ERX3292997	ERS3358380	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.93816	0.08859	0.70999	0.4661	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9677	9677	ERR3266370	ERX3292997	ERS3358380	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep2	SAMEA5556340	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556340\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep2 s	sponge isl gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7neg_S9_L003_R1_001.fastq.gz	fastq	715991833.0	9508323.0	E MTAB 7846:sponge isl gfp negative rep2 lane3	0:75.30 1:0	A:197297222;C:159913026;G:165363927;T:193402765;N:14893	75	0	197297222	159913026	165363927	193402765	14893	ERX3292997	ERS3358380	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.93844	0.08854	0.70828	0.46042	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9678	9678	ERR3266371	ERX3292997	ERS3358380	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep2	SAMEA5556340	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556340\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep2 s	sponge isl gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7neg_S9_L004_R1_001.fastq.gz	fastq	703723869.0	9345669.0	E MTAB 7846:sponge isl gfp negative rep2 lane4	0:75.30 1:0	A:194029886;C:157050176;G:162432310;T:190193608;N:17889	75	0	194029886	157050176	162432310	190193608	17889	ERX3292997	ERS3358380	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.93897	0.08993	0.70863	0.45707	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9679	9679	ERR3266364	ERX3292996	ERS3358379	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep1	SAMEA5556339	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556339\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep1 s	sponge isl gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6neg_S11_L001_R1_001.fastq.gz	fastq	676581458.0	8983758.0	E MTAB 7846:sponge isl gfp negative rep1 lane1	0:75.31 1:0	A:184297337;C:153352193;G:158268476;T:180651038;N:12414	75	0	184297337	153352193	158268476	180651038	12414	ERX3292996	ERS3358379	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94981	0.07715	0.69138	0.47243	74	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9680	9680	ERR3266365	ERX3292996	ERS3358379	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep1	SAMEA5556339	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556339\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep1 s	sponge isl gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6neg_S11_L002_R1_001.fastq.gz	fastq	676876555.0	8987445.0	E MTAB 7846:sponge isl gfp negative rep1 lane2	0:75.31 1:0	A:184435129;C:153332402;G:158323789;T:180770978;N:14257	75	0	184435129	153332402	158323789	180770978	14257	ERX3292996	ERS3358379	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94901	0.07805	0.69179	0.47182	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9681	9681	ERR3266366	ERX3292996	ERS3358379	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep1	SAMEA5556339	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556339\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep1 s	sponge isl gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6neg_S11_L003_R1_001.fastq.gz	fastq	681771213.0	9052615.0	E MTAB 7846:sponge isl gfp negative rep1 lane3	0:75.31 1:0	A:185717696;C:154552039;G:159567102;T:181919781;N:14595	75	0	185717696	154552039	159567102	181919781	14595	ERX3292996	ERS3358379	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94923	0.07768	0.69167	0.47219	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9682	9682	ERR3266367	ERX3292996	ERS3358379	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep1	SAMEA5556339	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556339\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep1 s	sponge isl gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6neg_S11_L004_R1_001.fastq.gz	fastq	671169917.0	8911624.0	E MTAB 7846:sponge isl gfp negative rep1 lane4	0:75.31 1:0	A:182910490;C:152045814;G:157010053;T:179186548;N:17012	75	0	182910490	152045814	157010053	179186548	17012	ERX3292996	ERS3358379	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94941	0.07612	0.69106	0.47736	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9683	9683	ERR3266360	ERX3292995	ERS3358378	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep2	SAMEA5556338	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556338\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep2 s	sponge ccn gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8pos_S6_L001_R1_001.fastq.gz	fastq	745666738.0	9917771.0	E MTAB 7846:sponge ccn gfp positive rep2 lane1	0:75.18 1:0	A:207714377;C:163732420;G:169037726;T:205161925;N:20290	75	0	207714377	163732420	169037726	205161925	20290	ERX3292995	ERS3358378	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94006	0.17809	0.68166	0.48912	74	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9684	9684	ERR3266361	ERX3292995	ERS3358378	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep2	SAMEA5556338	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556338\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep2 s	sponge ccn gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8pos_S6_L002_R1_001.fastq.gz	fastq	747693645.0	9944395.0	E MTAB 7846:sponge ccn gfp positive rep2 lane2	0:75.19 1:0	A:208257288;C:164106384;G:169478025;T:205830399;N:21549	75	0	208257288	164106384	169478025	205830399	21549	ERX3292995	ERS3358378	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.93873	0.17738	0.68296	0.49656	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9685	9685	ERR3266362	ERX3292995	ERS3358378	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep2	SAMEA5556338	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556338\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep2 s	sponge ccn gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8pos_S6_L003_R1_001.fastq.gz	fastq	756134124.0	10056818.0	E MTAB 7846:sponge ccn gfp positive rep2 lane3	0:75.19 1:0	A:210573012;C:166089133;G:171475300;T:207973232;N:23447	75	0	210573012	166089133	171475300	207973232	23447	ERX3292995	ERS3358378	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94077	0.18001	0.68004	0.49812	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9686	9686	ERR3266363	ERX3292995	ERS3358378	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep2	SAMEA5556338	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556338\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep2 s	sponge ccn gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8pos_S6_L004_R1_001.fastq.gz	fastq	747687619.0	9944417.0	E MTAB 7846:sponge ccn gfp positive rep2 lane4	0:75.19 1:0	A:208315943;C:164104155;G:169484250;T:205757712;N:25559	75	0	208315943	164104155	169484250	205757712	25559	ERX3292995	ERS3358378	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94025	0.17965	0.68124	0.49249	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9687	9687	ERR3266356	ERX3292994	ERS3358377	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep1	SAMEA5556337	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556337\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep1 s	sponge ccn gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7pos_S8_L001_R1_001.fastq.gz	fastq	600153564.0	7972767.0	E MTAB 7846:sponge ccn gfp positive rep1 lane1	0:75.28 1:0	A:165075878;C:133961511;G:138306424;T:162797903;N:11848	75	0	165075878	133961511	138306424	162797903	11848	ERX3292994	ERS3358377	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95367	0.14146	0.69154	0.46621	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9688	9688	ERR3266357	ERX3292994	ERS3358377	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep1	SAMEA5556337	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556337\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep1 s	sponge ccn gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7pos_S8_L002_R1_001.fastq.gz	fastq	600790169.0	7981038.0	E MTAB 7846:sponge ccn gfp positive rep1 lane2	0:75.28 1:0	A:165262968;C:133988329;G:138458635;T:163066854;N:13383	75	0	165262968	133988329	138458635	163066854	13383	ERX3292994	ERS3358377	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95365	0.14116	0.69301	0.46836	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9689	9689	ERR3266358	ERX3292994	ERS3358377	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep1	SAMEA5556337	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556337\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep1 s	sponge ccn gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7pos_S8_L003_R1_001.fastq.gz	fastq	608611085.0	8084904.0	E MTAB 7846:sponge ccn gfp positive rep1 lane3	0:75.28 1:0	A:167402055;C:135871708;G:140314669;T:165009252;N:13401	75	0	167402055	135871708	140314669	165009252	13401	ERX3292994	ERS3358377	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95403	0.14167	0.69311	0.4702	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9690	9690	ERR3266359	ERX3292994	ERS3358377	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep1	SAMEA5556337	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556337\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep1 s	sponge ccn gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7pos_S8_L004_R1_001.fastq.gz	fastq	599558663.0	7964718.0	E MTAB 7846:sponge ccn gfp positive rep1 lane4	0:75.28 1:0	A:164965131;C:133749666;G:138194884;T:162633558;N:15424	75	0	164965131	133749666	138194884	162633558	15424	ERX3292994	ERS3358377	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95285	0.14085	0.69037	0.47345	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9691	9691	ERR3266352	ERX3292993	ERS3358376	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep2	SAMEA5556336	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556336\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep2 s	sponge ccn gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8neg_S5_L001_R1_001.fastq.gz	fastq	599599608.0	7970460.0	E MTAB 7846:sponge ccn gfp negative rep2 lane1	0:75.23 1:0	A:162236409;C:136907675;G:141538730;T:158902520;N:14274	75	0	162236409	136907675	141538730	158902520	14274	ERX3292993	ERS3358376	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95404	0.05923	0.69737	0.48627	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9692	9692	ERR3266353	ERX3292993	ERS3358376	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep2	SAMEA5556336	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556336\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep2 s	sponge ccn gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8neg_S5_L002_R1_001.fastq.gz	fastq	600057776.0	7976438.0	E MTAB 7846:sponge ccn gfp negative rep2 lane2	0:75.23 1:0	A:162367410;C:136994919;G:141577782;T:159102194;N:15471	75	0	162367410	136994919	141577782	159102194	15471	ERX3292993	ERS3358376	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.953	0.06085	0.6952	0.48868	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9693	9693	ERR3266354	ERX3292993	ERS3358376	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep2	SAMEA5556336	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556336\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep2 s	sponge ccn gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8neg_S5_L003_R1_001.fastq.gz	fastq	607089697.0	8069901.0	E MTAB 7846:sponge ccn gfp negative rep2 lane3	0:75.23 1:0	A:164235344;C:138684000;G:143335680;T:160819270;N:15403	75	0	164235344	138684000	143335680	160819270	15403	ERX3292993	ERS3358376	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95245	0.06055	0.69589	0.48813	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9694	9694	ERR3266355	ERX3292993	ERS3358376	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep2	SAMEA5556336	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556336\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep2 s	sponge ccn gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8neg_S5_L004_R1_001.fastq.gz	fastq	598098243.0	7950223.0	E MTAB 7846:sponge ccn gfp negative rep2 lane4	0:75.23 1:0	A:161836808;C:136564804;G:141157424;T:158521860;N:17347	75	0	161836808	136564804	141157424	158521860	17347	ERX3292993	ERS3358376	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95299	0.06032	0.69501	0.48928	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9695	9695	ERR3266348	ERX3292992	ERS3358375	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep1	SAMEA5556335	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556335\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep1 s	sponge ccn gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7neg_S7_L001_R1_001.fastq.gz	fastq	668175990.0	8872549.0	E MTAB 7846:sponge ccn gfp negative rep1 lane1	0:75.31 1:0	A:179859350;C:153483169;G:158360605;T:176462088;N:10778	75	0	179859350	153483169	158360605	176462088	10778	ERX3292992	ERS3358375	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95955	0.07154	0.69696	0.46425	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9696	9696	ERR3266349	ERX3292992	ERS3358375	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep1	SAMEA5556335	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556335\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep1 s	sponge ccn gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7neg_S7_L002_R1_001.fastq.gz	fastq	668154755.0	8872093.0	E MTAB 7846:sponge ccn gfp negative rep1 lane2	0:75.31 1:0	A:179811687;C:153454931;G:158314391;T:176560936;N:12810	75	0	179811687	153454931	158314391	176560936	12810	ERX3292992	ERS3358375	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.96029	0.06969	0.69684	0.46725	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9697	9697	ERR3266350	ERX3292992	ERS3358375	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep1	SAMEA5556335	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556335\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep1 s	sponge ccn gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7neg_S7_L003_R1_001.fastq.gz	fastq	676984426.0	8989004.0	E MTAB 7846:sponge ccn gfp negative rep1 lane3	0:75.31 1:0	A:182159685;C:155578195;G:160511499;T:178722363;N:12684	75	0	182159685	155578195	160511499	178722363	12684	ERX3292992	ERS3358375	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.96012	0.07159	0.69554	0.46811	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9698	9698	ERR3266351	ERX3292992	ERS3358375	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep1	SAMEA5556335	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556335\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep1 s	sponge ccn gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7neg_S7_L004_R1_001.fastq.gz	fastq	666031892.0	8843695.0	E MTAB 7846:sponge ccn gfp negative rep1 lane4	0:75.31 1:0	A:179243298;C:152946459;G:157873912;T:175953752;N:14471	75	0	179243298	152946459	157873912	175953752	14471	ERX3292992	ERS3358375	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.96014	0.07169	0.69493	0.47058	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9874	9874	ERR4132490	ERX4099806	ERS4552001	ERP121652	PRJEB38247	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	E-MTAB-9054	Transcriptome Analysis	Endocrine disruption can trigger far reaching effects on environmental populations justifying a refusal of market approval for chemicals with ED properties. Ecotoxicogenomic screening was performed to identify molecular fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. 6 Propyl 2 thiouracil 6PTU CAS: 51 52 5 was tested as a model substance for anti thyroidal activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked from each sample group and pooled for RNA and protein extraction with NucleoSpin© RNA/Protein kit Macherey Nagel. RNA quality was assessed via a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing 30 million reads per sample. Initial BCL files were demultiplexed to fastq files via bcl2fastq. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library mapped read tables were then merged to a single count matrix. Using this matrix as input read counts were normalized with DESeq2 for differential gene expression analysis.	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 11	Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions.…	R904	SAMEA6824372	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany	ENA FIRST PUBLIC:2020 07 31T04:03:57Z\|ENA LAST UPDATE:2020 05 11T17:12:34Z\|External Id:SAMEA6824372\|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany\|INSDC first public:2020 07 31T04:03:57Z\|INSDC last update:2020 05 11T17:12:34Z\|INSDC status:public\|Submitter Id:E MTAB 9054:R904\|age:96\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|genotype:wild type genotype\|growth condition:low exposure\|individual:mixed pool of 10 fish\|organism part:whole organism\|rin values:10\|sample name:E MTAB 9054:R904\|scientific name:Danio rerio\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	E MTAB 9054:R904 s	R904 s	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 h…	Experimental Factor: compound:6 propyl 2 thiouracil\|Experimental Factor: dose:0.001	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP121652	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 11	R904_sr.fastq.gz	fastq	1605165390.0	31794192.0	E MTAB 9054:R904	0:50.49 1:0	A:412564740;C:388045945;G:374953342;T:427657902;N:1943461	50	0	412564740	388045945	374953342	427657902	1943461	ERX4099806	ERS4552001	ERA2597157	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	1	0.93893	0.09893	0.64646	0.47809	50	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2020-05-11	Larval	Larval	Whole Organism	All anatomical structures
9875	9875	ERR4132489	ERX4099805	ERS4552000	ERP121652	PRJEB38247	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	E-MTAB-9054	Transcriptome Analysis	Endocrine disruption can trigger far reaching effects on environmental populations justifying a refusal of market approval for chemicals with ED properties. Ecotoxicogenomic screening was performed to identify molecular fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. 6 Propyl 2 thiouracil 6PTU CAS: 51 52 5 was tested as a model substance for anti thyroidal activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked from each sample group and pooled for RNA and protein extraction with NucleoSpin© RNA/Protein kit Macherey Nagel. RNA quality was assessed via a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing 30 million reads per sample. Initial BCL files were demultiplexed to fastq files via bcl2fastq. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library mapped read tables were then merged to a single count matrix. Using this matrix as input read counts were normalized with DESeq2 for differential gene expression analysis.	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 11	Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions.…	R900	SAMEA6824371	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany	ENA FIRST PUBLIC:2020 07 31T04:03:57Z\|ENA LAST UPDATE:2020 05 11T17:12:34Z\|External Id:SAMEA6824371\|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany\|INSDC first public:2020 07 31T04:03:57Z\|INSDC last update:2020 05 11T17:12:34Z\|INSDC status:public\|Submitter Id:E MTAB 9054:R900\|age:96\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|genotype:wild type genotype\|growth condition:low exposure\|individual:mixed pool of 10 fish\|organism part:whole organism\|rin values:9.6\|sample name:E MTAB 9054:R900\|scientific name:Danio rerio\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	E MTAB 9054:R900 s	R900 s	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 h…	Experimental Factor: compound:6 propyl 2 thiouracil\|Experimental Factor: dose:0.001	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP121652	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 11	R900_sr.fastq.gz	fastq	1597198644.0	31638370.0	E MTAB 9054:R900	0:50.48 1:0	A:410085529;C:386591071;G:373950085;T:424276623;N:2295336	50	0	410085529	386591071	373950085	424276623	2295336	ERX4099805	ERS4552000	ERA2597157	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	1	0.93876	0.09801	0.64889	0.48057	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2020-05-11	Larval	Larval	Whole Organism	All anatomical structures
9876	9876	ERR4132488	ERX4099804	ERS4551999	ERP121652	PRJEB38247	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	E-MTAB-9054	Transcriptome Analysis	Endocrine disruption can trigger far reaching effects on environmental populations justifying a refusal of market approval for chemicals with ED properties. Ecotoxicogenomic screening was performed to identify molecular fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. 6 Propyl 2 thiouracil 6PTU CAS: 51 52 5 was tested as a model substance for anti thyroidal activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked from each sample group and pooled for RNA and protein extraction with NucleoSpin© RNA/Protein kit Macherey Nagel. RNA quality was assessed via a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing 30 million reads per sample. Initial BCL files were demultiplexed to fastq files via bcl2fastq. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library mapped read tables were then merged to a single count matrix. Using this matrix as input read counts were normalized with DESeq2 for differential gene expression analysis.	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 11	Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions.…	R896	SAMEA6824370	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany	ENA FIRST PUBLIC:2020 07 31T04:03:57Z\|ENA LAST UPDATE:2020 05 11T17:12:34Z\|External Id:SAMEA6824370\|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany\|INSDC first public:2020 07 31T04:03:57Z\|INSDC last update:2020 05 11T17:12:34Z\|INSDC status:public\|Submitter Id:E MTAB 9054:R896\|age:96\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|genotype:wild type genotype\|growth condition:low exposure\|individual:mixed pool of 10 fish\|organism part:whole organism\|rin values:10\|sample name:E MTAB 9054:R896\|scientific name:Danio rerio\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	E MTAB 9054:R896 s	R896 s	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 h…	Experimental Factor: compound:6 propyl 2 thiouracil\|Experimental Factor: dose:0.001	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP121652	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 11	R896_sr.fastq.gz	fastq	1946340744.0	38553341.0	E MTAB 9054:R896	0:50.48 1:0	A:497881336;C:472722708;G:455800573;T:517246014;N:2690113	50	0	497881336	472722708	455800573	517246014	2690113	ERX4099804	ERS4551999	ERA2597157	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	1	0.93904	0.10115	0.64885	0.47903	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2020-05-11	Larval	Larval	Whole Organism	All anatomical structures
9877	9877	ERR4132487	ERX4099803	ERS4551998	ERP121652	PRJEB38247	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	E-MTAB-9054	Transcriptome Analysis	Endocrine disruption can trigger far reaching effects on environmental populations justifying a refusal of market approval for chemicals with ED properties. Ecotoxicogenomic screening was performed to identify molecular fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. 6 Propyl 2 thiouracil 6PTU CAS: 51 52 5 was tested as a model substance for anti thyroidal activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked from each sample group and pooled for RNA and protein extraction with NucleoSpin© RNA/Protein kit Macherey Nagel. RNA quality was assessed via a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing 30 million reads per sample. Initial BCL files were demultiplexed to fastq files via bcl2fastq. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library mapped read tables were then merged to a single count matrix. Using this matrix as input read counts were normalized with DESeq2 for differential gene expression analysis.	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 11	Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions.…	R906	SAMEA6824369	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany	ENA FIRST PUBLIC:2020 07 31T04:03:57Z\|ENA LAST UPDATE:2020 05 11T17:12:34Z\|External Id:SAMEA6824369\|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany\|INSDC first public:2020 07 31T04:03:57Z\|INSDC last update:2020 05 11T17:12:34Z\|INSDC status:public\|Submitter Id:E MTAB 9054:R906\|age:96\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|genotype:wild type genotype\|growth condition:high exposure\|individual:mixed pool of 10 fish\|organism part:whole organism\|rin values:9.8\|sample name:E MTAB 9054:R906\|scientific name:Danio rerio\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	E MTAB 9054:R906 s	R906 s	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 h…	Experimental Factor: compound:6 propyl 2 thiouracil\|Experimental Factor: dose:0.1	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP121652	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 11	R906_sr.fastq.gz	fastq	2341343751.0	46379726.0	E MTAB 9054:R906	0:50.48 1:0	A:597650493;C:569437401;G:551299383;T:619558551;N:3397923	50	0	597650493	569437401	551299383	619558551	3397923	ERX4099803	ERS4551998	ERA2597157	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	1	0.94175	0.09795	0.65153	0.47478	50	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2020-05-11	Larval	Larval	Whole Organism	All anatomical structures
9878	9878	ERR4132486	ERX4099802	ERS4551997	ERP121652	PRJEB38247	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	E-MTAB-9054	Transcriptome Analysis	Endocrine disruption can trigger far reaching effects on environmental populations justifying a refusal of market approval for chemicals with ED properties. Ecotoxicogenomic screening was performed to identify molecular fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. 6 Propyl 2 thiouracil 6PTU CAS: 51 52 5 was tested as a model substance for anti thyroidal activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked from each sample group and pooled for RNA and protein extraction with NucleoSpin© RNA/Protein kit Macherey Nagel. RNA quality was assessed via a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing 30 million reads per sample. Initial BCL files were demultiplexed to fastq files via bcl2fastq. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library mapped read tables were then merged to a single count matrix. Using this matrix as input read counts were normalized with DESeq2 for differential gene expression analysis.	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 11	Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions.…	R902	SAMEA6824368	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany	ENA FIRST PUBLIC:2020 07 31T04:03:57Z\|ENA LAST UPDATE:2020 05 11T17:12:34Z\|External Id:SAMEA6824368\|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany\|INSDC first public:2020 07 31T04:03:57Z\|INSDC last update:2020 05 11T17:12:34Z\|INSDC status:public\|Submitter Id:E MTAB 9054:R902\|age:96\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|genotype:wild type genotype\|growth condition:high exposure\|individual:mixed pool of 10 fish\|organism part:whole organism\|rin values:10\|sample name:E MTAB 9054:R902\|scientific name:Danio rerio\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	E MTAB 9054:R902 s	R902 s	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 h…	Experimental Factor: compound:6 propyl 2 thiouracil\|Experimental Factor: dose:0.1	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP121652	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 11	R902_sr.fastq.gz	fastq	1632244657.0	32331034.0	E MTAB 9054:R902	0:50.49 1:0	A:413710466;C:400183665;G:387130890;T:428954946;N:2264690	50	0	413710466	400183665	387130890	428954946	2264690	ERX4099802	ERS4551997	ERA2597157	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	1	0.94282	0.09186	0.65192	0.48446	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2020-05-11	Larval	Larval	Whole Organism	All anatomical structures
9879	9879	ERR4132485	ERX4099801	ERS4551996	ERP121652	PRJEB38247	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	E-MTAB-9054	Transcriptome Analysis	Endocrine disruption can trigger far reaching effects on environmental populations justifying a refusal of market approval for chemicals with ED properties. Ecotoxicogenomic screening was performed to identify molecular fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. 6 Propyl 2 thiouracil 6PTU CAS: 51 52 5 was tested as a model substance for anti thyroidal activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked from each sample group and pooled for RNA and protein extraction with NucleoSpin© RNA/Protein kit Macherey Nagel. RNA quality was assessed via a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing 30 million reads per sample. Initial BCL files were demultiplexed to fastq files via bcl2fastq. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library mapped read tables were then merged to a single count matrix. Using this matrix as input read counts were normalized with DESeq2 for differential gene expression analysis.	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 11	Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions.…	R898	SAMEA6824367	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany	ENA FIRST PUBLIC:2020 07 31T04:03:57Z\|ENA LAST UPDATE:2020 05 11T17:12:34Z\|External Id:SAMEA6824367\|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany\|INSDC first public:2020 07 31T04:03:57Z\|INSDC last update:2020 05 11T17:12:34Z\|INSDC status:public\|Submitter Id:E MTAB 9054:R898\|age:96\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|genotype:wild type genotype\|growth condition:high exposure\|individual:mixed pool of 10 fish\|organism part:whole organism\|rin values:9.8\|sample name:E MTAB 9054:R898\|scientific name:Danio rerio\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	E MTAB 9054:R898 s	R898 s	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 h…	Experimental Factor: compound:6 propyl 2 thiouracil\|Experimental Factor: dose:0.1	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP121652	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 11	R898_sr.fastq.gz	fastq	1973588979.0	39097363.0	E MTAB 9054:R898	0:50.48 1:0	A:501700006;C:481059078;G:466931881;T:520778140;N:3119874	50	0	501700006	481059078	466931881	520778140	3119874	ERX4099801	ERS4551996	ERA2597157	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	1	0.94133	0.09578	0.651	0.474	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2020-05-11	Larval	Larval	Whole Organism	All anatomical structures
9880	9880	ERR4132484	ERX4099800	ERS4551995	ERP121652	PRJEB38247	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	E-MTAB-9054	Transcriptome Analysis	Endocrine disruption can trigger far reaching effects on environmental populations justifying a refusal of market approval for chemicals with ED properties. Ecotoxicogenomic screening was performed to identify molecular fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. 6 Propyl 2 thiouracil 6PTU CAS: 51 52 5 was tested as a model substance for anti thyroidal activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked from each sample group and pooled for RNA and protein extraction with NucleoSpin© RNA/Protein kit Macherey Nagel. RNA quality was assessed via a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing 30 million reads per sample. Initial BCL files were demultiplexed to fastq files via bcl2fastq. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library mapped read tables were then merged to a single count matrix. Using this matrix as input read counts were normalized with DESeq2 for differential gene expression analysis.	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 11	Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions.…	R903	SAMEA6824366	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany	ENA FIRST PUBLIC:2020 07 31T04:03:57Z\|ENA LAST UPDATE:2020 05 11T17:12:34Z\|External Id:SAMEA6824366\|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany\|INSDC first public:2020 07 31T04:03:57Z\|INSDC last update:2020 05 11T17:12:34Z\|INSDC status:public\|Submitter Id:E MTAB 9054:R903\|age:96\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|genotype:wild type genotype\|growth condition:normal\|individual:mixed pool of 10 fish\|organism part:whole organism\|rin values:9.8\|sample name:E MTAB 9054:R903\|scientific name:Danio rerio\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	E MTAB 9054:R903 s	R903 s	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 h…	Experimental Factor: compound:n1	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP121652	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 11	R903_sr.fastq.gz	fastq	1978975800.0	39199481.0	E MTAB 9054:R903	0:50.48 1:0	A:502614523;C:482986303;G:468168184;T:522608062;N:2598728	50	0	502614523	482986303	468168184	522608062	2598728	ERX4099800	ERS4551995	ERA2597157	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	1	0.9404	0.09216	0.64607	0.47417	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2020-05-11	Larval	Larval	Whole Organism	All anatomical structures
9881	9881	ERR4132483	ERX4099799	ERS4551994	ERP121652	PRJEB38247	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	E-MTAB-9054	Transcriptome Analysis	Endocrine disruption can trigger far reaching effects on environmental populations justifying a refusal of market approval for chemicals with ED properties. Ecotoxicogenomic screening was performed to identify molecular fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. 6 Propyl 2 thiouracil 6PTU CAS: 51 52 5 was tested as a model substance for anti thyroidal activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked from each sample group and pooled for RNA and protein extraction with NucleoSpin© RNA/Protein kit Macherey Nagel. RNA quality was assessed via a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing 30 million reads per sample. Initial BCL files were demultiplexed to fastq files via bcl2fastq. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library mapped read tables were then merged to a single count matrix. Using this matrix as input read counts were normalized with DESeq2 for differential gene expression analysis.	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 11	Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions.…	R899	SAMEA6824365	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany	ENA FIRST PUBLIC:2020 07 31T04:03:57Z\|ENA LAST UPDATE:2020 05 11T17:12:34Z\|External Id:SAMEA6824365\|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany\|INSDC first public:2020 07 31T04:03:57Z\|INSDC last update:2020 05 11T17:12:34Z\|INSDC status:public\|Submitter Id:E MTAB 9054:R899\|age:96\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|genotype:wild type genotype\|growth condition:normal\|individual:mixed pool of 10 fish\|organism part:whole organism\|rin values:10\|sample name:E MTAB 9054:R899\|scientific name:Danio rerio\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	E MTAB 9054:R899 s	R899 s	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 h…	Experimental Factor: compound:n1	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP121652	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 11	R899_sr.fastq.gz	fastq	1556233879.0	30835141.0	E MTAB 9054:R899	0:50.47 1:0	A:394448696;C:380284673;G:367546543;T:410802983;N:3150984	50	0	394448696	380284673	367546543	410802983	3150984	ERX4099799	ERS4551994	ERA2597157	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	1	0.93845	0.09509	0.64926	0.48436	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2020-05-11	Larval	Larval	Whole Organism	All anatomical structures
9882	9882	ERR4132482	ERX4099798	ERS4551993	ERP121652	PRJEB38247	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	E-MTAB-9054	Transcriptome Analysis	Endocrine disruption can trigger far reaching effects on environmental populations justifying a refusal of market approval for chemicals with ED properties. Ecotoxicogenomic screening was performed to identify molecular fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. 6 Propyl 2 thiouracil 6PTU CAS: 51 52 5 was tested as a model substance for anti thyroidal activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked from each sample group and pooled for RNA and protein extraction with NucleoSpin© RNA/Protein kit Macherey Nagel. RNA quality was assessed via a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing 30 million reads per sample. Initial BCL files were demultiplexed to fastq files via bcl2fastq. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library mapped read tables were then merged to a single count matrix. Using this matrix as input read counts were normalized with DESeq2 for differential gene expression analysis.	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 11	Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions.…	R895	SAMEA6824364	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany	ENA FIRST PUBLIC:2020 07 31T04:03:57Z\|ENA LAST UPDATE:2020 05 11T17:12:34Z\|External Id:SAMEA6824364\|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany\|INSDC first public:2020 07 31T04:03:57Z\|INSDC last update:2020 05 11T17:12:34Z\|INSDC status:public\|Submitter Id:E MTAB 9054:R895\|age:96\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|genotype:wild type genotype\|growth condition:normal\|individual:mixed pool of 10 fish\|organism part:whole organism\|rin values:10\|sample name:E MTAB 9054:R895\|scientific name:Danio rerio\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	E MTAB 9054:R895 s	R895 s	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 h…	Experimental Factor: compound:n1	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP121652	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 11	R895_sr.fastq.gz	fastq	1098959757.0	21771883.0	E MTAB 9054:R895	0:50.48 1:0	A:281414032;C:266978094;G:257304686;T:291591340;N:1671605	50	0	281414032	266978094	257304686	291591340	1671605	ERX4099798	ERS4551993	ERA2597157	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	1	0.93996	0.09776	0.64989	0.47968	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2020-05-11	Larval	Larval	Whole Organism	All anatomical structures
9883	9883	ERR4140034	ERX4107347	ERS4556110	ERP121678	PRJEB38271	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	E-MTAB-9056	Transcriptome Analysis	The aim of this sequencing experiment was to screen for ecotoxicogenomic fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. Triiodothyronine T3 CAS: 6893 02 3 was tested as a model substance for thyroidal inducing activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of T3 for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked for each sample and pooled for RNA and protein extraction with NucleoSpin RNA/Protein kit Macherey Nagel. RNA quality was assessed with a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing roughly 30 million reads per sample. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library gene count tables were then merged to a single count matrix as input for differential gene expression analysis with DESeq2.	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 12	Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphologi…	R86	SAMEA6828487	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany	ENA FIRST PUBLIC:2020 07 31T04:03:57Z\|ENA LAST UPDATE:2020 05 12T15:52:19Z\|External Id:SAMEA6828487\|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany\|INSDC first public:2020 07 31T04:03:57Z\|INSDC last update:2020 05 12T15:52:19Z\|INSDC status:public\|Submitter Id:E MTAB 9056:R86\|age:96\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|genotype:wild type genotype\|growth condition:low exposure\|individual:pool of 10 fish\|organism part:whole organism\|sample name:E MTAB 9056:R86\|scientific name:Danio rerio\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyro9 T3 below acute toxicity levels against untreated control groups	E MTAB 9056:R86 s	R86 s	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malfo…	Experimental Factor: compound:3 3 prime 5 triiodo L thyro9\|Experimental Factor: dose:3.3E 06	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP121678	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 13	R86_sr.fastq.gz	fastq	1327826966.0	26294265.0	E MTAB 9056:R86	0:50.50 1:0	A:340934934;C:322947435;G:309801278;T:353159102;N:984217	50	0	340934934	322947435	309801278	353159102	984217	ERX4107347	ERS4556110	ERA2597448	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	1	0.9393	0.1031	0.65683	0.46848	50	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2020-05-12	Larval	Larval	Whole Organism	All anatomical structures
9884	9884	ERR4140033	ERX4107346	ERS4556109	ERP121678	PRJEB38271	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	E-MTAB-9056	Transcriptome Analysis	The aim of this sequencing experiment was to screen for ecotoxicogenomic fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. Triiodothyronine T3 CAS: 6893 02 3 was tested as a model substance for thyroidal inducing activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of T3 for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked for each sample and pooled for RNA and protein extraction with NucleoSpin RNA/Protein kit Macherey Nagel. RNA quality was assessed with a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing roughly 30 million reads per sample. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library gene count tables were then merged to a single count matrix as input for differential gene expression analysis with DESeq2.	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 12	Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphologi…	R164	SAMEA6828486	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany	ENA FIRST PUBLIC:2020 07 31T04:03:57Z\|ENA LAST UPDATE:2020 05 12T15:52:19Z\|External Id:SAMEA6828486\|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany\|INSDC first public:2020 07 31T04:03:57Z\|INSDC last update:2020 05 12T15:52:19Z\|INSDC status:public\|Submitter Id:E MTAB 9056:R164\|age:96\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|genotype:wild type genotype\|growth condition:low exposure\|individual:pool of 10 fish\|organism part:whole organism\|sample name:E MTAB 9056:R164\|scientific name:Danio rerio\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyro9 T3 below acute toxicity levels against untreated control groups	E MTAB 9056:R164 s	R164 s	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malfo…	Experimental Factor: compound:3 3 prime 5 triiodo L thyro9\|Experimental Factor: dose:3.3E 06	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP121678	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 13	R164_sr.fastq.gz	fastq	1513567439.0	29975869.0	E MTAB 9056:R164	0:50.49 1:0	A:388109813;C:368964600;G:352756505;T:402261160;N:1475361	50	0	388109813	368964600	352756505	402261160	1475361	ERX4107346	ERS4556109	ERA2597448	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	1	0.93992	0.10282	0.65437	0.47367	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2020-05-12	Larval	Larval	Whole Organism	All anatomical structures
9885	9885	ERR4140032	ERX4107345	ERS4556108	ERP121678	PRJEB38271	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	E-MTAB-9056	Transcriptome Analysis	The aim of this sequencing experiment was to screen for ecotoxicogenomic fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. Triiodothyronine T3 CAS: 6893 02 3 was tested as a model substance for thyroidal inducing activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of T3 for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked for each sample and pooled for RNA and protein extraction with NucleoSpin RNA/Protein kit Macherey Nagel. RNA quality was assessed with a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing roughly 30 million reads per sample. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library gene count tables were then merged to a single count matrix as input for differential gene expression analysis with DESeq2.	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 12	Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphologi…	R158	SAMEA6828485	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany	ENA FIRST PUBLIC:2020 07 31T04:03:57Z\|ENA LAST UPDATE:2020 05 12T15:52:19Z\|External Id:SAMEA6828485\|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany\|INSDC first public:2020 07 31T04:03:57Z\|INSDC last update:2020 05 12T15:52:19Z\|INSDC status:public\|Submitter Id:E MTAB 9056:R158\|age:96\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|genotype:wild type genotype\|growth condition:low exposure\|individual:pool of 10 fish\|organism part:whole organism\|sample name:E MTAB 9056:R158\|scientific name:Danio rerio\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyro9 T3 below acute toxicity levels against untreated control groups	E MTAB 9056:R158 s	R158 s	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malfo…	Experimental Factor: compound:3 3 prime 5 triiodo L thyro9\|Experimental Factor: dose:3.3E 06	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP121678	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 13	R158_sr.fastq.gz	fastq	1512642153.0	29962837.0	E MTAB 9056:R158	0:50.48 1:0	A:389585690;C:365364747;G:351299223;T:404327286;N:2065207	50	0	389585690	365364747	351299223	404327286	2065207	ERX4107345	ERS4556108	ERA2597448	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	1	0.93757	0.10553	0.65557	0.47147	49	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2020-05-12	Larval	Larval	Whole Organism	All anatomical structures
9886	9886	ERR4140031	ERX4107344	ERS4556107	ERP121678	PRJEB38271	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	E-MTAB-9056	Transcriptome Analysis	The aim of this sequencing experiment was to screen for ecotoxicogenomic fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. Triiodothyronine T3 CAS: 6893 02 3 was tested as a model substance for thyroidal inducing activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of T3 for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked for each sample and pooled for RNA and protein extraction with NucleoSpin RNA/Protein kit Macherey Nagel. RNA quality was assessed with a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing roughly 30 million reads per sample. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library gene count tables were then merged to a single count matrix as input for differential gene expression analysis with DESeq2.	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 12	Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphologi…	R89	SAMEA6828484	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany	ENA FIRST PUBLIC:2020 07 31T04:03:57Z\|ENA LAST UPDATE:2020 05 12T15:52:19Z\|External Id:SAMEA6828484\|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany\|INSDC first public:2020 07 31T04:03:57Z\|INSDC last update:2020 05 12T15:52:19Z\|INSDC status:public\|Submitter Id:E MTAB 9056:R89\|age:96\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|genotype:wild type genotype\|growth condition:high exposure\|individual:pool of 10 fish\|organism part:whole organism\|sample name:E MTAB 9056:R89\|scientific name:Danio rerio\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyro9 T3 below acute toxicity levels against untreated control groups	E MTAB 9056:R89 s	R89 s	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malfo…	Experimental Factor: compound:3 3 prime 5 triiodo L thyro9\|Experimental Factor: dose:0.000327	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP121678	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 13	R89_sr.fastq.gz	fastq	1347758243.0	26686154.0	E MTAB 9056:R89	0:50.50 1:0	A:347954623;C:326744319;G:311736057;T:360479809;N:843435	50	0	347954623	326744319	311736057	360479809	843435	ERX4107344	ERS4556107	ERA2597448	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	1	0.93909	0.1032	0.64906	0.47499	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2020-05-12	Larval	Larval	Whole Organism	All anatomical structures
9887	9887	ERR4140030	ERX4107343	ERS4556106	ERP121678	PRJEB38271	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	E-MTAB-9056	Transcriptome Analysis	The aim of this sequencing experiment was to screen for ecotoxicogenomic fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. Triiodothyronine T3 CAS: 6893 02 3 was tested as a model substance for thyroidal inducing activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of T3 for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked for each sample and pooled for RNA and protein extraction with NucleoSpin RNA/Protein kit Macherey Nagel. RNA quality was assessed with a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing roughly 30 million reads per sample. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library gene count tables were then merged to a single count matrix as input for differential gene expression analysis with DESeq2.	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 12	Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphologi…	R167	SAMEA6828483	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany	ENA FIRST PUBLIC:2020 07 31T04:03:57Z\|ENA LAST UPDATE:2020 05 12T15:52:19Z\|External Id:SAMEA6828483\|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany\|INSDC first public:2020 07 31T04:03:57Z\|INSDC last update:2020 05 12T15:52:19Z\|INSDC status:public\|Submitter Id:E MTAB 9056:R167\|age:96\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|genotype:wild type genotype\|growth condition:high exposure\|individual:pool of 10 fish\|organism part:whole organism\|sample name:E MTAB 9056:R167\|scientific name:Danio rerio\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyro9 T3 below acute toxicity levels against untreated control groups	E MTAB 9056:R167 s	R167 s	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malfo…	Experimental Factor: compound:3 3 prime 5 triiodo L thyro9\|Experimental Factor: dose:0.000327	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP121678	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 13	R167_sr.fastq.gz	fastq	1422756236.0	28174340.0	E MTAB 9056:R167	0:50.50 1:0	A:366380887;C:345824655;G:330108682;T:379312527;N:1129485	50	0	366380887	345824655	330108682	379312527	1129485	ERX4107343	ERS4556106	ERA2597448	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	1	0.93724	0.10506	0.65001	0.47599	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2020-05-12	Larval	Larval	Whole Organism	All anatomical structures
9888	9888	ERR4140029	ERX4107342	ERS4556105	ERP121678	PRJEB38271	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	E-MTAB-9056	Transcriptome Analysis	The aim of this sequencing experiment was to screen for ecotoxicogenomic fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. Triiodothyronine T3 CAS: 6893 02 3 was tested as a model substance for thyroidal inducing activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of T3 for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked for each sample and pooled for RNA and protein extraction with NucleoSpin RNA/Protein kit Macherey Nagel. RNA quality was assessed with a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing roughly 30 million reads per sample. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library gene count tables were then merged to a single count matrix as input for differential gene expression analysis with DESeq2.	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 12	Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphologi…	R161	SAMEA6828482	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany	ENA FIRST PUBLIC:2020 07 31T04:03:57Z\|ENA LAST UPDATE:2020 05 12T15:52:19Z\|External Id:SAMEA6828482\|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany\|INSDC first public:2020 07 31T04:03:57Z\|INSDC last update:2020 05 12T15:52:19Z\|INSDC status:public\|Submitter Id:E MTAB 9056:R161\|age:96\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|genotype:wild type genotype\|growth condition:high exposure\|individual:pool of 10 fish\|organism part:whole organism\|sample name:E MTAB 9056:R161\|scientific name:Danio rerio\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyro9 T3 below acute toxicity levels against untreated control groups	E MTAB 9056:R161 s	R161 s	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malfo…	Experimental Factor: compound:3 3 prime 5 triiodo L thyro9\|Experimental Factor: dose:0.000327	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP121678	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 13	R161_sr.fastq.gz	fastq	1696412529.0	33592555.0	E MTAB 9056:R161	0:50.50 1:0	A:439133160;C:409023953;G:389977077;T:457053986;N:1224353	50	0	439133160	409023953	389977077	457053986	1224353	ERX4107342	ERS4556105	ERA2597448	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	1	0.93609	0.1083	0.6535	0.46658	50	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2020-05-12	Larval	Larval	Whole Organism	All anatomical structures
9889	9889	ERR4140028	ERX4107341	ERS4556104	ERP121678	PRJEB38271	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	E-MTAB-9056	Transcriptome Analysis	The aim of this sequencing experiment was to screen for ecotoxicogenomic fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. Triiodothyronine T3 CAS: 6893 02 3 was tested as a model substance for thyroidal inducing activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of T3 for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked for each sample and pooled for RNA and protein extraction with NucleoSpin RNA/Protein kit Macherey Nagel. RNA quality was assessed with a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing roughly 30 million reads per sample. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library gene count tables were then merged to a single count matrix as input for differential gene expression analysis with DESeq2.	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 12	Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphologi…	R85	SAMEA6828481	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany	ENA FIRST PUBLIC:2020 07 31T04:03:57Z\|ENA LAST UPDATE:2020 05 12T15:52:19Z\|External Id:SAMEA6828481\|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany\|INSDC first public:2020 07 31T04:03:57Z\|INSDC last update:2020 05 12T15:52:19Z\|INSDC status:public\|Submitter Id:E MTAB 9056:R85\|age:96\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|genotype:wild type genotype\|growth condition:control\|individual:pool of 10 fish\|organism part:whole organism\|sample name:E MTAB 9056:R85\|scientific name:Danio rerio\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyro9 T3 below acute toxicity levels against untreated control groups	E MTAB 9056:R85 s	R85 s	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malfo…	Experimental Factor: compound:n1\|Experimental Factor: dose:0	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP121678	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 13	R85_sr.fastq.gz	fastq	1115426084.0	22086160.0	E MTAB 9056:R85	0:50.50 1:0	A:288411880;C:265358022;G:259432943;T:301493661;N:729578	50	0	288411880	265358022	259432943	301493661	729578	ERX4107341	ERS4556104	ERA2597448	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	1	0.94238	0.10918	0.65372	0.48727	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2020-05-12	Larval	Larval	Whole Organism	All anatomical structures
9890	9890	ERR4140027	ERX4107340	ERS4556103	ERP121678	PRJEB38271	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	E-MTAB-9056	Transcriptome Analysis	The aim of this sequencing experiment was to screen for ecotoxicogenomic fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. Triiodothyronine T3 CAS: 6893 02 3 was tested as a model substance for thyroidal inducing activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of T3 for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked for each sample and pooled for RNA and protein extraction with NucleoSpin RNA/Protein kit Macherey Nagel. RNA quality was assessed with a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing roughly 30 million reads per sample. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library gene count tables were then merged to a single count matrix as input for differential gene expression analysis with DESeq2.	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 12	Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphologi…	R162	SAMEA6828480	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany	ENA FIRST PUBLIC:2020 07 31T04:03:57Z\|ENA LAST UPDATE:2020 05 12T15:52:19Z\|External Id:SAMEA6828480\|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany\|INSDC first public:2020 07 31T04:03:57Z\|INSDC last update:2020 05 12T15:52:19Z\|INSDC status:public\|Submitter Id:E MTAB 9056:R162\|age:96\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|genotype:wild type genotype\|growth condition:control\|individual:pool of 10 fish\|organism part:whole organism\|sample name:E MTAB 9056:R162\|scientific name:Danio rerio\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyro9 T3 below acute toxicity levels against untreated control groups	E MTAB 9056:R162 s	R162 s	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malfo…	Experimental Factor: compound:n1\|Experimental Factor: dose:0	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP121678	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 13	R162_sr.fastq.gz	fastq	1368462525.0	27098537.0	E MTAB 9056:R162	0:50.50 1:0	A:352965195;C:330975762;G:317956233;T:365598349;N:966986	50	0	352965195	330975762	317956233	365598349	966986	ERX4107340	ERS4556103	ERA2597448	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	1	0.93788	0.10812	0.65482	0.47962	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2020-05-12	Larval	Larval	Whole Organism	All anatomical structures
9891	9891	ERR4140026	ERX4107339	ERS4556102	ERP121678	PRJEB38271	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	E-MTAB-9056	Transcriptome Analysis	The aim of this sequencing experiment was to screen for ecotoxicogenomic fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. Triiodothyronine T3 CAS: 6893 02 3 was tested as a model substance for thyroidal inducing activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of T3 for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked for each sample and pooled for RNA and protein extraction with NucleoSpin RNA/Protein kit Macherey Nagel. RNA quality was assessed with a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing roughly 30 million reads per sample. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library gene count tables were then merged to a single count matrix as input for differential gene expression analysis with DESeq2.	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 12	Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphologi…	R157	SAMEA6828479	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany	ENA FIRST PUBLIC:2020 07 31T04:03:57Z\|ENA LAST UPDATE:2020 05 12T15:52:19Z\|External Id:SAMEA6828479\|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany\|INSDC first public:2020 07 31T04:03:57Z\|INSDC last update:2020 05 12T15:52:19Z\|INSDC status:public\|Submitter Id:E MTAB 9056:R157\|age:96\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|genotype:wild type genotype\|growth condition:control\|individual:pool of 10 fish\|organism part:whole organism\|sample name:E MTAB 9056:R157\|scientific name:Danio rerio\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyro9 T3 below acute toxicity levels against untreated control groups	E MTAB 9056:R157 s	R157 s	RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malfo…	Experimental Factor: compound:n1\|Experimental Factor: dose:0	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP121678	Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2020 09 30\|ENA LAST UPDATE:2020 05 13	R157_sr.fastq.gz	fastq	1500167669.0	29707076.0	E MTAB 9056:R157	0:50.50 1:0	A:386622926;C:363330639;G:347819057;T:401278075;N:1116972	50	0	386622926	363330639	347819057	401278075	1116972	ERX4107339	ERS4556102	ERA2597448	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany\|European Nucleotide Archive	1	0.93887	0.10641	0.65283	0.46616	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2020-05-12	Larval	Larval	Whole Organism	All anatomical structures
9898	9898	ERR4194114	ERX4155254	ERS4601292	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 2	SAMEA6873729	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873729\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 2\|age:8\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 2\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 2 s	Sample 2 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:8\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA8h_1_S2_L001.bam	bam	10087287534.0	99874134.0	E MTAB 9193:cDNA8h 1 S2 L001	0:101	A:2892833391;C:2022466595;G:2198646699;T:2962268446;N:11072403	101		2892833391	2022466595	2198646699	2962268446	11072403	ERX4155254	ERS4601292	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93609	0.12902	0.82158	0.5062	101	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9899	9899	ERR4194115	ERX4155254	ERS4601292	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 2	SAMEA6873729	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873729\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 2\|age:8\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 2\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 2 s	Sample 2 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:8\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA8h_1_S2_L002.bam	bam	10191911414.0	100910014.0	E MTAB 9193:cDNA8h 1 S2 L002	0:101	A:2923216190;C:2043975715;G:2221734566;T:2992798366;N:10186577	101		2923216190	2043975715	2221734566	2992798366	10186577	ERX4155254	ERS4601292	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93445	0.13038	0.824	0.49774	101	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9900	9900	ERR4194112	ERX4155253	ERS4601291	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 1	SAMEA6873728	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873728\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 1\|age:6\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 1\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 1 s	Sample 1 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:6\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA6h_1_S1_L001.bam	bam	7181772357.0	71106657.0	E MTAB 9193:cDNA6h 1 S1 L001	0:101	A:2074032710;C:1415439071;G:1544274166;T:2140112533;N:7913877	101		2074032710	1415439071	1544274166	2140112533	7913877	ERX4155253	ERS4601291	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.9297	0.12156	0.8117	0.51457	101	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9901	9901	ERR4194113	ERX4155253	ERS4601291	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 1	SAMEA6873728	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873728\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 1\|age:6\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 1\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 1 s	Sample 1 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:6\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA6h_1_S1_L002.bam	bam	7256542253.0	71846953.0	E MTAB 9193:cDNA6h 1 S1 L002	0:101	A:2096163385;C:1430325700;G:1560530043;T:2162265616;N:7257509	101		2096163385	1430325700	1560530043	2162265616	7257509	ERX4155253	ERS4601291	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.92882	0.12127	0.81162	0.51457	101	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9902	9902	ERR4194128	ERX4155256	ERS4601294	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 4	SAMEA6873731	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873731\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 4\|age:13\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 4\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 4 s	Sample 4 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:13\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA13h_1_control_S1_L001.bam	bam	10785974123.0	106791823.0	E MTAB 9193:cDNA13h 1 control S1 L001	0:101	A:3007305661;C:2241057062;G:2505494392;T:2986021199;N:46095809	101		3007305661	2241057062	2505494392	2986021199	46095809	ERX4155256	ERS4601294	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.67094	0.07571	0.92951	0.5272	101	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9903	9903	ERR4194129	ERX4155256	ERS4601294	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 4	SAMEA6873731	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873731\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 4\|age:13\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 4\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 4 s	Sample 4 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:13\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA13h_1_control_S1_L002.bam	bam	10595192294.0	104902894.0	E MTAB 9193:cDNA13h 1 control S1 L002	0:101	A:2971916419;C:2204229263;G:2390854035;T:2949877754;N:78314823	101		2971916419	2204229263	2390854035	2949877754	78314823	ERX4155256	ERS4601294	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.67255	0.08054	0.91583	0.52661	101	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9904	9904	ERR4194116	ERX4155255	ERS4601293	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 3	SAMEA6873730	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873730\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 3\|age:10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 3\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 3 s	Sample 3 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:10\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA10h_1_S3_L001.bam	bam	1622536412.0	16556494.0	E MTAB 9193:cDNA10h 1 S3 L001	0:98	A:491141175;C:317161060;G:354179755;T:459976409;N:78013	98		491141175	317161060	354179755	459976409	78013	ERX4155255	ERS4601293	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93238	0.13033	0.89132	0.47076	98	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9905	9905	ERR4194117	ERX4155255	ERS4601293	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 3	SAMEA6873730	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873730\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 3\|age:10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 3\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 3 s	Sample 3 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:10\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA10h_1_S3_L002.bam	bam	1484328776.0	15146212.0	E MTAB 9193:cDNA10h 1 S3 L002	0:98	A:450782055;C:290088574;G:322801188;T:420570801;N:86158	98		450782055	290088574	322801188	420570801	86158	ERX4155255	ERS4601293	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.92846	0.13128	0.89923	0.46879	98	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9906	9906	ERR4194118	ERX4155255	ERS4601293	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 3	SAMEA6873730	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873730\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 3\|age:10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 3\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 3 s	Sample 3 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:10\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA10h_1_S3_L003.bam	bam	1578833116.0	16110542.0	E MTAB 9193:cDNA10h 1 S3 L003	0:98	A:477600666;C:308260969;G:347303289;T:445467384;N:200808	98		477600666	308260969	347303289	445467384	200808	ERX4155255	ERS4601293	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93107	0.12965	0.91265	0.47375	98	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9907	9907	ERR4194119	ERX4155255	ERS4601293	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 3	SAMEA6873730	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873730\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 3\|age:10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 3\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 3 s	Sample 3 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:10\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA10h_1_S3_L004.bam	bam	1859564994.0	18975153.0	E MTAB 9193:cDNA10h 1 S3 L004	0:98	A:562936790;C:364057256;G:406607636;T:525811595;N:151717	98		562936790	364057256	406607636	525811595	151717	ERX4155255	ERS4601293	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93453	0.1266	0.87714	0.46957	98	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9908	9908	ERR4194120	ERX4155255	ERS4601293	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 3	SAMEA6873730	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873730\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 3\|age:10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 3\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 3 s	Sample 3 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:10\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA10h_2_S3_L001.bam	bam	1156341102.0	11799399.0	E MTAB 9193:cDNA10h 2 S3 L001	0:98	A:345857612;C:224453195;G:257551986;T:327969064;N:509245	98		345857612	224453195	257551986	327969064	509245	ERX4155255	ERS4601293	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93863	0.10744	0.81984	0.501	98	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9909	9909	ERR4194121	ERX4155255	ERS4601293	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 3	SAMEA6873730	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873730\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 3\|age:10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 3\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 3 s	Sample 3 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:10\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA10h_2_S3_L002.bam	bam	1105219696.0	11277752.0	E MTAB 9193:cDNA10h 2 S3 L002	0:98	A:331051973;C:214369903;G:246546338;T:312897773;N:353709	98		331051973	214369903	246546338	312897773	353709	ERX4155255	ERS4601293	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93941	0.10818	0.82211	0.50079	98	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9910	9910	ERR4194122	ERX4155255	ERS4601293	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 3	SAMEA6873730	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873730\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 3\|age:10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 3\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 3 s	Sample 3 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:10\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA10h_2_S3_L003.bam	bam	1105199606.0	11277547.0	E MTAB 9193:cDNA10h 2 S3 L003	0:98	A:331158619;C:214305131;G:246465559;T:312930408;N:339889	98		331158619	214305131	246465559	312930408	339889	ERX4155255	ERS4601293	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93767	0.10645	0.82329	0.50057	98	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9911	9911	ERR4194123	ERX4155255	ERS4601293	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 3	SAMEA6873730	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873730\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 3\|age:10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 3\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 3 s	Sample 3 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:10\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA10h_2_S3_L004.bam	bam	1108707712.0	11313344.0	E MTAB 9193:cDNA10h 2 S3 L004	0:98	A:331374433;C:215925150;G:247131942;T:313865174;N:411013	98		331374433	215925150	247131942	313865174	411013	ERX4155255	ERS4601293	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93827	0.10842	0.82031	0.49241	98	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9912	9912	ERR4194124	ERX4155255	ERS4601293	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 3	SAMEA6873730	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873730\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 3\|age:10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 3\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 3 s	Sample 3 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:10\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA10h_2_S3_L005.bam	bam	1110084612.0	11327394.0	E MTAB 9193:cDNA10h 2 S3 L005	0:98	A:332881960;C:215360330;G:247563319;T:313842331;N:436672	98		332881960	215360330	247563319	313842331	436672	ERX4155255	ERS4601293	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93827	0.10719	0.8238	0.50406	98	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9913	9913	ERR4194125	ERX4155255	ERS4601293	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 3	SAMEA6873730	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873730\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 3\|age:10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 3\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 3 s	Sample 3 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:10\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA10h_2_S3_L006.bam	bam	1113812728.0	11365436.0	E MTAB 9193:cDNA10h 2 S3 L006	0:98	A:333112288;C:216649152;G:248341020;T:315338848;N:371420	98		333112288	216649152	248341020	315338848	371420	ERX4155255	ERS4601293	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93843	0.10675	0.82079	0.49284	98	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9914	9914	ERR4194126	ERX4155255	ERS4601293	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 3	SAMEA6873730	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873730\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 3\|age:10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 3\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 3 s	Sample 3 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:10\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA10h_2_S3_L007.bam	bam	1119495748.0	11423426.0	E MTAB 9193:cDNA10h 2 S3 L007	0:98	A:335288339;C:217283719;G:249624836;T:316900388;N:398466	98		335288339	217283719	249624836	316900388	398466	ERX4155255	ERS4601293	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93711	0.10749	0.82266	0.49382	98	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9915	9915	ERR4194127	ERX4155255	ERS4601293	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 3	SAMEA6873730	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873730\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 3\|age:10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 3\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 3 s	Sample 3 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:10\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA10h_2_S3_L008.bam	bam	1175946688.0	11999456.0	E MTAB 9193:cDNA10h 2 S3 L008	0:98	A:351364169;C:228318193;G:261971072;T:333863943;N:429311	98		351364169	228318193	261971072	333863943	429311	ERX4155255	ERS4601293	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93851	0.10755	0.82158	0.49895	98	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9916	9916	ERR4194130	ERX4155257	ERS4601295	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 5	SAMEA6873732	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873732\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 5\|age:13\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 5\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 5 s	Sample 5 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:13\|Experimental Factor: RNA interference:morpholino mediated Gata5/6 knockdown	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA13h_2_gata56KD_S2_L001.bam	bam	7791309377.0	77141677.0	E MTAB 9193:cDNA13h 2 gata56KD S2 L001	0:101	A:2198242220;C:1593746618;G:1784167452;T:2181979820;N:33173267	101		2198242220	1593746618	1784167452	2181979820	33173267	ERX4155257	ERS4601295	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.66736	0.08039	0.93026	0.50796	101	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9917	9917	ERR4194131	ERX4155257	ERS4601295	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 5	SAMEA6873732	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873732\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 5\|age:13\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 5\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 5 s	Sample 5 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:13\|Experimental Factor: RNA interference:morpholino mediated Gata5/6 knockdown	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA13h_2_gata56KD_S2_L002.bam	bam	7658149967.0	75823267.0	E MTAB 9193:cDNA13h 2 gata56KD S2 L002	0:101	A:2172230233;C:1568805100;G:1703587704;T:2157181071;N:56345859	101		2172230233	1568805100	1703587704	2157181071	56345859	ERX4155257	ERS4601295	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.66565	0.08597	0.91804	0.51772	101	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
10068	10068	ERR4844843	ERX4714625	ERS5338302	ERP125162	PRJEB41393	Depletion of Foxk transcription factors causes genome wide transcriptional misregulation and developmental arrest in zebrafish embryos	E-MTAB-9777	Transcriptome Analysis	Foxk proteins are transcriptional regulators implicated in key biological processes such as glycolysis autophagy and cell cycle regulation among others. Here we employ targeted morpholino knockdown to deplete Foxk1 Fokx2 and Foxk2 1 proteins in developing zebrafish embryos. We demonstrate that the loss of Foxk transcription factors causes genome wide transcriptional misregulation characterised by upregulation of autophagy related genes and downregulation of cell cycle regulators. The phenotype is embryonic lethal with the majority of embryos not surviving past 24hpf.	ENA FIRST PUBLIC:2020 12 01\|ENA LAST UPDATE:2020 11 17	Protocols: Embryos were collected 0 hpf and incubated in 1X E3 medium 0.03% NaCl 0.005% CaCl2 0.0013% KCl 99.9557% H2O 0.008% H14MgO11S for 24 hours at 28.5°C Adult wild type AB/Tubingen Danio rerio zebrafish were bred in a 1 male:1 female ratio. 1c embryos were injected with morpholino oligonucleotides targeting foxk1 foxk2 and foxk2 1 transcripts Total RNA was purified from xxx embryos using the RNeasy Mini Kit Qiagen Valencia CA USA according to the manufacturer's instructions. mRNA Seq libraries were generated from total RNA with polyA+ selection of mRNA using the TruSeq RNA Sample Prep Kit v2 Illumina San Diego CA. Strand specific libraries were constructed using a dUTP methodology as described previously [Zhong S. et al. High Throughput Illumina Strand Specific RNA Sequencing Library Preparation. Cold Spring Harb. Protoc. 2011 940 949 2011]	wt rep2	SAMEA7579966	Garvan Institute of Medical Research	ENA first public:2020 12 01\|ENA last update:2020 11 17\|External Id:SAMEA7579966\|INSDC center alias:Garvan Institute of Medical Research\|INSDC center name:Garvan Institute of Medical Research\|INSDC first public:2020 12 01T04:12:08Z\|INSDC last update:2020 11 17T14:25:39Z\|INSDC status:public\|Submitter Id:E MTAB 9777:wt rep2\|age:24hpf\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|organism part:whole organism\|sample name:E MTAB 9777:wt rep2\|strain:Ab / Tubingen	Illumina HiSeq 1500 sequencing; Depletion of Foxk transcription factors causes genome wide transcriptional misregulation and developmental arrest in zebrafish embryos	E MTAB 9777:wt rep2 s	wt rep2 s	Depletion of Foxk transcription factors causes genome wide transcriptional misregulation and developmental arrest in zebrafish embryos	Embryos were collected 0 hpf and incubated in 1X E3 medium 0.03% NaCl 0.005% CaCl2 0.0013% KCl 99.9557% H2O 0.008% H14MgO11S for 24 hours at 28.5°C Adult wild type AB/Tubingen Danio rerio zebrafish were bred in a 1 male:1 female ratio. 1c embryos were injected with morpholino oligonucleotides targeting foxk1 foxk2 and foxk2 1 transcripts Total RNA was purified from xxx embryos using the RNeasy Mini Kit Qiagen Valencia CA USA according to the manufacturer's instructions. mRNA Seq libraries were generated from total RNA with polyA+ selection of mRNA using the TruSeq RNA Sample Prep Kit v2 Illumina San Diego CA. Strand specific libraries were constructed using a dUTP methodology as described previously [Zhong S. et al. High Throughput Illumina Strand Specific RNA Sequencing Library Preparation. Cold Spring Harb. Protoc. 2011 940 949 2011]	Experimental Factor: compound:n1	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 1500	ERP125162	Illumina HiSeq 1500 sequencing; Depletion of Foxk transcription factors causes genome wide transcriptional misregulation and developmental arrest in zebrafish embryos	ENA FIRST PUBLIC:2020 12 01\|ENA LAST UPDATE:2020 11 17	wt_rep2.fastq.gz	fastq	3456340392.0	34221192.0	E MTAB 9777:wt rep2	0:101 1:0	A:850781866;C:827613239;G:837337477;T:936245388;N:4362422	101	0	850781866	827613239	837337477	936245388	4362422	ERX4714625	ERS5338302	ERA3145932	European Nucleotide Archive	European Nucleotide Archive	1	0.94198	0.05681	0.69613	0.46685	101	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Unknown	2020-11-17	Pharyngula	Embryo	Whole Organism	All anatomical structures
10069	10069	ERR4844842	ERX4714624	ERS5338301	ERP125162	PRJEB41393	Depletion of Foxk transcription factors causes genome wide transcriptional misregulation and developmental arrest in zebrafish embryos	E-MTAB-9777	Transcriptome Analysis	Foxk proteins are transcriptional regulators implicated in key biological processes such as glycolysis autophagy and cell cycle regulation among others. Here we employ targeted morpholino knockdown to deplete Foxk1 Fokx2 and Foxk2 1 proteins in developing zebrafish embryos. We demonstrate that the loss of Foxk transcription factors causes genome wide transcriptional misregulation characterised by upregulation of autophagy related genes and downregulation of cell cycle regulators. The phenotype is embryonic lethal with the majority of embryos not surviving past 24hpf.	ENA FIRST PUBLIC:2020 12 01\|ENA LAST UPDATE:2020 11 17	Protocols: Embryos were collected 0 hpf and incubated in 1X E3 medium 0.03% NaCl 0.005% CaCl2 0.0013% KCl 99.9557% H2O 0.008% H14MgO11S for 24 hours at 28.5°C Adult wild type AB/Tubingen Danio rerio zebrafish were bred in a 1 male:1 female ratio. 1c embryos were injected with morpholino oligonucleotides targeting foxk1 foxk2 and foxk2 1 transcripts Total RNA was purified from xxx embryos using the RNeasy Mini Kit Qiagen Valencia CA USA according to the manufacturer's instructions. mRNA Seq libraries were generated from total RNA with polyA+ selection of mRNA using the TruSeq RNA Sample Prep Kit v2 Illumina San Diego CA. Strand specific libraries were constructed using a dUTP methodology as described previously [Zhong S. et al. High Throughput Illumina Strand Specific RNA Sequencing Library Preparation. Cold Spring Harb. Protoc. 2011 940 949 2011]	wt rep1	SAMEA7579965	Garvan Institute of Medical Research	ENA first public:2020 12 01\|ENA last update:2020 11 17\|External Id:SAMEA7579965\|INSDC center alias:Garvan Institute of Medical Research\|INSDC center name:Garvan Institute of Medical Research\|INSDC first public:2020 12 01T04:12:08Z\|INSDC last update:2020 11 17T14:25:39Z\|INSDC status:public\|Submitter Id:E MTAB 9777:wt rep1\|age:24hpf\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|organism part:whole organism\|sample name:E MTAB 9777:wt rep1\|strain:AB / Tubingen	Illumina HiSeq 1500 sequencing; Depletion of Foxk transcription factors causes genome wide transcriptional misregulation and developmental arrest in zebrafish embryos	E MTAB 9777:wt rep1 s	wt rep1 s	Depletion of Foxk transcription factors causes genome wide transcriptional misregulation and developmental arrest in zebrafish embryos	Embryos were collected 0 hpf and incubated in 1X E3 medium 0.03% NaCl 0.005% CaCl2 0.0013% KCl 99.9557% H2O 0.008% H14MgO11S for 24 hours at 28.5°C Adult wild type AB/Tubingen Danio rerio zebrafish were bred in a 1 male:1 female ratio. 1c embryos were injected with morpholino oligonucleotides targeting foxk1 foxk2 and foxk2 1 transcripts Total RNA was purified from xxx embryos using the RNeasy Mini Kit Qiagen Valencia CA USA according to the manufacturer's instructions. mRNA Seq libraries were generated from total RNA with polyA+ selection of mRNA using the TruSeq RNA Sample Prep Kit v2 Illumina San Diego CA. Strand specific libraries were constructed using a dUTP methodology as described previously [Zhong S. et al. High Throughput Illumina Strand Specific RNA Sequencing Library Preparation. Cold Spring Harb. Protoc. 2011 940 949 2011]	Experimental Factor: compound:n1	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 1500	ERP125162	Illumina HiSeq 1500 sequencing; Depletion of Foxk transcription factors causes genome wide transcriptional misregulation and developmental arrest in zebrafish embryos	ENA FIRST PUBLIC:2020 12 01\|ENA LAST UPDATE:2020 11 17	wt_rep1.fastq.gz	fastq	5640822932.0	55849732.0	E MTAB 9777:wt rep1	0:101 1:0	A:1394470185;C:1346058952;G:1354472388;T:1538701573;N:7119834	101	0	1394470185	1346058952	1354472388	1538701573	7119834	ERX4714624	ERS5338301	ERA3145932	European Nucleotide Archive	European Nucleotide Archive	1	0.94371	0.05678	0.69664	0.47233	101	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Unknown	2020-11-17	Pharyngula	Embryo	Whole Organism	All anatomical structures
10070	10070	ERR4844841	ERX4714623	ERS5338300	ERP125162	PRJEB41393	Depletion of Foxk transcription factors causes genome wide transcriptional misregulation and developmental arrest in zebrafish embryos	E-MTAB-9777	Transcriptome Analysis	Foxk proteins are transcriptional regulators implicated in key biological processes such as glycolysis autophagy and cell cycle regulation among others. Here we employ targeted morpholino knockdown to deplete Foxk1 Fokx2 and Foxk2 1 proteins in developing zebrafish embryos. We demonstrate that the loss of Foxk transcription factors causes genome wide transcriptional misregulation characterised by upregulation of autophagy related genes and downregulation of cell cycle regulators. The phenotype is embryonic lethal with the majority of embryos not surviving past 24hpf.	ENA FIRST PUBLIC:2020 12 01\|ENA LAST UPDATE:2020 11 17	Protocols: Embryos were collected 0 hpf and incubated in 1X E3 medium 0.03% NaCl 0.005% CaCl2 0.0013% KCl 99.9557% H2O 0.008% H14MgO11S for 24 hours at 28.5°C Adult wild type AB/Tubingen Danio rerio zebrafish were bred in a 1 male:1 female ratio. 1c embryos were injected with morpholino oligonucleotides targeting foxk1 foxk2 and foxk2 1 transcripts Total RNA was purified from xxx embryos using the RNeasy Mini Kit Qiagen Valencia CA USA according to the manufacturer's instructions. mRNA Seq libraries were generated from total RNA with polyA+ selection of mRNA using the TruSeq RNA Sample Prep Kit v2 Illumina San Diego CA. Strand specific libraries were constructed using a dUTP methodology as described previously [Zhong S. et al. High Throughput Illumina Strand Specific RNA Sequencing Library Preparation. Cold Spring Harb. Protoc. 2011 940 949 2011]	foxk MO rep2	SAMEA7579964	Garvan Institute of Medical Research	ENA first public:2020 12 01\|ENA last update:2020 11 17\|External Id:SAMEA7579964\|INSDC center alias:Garvan Institute of Medical Research\|INSDC center name:Garvan Institute of Medical Research\|INSDC first public:2020 12 01T04:12:08Z\|INSDC last update:2020 11 17T14:25:39Z\|INSDC status:public\|Submitter Id:E MTAB 9777:foxk MO rep2\|age:24hpf\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|organism part:whole organism\|sample name:E MTAB 9777:foxk MO rep2\|strain:AB / Tubingen	Illumina HiSeq 1500 sequencing; Depletion of Foxk transcription factors causes genome wide transcriptional misregulation and developmental arrest in zebrafish embryos	E MTAB 9777:foxk MO rep2 s	foxk MO rep2 s	Depletion of Foxk transcription factors causes genome wide transcriptional misregulation and developmental arrest in zebrafish embryos	Embryos were collected 0 hpf and incubated in 1X E3 medium 0.03% NaCl 0.005% CaCl2 0.0013% KCl 99.9557% H2O 0.008% H14MgO11S for 24 hours at 28.5°C Adult wild type AB/Tubingen Danio rerio zebrafish were bred in a 1 male:1 female ratio. 1c embryos were injected with morpholino oligonucleotides targeting foxk1 foxk2 and foxk2 1 transcripts Total RNA was purified from xxx embryos using the RNeasy Mini Kit Qiagen Valencia CA USA according to the manufacturer's instructions. mRNA Seq libraries were generated from total RNA with polyA+ selection of mRNA using the TruSeq RNA Sample Prep Kit v2 Illumina San Diego CA. Strand specific libraries were constructed using a dUTP methodology as described previously [Zhong S. et al. High Throughput Illumina Strand Specific RNA Sequencing Library Preparation. Cold Spring Harb. Protoc. 2011 940 949 2011]	Experimental Factor: compound:morpholino against foxk1/foxk2/foxk2 1\|Experimental Factor: dose:9	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 1500	ERP125162	Illumina HiSeq 1500 sequencing; Depletion of Foxk transcription factors causes genome wide transcriptional misregulation and developmental arrest in zebrafish embryos	ENA FIRST PUBLIC:2020 12 01\|ENA LAST UPDATE:2020 11 17	foxk1-2_rep2.fastq.gz	fastq	3550070715.0	35149215.0	E MTAB 9777:foxk MO rep2	0:101 1:0	A:901160433;C:835963324;G:840839574;T:967604789;N:4502595	101	0	901160433	835963324	840839574	967604789	4502595	ERX4714623	ERS5338300	ERA3145932	European Nucleotide Archive	European Nucleotide Archive	1	0.94006	0.07603	0.69455	0.46867	101	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Unknown	2020-11-17	Pharyngula	Embryo	Whole Organism	All anatomical structures
10071	10071	ERR4844840	ERX4714622	ERS5338299	ERP125162	PRJEB41393	Depletion of Foxk transcription factors causes genome wide transcriptional misregulation and developmental arrest in zebrafish embryos	E-MTAB-9777	Transcriptome Analysis	Foxk proteins are transcriptional regulators implicated in key biological processes such as glycolysis autophagy and cell cycle regulation among others. Here we employ targeted morpholino knockdown to deplete Foxk1 Fokx2 and Foxk2 1 proteins in developing zebrafish embryos. We demonstrate that the loss of Foxk transcription factors causes genome wide transcriptional misregulation characterised by upregulation of autophagy related genes and downregulation of cell cycle regulators. The phenotype is embryonic lethal with the majority of embryos not surviving past 24hpf.	ENA FIRST PUBLIC:2020 12 01\|ENA LAST UPDATE:2020 11 17	Protocols: Embryos were collected 0 hpf and incubated in 1X E3 medium 0.03% NaCl 0.005% CaCl2 0.0013% KCl 99.9557% H2O 0.008% H14MgO11S for 24 hours at 28.5°C Adult wild type AB/Tubingen Danio rerio zebrafish were bred in a 1 male:1 female ratio. 1c embryos were injected with morpholino oligonucleotides targeting foxk1 foxk2 and foxk2 1 transcripts Total RNA was purified from xxx embryos using the RNeasy Mini Kit Qiagen Valencia CA USA according to the manufacturer's instructions. mRNA Seq libraries were generated from total RNA with polyA+ selection of mRNA using the TruSeq RNA Sample Prep Kit v2 Illumina San Diego CA. Strand specific libraries were constructed using a dUTP methodology as described previously [Zhong S. et al. High Throughput Illumina Strand Specific RNA Sequencing Library Preparation. Cold Spring Harb. Protoc. 2011 940 949 2011]	foxk MO rep1	SAMEA7579963	Garvan Institute of Medical Research	ENA first public:2020 12 01\|ENA last update:2020 11 17\|External Id:SAMEA7579963\|INSDC center alias:Garvan Institute of Medical Research\|INSDC center name:Garvan Institute of Medical Research\|INSDC first public:2020 12 01T04:12:08Z\|INSDC last update:2020 11 17T14:25:39Z\|INSDC status:public\|Submitter Id:E MTAB 9777:foxk MO rep1\|age:24hpf\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|organism part:whole organism\|sample name:E MTAB 9777:foxk MO rep1\|strain:AB / Tubingen	Illumina HiSeq 1500 sequencing; Depletion of Foxk transcription factors causes genome wide transcriptional misregulation and developmental arrest in zebrafish embryos	E MTAB 9777:foxk MO rep1 s	foxk MO rep1 s	Depletion of Foxk transcription factors causes genome wide transcriptional misregulation and developmental arrest in zebrafish embryos	Embryos were collected 0 hpf and incubated in 1X E3 medium 0.03% NaCl 0.005% CaCl2 0.0013% KCl 99.9557% H2O 0.008% H14MgO11S for 24 hours at 28.5°C Adult wild type AB/Tubingen Danio rerio zebrafish were bred in a 1 male:1 female ratio. 1c embryos were injected with morpholino oligonucleotides targeting foxk1 foxk2 and foxk2 1 transcripts Total RNA was purified from xxx embryos using the RNeasy Mini Kit Qiagen Valencia CA USA according to the manufacturer's instructions. mRNA Seq libraries were generated from total RNA with polyA+ selection of mRNA using the TruSeq RNA Sample Prep Kit v2 Illumina San Diego CA. Strand specific libraries were constructed using a dUTP methodology as described previously [Zhong S. et al. High Throughput Illumina Strand Specific RNA Sequencing Library Preparation. Cold Spring Harb. Protoc. 2011 940 949 2011]	Experimental Factor: compound:morpholino against foxk1/foxk2/foxk2 1\|Experimental Factor: dose:9	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 1500	ERP125162	Illumina HiSeq 1500 sequencing; Depletion of Foxk transcription factors causes genome wide transcriptional misregulation and developmental arrest in zebrafish embryos	ENA FIRST PUBLIC:2020 12 01\|ENA LAST UPDATE:2020 11 17	foxk1-2_rep1.fastq.gz	fastq	3601987139.0	35663239.0	E MTAB 9777:foxk MO rep1	0:101 1:0	A:910641017;C:846039018;G:853351642;T:987409698;N:4545764	101	0	910641017	846039018	853351642	987409698	4545764	ERX4714622	ERS5338299	ERA3145932	European Nucleotide Archive	European Nucleotide Archive	1	0.93784	0.08061	0.69292	0.47364	101	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Unknown	2020-11-17	Pharyngula	Embryo	Whole Organism	All anatomical structures
10072	10072	ERR4910331	ERX4777154	ERS5435101	ERP125509	PRJEB41694	mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	E-MTAB-9853	Transcriptome Analysis	The aim of this mRNA expression profiling experiment was to screen for ecotoxicogenomic fingerprints in zebrafish Danio rerio embryos as aquatic vertebrate non target model exposed to sub lethal concentrations of the heavily used organophosphate insecticide Chlorpyrifos CAS 2921 88 2. The Insecticide Resistance Action Committee IRAC classified Chlorpyrifos post its mode of action MoA in the target organism as an acetylcholinesterase AChE inhibitor Group 1B. The goal is to identify toxicogenomic profiles with predictive character and potential molecular key events KE explaining upstream adverse effects in aquatic non target organisms. This will provide useful information to refine and improve existing adverse outcome pathways AOP. Furthermore integrating the obtained profiles for this and other tested chemicals in a collective database will enable us in the future to derive predictions about the ecotoxicological hazard for chemcials with unknown apical effects based on similarly altered transcriptomic and proteomic profiles. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE 0.75 mg/L high exposure HE 3 mg/L and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked for each sample and pooled for RNA and protein extraction with NucleoSpin RNA/Protein kit Macherey Nagel. RNA quality was assessed with a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing roughly 30 million reads per sample. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library gene count tables were then merged to…	ENA FIRST PUBLIC:2021 10 15\|ENA LAST UPDATE:2021 10 15	Protocols: Catalogue no. 2921 88 2. For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were collected for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was then carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall …	R842	SAMEA7678119	Fraunhofer Attract Eco'n'OMICs, Fraunhofer Institute for Molecular Biology and Applied Ecology, Schmallenberg, Germany Evolutionary Ecology and Environmental Toxicology, Faculty Biological Sciences, Goethe University Frankfurt, Frankfurt, Germany	ENA first public:2021 10 15\|ENA last update:2021 10 15\|External Id:SAMEA7678119\|INSDC center alias:Fraunhofer Attract Eco'n'OMICs Fraunhofer Institute for Molecular Biology and Applied Ecology Schmallenberg Germany Evolutionary Ecology and Environmental Toxicology Faculty Biological Sciences Goethe University Frankfurt Frankfurt Germany\|INSDC center name:Fraunhofer Attract Eco'n'OMICs Fraunhofer Institute for Molecular Biology and Applied Ecology Schmallenberg Germany Evolutionary Ecology and Environmental Toxicology Faculty Biological Sciences Goethe University Frankfurt Frankfurt Germany\|INSDC first public:2021 10 15T00:15:29Z\|INSDC last update:2021 10 15T00:15:29Z\|INSDC status:public\|Submitter Id:E MTAB 9853:R842\|age:96\|batch:T10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|extraction date:09.12.2019\|genotype:wild type genotype\|organism part:whole organism\|rin:10\|sample name:E MTAB 9853:R842\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	E MTAB 9853:R842 s	R842 s	mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	Catalogue no. 2921 88 2. For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were collected for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was then carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival …	Experimental Factor: compound:chlorpyrifos\|Experimental Factor: dose:3\|Experimental Factor: growth condition:high exposure	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP125509	Illumina HiSeq 4000 sequencing; mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2021 10 15\|ENA LAST UPDATE:2021 10 15	R842.fastq.gz	fastq	2078761529.0	41168286.0	E MTAB 9853:R842	0:50.49 1:0	A:525043812;C:513138389;G:493165128;T:542354255;N:5059945	50	0	525043812	513138389	493165128	542354255	5059945	ERX4777154	ERS5435101	ERA3184347	Fraunhofer Attract Eco	Fraunhofer Attract Eco	1	0.93137	0.09995	0.66634	0.48015	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2021-10-15	Larval	Larval	Whole Organism	All anatomical structures
10073	10073	ERR4910330	ERX4777153	ERS5435100	ERP125509	PRJEB41694	mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	E-MTAB-9853	Transcriptome Analysis	The aim of this mRNA expression profiling experiment was to screen for ecotoxicogenomic fingerprints in zebrafish Danio rerio embryos as aquatic vertebrate non target model exposed to sub lethal concentrations of the heavily used organophosphate insecticide Chlorpyrifos CAS 2921 88 2. The Insecticide Resistance Action Committee IRAC classified Chlorpyrifos post its mode of action MoA in the target organism as an acetylcholinesterase AChE inhibitor Group 1B. The goal is to identify toxicogenomic profiles with predictive character and potential molecular key events KE explaining upstream adverse effects in aquatic non target organisms. This will provide useful information to refine and improve existing adverse outcome pathways AOP. Furthermore integrating the obtained profiles for this and other tested chemicals in a collective database will enable us in the future to derive predictions about the ecotoxicological hazard for chemcials with unknown apical effects based on similarly altered transcriptomic and proteomic profiles. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE 0.75 mg/L high exposure HE 3 mg/L and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked for each sample and pooled for RNA and protein extraction with NucleoSpin RNA/Protein kit Macherey Nagel. RNA quality was assessed with a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing roughly 30 million reads per sample. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library gene count tables were then merged to…	ENA FIRST PUBLIC:2021 10 15\|ENA LAST UPDATE:2021 10 15	Protocols: Catalogue no. 2921 88 2. For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were collected for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was then carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall …	R840	SAMEA7678118	Fraunhofer Attract Eco'n'OMICs, Fraunhofer Institute for Molecular Biology and Applied Ecology, Schmallenberg, Germany Evolutionary Ecology and Environmental Toxicology, Faculty Biological Sciences, Goethe University Frankfurt, Frankfurt, Germany	ENA first public:2021 10 15\|ENA last update:2021 10 15\|External Id:SAMEA7678118\|INSDC center alias:Fraunhofer Attract Eco'n'OMICs Fraunhofer Institute for Molecular Biology and Applied Ecology Schmallenberg Germany Evolutionary Ecology and Environmental Toxicology Faculty Biological Sciences Goethe University Frankfurt Frankfurt Germany\|INSDC center name:Fraunhofer Attract Eco'n'OMICs Fraunhofer Institute for Molecular Biology and Applied Ecology Schmallenberg Germany Evolutionary Ecology and Environmental Toxicology Faculty Biological Sciences Goethe University Frankfurt Frankfurt Germany\|INSDC first public:2021 10 15T00:15:29Z\|INSDC last update:2021 10 15T00:15:29Z\|INSDC status:public\|Submitter Id:E MTAB 9853:R840\|age:96\|batch:T10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|extraction date:09.12.2019\|genotype:wild type genotype\|organism part:whole organism\|rin:10\|sample name:E MTAB 9853:R840\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	E MTAB 9853:R840 s	R840 s	mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	Catalogue no. 2921 88 2. For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were collected for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was then carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival …	Experimental Factor: compound:chlorpyrifos\|Experimental Factor: dose:0.00075\|Experimental Factor: growth condition:low exposure	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP125509	Illumina HiSeq 4000 sequencing; mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2021 10 15\|ENA LAST UPDATE:2021 10 15	R840.fastq.gz	fastq	2344231087.0	46394848.0	E MTAB 9853:R840	0:50.53 1:0	A:603829684;C:570903008;G:545594153;T:621405057;N:2499185	50	0	603829684	570903008	545594153	621405057	2499185	ERX4777153	ERS5435100	ERA3184347	Fraunhofer Attract Eco	Fraunhofer Attract Eco	1	0.92792	0.10519	0.6646	0.48351	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2021-10-15	Larval	Larval	Whole Organism	All anatomical structures
10074	10074	ERR4910329	ERX4777152	ERS5435099	ERP125509	PRJEB41694	mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	E-MTAB-9853	Transcriptome Analysis	The aim of this mRNA expression profiling experiment was to screen for ecotoxicogenomic fingerprints in zebrafish Danio rerio embryos as aquatic vertebrate non target model exposed to sub lethal concentrations of the heavily used organophosphate insecticide Chlorpyrifos CAS 2921 88 2. The Insecticide Resistance Action Committee IRAC classified Chlorpyrifos post its mode of action MoA in the target organism as an acetylcholinesterase AChE inhibitor Group 1B. The goal is to identify toxicogenomic profiles with predictive character and potential molecular key events KE explaining upstream adverse effects in aquatic non target organisms. This will provide useful information to refine and improve existing adverse outcome pathways AOP. Furthermore integrating the obtained profiles for this and other tested chemicals in a collective database will enable us in the future to derive predictions about the ecotoxicological hazard for chemcials with unknown apical effects based on similarly altered transcriptomic and proteomic profiles. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE 0.75 mg/L high exposure HE 3 mg/L and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked for each sample and pooled for RNA and protein extraction with NucleoSpin RNA/Protein kit Macherey Nagel. RNA quality was assessed with a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing roughly 30 million reads per sample. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library gene count tables were then merged to…	ENA FIRST PUBLIC:2021 10 15\|ENA LAST UPDATE:2021 10 15	Protocols: Catalogue no. 2921 88 2. For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were collected for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was then carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall …	R839	SAMEA7678117	Fraunhofer Attract Eco'n'OMICs, Fraunhofer Institute for Molecular Biology and Applied Ecology, Schmallenberg, Germany Evolutionary Ecology and Environmental Toxicology, Faculty Biological Sciences, Goethe University Frankfurt, Frankfurt, Germany	ENA first public:2021 10 15\|ENA last update:2021 10 15\|External Id:SAMEA7678117\|INSDC center alias:Fraunhofer Attract Eco'n'OMICs Fraunhofer Institute for Molecular Biology and Applied Ecology Schmallenberg Germany Evolutionary Ecology and Environmental Toxicology Faculty Biological Sciences Goethe University Frankfurt Frankfurt Germany\|INSDC center name:Fraunhofer Attract Eco'n'OMICs Fraunhofer Institute for Molecular Biology and Applied Ecology Schmallenberg Germany Evolutionary Ecology and Environmental Toxicology Faculty Biological Sciences Goethe University Frankfurt Frankfurt Germany\|INSDC first public:2021 10 15T00:15:29Z\|INSDC last update:2021 10 15T00:15:29Z\|INSDC status:public\|Submitter Id:E MTAB 9853:R839\|age:96\|batch:T10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|extraction date:09.12.2019\|genotype:wild type genotype\|organism part:whole organism\|rin:10\|sample name:E MTAB 9853:R839\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	E MTAB 9853:R839 s	R839 s	mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	Catalogue no. 2921 88 2. For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were collected for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was then carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival …	Experimental Factor: compound:n1\|Experimental Factor: growth condition:normal	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP125509	Illumina HiSeq 4000 sequencing; mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2021 10 15\|ENA LAST UPDATE:2021 10 15	R839.fastq.gz	fastq	1996290916.0	39508020.0	E MTAB 9853:R839	0:50.53 1:0	A:509362981;C:490497777;G:469414712;T:524505312;N:2510134	50	0	509362981	490497777	469414712	524505312	2510134	ERX4777152	ERS5435099	ERA3184347	Fraunhofer Attract Eco	Fraunhofer Attract Eco	1	0.93138	0.10299	0.66468	0.48637	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2021-10-15	Larval	Larval	Whole Organism	All anatomical structures
10075	10075	ERR4910328	ERX4777151	ERS5435098	ERP125509	PRJEB41694	mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	E-MTAB-9853	Transcriptome Analysis	The aim of this mRNA expression profiling experiment was to screen for ecotoxicogenomic fingerprints in zebrafish Danio rerio embryos as aquatic vertebrate non target model exposed to sub lethal concentrations of the heavily used organophosphate insecticide Chlorpyrifos CAS 2921 88 2. The Insecticide Resistance Action Committee IRAC classified Chlorpyrifos post its mode of action MoA in the target organism as an acetylcholinesterase AChE inhibitor Group 1B. The goal is to identify toxicogenomic profiles with predictive character and potential molecular key events KE explaining upstream adverse effects in aquatic non target organisms. This will provide useful information to refine and improve existing adverse outcome pathways AOP. Furthermore integrating the obtained profiles for this and other tested chemicals in a collective database will enable us in the future to derive predictions about the ecotoxicological hazard for chemcials with unknown apical effects based on similarly altered transcriptomic and proteomic profiles. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE 0.75 mg/L high exposure HE 3 mg/L and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked for each sample and pooled for RNA and protein extraction with NucleoSpin RNA/Protein kit Macherey Nagel. RNA quality was assessed with a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing roughly 30 million reads per sample. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library gene count tables were then merged to…	ENA FIRST PUBLIC:2021 10 15\|ENA LAST UPDATE:2021 10 15	Protocols: Catalogue no. 2921 88 2. For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were collected for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was then carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall …	R838	SAMEA7678116	Fraunhofer Attract Eco'n'OMICs, Fraunhofer Institute for Molecular Biology and Applied Ecology, Schmallenberg, Germany Evolutionary Ecology and Environmental Toxicology, Faculty Biological Sciences, Goethe University Frankfurt, Frankfurt, Germany	ENA first public:2021 10 15\|ENA last update:2021 10 15\|External Id:SAMEA7678116\|INSDC center alias:Fraunhofer Attract Eco'n'OMICs Fraunhofer Institute for Molecular Biology and Applied Ecology Schmallenberg Germany Evolutionary Ecology and Environmental Toxicology Faculty Biological Sciences Goethe University Frankfurt Frankfurt Germany\|INSDC center name:Fraunhofer Attract Eco'n'OMICs Fraunhofer Institute for Molecular Biology and Applied Ecology Schmallenberg Germany Evolutionary Ecology and Environmental Toxicology Faculty Biological Sciences Goethe University Frankfurt Frankfurt Germany\|INSDC first public:2021 10 15T00:15:29Z\|INSDC last update:2021 10 15T00:15:29Z\|INSDC status:public\|Submitter Id:E MTAB 9853:R838\|age:96\|batch:T2\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|extraction date:09.12.2019\|genotype:wild type genotype\|organism part:whole organism\|rin:9 9\|sample name:E MTAB 9853:R838\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	E MTAB 9853:R838 s	R838 s	mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	Catalogue no. 2921 88 2. For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were collected for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was then carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival …	Experimental Factor: compound:chlorpyrifos\|Experimental Factor: dose:3\|Experimental Factor: growth condition:high exposure	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP125509	Illumina HiSeq 4000 sequencing; mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2021 10 15\|ENA LAST UPDATE:2021 10 15	R838.fastq.gz	fastq	1801740137.0	35669320.0	E MTAB 9853:R838	0:50.51 1:0	A:466977493;C:436158087;G:416333880;T:479487201;N:2783476	50	0	466977493	436158087	416333880	479487201	2783476	ERX4777151	ERS5435098	ERA3184347	Fraunhofer Attract Eco	Fraunhofer Attract Eco	1	0.92647	0.11533	0.666	0.48331	49	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2021-10-15	Larval	Larval	Whole Organism	All anatomical structures
10076	10076	ERR4910327	ERX4777150	ERS5435097	ERP125509	PRJEB41694	mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	E-MTAB-9853	Transcriptome Analysis	The aim of this mRNA expression profiling experiment was to screen for ecotoxicogenomic fingerprints in zebrafish Danio rerio embryos as aquatic vertebrate non target model exposed to sub lethal concentrations of the heavily used organophosphate insecticide Chlorpyrifos CAS 2921 88 2. The Insecticide Resistance Action Committee IRAC classified Chlorpyrifos post its mode of action MoA in the target organism as an acetylcholinesterase AChE inhibitor Group 1B. The goal is to identify toxicogenomic profiles with predictive character and potential molecular key events KE explaining upstream adverse effects in aquatic non target organisms. This will provide useful information to refine and improve existing adverse outcome pathways AOP. Furthermore integrating the obtained profiles for this and other tested chemicals in a collective database will enable us in the future to derive predictions about the ecotoxicological hazard for chemcials with unknown apical effects based on similarly altered transcriptomic and proteomic profiles. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE 0.75 mg/L high exposure HE 3 mg/L and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked for each sample and pooled for RNA and protein extraction with NucleoSpin RNA/Protein kit Macherey Nagel. RNA quality was assessed with a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing roughly 30 million reads per sample. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library gene count tables were then merged to…	ENA FIRST PUBLIC:2021 10 15\|ENA LAST UPDATE:2021 10 15	Protocols: Catalogue no. 2921 88 2. For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were collected for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was then carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall …	R836	SAMEA7678115	Fraunhofer Attract Eco'n'OMICs, Fraunhofer Institute for Molecular Biology and Applied Ecology, Schmallenberg, Germany Evolutionary Ecology and Environmental Toxicology, Faculty Biological Sciences, Goethe University Frankfurt, Frankfurt, Germany	ENA first public:2021 10 15\|ENA last update:2021 10 15\|External Id:SAMEA7678115\|INSDC center alias:Fraunhofer Attract Eco'n'OMICs Fraunhofer Institute for Molecular Biology and Applied Ecology Schmallenberg Germany Evolutionary Ecology and Environmental Toxicology Faculty Biological Sciences Goethe University Frankfurt Frankfurt Germany\|INSDC center name:Fraunhofer Attract Eco'n'OMICs Fraunhofer Institute for Molecular Biology and Applied Ecology Schmallenberg Germany Evolutionary Ecology and Environmental Toxicology Faculty Biological Sciences Goethe University Frankfurt Frankfurt Germany\|INSDC first public:2021 10 15T00:15:29Z\|INSDC last update:2021 10 15T00:15:29Z\|INSDC status:public\|Submitter Id:E MTAB 9853:R836\|age:96\|batch:T2\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|extraction date:09.12.2019\|genotype:wild type genotype\|organism part:whole organism\|rin:9 8\|sample name:E MTAB 9853:R836\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	E MTAB 9853:R836 s	R836 s	mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	Catalogue no. 2921 88 2. For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were collected for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was then carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival …	Experimental Factor: compound:chlorpyrifos\|Experimental Factor: dose:0.00075\|Experimental Factor: growth condition:low exposure	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP125509	Illumina HiSeq 4000 sequencing; mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2021 10 15\|ENA LAST UPDATE:2021 10 15	R836.fastq.gz	fastq	1816994468.0	35959155.0	E MTAB 9853:R836	0:50.53 1:0	A:465931946;C:444466278;G:425419784;T:479276121;N:1900339	50	0	465931946	444466278	425419784	479276121	1900339	ERX4777150	ERS5435097	ERA3184347	Fraunhofer Attract Eco	Fraunhofer Attract Eco	1	0.92973	0.10412	0.66425	0.4798	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2021-10-15	Larval	Larval	Whole Organism	All anatomical structures
10077	10077	ERR4910326	ERX4777149	ERS5435096	ERP125509	PRJEB41694	mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	E-MTAB-9853	Transcriptome Analysis	The aim of this mRNA expression profiling experiment was to screen for ecotoxicogenomic fingerprints in zebrafish Danio rerio embryos as aquatic vertebrate non target model exposed to sub lethal concentrations of the heavily used organophosphate insecticide Chlorpyrifos CAS 2921 88 2. The Insecticide Resistance Action Committee IRAC classified Chlorpyrifos post its mode of action MoA in the target organism as an acetylcholinesterase AChE inhibitor Group 1B. The goal is to identify toxicogenomic profiles with predictive character and potential molecular key events KE explaining upstream adverse effects in aquatic non target organisms. This will provide useful information to refine and improve existing adverse outcome pathways AOP. Furthermore integrating the obtained profiles for this and other tested chemicals in a collective database will enable us in the future to derive predictions about the ecotoxicological hazard for chemcials with unknown apical effects based on similarly altered transcriptomic and proteomic profiles. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE 0.75 mg/L high exposure HE 3 mg/L and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked for each sample and pooled for RNA and protein extraction with NucleoSpin RNA/Protein kit Macherey Nagel. RNA quality was assessed with a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing roughly 30 million reads per sample. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library gene count tables were then merged to…	ENA FIRST PUBLIC:2021 10 15\|ENA LAST UPDATE:2021 10 15	Protocols: Catalogue no. 2921 88 2. For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were collected for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was then carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall …	R835	SAMEA7678114	Fraunhofer Attract Eco'n'OMICs, Fraunhofer Institute for Molecular Biology and Applied Ecology, Schmallenberg, Germany Evolutionary Ecology and Environmental Toxicology, Faculty Biological Sciences, Goethe University Frankfurt, Frankfurt, Germany	ENA first public:2021 10 15\|ENA last update:2021 10 15\|External Id:SAMEA7678114\|INSDC center alias:Fraunhofer Attract Eco'n'OMICs Fraunhofer Institute for Molecular Biology and Applied Ecology Schmallenberg Germany Evolutionary Ecology and Environmental Toxicology Faculty Biological Sciences Goethe University Frankfurt Frankfurt Germany\|INSDC center name:Fraunhofer Attract Eco'n'OMICs Fraunhofer Institute for Molecular Biology and Applied Ecology Schmallenberg Germany Evolutionary Ecology and Environmental Toxicology Faculty Biological Sciences Goethe University Frankfurt Frankfurt Germany\|INSDC first public:2021 10 15T00:15:29Z\|INSDC last update:2021 10 15T00:15:29Z\|INSDC status:public\|Submitter Id:E MTAB 9853:R835\|age:96\|batch:T2\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|extraction date:09.12.2019\|genotype:wild type genotype\|organism part:whole organism\|rin:9 9\|sample name:E MTAB 9853:R835\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	E MTAB 9853:R835 s	R835 s	mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	Catalogue no. 2921 88 2. For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were collected for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was then carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival …	Experimental Factor: compound:n1\|Experimental Factor: growth condition:normal	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP125509	Illumina HiSeq 4000 sequencing; mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2021 10 15\|ENA LAST UPDATE:2021 10 15	R835.fastq.gz	fastq	2309123342.0	45698247.0	E MTAB 9853:R835	0:50.53 1:0	A:590448588;C:564838103;G:542833223;T:608521072;N:2482356	50	0	590448588	564838103	542833223	608521072	2482356	ERX4777149	ERS5435096	ERA3184347	Fraunhofer Attract Eco	Fraunhofer Attract Eco	1	0.92963	0.10535	0.66156	0.48118	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2021-10-15	Larval	Larval	Whole Organism	All anatomical structures
10078	10078	ERR4910325	ERX4777148	ERS5435095	ERP125509	PRJEB41694	mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	E-MTAB-9853	Transcriptome Analysis	The aim of this mRNA expression profiling experiment was to screen for ecotoxicogenomic fingerprints in zebrafish Danio rerio embryos as aquatic vertebrate non target model exposed to sub lethal concentrations of the heavily used organophosphate insecticide Chlorpyrifos CAS 2921 88 2. The Insecticide Resistance Action Committee IRAC classified Chlorpyrifos post its mode of action MoA in the target organism as an acetylcholinesterase AChE inhibitor Group 1B. The goal is to identify toxicogenomic profiles with predictive character and potential molecular key events KE explaining upstream adverse effects in aquatic non target organisms. This will provide useful information to refine and improve existing adverse outcome pathways AOP. Furthermore integrating the obtained profiles for this and other tested chemicals in a collective database will enable us in the future to derive predictions about the ecotoxicological hazard for chemcials with unknown apical effects based on similarly altered transcriptomic and proteomic profiles. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE 0.75 mg/L high exposure HE 3 mg/L and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked for each sample and pooled for RNA and protein extraction with NucleoSpin RNA/Protein kit Macherey Nagel. RNA quality was assessed with a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing roughly 30 million reads per sample. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library gene count tables were then merged to…	ENA FIRST PUBLIC:2021 10 15\|ENA LAST UPDATE:2021 10 15	Protocols: Catalogue no. 2921 88 2. For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were collected for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was then carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall …	R834	SAMEA7678113	Fraunhofer Attract Eco'n'OMICs, Fraunhofer Institute for Molecular Biology and Applied Ecology, Schmallenberg, Germany Evolutionary Ecology and Environmental Toxicology, Faculty Biological Sciences, Goethe University Frankfurt, Frankfurt, Germany	ENA first public:2021 10 15\|ENA last update:2021 10 15\|External Id:SAMEA7678113\|INSDC center alias:Fraunhofer Attract Eco'n'OMICs Fraunhofer Institute for Molecular Biology and Applied Ecology Schmallenberg Germany Evolutionary Ecology and Environmental Toxicology Faculty Biological Sciences Goethe University Frankfurt Frankfurt Germany\|INSDC center name:Fraunhofer Attract Eco'n'OMICs Fraunhofer Institute for Molecular Biology and Applied Ecology Schmallenberg Germany Evolutionary Ecology and Environmental Toxicology Faculty Biological Sciences Goethe University Frankfurt Frankfurt Germany\|INSDC first public:2021 10 15T00:15:29Z\|INSDC last update:2021 10 15T00:15:29Z\|INSDC status:public\|Submitter Id:E MTAB 9853:R834\|age:96\|batch:T11\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|extraction date:09.12.2019\|genotype:wild type genotype\|organism part:whole organism\|rin:9 8\|sample name:E MTAB 9853:R834\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	E MTAB 9853:R834 s	R834 s	mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	Catalogue no. 2921 88 2. For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were collected for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was then carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival …	Experimental Factor: compound:chlorpyrifos\|Experimental Factor: dose:3\|Experimental Factor: growth condition:high exposure	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP125509	Illumina HiSeq 4000 sequencing; mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2021 10 15\|ENA LAST UPDATE:2021 10 15	R834.fastq.gz	fastq	2122701060.0	42013381.0	E MTAB 9853:R834	0:50.52 1:0	A:547558397;C:515792741;G:494125094;T:562812656;N:2412172	50	0	547558397	515792741	494125094	562812656	2412172	ERX4777148	ERS5435095	ERA3184347	Fraunhofer Attract Eco	Fraunhofer Attract Eco	1	0.92823	0.11135	0.66492	0.48309	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2021-10-15	Larval	Larval	Whole Organism	All anatomical structures
10079	10079	ERR4910324	ERX4777147	ERS5435094	ERP125509	PRJEB41694	mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	E-MTAB-9853	Transcriptome Analysis	The aim of this mRNA expression profiling experiment was to screen for ecotoxicogenomic fingerprints in zebrafish Danio rerio embryos as aquatic vertebrate non target model exposed to sub lethal concentrations of the heavily used organophosphate insecticide Chlorpyrifos CAS 2921 88 2. The Insecticide Resistance Action Committee IRAC classified Chlorpyrifos post its mode of action MoA in the target organism as an acetylcholinesterase AChE inhibitor Group 1B. The goal is to identify toxicogenomic profiles with predictive character and potential molecular key events KE explaining upstream adverse effects in aquatic non target organisms. This will provide useful information to refine and improve existing adverse outcome pathways AOP. Furthermore integrating the obtained profiles for this and other tested chemicals in a collective database will enable us in the future to derive predictions about the ecotoxicological hazard for chemcials with unknown apical effects based on similarly altered transcriptomic and proteomic profiles. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE 0.75 mg/L high exposure HE 3 mg/L and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked for each sample and pooled for RNA and protein extraction with NucleoSpin RNA/Protein kit Macherey Nagel. RNA quality was assessed with a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing roughly 30 million reads per sample. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library gene count tables were then merged to…	ENA FIRST PUBLIC:2021 10 15\|ENA LAST UPDATE:2021 10 15	Protocols: Catalogue no. 2921 88 2. For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were collected for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was then carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall …	R832	SAMEA7678112	Fraunhofer Attract Eco'n'OMICs, Fraunhofer Institute for Molecular Biology and Applied Ecology, Schmallenberg, Germany Evolutionary Ecology and Environmental Toxicology, Faculty Biological Sciences, Goethe University Frankfurt, Frankfurt, Germany	ENA first public:2021 10 15\|ENA last update:2021 10 15\|External Id:SAMEA7678112\|INSDC center alias:Fraunhofer Attract Eco'n'OMICs Fraunhofer Institute for Molecular Biology and Applied Ecology Schmallenberg Germany Evolutionary Ecology and Environmental Toxicology Faculty Biological Sciences Goethe University Frankfurt Frankfurt Germany\|INSDC center name:Fraunhofer Attract Eco'n'OMICs Fraunhofer Institute for Molecular Biology and Applied Ecology Schmallenberg Germany Evolutionary Ecology and Environmental Toxicology Faculty Biological Sciences Goethe University Frankfurt Frankfurt Germany\|INSDC first public:2021 10 15T00:15:29Z\|INSDC last update:2021 10 15T00:15:29Z\|INSDC status:public\|Submitter Id:E MTAB 9853:R832\|age:96\|batch:T11\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|extraction date:09.12.2019\|genotype:wild type genotype\|organism part:whole organism\|rin:9 7\|sample name:E MTAB 9853:R832\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	E MTAB 9853:R832 s	R832 s	mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	Catalogue no. 2921 88 2. For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were collected for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was then carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival …	Experimental Factor: compound:chlorpyrifos\|Experimental Factor: dose:0.00075\|Experimental Factor: growth condition:low exposure	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP125509	Illumina HiSeq 4000 sequencing; mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2021 10 15\|ENA LAST UPDATE:2021 10 15	R832.fastq.gz	fastq	2407016662.0	47713826.0	E MTAB 9853:R832	0:50.45 1:0	A:637497754;C:575428535;G:531202727;T:659395837;N:3491809	50	0	637497754	575428535	531202727	659395837	3491809	ERX4777147	ERS5435094	ERA3184347	Fraunhofer Attract Eco	Fraunhofer Attract Eco	1	0.91708	0.12568	0.65494	0.48103	50	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2021-10-15	Larval	Larval	Whole Organism	All anatomical structures
10080	10080	ERR4910323	ERX4777146	ERS5435093	ERP125509	PRJEB41694	mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	E-MTAB-9853	Transcriptome Analysis	The aim of this mRNA expression profiling experiment was to screen for ecotoxicogenomic fingerprints in zebrafish Danio rerio embryos as aquatic vertebrate non target model exposed to sub lethal concentrations of the heavily used organophosphate insecticide Chlorpyrifos CAS 2921 88 2. The Insecticide Resistance Action Committee IRAC classified Chlorpyrifos post its mode of action MoA in the target organism as an acetylcholinesterase AChE inhibitor Group 1B. The goal is to identify toxicogenomic profiles with predictive character and potential molecular key events KE explaining upstream adverse effects in aquatic non target organisms. This will provide useful information to refine and improve existing adverse outcome pathways AOP. Furthermore integrating the obtained profiles for this and other tested chemicals in a collective database will enable us in the future to derive predictions about the ecotoxicological hazard for chemcials with unknown apical effects based on similarly altered transcriptomic and proteomic profiles. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE 0.75 mg/L high exposure HE 3 mg/L and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked for each sample and pooled for RNA and protein extraction with NucleoSpin RNA/Protein kit Macherey Nagel. RNA quality was assessed with a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing roughly 30 million reads per sample. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library gene count tables were then merged to…	ENA FIRST PUBLIC:2021 10 15\|ENA LAST UPDATE:2021 10 15	Protocols: Catalogue no. 2921 88 2. For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were collected for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was then carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall …	R831	SAMEA7678111	Fraunhofer Attract Eco'n'OMICs, Fraunhofer Institute for Molecular Biology and Applied Ecology, Schmallenberg, Germany Evolutionary Ecology and Environmental Toxicology, Faculty Biological Sciences, Goethe University Frankfurt, Frankfurt, Germany	ENA first public:2021 10 15\|ENA last update:2021 10 15\|External Id:SAMEA7678111\|INSDC center alias:Fraunhofer Attract Eco'n'OMICs Fraunhofer Institute for Molecular Biology and Applied Ecology Schmallenberg Germany Evolutionary Ecology and Environmental Toxicology Faculty Biological Sciences Goethe University Frankfurt Frankfurt Germany\|INSDC center name:Fraunhofer Attract Eco'n'OMICs Fraunhofer Institute for Molecular Biology and Applied Ecology Schmallenberg Germany Evolutionary Ecology and Environmental Toxicology Faculty Biological Sciences Goethe University Frankfurt Frankfurt Germany\|INSDC first public:2021 10 15T00:15:29Z\|INSDC last update:2021 10 15T00:15:29Z\|INSDC status:public\|Submitter Id:E MTAB 9853:R831\|age:96\|batch:T11\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|extraction date:09.12.2019\|genotype:wild type genotype\|organism part:whole organism\|rin:9 9\|sample name:E MTAB 9853:R831\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	E MTAB 9853:R831 s	R831 s	mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	Catalogue no. 2921 88 2. For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were collected for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was then carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival …	Experimental Factor: compound:n1\|Experimental Factor: growth condition:normal	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP125509	Illumina HiSeq 4000 sequencing; mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Chlorpyrifos below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2021 10 15\|ENA LAST UPDATE:2021 10 15	R831.fastq.gz	fastq	2084924019.0	41265710.0	E MTAB 9853:R831	0:50.52 1:0	A:529532094;C:513298404;G:493028485;T:546325575;N:2739461	50	0	529532094	513298404	493028485	546325575	2739461	ERX4777146	ERS5435093	ERA3184347	Fraunhofer Attract Eco	Fraunhofer Attract Eco	1	0.93121	0.10702	0.66064	0.47779	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2021-10-15	Larval	Larval	Whole Organism	All anatomical structures
10081	10081	ERR4910712	ERX4777535	ERS5435303	ERP125510	PRJEB41695	mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Abamectin below acute toxicity levels against untreated control groups	E-MTAB-9852	Transcriptome Analysis	The aim of this mRNA expression profiling experiment was to screen for ecotoxicogenomic fingerprints in zebrafish Danio rerio embryos as aquatic vertebrate non target model exposed to sub lethal concentrations of Abamectin CAS 71751 41 2. Abamectin is a heavily used insecticide applied for crop protection against sucking insects i.e. Acari. The Insecticide Resistance Action Committee IRAC classified Abamectin post its mode of action MoA in the target organism as a Glutamate gated chloride channel GluCl allosteric modulator Group 6. In vertebrates GluCl do not exist but they are closely related to vertebrate glycine receptors Wolstenholme 2012. The goal is to identify toxicogenomic profiles with predictive character and potential molecular key events KE explaining upstream adverse effects in aquatic non target organisms. This will provide useful information to refine and improve existing adverse outcome pathways AOP. Furthermore integrating the obtained profiles for this and other tested chemicals in a collective database will enable us in the future to derive predictions about the ecotoxicological hazard for chemcials with unknown apical effects based on similarly altered transcriptomic and proteomic profiles. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of Abamectin for xxx hours under semi static conditions. Each test comprised of a low exposure LE 0.11 mg/L mid exposure ME 0.22 mg/L high exposure HE 0.44 mg/L and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked for each sample and pooled for RNA and protein extraction with NucleoSpin RNA/Protein kit Macherey Nagel. RNA quality was assessed with a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing roughly 30 million reads per sample. Adapter sequ…	ENA FIRST PUBLIC:2021 10 15\|ENA LAST UPDATE:2021 10 15	Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were collected for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was then carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. CASRN: 71751 41 2 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall surviva…	R249	SAMEA7678322	Fraunhofer Attract Eco'n'OMICs, Fraunhofer Institute for Molecular Biology and Applied Ecology, Schmallenberg, Germany Evolutionary Ecology and Environmental Toxicology, Faculty Biological Sciences, Goethe University Frankfurt, Frankfurt, Germany	ENA first public:2021 10 15\|ENA last update:2021 10 15\|External Id:SAMEA7678322\|INSDC center alias:Fraunhofer Attract Eco'n'OMICs Fraunhofer Institute for Molecular Biology and Applied Ecology Schmallenberg Germany Evolutionary Ecology and Environmental Toxicology Faculty Biological Sciences Goethe University Frankfurt Frankfurt Germany\|INSDC center name:Fraunhofer Attract Eco'n'OMICs Fraunhofer Institute for Molecular Biology and Applied Ecology Schmallenberg Germany Evolutionary Ecology and Environmental Toxicology Faculty Biological Sciences Goethe University Frankfurt Frankfurt Germany\|INSDC first public:2021 10 15T00:15:29Z\|INSDC last update:2021 10 15T00:15:29Z\|INSDC status:public\|Submitter Id:E MTAB 9852:R249\|age:96\|batch:T14 3\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 4\|extraction date:18.02.2019\|genotype:wild type genotype\|individual:mixed pool of 10 larvae\|organism part:whole organism\|rin:9 7\|sample name:E MTAB 9852:R249\|sex:mixed\|strain:AB	Illumina HiSeq 4000 sequencing; mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Abamectin below acute toxicity levels against untreated control groups	E MTAB 9852:R249 s	R249 s	mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Abamectin below acute toxicity levels against untreated control groups	For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were collected for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was then carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. CASRN: 71751 41 2 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch …	Experimental Factor: growth condition:mid exposure\|Experimental Factor: compound:abamectin\|Experimental Factor: dose:0.00022	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 4000	ERP125510	Illumina HiSeq 4000 sequencing; mRNA Seq of zebrafish embryos 96hpf exposed to different concentrations of Abamectin below acute toxicity levels against untreated control groups	ENA FIRST PUBLIC:2021 10 15\|ENA LAST UPDATE:2021 10 15	p823sR249_sr.fastq.gz	fastq	1238386140.0	24550785.0	E MTAB 9852:R249	0:50.44 1:0	A:315619803;C:300278943;G:290065564;T:328018594;N:4403236	50	0	315619803	300278943	290065564	328018594	4403236	ERX4777535	ERS5435303	ERA3184562	Fraunhofer Attract Eco	Fraunhofer Attract Eco	1	0.94195	0.10394	0.65249	0.46521	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	Germany	2021-10-15	Larval	Larval	Whole Organism	All anatomical structures

Advanced export

JSON shape: default, array, newline-delimited

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;