run_metadata
16 rows where experiment.library_layout = "PAIRED", technology = "iclip" and tissue_curation_coarse = "Nervous System"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 41262 | 41262 | SRR4026154 | SRX2018187 | SRS1614128 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | FUS KO 6 | GSM2277123 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | FUS KO 6 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | GSM2277123 | GSM2277123: FUS KO 6; Danio rerio; RNA Seq | GSM2277123 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277123 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | Sample_imb_ketting_2014_13_FUS_KO_6_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_6_R2.fastq.gz | fastq fastq | 7975498532.0 | 39482666.0 | GSM2277123 r1 | 0:101 1:101 | A:2277361634;C:1708878425;G:1702517993;T:2283731854;N:3008626 | 101 | 101 | 2277361634 | 1708878425 | 1702517993 | 2283731854 | 3008626 | SRX2018187 | SRS1614128 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.92046 | 0.9235 | 0.18223 | 0.18163 | 0.68866 | 0.68927 | 0.48519 | 0.47059 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41263 | 41263 | SRR4026155 | SRX2018187 | SRS1614128 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | FUS KO 6 | GSM2277123 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | FUS KO 6 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | GSM2277123 | GSM2277123: FUS KO 6; Danio rerio; RNA Seq | GSM2277123 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277123 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | FUS_KO_6_R1.fastq.gz FUS_KO_6_R2.fastq.gz | fastq fastq | 7173346028.0 | 35511614.0 | GSM2277123 r2 | 0:101 1:101 | A:1991537753;C:1595400788;G:1586024536;T:1997441866;N:2941085 | 101 | 101 | 1991537753 | 1595400788 | 1586024536 | 1997441866 | 2941085 | SRX2018187 | SRS1614128 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.93379 | 0.93701 | 0.16593 | 0.1657 | 0.68517 | 0.68558 | 0.49349 | 0.49229 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41264 | 41264 | SRR4026152 | SRX2018186 | SRS1614129 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | FUS KO 5 | GSM2277122 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | FUS KO 5 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | GSM2277122 | GSM2277122: FUS KO 5; Danio rerio; RNA Seq | GSM2277122 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277122 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | Sample_imb_ketting_2014_13_FUS_KO_5_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_5_R2.fastq.gz | fastq fastq | 7478598328.0 | 37022764.0 | GSM2277122 r1 | 0:101 1:101 | A:2133855925;C:1603288158;G:1598612742;T:2140065375;N:2776128 | 101 | 101 | 2133855925 | 1603288158 | 1598612742 | 2140065375 | 2776128 | SRX2018186 | SRS1614129 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.9197 | 0.92307 | 0.17221 | 0.17171 | 0.68578 | 0.68586 | 0.49581 | 0.50519 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41265 | 41265 | SRR4026153 | SRX2018186 | SRS1614129 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | FUS KO 5 | GSM2277122 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | FUS KO 5 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | GSM2277122 | GSM2277122: FUS KO 5; Danio rerio; RNA Seq | GSM2277122 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277122 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | FUS_KO_5_R1.fastq.gz FUS_KO_5_R2.fastq.gz | fastq fastq | 6719087822.0 | 33262811.0 | GSM2277122 r2 | 0:101 1:101 | A:1785013612;C:1574089873;G:1572290158;T:1784978560;N:2715619 | 101 | 101 | 1785013612 | 1574089873 | 1572290158 | 1784978560 | 2715619 | SRX2018186 | SRS1614129 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.94652 | 0.94901 | 0.12756 | 0.12603 | 0.67834 | 0.6789 | 0.50281 | 0.50397 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41266 | 41266 | SRR4026151 | SRX2018185 | SRS1614126 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | FUS KO 3 | GSM2277121 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | FUS KO 3 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | GSM2277121 | GSM2277121: FUS KO 3; Danio rerio; RNA Seq | GSM2277121 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277121 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | Sample_imb_ketting_2014_13_FUS_KO_3_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_3_R2.fastq.gz | fastq fastq | 7443582840.0 | 36849420.0 | GSM2277121 r1 | 0:101 1:101 | A:2135476546;C:1584607182;G:1583492766;T:2137210756;N:2795590 | 101 | 101 | 2135476546 | 1584607182 | 1583492766 | 2137210756 | 2795590 | SRX2018185 | SRS1614126 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.91865 | 0.92202 | 0.16917 | 0.16765 | 0.69402 | 0.69424 | 0.49158 | 0.505 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41267 | 41267 | SRR4026149 | SRX2018184 | SRS1614127 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | FUS KO 2 | GSM2277120 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | FUS KO 2 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | GSM2277120 | GSM2277120: FUS KO 2; Danio rerio; RNA Seq | GSM2277120 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277120 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | Sample_imb_ketting_2014_13_FUS_KO_2_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_2_R2.fastq.gz | fastq fastq | 7538568694.0 | 37319647.0 | GSM2277120 r1 | 0:101 1:101 | A:2147431018;C:1618323797;G:1622221747;T:2147775519;N:2816613 | 101 | 101 | 2147431018 | 1618323797 | 1622221747 | 2147775519 | 2816613 | SRX2018184 | SRS1614127 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.92241 | 0.92545 | 0.17277 | 0.17289 | 0.6882 | 0.68878 | 0.50153 | 0.49587 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41268 | 41268 | SRR4026150 | SRX2018184 | SRS1614127 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | FUS KO 2 | GSM2277120 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | FUS KO 2 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | GSM2277120 | GSM2277120: FUS KO 2; Danio rerio; RNA Seq | GSM2277120 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277120 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | FUS_KO_2_R1.fastq.gz FUS_KO_2_R2.fastq.gz | fastq fastq | 6447010386.0 | 31915893.0 | GSM2277120 r2 | 0:101 1:101 | A:1836751010;C:1386222757;G:1379853653;T:1841581040;N:2601926 | 101 | 101 | 1836751010 | 1386222757 | 1379853653 | 1841581040 | 2601926 | SRX2018184 | SRS1614127 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.92533 | 0.92991 | 0.17619 | 0.17625 | 0.69031 | 0.69081 | 0.49983 | 0.50191 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41269 | 41269 | SRR4026148 | SRX2018183 | SRS1614125 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | FUS KO 1 | GSM2277119 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | FUS KO 1 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO | GSM2277119 | GSM2277119: FUS KO 1; Danio rerio; RNA Seq | GSM2277119 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277119 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | FUS_KO_1_R1.fastq.gz FUS_KO_1_R2.fastq.gz | fastq fastq | 7395102840.0 | 36609420.0 | GSM2277119 r1 | 0:101 1:101 | A:2103771703;C:1595017984;G:1583980946;T:2109307704;N:3024503 | 101 | 101 | 2103771703 | 1595017984 | 1583980946 | 2109307704 | 3024503 | SRX2018183 | SRS1614125 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.9246 | 0.92781 | 0.17577 | 0.17518 | 0.69116 | 0.69232 | 0.50228 | 0.49896 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41270 | 41270 | SRR4026146 | SRX2018182 | SRS1614123 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | WT 6 | GSM2277118 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | WT 6 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | GSM2277118 | GSM2277118: WT 6; Danio rerio; RNA Seq | GSM2277118 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277118 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | Sample_imb_ketting_2014_13_WT_6_R1.fastq.gz Sample_imb_ketting_2014_13_WT_6_R2.fastq.gz | fastq fastq | 8334635544.0 | 41260572.0 | GSM2277118 r1 | 0:101 1:101 | A:2382306534;C:1783081151;G:1778919442;T:2387251408;N:3077009 | 101 | 101 | 2382306534 | 1783081151 | 1778919442 | 2387251408 | 3077009 | SRX2018182 | SRS1614123 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.91647 | 0.9192 | 0.1793 | 0.17873 | 0.69215 | 0.69262 | 0.50463 | 0.50038 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41271 | 41271 | SRR4026147 | SRX2018182 | SRS1614123 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | WT 6 | GSM2277118 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | WT 6 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | GSM2277118 | GSM2277118: WT 6; Danio rerio; RNA Seq | GSM2277118 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277118 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | WT_6_R1.fastq.gz WT_6_R2.fastq.gz | fastq fastq | 7239861396.0 | 35840898.0 | GSM2277118 r2 | 0:101 1:101 | A:1993396411;C:1626521001;G:1620190105;T:1996794482;N:2959397 | 101 | 101 | 1993396411 | 1626521001 | 1620190105 | 1996794482 | 2959397 | SRX2018182 | SRS1614123 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.93444 | 0.93758 | 0.15305 | 0.15223 | 0.68781 | 0.6885 | 0.5083 | 0.50745 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41272 | 41272 | SRR4026144 | SRX2018181 | SRS1614122 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | WT 4 | GSM2277117 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | WT 4 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | GSM2277117 | GSM2277117: WT 4; Danio rerio; RNA Seq | GSM2277117 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277117 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | Sample_imb_ketting_2014_13_WT_4_R1.fastq.gz Sample_imb_ketting_2014_13_WT_4_R2.fastq.gz | fastq fastq | 7425010556.0 | 36757478.0 | GSM2277117 r1 | 0:101 1:101 | A:2145596358;C:1565455511;G:1562345442;T:2148814299;N:2798946 | 101 | 101 | 2145596358 | 1565455511 | 1562345442 | 2148814299 | 2798946 | SRX2018181 | SRS1614122 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.91897 | 0.92157 | 0.17645 | 0.17633 | 0.6981 | 0.69948 | 0.51038 | 0.50544 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41273 | 41273 | SRR4026145 | SRX2018181 | SRS1614122 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | WT 4 | GSM2277117 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | WT 4 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | GSM2277117 | GSM2277117: WT 4; Danio rerio; RNA Seq | GSM2277117 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277117 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | WT_4_R1.fastq.gz WT_4_R2.fastq.gz | fastq fastq | 6322186910.0 | 31297955.0 | GSM2277117 r2 | 0:101 1:101 | A:1808695425;C:1352265448;G:1346884156;T:1811742728;N:2599153 | 101 | 101 | 1808695425 | 1352265448 | 1346884156 | 1811742728 | 2599153 | SRX2018181 | SRS1614122 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.927 | 0.92959 | 0.17323 | 0.17284 | 0.69562 | 0.69601 | 0.50522 | 0.50634 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41274 | 41274 | SRR4026142 | SRX2018180 | SRS1614124 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | WT 3 | GSM2277116 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | WT 3 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | GSM2277116 | GSM2277116: WT 3; Danio rerio; RNA Seq | GSM2277116 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277116 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | Sample_imb_ketting_2014_13_WT_3_R1.fastq.gz Sample_imb_ketting_2014_13_WT_3_R2.fastq.gz | fastq fastq | 7556697588.0 | 37409394.0 | GSM2277116 r1 | 0:101 1:101 | A:2168554402;C:1607788560;G:1605790339;T:2171752391;N:2811896 | 101 | 101 | 2168554402 | 1607788560 | 1605790339 | 2171752391 | 2811896 | SRX2018180 | SRS1614124 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.91892 | 0.92233 | 0.17858 | 0.17763 | 0.69589 | 0.69674 | 0.50649 | 0.50869 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41275 | 41275 | SRR4026143 | SRX2018180 | SRS1614124 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | WT 3 | GSM2277116 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | WT 3 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | GSM2277116 | GSM2277116: WT 3; Danio rerio; RNA Seq | GSM2277116 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277116 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | WT_3_R1.fastq.gz WT_3_R2.fastq.gz | fastq fastq | 7898912858.0 | 39103529.0 | GSM2277116 r2 | 0:101 1:101 | A:2243356257;C:1706636846;G:1702064968;T:2243634692;N:3220095 | 101 | 101 | 2243356257 | 1706636846 | 1702064968 | 2243634692 | 3220095 | SRX2018180 | SRS1614124 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.92701 | 0.93109 | 0.17113 | 0.17214 | 0.69591 | 0.69716 | 0.50649 | 0.51272 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41276 | 41276 | SRR4026140 | SRX2018179 | SRS1614121 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | WT 1 | GSM2277115 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | WT 1 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | GSM2277115 | GSM2277115: WT 1; Danio rerio; RNA Seq | GSM2277115 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277115 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | Sample_imb_ketting_2014_13_WT_1_R1.fastq.gz Sample_imb_ketting_2014_13_WT_1_R2.fastq.gz | fastq fastq | 7999392910.0 | 39600955.0 | GSM2277115 r1 | 0:101 1:101 | A:2287512350;C:1711532349;G:1705616114;T:2291731604;N:3000493 | 101 | 101 | 2287512350 | 1711532349 | 1705616114 | 2291731604 | 3000493 | SRX2018179 | SRS1614121 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.92291 | 0.92474 | 0.16701 | 0.16646 | 0.698 | 0.69814 | 0.51025 | 0.51024 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System | ||||||||||
| 41277 | 41277 | SRR4026141 | SRX2018179 | SRS1614121 | SRP081553 | PRJNA338793 | Characterization of genetic loss of function of Fus in zebrafish | GSE85554 | Transcriptome Analysis | The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates. | pubmed:27898262 | WT 1 | GSM2277115 | source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | WT 1 | RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an… | adult female brain | The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy. | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips. | tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type | GSM2277115 | GSM2277115: WT 1; Danio rerio; RNA Seq | GSM2277115 | 1 | Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol. | GEO Accession:GSM2277115 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP081553 | WT_1_R1.fastq.gz WT_1_R2.fastq.gz | fastq fastq | 6187101026.0 | 30629213.0 | GSM2277115 r2 | 0:101 1:101 | A:1757769151;C:1333826875;G:1336928364;T:1756068161;N:2508475 | 101 | 101 | 1757769151 | 1333826875 | 1336928364 | 1756068161 | 2508475 | SRX2018179 | SRS1614121 | SRA451974 | GEO | Rene Ketting, Institute of Molecular Biology | 2 | 0.9294 | 0.9334 | 0.16402 | 0.16355 | 0.69682 | 0.69741 | 0.49912 | 0.50428 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | 3prime | poly_a | trueseq | bulk | clip | iclip | Germany | 2016-08-12 | Adult | Adult | Brain | Nervous System |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;