RNAquarium Metadata Server
Institute Website Terms of Use Privacy Policy

run_metadata

92 rows where devstage_curation_coarse = "Undetermined" and tissue_curation = "Gonad"

✎ View and edit SQL

This data as json, CSV (advanced)

experiment.library_selection 4

technology 3

experiment.library_strategy 3

experiment.platform 2

experiment.library_layout 2

tissue_curation_coarse 1

tissue_curation 1

  • Gonad · 92 ✖

experiment.library_source 1

devstage_curation_coarse 1

  • Undetermined · 92 ✖

devstage_curation 1

Link rowid ▼ run.accession experiment.accession sample.accession study.accession bioproject study.title study.alias study.type study.abstract study.attributes study.PMIDs sample.description sample.title sample.alias sample.centername sample.attributes GEOsample.title GEOsample.dataprocessing GEOsample.source GEOsample.treatmentprotocol GEOsample.extractprotocol GEOsample.growthprotocol GEOsample.characteristics GEOsample.accession experiment.title experiment.alias experiment.library_name experiment.design_description experiment.library_construction_protocol experiment.attributes experiment.library_strategy experiment.library_source experiment.library_selection experiment.library_layout experiment.platform experiment.instrument_model experiment.spot_descriptor experiment.study_ref run.title run.attributes run.filename run.semantic_name run.total_bases run.total_spots run.alias run.read_lengths run.base_counts run.r1_length run.r2_length run.r3_length run.r4_length run.Acount run.Ccount run.Gcount run.Tcount run.Ncount run.experiment run.pool_member submission.accession submission.srasource submission.bioprojectsource seqdetective.n_mates seqdetective.mapping_rate.mate1 seqdetective.mapping_rate.mate2 seqdetective.nofeature_rate.mate1 seqdetective.nofeature_rate.mate2 seqdetective.sparsity.mate1 seqdetective.sparsity.mate2 seqdetective.pos_strand_rate.mate1 seqdetective.pos_strand_rate.mate2 seqdetective.readlen.mate1 seqdetective.readlen.mate2 seqdetective.judgement.mate1 seqdetective.judgement.mate2 seqdetective.judgement.reason platform_family instrument_generation read_bias selection_class prep_kit sc_or_bulk tech_class technology tech_variant submission.bioprojectsource.country earliest_date devstage_curation devstage_curation_coarse tissue_curation tissue_curation_coarse
5793 5793 ERR1955208 ERX2020800 ERS1697077 ERP017053 PRJEB15333 Transposon driven transcription is a conserved feature of vertebrate spermatogenesis and transcript evolution ena-STUDY-EMBL EUROPEAN BIOINFORMATICS INSTITUTE-07-09-2016-10:25:55:499-247 Other In order to better understand the features associated with male germline transcription we profiled the RNA expression in a number of germline cell types. These include spermatogonial stem cells spermatocytes and round spermatids in mouse and spermatocytes in rat. We also profiled the transcription in zebrafish testes. As a consequence it became apparent that transposable elements are driving considerable lncRNA expression in the later stages of spermatogenesis. This is particularly apparent in the case of endogenous retroviruses in rodents. ENA FIRST PUBLIC:2017 01 31|ENA LAST UPDATE:2017 05 08     Transcriptional profiling of zebrafish testes for analysis of conserved repeat element associations SAMEA104033184 EMBL EUROPEAN BIOINFORMATICS INSTITUTE ENA FIRST PUBLIC:2017 05 10T17:01:28Z|ENA LAST UPDATE:2017 04 28T10:34:37Z|External Id:SAMEA104033184|INSDC center name:EMBL EUROPEAN BIOINFORMATICS INSTITUTE|INSDC first public:2017 05 10T17:01:28Z|INSDC last update:2017 04 28T10:34:37Z|INSDC status:public|Submitter Id:Zebrafish.Testis 2|common name:zebrafish|sample name:Zebrafish.Testis 2|scientific name:Danio rerio|strain:AB|tissue type:testis                 Illumina HiSeq 2000 paired end sequencing ena EXPERIMENT EMBL EUROPEAN BIOINFORMATICS INSTITUTE 03 05 2017 17:32:41:660 16 unspecified 1     RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP017053 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2017 05 10|ENA LAST UPDATE:2018 11 16 zebrafish_testis_2.conserved.1.fastq.gz zebrafish_testis_2.conserved.2.fastq.gz fastq fastq 46555372886.0 230472143.0 ena RUN EMBL EUROPEAN BIOINFORMATICS INSTITUTE 03 05 2017 17:32:41:660 16 0:101 1:101 A:12260062264;C:10888457642;G:11605642683;T:11637267744;N:163942553 101 101     12260062264 10888457642 11605642683 11637267744 163942553 ERX2020800 ERS1697077 ERA904389 EMBL EUROPEAN BIOINFORMATICS INSTITUTE|European Nucleotide Archive EMBL EUROPEAN BIOINFORMATICS INSTITUTE 2 0.93165 0.92785 0.29822 0.32141 0.71386 0.71971 0.66173 0.63843 101 101 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2017-01-31 Undetermined Undetermined Gonad Reproductive System
5794 5794 ERR1955207 ERX2020799 ERS1697076 ERP017053 PRJEB15333 Transposon driven transcription is a conserved feature of vertebrate spermatogenesis and transcript evolution ena-STUDY-EMBL EUROPEAN BIOINFORMATICS INSTITUTE-07-09-2016-10:25:55:499-247 Other In order to better understand the features associated with male germline transcription we profiled the RNA expression in a number of germline cell types. These include spermatogonial stem cells spermatocytes and round spermatids in mouse and spermatocytes in rat. We also profiled the transcription in zebrafish testes. As a consequence it became apparent that transposable elements are driving considerable lncRNA expression in the later stages of spermatogenesis. This is particularly apparent in the case of endogenous retroviruses in rodents. ENA FIRST PUBLIC:2017 01 31|ENA LAST UPDATE:2017 05 08     Transcriptional profiling of zebrafish testes for analysis of conserved repeat element associations SAMEA104033183 EMBL EUROPEAN BIOINFORMATICS INSTITUTE ENA FIRST PUBLIC:2017 05 10T17:01:28Z|ENA LAST UPDATE:2017 04 28T10:34:37Z|External Id:SAMEA104033183|INSDC center name:EMBL EUROPEAN BIOINFORMATICS INSTITUTE|INSDC first public:2017 05 10T17:01:28Z|INSDC last update:2017 04 28T10:34:37Z|INSDC status:public|Submitter Id:Zebrafish.Testis 1|common name:zebrafish|sample name:Zebrafish.Testis 1|scientific name:Danio rerio|strain:AB|tissue type:testis                 Illumina HiSeq 2000 paired end sequencing ena EXPERIMENT EMBL EUROPEAN BIOINFORMATICS INSTITUTE 03 05 2017 17:32:41:660 15 unspecified 1     RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP017053 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2017 05 10|ENA LAST UPDATE:2018 11 16 zebrafish_testis_1.conserved.1.fastq.gz zebrafish_testis_1.conserved.2.fastq.gz fastq fastq 41056086708.0 203247954.0 ena RUN EMBL EUROPEAN BIOINFORMATICS INSTITUTE 03 05 2017 17:32:41:660 15 0:101 1:101 A:10675591750;C:9672762387;G:10139834713;T:10380949257;N:186948601 101 101     10675591750 9672762387 10139834713 10380949257 186948601 ERX2020799 ERS1697076 ERA904389 EMBL EUROPEAN BIOINFORMATICS INSTITUTE|European Nucleotide Archive EMBL EUROPEAN BIOINFORMATICS INSTITUTE 2 0.92308 0.9157 0.30221 0.31293 0.68276 0.68836 0.56114 0.5857 101 101 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2017-01-31 Undetermined Undetermined Gonad Reproductive System
30556 30556 SRR27836071 SRX23499420 SRS20351177 SRP487485 PRJNA1072072 Rbpms2 promotes female fate upstream of the nutrient sensing Gator2 complex component Mios GSE254850 Transcriptome Analysis Reproductive success relies on proper establishment and maintenance of biological sex. In many animals including mammals the primary gonad is initially ovary in character. We previously showed the RNA binding protein RNAbp Rbpms2 is required for ovary fate in zebrafish. Here we identified Rbpms2 targets in oocytesRbpms2 bound oocyte RNAs; rboRNAs. We identify Rbpms2 as a translational regulator ofrboRNAs which include testis factors and ribosome biogenesis factors. Further genetic analyses indicate that Rbpms2 promotes nucleolar amplification via the mTorc1 signaling pathway specifically through the mTorc1 activating Gap activity towards Rags 2 Gator2 component Missing oocyte Mios. Cumulatively our findings indicate that early gonocytes are in a dual poised bipotential state in which Rbpms2 acts as a binary fate switch. Specifically Rbpms2 represses testis factors and promotes oocyte factors to promote oocyte progression through an essential Gator2 mediated checkpoint thereby integrating regulation of sexual differentiation factors and nutritional availability pathways in zebrafish oogenesis. Overall design: To determine the RNA targets of Rbpms2 we generated wildtype female zebrafish expressing Rbpms2 mApple or mApple alone fusion proteins exclusively in the germline. Immunoprecipitation was performed in 2 adult female ovaries per transgene. Crosslinked and uncrosslinked samples for Rbpms2 mApple expressing fish and crosslined and uncrosslinked samples for mApple expressing fish were sequenced. RNAs found in the Rbpms2 mApple crosslinked and the mApple crosslinked and uncrosslinked datasets that were also present in the Rbpms2 mApple uncrosslinked dataset were excluded. RNAs present only in the uncrosslinked datasets were counted as RNA targets of Rbpms2. To characterize the transcriptional differences of rbpms2 mutants vs wildtype fish prior to sex determination 21 dpf we performed bulk RNA sequencing on n=3 dpf 21 dpf wildtype and n=3 rbpms2 mutant fish. DESeq was then performed for Differential…   pubmed:38898112   Rbpms2 mApple crosslinked SR3 GSM8059038   source name:Gonad|tissue:Gonad|cell type:Germline and somatic|genotype:Wildtype|geo loc name:missing|collection date:missing Rbpms2 mApple crosslinked SR3 Basespace illumina platform was used and reads were mapped using tophate2 aligner. Estimation of reference genes and transcript was done using cufflinks and reads were mapped to the genome GRCz10. Reads were aligned with the TopHat Alignment App. GRCz10 CSV file that compiled includes tracking ids gene loci and FPKMs for each samples CSV files include tracking and gene id gene short name tss id locus and FPKM for each sample Gonad   RNA was extracted with an Rneasy Mini Kit Qiagen 74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina 20020589   tissue:Gonad|cell type:Germline and somatic|genotype:Wildtype GSM8059038 GSM8059038: Rbpms2 mApple crosslinked SR3; Danio rerio; RNA Seq GSM8059038 r1 GSM8059038 1 RNA was extracted with an Rneasy Mini Kit Qiagen 74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina 20020589   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP487485     SR-3_S4_L001_R1_001.fastq.gz SR-3_S4_L001_R2_001.fastq.gz fastq fastq 588252864.0 3949222.0 GSM8059038 r1 0:74.42 1:74.53 A:116383167;C:176622592;G:176850622;T:118306997;N:89486 74 74     116383167 176622592 176850622 118306997 89486 SRX23499420 SRS20351177 SRA1796363 Marlow, CDRB, Icahn School of Medicine Mount Sinai Marlow, CDRB, Icahn School of Medicine Mount Sinai                       B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified trueseq bulk bulk bulk   United States 2024-02-01 Undetermined Undetermined Gonad Reproductive System
30557 30557 SRR27836072 SRX23499419 SRS20351178 SRP487485 PRJNA1072072 Rbpms2 promotes female fate upstream of the nutrient sensing Gator2 complex component Mios GSE254850 Transcriptome Analysis Reproductive success relies on proper establishment and maintenance of biological sex. In many animals including mammals the primary gonad is initially ovary in character. We previously showed the RNA binding protein RNAbp Rbpms2 is required for ovary fate in zebrafish. Here we identified Rbpms2 targets in oocytesRbpms2 bound oocyte RNAs; rboRNAs. We identify Rbpms2 as a translational regulator ofrboRNAs which include testis factors and ribosome biogenesis factors. Further genetic analyses indicate that Rbpms2 promotes nucleolar amplification via the mTorc1 signaling pathway specifically through the mTorc1 activating Gap activity towards Rags 2 Gator2 component Missing oocyte Mios. Cumulatively our findings indicate that early gonocytes are in a dual poised bipotential state in which Rbpms2 acts as a binary fate switch. Specifically Rbpms2 represses testis factors and promotes oocyte factors to promote oocyte progression through an essential Gator2 mediated checkpoint thereby integrating regulation of sexual differentiation factors and nutritional availability pathways in zebrafish oogenesis. Overall design: To determine the RNA targets of Rbpms2 we generated wildtype female zebrafish expressing Rbpms2 mApple or mApple alone fusion proteins exclusively in the germline. Immunoprecipitation was performed in 2 adult female ovaries per transgene. Crosslinked and uncrosslinked samples for Rbpms2 mApple expressing fish and crosslined and uncrosslinked samples for mApple expressing fish were sequenced. RNAs found in the Rbpms2 mApple crosslinked and the mApple crosslinked and uncrosslinked datasets that were also present in the Rbpms2 mApple uncrosslinked dataset were excluded. RNAs present only in the uncrosslinked datasets were counted as RNA targets of Rbpms2. To characterize the transcriptional differences of rbpms2 mutants vs wildtype fish prior to sex determination 21 dpf we performed bulk RNA sequencing on n=3 dpf 21 dpf wildtype and n=3 rbpms2 mutant fish. DESeq was then performed for Differential…   pubmed:38898112   Rbpms2 mApple uncrosslinked SR2 GSM8059037   source name:Gonad|tissue:Gonad|cell type:Germline and somatic|genotype:Wildtype|geo loc name:missing|collection date:missing Rbpms2 mApple uncrosslinked SR2 Basespace illumina platform was used and reads were mapped using tophate2 aligner. Estimation of reference genes and transcript was done using cufflinks and reads were mapped to the genome GRCz10. Reads were aligned with the TopHat Alignment App. GRCz10 CSV file that compiled includes tracking ids gene loci and FPKMs for each samples CSV files include tracking and gene id gene short name tss id locus and FPKM for each sample Gonad   RNA was extracted with an Rneasy Mini Kit Qiagen 74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina 20020589   tissue:Gonad|cell type:Germline and somatic|genotype:Wildtype GSM8059037 GSM8059037: Rbpms2 mApple uncrosslinked SR2; Danio rerio; RNA Seq GSM8059037 r1 GSM8059037 1 RNA was extracted with an Rneasy Mini Kit Qiagen 74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina 20020589   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP487485     SR-2_S3_L001_R1_001.fastq.gz SR-2_S3_L001_R2_001.fastq.gz fastq fastq 547329260.0 3670350.0 GSM8059037 r1 0:74.51 1:74.61 A:109193152;C:163365002;G:162344228;T:112378069;N:48809 74 74     109193152 163365002 162344228 112378069 48809 SRX23499419 SRS20351178 SRA1796363 Marlow, CDRB, Icahn School of Medicine Mount Sinai Marlow, CDRB, Icahn School of Medicine Mount Sinai                       B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified trueseq bulk bulk bulk   United States 2024-02-01 Undetermined Undetermined Gonad Reproductive System
30558 30558 SRR27836073 SRX23499418 SRS20351176 SRP487485 PRJNA1072072 Rbpms2 promotes female fate upstream of the nutrient sensing Gator2 complex component Mios GSE254850 Transcriptome Analysis Reproductive success relies on proper establishment and maintenance of biological sex. In many animals including mammals the primary gonad is initially ovary in character. We previously showed the RNA binding protein RNAbp Rbpms2 is required for ovary fate in zebrafish. Here we identified Rbpms2 targets in oocytesRbpms2 bound oocyte RNAs; rboRNAs. We identify Rbpms2 as a translational regulator ofrboRNAs which include testis factors and ribosome biogenesis factors. Further genetic analyses indicate that Rbpms2 promotes nucleolar amplification via the mTorc1 signaling pathway specifically through the mTorc1 activating Gap activity towards Rags 2 Gator2 component Missing oocyte Mios. Cumulatively our findings indicate that early gonocytes are in a dual poised bipotential state in which Rbpms2 acts as a binary fate switch. Specifically Rbpms2 represses testis factors and promotes oocyte factors to promote oocyte progression through an essential Gator2 mediated checkpoint thereby integrating regulation of sexual differentiation factors and nutritional availability pathways in zebrafish oogenesis. Overall design: To determine the RNA targets of Rbpms2 we generated wildtype female zebrafish expressing Rbpms2 mApple or mApple alone fusion proteins exclusively in the germline. Immunoprecipitation was performed in 2 adult female ovaries per transgene. Crosslinked and uncrosslinked samples for Rbpms2 mApple expressing fish and crosslined and uncrosslinked samples for mApple expressing fish were sequenced. RNAs found in the Rbpms2 mApple crosslinked and the mApple crosslinked and uncrosslinked datasets that were also present in the Rbpms2 mApple uncrosslinked dataset were excluded. RNAs present only in the uncrosslinked datasets were counted as RNA targets of Rbpms2. To characterize the transcriptional differences of rbpms2 mutants vs wildtype fish prior to sex determination 21 dpf we performed bulk RNA sequencing on n=3 dpf 21 dpf wildtype and n=3 rbpms2 mutant fish. DESeq was then performed for Differential…   pubmed:38898112   mApple control crosslinked SR8 GSM8059036   source name:Gonad|tissue:Gonad|cell type:Germline and somatic|genotype:Wildtype|geo loc name:missing|collection date:missing mApple control crosslinked SR8 Basespace illumina platform was used and reads were mapped using tophate2 aligner. Estimation of reference genes and transcript was done using cufflinks and reads were mapped to the genome GRCz10. Reads were aligned with the TopHat Alignment App. GRCz10 CSV file that compiled includes tracking ids gene loci and FPKMs for each samples CSV files include tracking and gene id gene short name tss id locus and FPKM for each sample Gonad   RNA was extracted with an Rneasy Mini Kit Qiagen 74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina 20020589   tissue:Gonad|cell type:Germline and somatic|genotype:Wildtype GSM8059036 GSM8059036: mApple control crosslinked SR8; Danio rerio; RNA Seq GSM8059036 r1 GSM8059036 1 RNA was extracted with an Rneasy Mini Kit Qiagen 74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina 20020589   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP487485     SR-8_S6_L001_R1_001.fastq.gz SR-8_S6_L001_R2_001.fastq.gz fastq fastq 474378287.0 3180744.0 GSM8059036 r1 0:74.52 1:74.62 A:90310344;C:145884340;G:146185172;T:91942086;N:56345 74 74     90310344 145884340 146185172 91942086 56345 SRX23499418 SRS20351176 SRA1796363 Marlow, CDRB, Icahn School of Medicine Mount Sinai Marlow, CDRB, Icahn School of Medicine Mount Sinai                       B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified trueseq bulk bulk bulk   United States 2024-02-01 Undetermined Undetermined Gonad Reproductive System
30559 30559 SRR27836074 SRX23499417 SRS20351175 SRP487485 PRJNA1072072 Rbpms2 promotes female fate upstream of the nutrient sensing Gator2 complex component Mios GSE254850 Transcriptome Analysis Reproductive success relies on proper establishment and maintenance of biological sex. In many animals including mammals the primary gonad is initially ovary in character. We previously showed the RNA binding protein RNAbp Rbpms2 is required for ovary fate in zebrafish. Here we identified Rbpms2 targets in oocytesRbpms2 bound oocyte RNAs; rboRNAs. We identify Rbpms2 as a translational regulator ofrboRNAs which include testis factors and ribosome biogenesis factors. Further genetic analyses indicate that Rbpms2 promotes nucleolar amplification via the mTorc1 signaling pathway specifically through the mTorc1 activating Gap activity towards Rags 2 Gator2 component Missing oocyte Mios. Cumulatively our findings indicate that early gonocytes are in a dual poised bipotential state in which Rbpms2 acts as a binary fate switch. Specifically Rbpms2 represses testis factors and promotes oocyte factors to promote oocyte progression through an essential Gator2 mediated checkpoint thereby integrating regulation of sexual differentiation factors and nutritional availability pathways in zebrafish oogenesis. Overall design: To determine the RNA targets of Rbpms2 we generated wildtype female zebrafish expressing Rbpms2 mApple or mApple alone fusion proteins exclusively in the germline. Immunoprecipitation was performed in 2 adult female ovaries per transgene. Crosslinked and uncrosslinked samples for Rbpms2 mApple expressing fish and crosslined and uncrosslinked samples for mApple expressing fish were sequenced. RNAs found in the Rbpms2 mApple crosslinked and the mApple crosslinked and uncrosslinked datasets that were also present in the Rbpms2 mApple uncrosslinked dataset were excluded. RNAs present only in the uncrosslinked datasets were counted as RNA targets of Rbpms2. To characterize the transcriptional differences of rbpms2 mutants vs wildtype fish prior to sex determination 21 dpf we performed bulk RNA sequencing on n=3 dpf 21 dpf wildtype and n=3 rbpms2 mutant fish. DESeq was then performed for Differential…   pubmed:38898112   mApple control uncrosslinked SR6 GSM8059035   source name:Gonad|tissue:Gonad|cell type:Germline and somatic|genotype:Wildtype|geo loc name:missing|collection date:missing mApple control uncrosslinked SR6 Basespace illumina platform was used and reads were mapped using tophate2 aligner. Estimation of reference genes and transcript was done using cufflinks and reads were mapped to the genome GRCz10. Reads were aligned with the TopHat Alignment App. GRCz10 CSV file that compiled includes tracking ids gene loci and FPKMs for each samples CSV files include tracking and gene id gene short name tss id locus and FPKM for each sample Gonad   RNA was extracted with an Rneasy Mini Kit Qiagen 74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina 20020589   tissue:Gonad|cell type:Germline and somatic|genotype:Wildtype GSM8059035 GSM8059035: mApple control uncrosslinked SR6; Danio rerio; RNA Seq GSM8059035 r1 GSM8059035 1 RNA was extracted with an Rneasy Mini Kit Qiagen 74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina 20020589   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP487485     SR-6_S5_L001_R1_001.fastq.gz SR-6_S5_L001_R2_001.fastq.gz fastq fastq 1667210566.0 11187841.0 GSM8059035 r1 0:74.46 1:74.56 A:348153529;C:480420209;G:474792496;T:363567978;N:276354 74 74     348153529 480420209 474792496 363567978 276354 SRX23499417 SRS20351175 SRA1796363 Marlow, CDRB, Icahn School of Medicine Mount Sinai Marlow, CDRB, Icahn School of Medicine Mount Sinai                       B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified trueseq bulk bulk bulk   United States 2024-02-01 Undetermined Undetermined Gonad Reproductive System
32476 32476 SRR29270149 SRX24787634 SRS21505104 SRP511487 PRJNA1119569 RNA seq of zebrafish foxl2l mutant PRJNA1119569 Other Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.         foxl2l Mut 20 1   strain:AB|age:20|collection date:2023 06 10|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal                 foxl2l Mut 20 1 E10 E10 50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA NextSeq 500   SRP511487     foxl2l_Mut-20-1_S162_R1.fastq.gz foxl2l_Mut-20-1_S162_R2.fastq.gz fastq fastq 8940963680.0 29605840.0 foxl2l Mut 20 1 S162 R1.fastq.gz 0:151 1:151 A:2232167098;C:2229744850;G:2271326718;T:2207692629;N:32385 151 151     2232167098 2229744850 2271326718 2207692629 32385 SRX24787634 SRS21505104 SRA1887976 Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology Institute of Hydrobiology, Chinese Academy of Sciences                       B B biological fallback assumption illumina nextseq unknown random_priming unknown bulk bulk bulk   China 2024-06-03 Undetermined Undetermined Gonad Reproductive System
32477 32477 SRR29270150 SRX24787633 SRS21505103 SRP511487 PRJNA1119569 RNA seq of zebrafish foxl2l mutant PRJNA1119569 Other Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.         foxl2l Het 20 3   strain:AB|age:20|collection date:2023 06 09|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal                 foxl2l Het 20 3 E9 E9 50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA NextSeq 500   SRP511487     foxl2l_Het-20-3_S161_R1.fastq.gz foxl2l_Het-20-3_S161_R2.fastq.gz fastq fastq 7038409282.0 23305991.0 foxl2l Het 20 3 S161 R1.fastq.gz 0:151 1:151 A:1766863186;C:1740008639;G:1787471686;T:1744039429;N:26342 151 151     1766863186 1740008639 1787471686 1744039429 26342 SRX24787633 SRS21505103 SRA1887976 Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology Institute of Hydrobiology, Chinese Academy of Sciences                       B B biological fallback assumption illumina nextseq unknown random_priming unknown bulk bulk bulk   China 2024-06-03 Undetermined Undetermined Gonad Reproductive System
32478 32478 SRR29270151 SRX24787632 SRS21505102 SRP511487 PRJNA1119569 RNA seq of zebrafish foxl2l mutant PRJNA1119569 Other Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.         foxl2l Het 20 2   strain:AB|age:20|collection date:2023 06 08|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal                 foxl2l Het 20 2 E8 E8 50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA NextSeq 500   SRP511487     foxl2l_Het-20-2_S160_R1.fastq.gz foxl2l_Het-20-2_S160_R2.fastq.gz fastq fastq 6772505832.0 22425516.0 foxl2l Het 20 2 S160 R1.fastq.gz 0:151 1:151 A:1704124986;C:1673138074;G:1713003931;T:1682214009;N:24832 151 151     1704124986 1673138074 1713003931 1682214009 24832 SRX24787632 SRS21505102 SRA1887976 Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology Institute of Hydrobiology, Chinese Academy of Sciences                       B B biological fallback assumption illumina nextseq unknown random_priming unknown bulk bulk bulk   China 2024-06-03 Undetermined Undetermined Gonad Reproductive System
32479 32479 SRR29270152 SRX24787631 SRS21505101 SRP511487 PRJNA1119569 RNA seq of zebrafish foxl2l mutant PRJNA1119569 Other Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.         foxl2l Het 20 1   strain:AB|age:20|collection date:2023 06 07|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal                 foxl2l Het 20 1 E7 E7 50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA NextSeq 500   SRP511487     foxl2l_Het-20-1_S159_R1.fastq.gz foxl2l_Het-20-1_S159_R2.fastq.gz fastq fastq 11685740812.0 38694506.0 foxl2l Het 20 1 S159 R1.fastq.gz 0:151 1:151 A:2939618668;C:2888861085;G:2958173208;T:2899044704;N:43147 151 151     2939618668 2888861085 2958173208 2899044704 43147 SRX24787631 SRS21505101 SRA1887976 Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology Institute of Hydrobiology, Chinese Academy of Sciences                       B B biological fallback assumption illumina nextseq unknown random_priming unknown bulk bulk bulk   China 2024-06-03 Undetermined Undetermined Gonad Reproductive System
32480 32480 SRR29270153 SRX24787630 SRS21505100 SRP511487 PRJNA1119569 RNA seq of zebrafish foxl2l mutant PRJNA1119569 Other Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.         foxl2l Mut 15 3   strain:AB|age:15|collection date:2023 06 06|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal                 foxl2l Mut 15 3 E6 E6 50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA NextSeq 500   SRP511487     foxl2l_Mut-15-3_S158_R1.fastq.gz foxl2l_Mut-15-3_S158_R2.fastq.gz fastq fastq 9503789604.0 31469502.0 foxl2l Mut 15 3 S158 R1.fastq.gz 0:151 1:151 A:2393052443;C:2340958111;G:2411502428;T:2358240313;N:36309 151 151     2393052443 2340958111 2411502428 2358240313 36309 SRX24787630 SRS21505100 SRA1887976 Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology Institute of Hydrobiology, Chinese Academy of Sciences                       B B biological fallback assumption illumina nextseq unknown random_priming unknown bulk bulk bulk   China 2024-06-03 Undetermined Undetermined Gonad Reproductive System
32481 32481 SRR29270154 SRX24787629 SRS21505099 SRP511487 PRJNA1119569 RNA seq of zebrafish foxl2l mutant PRJNA1119569 Other Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.         foxl2l Mut 15 2   strain:AB|age:15|collection date:2023 06 05|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal                 foxl2l Mut 15 2 E5 E5 50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA NextSeq 500   SRP511487     foxl2l_Mut-15-2_S157_R1.fastq.gz foxl2l_Mut-15-2_S157_R2.fastq.gz fastq fastq 7416837026.0 24559063.0 foxl2l Mut 15 2 S157 R1.fastq.gz 0:151 1:151 A:1865711045;C:1830489703;G:1881612508;T:1838995980;N:27790 151 151     1865711045 1830489703 1881612508 1838995980 27790 SRX24787629 SRS21505099 SRA1887976 Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology Institute of Hydrobiology, Chinese Academy of Sciences                       B B biological fallback assumption illumina nextseq unknown random_priming unknown bulk bulk bulk   China 2024-06-03 Undetermined Undetermined Gonad Reproductive System
32482 32482 SRR29270155 SRX24787628 SRS21505098 SRP511487 PRJNA1119569 RNA seq of zebrafish foxl2l mutant PRJNA1119569 Other Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.         foxl2l Mut 15 1   strain:AB|age:15|collection date:2023 06 04|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal                 foxl2l Mut 15 1 E4 E4 50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA NextSeq 500   SRP511487     foxl2l_Mut-15-1_S156_R1.fastq.gz foxl2l_Mut-15-1_S156_R2.fastq.gz fastq fastq 7092721868.0 23485834.0 foxl2l Mut 15 1 S156 R1.fastq.gz 0:151 1:151 A:1764166761;C:1770534219;G:1820397492;T:1737597123;N:26273 151 151     1764166761 1770534219 1820397492 1737597123 26273 SRX24787628 SRS21505098 SRA1887976 Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology Institute of Hydrobiology, Chinese Academy of Sciences                       B B biological fallback assumption illumina nextseq unknown random_priming unknown bulk bulk bulk   China 2024-06-03 Undetermined Undetermined Gonad Reproductive System
32483 32483 SRR29270156 SRX24787627 SRS21505097 SRP511487 PRJNA1119569 RNA seq of zebrafish foxl2l mutant PRJNA1119569 Other Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.         foxl2l Het 15 3   strain:AB|age:15|collection date:2023 06 03|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal                 foxl2l Het 15 3 E3 E3 50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA NextSeq 500   SRP511487     foxl2l_Het-15-3_S155_R1.fastq.gz foxl2l_Het-15-3_S155_R2.fastq.gz fastq fastq 8083606820.0 26766910.0 foxl2l Het 15 3 S155 R1.fastq.gz 0:151 1:151 A:2028557443;C:2001113164;G:2050610840;T:2003295953;N:29420 151 151     2028557443 2001113164 2050610840 2003295953 29420 SRX24787627 SRS21505097 SRA1887976 Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology Institute of Hydrobiology, Chinese Academy of Sciences                       B B biological fallback assumption illumina nextseq unknown random_priming unknown bulk bulk bulk   China 2024-06-03 Undetermined Undetermined Gonad Reproductive System
32484 32484 SRR29270157 SRX24787626 SRS21505096 SRP511487 PRJNA1119569 RNA seq of zebrafish foxl2l mutant PRJNA1119569 Other Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.         foxl2l Mut 20 3   strain:AB|age:20|collection date:2023 06 12|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal                 foxl2l Mut 20 3 E12 E12 50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA NextSeq 500   SRP511487     foxl2l_Mut-20-3_S164_R1.fastq.gz foxl2l_Mut-20-3_S164_R2.fastq.gz fastq fastq 7474861796.0 24751198.0 foxl2l Mut 20 3 S164 R1.fastq.gz 0:151 1:151 A:1878881650;C:1849512621;G:1891142525;T:1855296720;N:28280 151 151     1878881650 1849512621 1891142525 1855296720 28280 SRX24787626 SRS21505096 SRA1887976 Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology Institute of Hydrobiology, Chinese Academy of Sciences                       B B biological fallback assumption illumina nextseq unknown random_priming unknown bulk bulk bulk   China 2024-06-03 Undetermined Undetermined Gonad Reproductive System
32485 32485 SRR29270158 SRX24787625 SRS21505095 SRP511487 PRJNA1119569 RNA seq of zebrafish foxl2l mutant PRJNA1119569 Other Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.         foxl2l Mut 20 2   strain:AB|age:20|collection date:2023 06 11|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal                 foxl2l Mut 20 2 E11 E11 50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA NextSeq 500   SRP511487     foxl2l_Mut-20-2_S163_R1.fastq.gz foxl2l_Mut-20-2_S163_R2.fastq.gz fastq fastq 8203704066.0 27164583.0 foxl2l Mut 20 2 S163 R1.fastq.gz 0:151 1:151 A:2061693689;C:2030126562;G:2072980952;T:2038873198;N:29665 151 151     2061693689 2030126562 2072980952 2038873198 29665 SRX24787625 SRS21505095 SRA1887976 Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology Institute of Hydrobiology, Chinese Academy of Sciences                       B B biological fallback assumption illumina nextseq unknown random_priming unknown bulk bulk bulk   China 2024-06-03 Undetermined Undetermined Gonad Reproductive System
32486 32486 SRR29270159 SRX24787624 SRS21505094 SRP511487 PRJNA1119569 RNA seq of zebrafish foxl2l mutant PRJNA1119569 Other Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.         foxl2l Het 15 2   strain:AB|age:15|collection date:2023 06 02|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal                 foxl2l Het 15 2 E2 E2 50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA NextSeq 500   SRP511487     foxl2l_Het-15-2_S154_R1.fastq.gz foxl2l_Het-15-2_S154_R2.fastq.gz fastq fastq 7868286860.0 26053930.0 foxl2l Het 15 2 S154 R1.fastq.gz 0:151 1:151 A:1972210357;C:1946891859;G:2008091153;T:1941064817;N:28674 151 151     1972210357 1946891859 2008091153 1941064817 28674 SRX24787624 SRS21505094 SRA1887976 Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology Institute of Hydrobiology, Chinese Academy of Sciences                       B B biological fallback assumption illumina nextseq unknown random_priming unknown bulk bulk bulk   China 2024-06-03 Undetermined Undetermined Gonad Reproductive System
32487 32487 SRR29270160 SRX24787623 SRS21505093 SRP511487 PRJNA1119569 RNA seq of zebrafish foxl2l mutant PRJNA1119569 Other Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.         foxl2l Het 15 1   strain:AB|age:15|collection date:2023 06 01|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal                 foxl2l Het 15 1 E1 E1 50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA NextSeq 500   SRP511487     foxl2l_Het-15-1_S153_R1.fastq.gz foxl2l_Het-15-1_S153_R2.fastq.gz fastq fastq 7117391946.0 23567523.0 foxl2l Het 15 1 S153 R1.fastq.gz 0:151 1:151 A:1795668098;C:1752824783;G:1793720116;T:1775153584;N:25365 151 151     1795668098 1752824783 1793720116 1775153584 25365 SRX24787623 SRS21505093 SRA1887976 Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology Institute of Hydrobiology, Chinese Academy of Sciences                       B B biological fallback assumption illumina nextseq unknown random_priming unknown bulk bulk bulk   China 2024-06-03 Undetermined Undetermined Gonad Reproductive System
36285 36285 SRR363985 SRX105298 SRS270141 SRP009275 PRJNA148581 Hen1 analysis in zebrafish GSE33582 Transcriptome Analysis small RNA libraries from wild type and Hen1 mutant testes were made with either polyA tailing VASAGFPHen1minus/plus or adapter ligation Hen1Testis and WTTestis and sequenced on an Illumina GAII platform. Overall design: RNA was isolated from total testis tissue of both Hen1 wildtype and Hen1 mutant animals. post size selection from gel the small RNA libraries wre made.   pubmed:20859253   wildtype ligation GSM830247   source name:testis|strain:TL|genotype/variation:Hen1 wildtype|tissue:testis|small rna library prep method:adapter ligation wildtype ligation three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the zebrafish genome Zv8 testis   Small RNAs in the size range of 19 31 bases were excised from a denaturing gel. Adaptors were ligated to the five prime and three prime ends of the isolated RNA and the product was converted to cDNA using a primer on the three prime adaptor. post 15 cycles PCR amplification of the library the product was gel purified and sequenced on a Solexa platform.   strain:TL|genotype/variation:Hen1 wildtype|tissue:testis|small rna library prep method:adapter ligation GSM830247 GSM830247: wildtype ligation GSM830247: wildtype ligation GSM830247: wildtype ligation 1   GEO Accession:GSM830247 RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>46</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP009275   read name barcode proc directive:ignore WTTESTIS.fastq fastq 395791130.0 8604155.0 GSM830247 1 0:46 A:79045664;C:90489917;G:99082007;T:127024229;N:149313 46       79045664 90489917 99082007 127024229 149313 SRX105298 SRS270141 SRA047996 GEO European Research Institute for the Biology of Ageing, University Medical Center Groningen 1 0.00021   0.00015   0.99989   0.0   46   T   under 1.2% mapping rate illumina early_illumina 5prime poly_a unknown bulk unknown unknown   Netherlands 2011-11-09 Undetermined Undetermined Gonad Reproductive System
36286 36286 SRR363984 SRX105297 SRS270140 SRP009275 PRJNA148581 Hen1 analysis in zebrafish GSE33582 Transcriptome Analysis small RNA libraries from wild type and Hen1 mutant testes were made with either polyA tailing VASAGFPHen1minus/plus or adapter ligation Hen1Testis and WTTestis and sequenced on an Illumina GAII platform. Overall design: RNA was isolated from total testis tissue of both Hen1 wildtype and Hen1 mutant animals. post size selection from gel the small RNA libraries wre made.   pubmed:20859253   hen1 mutant ligation GSM830246   source name:testis|strain:TL|genotype/variation:Hen1 mutant|tissue:testis|small rna library prep method:adapter ligation hen1 mutant ligation three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the zebrafish genome Zv8 testis   Small RNAs in the size range of 19 31 bases were excised from a denaturing gel. Adaptors were ligated to the five prime and three prime ends of the isolated RNA and the product was converted to cDNA using a primer on the three prime adaptor. post 15 cycles PCR amplification of the library the product was gel purified and sequenced on a Solexa platform.   strain:TL|genotype/variation:Hen1 mutant|tissue:testis|small rna library prep method:adapter ligation GSM830246 GSM830246: hen1 mutant ligation GSM830246: hen1 mutant ligation GSM830246: hen1 mutant ligation 1   GEO Accession:GSM830246 RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>46</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP009275   read name barcode proc directive:ignore HEN1TESTIS.fastq fastq 440876374.0 9584269.0 GSM830246 1 0:46 A:91693980;C:99515953;G:105634029;T:143841954;N:190458 46       91693980 99515953 105634029 143841954 190458 SRX105297 SRS270140 SRA047996 GEO European Research Institute for the Biology of Ageing, University Medical Center Groningen 1 0.00039   0.00033   0.99995   0.0   46   T   under 1.2% mapping rate illumina early_illumina 5prime poly_a unknown bulk unknown unknown   Netherlands 2011-11-09 Undetermined Undetermined Gonad Reproductive System
36287 36287 SRR363983 SRX105296 SRS270139 SRP009275 PRJNA148581 Hen1 analysis in zebrafish GSE33582 Transcriptome Analysis small RNA libraries from wild type and Hen1 mutant testes were made with either polyA tailing VASAGFPHen1minus/plus or adapter ligation Hen1Testis and WTTestis and sequenced on an Illumina GAII platform. Overall design: RNA was isolated from total testis tissue of both Hen1 wildtype and Hen1 mutant animals. post size selection from gel the small RNA libraries wre made.   pubmed:20859253   wildtype polyA GSM830245   source name:testis|strain:TL|genotype/variation:Hen1 wildtype|tissue:testis|small rna library prep method:polyA tailing wildtype polyA three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the zebrafish genome Zv8 testis   Small RNAs in the size range of 19 31 bases were excised from a denaturing gel. RNA was polyA tailed using polyA polymerase followed by ligation of a RNA adaptor to the five prime phosphate of the small RNAs. First strand cDNA synthesis was performed using an oligodT linker primer and M MLV RNase H reverse transcriptase. post amplification the cDNA was sent for sequencing on an Illumina/Solexa platform.   strain:TL|genotype/variation:Hen1 wildtype|tissue:testis|small rna library prep method:polyA tailing GSM830245 GSM830245: wildtype polyA GSM830245: wildtype polyA GSM830245: wildtype polyA 1   GEO Accession:GSM830245 RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>44</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP009275   read name barcode proc directive:ignore VASAGFPHEN1plusMALE.fastq fastq 167344144.0 3803276.0 GSM830245 1 0:44 A:87935982;C:21182538;G:19081938;T:34474815;N:4668871 44       87935982 21182538 19081938 34474815 4668871 SRX105296 SRS270139 SRA047996 GEO European Research Institute for the Biology of Ageing, University Medical Center Groningen 1 0.06642   0.05042   0.99226   0.38346   44   B   usable mapping rate illumina early_illumina unknown poly_a unknown bulk unknown unknown   Netherlands 2011-11-09 Undetermined Undetermined Gonad Reproductive System
36288 36288 SRR363982 SRX105295 SRS270138 SRP009275 PRJNA148581 Hen1 analysis in zebrafish GSE33582 Transcriptome Analysis small RNA libraries from wild type and Hen1 mutant testes were made with either polyA tailing VASAGFPHen1minus/plus or adapter ligation Hen1Testis and WTTestis and sequenced on an Illumina GAII platform. Overall design: RNA was isolated from total testis tissue of both Hen1 wildtype and Hen1 mutant animals. post size selection from gel the small RNA libraries wre made.   pubmed:20859253   hen1 mutant polyA GSM830244   source name:testis|strain:TL|genotype/variation:Hen1 mutant|tissue:testis|small rna library prep method:polyA tailing hen1 mutant polyA three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the zebrafish genome Zv8 testis   Small RNAs in the size range of 19 31 bases were excised from a denaturing gel. RNA was polyA tailed using polyA polymerase followed by ligation of a RNA adaptor to the five prime phosphate of the small RNAs. First strand cDNA synthesis was performed using an oligodT linker primer and M MLV RNase H reverse transcriptase. post amplification the cDNA was sent for sequencing on an Illumina/Solexa platform.   strain:TL|genotype/variation:Hen1 mutant|tissue:testis|small rna library prep method:polyA tailing GSM830244 GSM830244: hen1 mutant polyA GSM830244: hen1 mutant polyA GSM830244: hen1 mutant polyA 1   GEO Accession:GSM830244 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>44</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP009275   read name barcode proc directive:ignore VASAGFPHEN1minusMALE.fastq fastq 267208964.0 6072931.0 GSM830244 1 0:44 A:143478691;C:30051676;G:33682677;T:59883224;N:112696 44       143478691 30051676 33682677 59883224 112696 SRX105295 SRS270138 SRA047996 GEO European Research Institute for the Biology of Ageing, University Medical Center Groningen 1 0.01616   0.01033   0.99381   0.76337   44   B   usable mapping rate illumina early_illumina unknown poly_a unknown bulk unknown unknown   Netherlands 2011-11-09 Undetermined Undetermined Gonad Reproductive System
42465 42465 SRR5605448 SRX2858036 SRS2228760 SRP108050 PRJNA388086 Transcriptomic Analysis for Differentially Expressed Genes in Ovarian Follicle Activation and Puberty Onset in the Zebrafish GSE99308 Transcriptome Analysis Puberty is a special transition period in sexual maturation and it has been extensively studied in vertebrates in the past decades. In mammals the initiation of puberty involves activation of numerous genes; however there have been few comprehensive reports in small model teleosts such as the zebrafish. In the zebrafish the onset of puberty in females is marked by the appearance of the first wave of pre vitellogenic PV follicles in the ovary during sexual maturation. Using transcriptomics and real time qPCR this study was undertaken to investigate temporal gene expression differences between the primary growth PG follicles and pre vitellogenic PV follicles with particular emphasis on oocyte and follicular cell specific genes as well as several closely associated signaling pathways. Our results showed that totally 1082 genes were significantly upregulated and 530 evidently downregulated during the PG PV transition and among them were some well recognized biomarkers such as cyp19a1a fshr inha and inhbaa and some novel genes like notch3 amh gadd45ga and lpl. Further gene ontology analysis showed that egg coat formation and steroid hormone mediated signaling pathway might be critical for follicle activation from PG to PV stage. In addition KEGG identified several signaling pathways that might play pivotal roles in early folliculogenesis including phosphatidylinositol signaling system glycolsaminoglycan biosynthesis RNA transport and p53 signaling pathways. Overall this study reported a comprehensive analysis for biomarker genes and potential pathways involved in PG PV transition or follicle activation which also marks female puberty onset in the zebrafish when occurring for the first time in sexual maturation. Overall design: Examination of gene expression patterns in 2 different stage follicles PG and PV follicles   pubmed:30364302   PV WT3 GSM2640960   source name:PV WT3|strain:AB|tissue:follice|developmental stage:pre vitellogenin|genotype:WT PV WT3 Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Danio rerio genome version GRCz10 from Ensembl using Tophat2. Parameters: p 6 StringTie and prepDE.py Python script provided with StringTie tool was used to assemble the alignments into transcripts and extract the raw read counts for reference genomic features respectively. The read count matrix was processed by DeSeq2 package for differential gene expression analysis. Genome build: GRCz10 Ensembl build 84 Supplementary files format and content: PG vs PV rawCounts.csv: Raw read counts for each sample. Supplementary files format and content: PG vs PV normCounts.tab: Normalized read counts for each sample. PV WT3   Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols   strain:AB|tissue:follice|developmental stage:pre vitellogenin|genotype:WT GSM2640960 GSM2640960: PV WT3; Danio rerio; RNA Seq GSM2640960   1 Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM2640960 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP108050     PV_WT3_R1.fastq.gz PV_WT3_R2.fastq.gz fastq fastq 2965772270.0 14976621.0 GSM2640960 r1 0:99.03 1:98.99 A:759343389;C:716154246;G:713466520;T:775995980;N:812135 99 98     759343389 716154246 713466520 775995980 812135 SRX2858036 SRS2228760 SRA566530 GEO Genomics and Bioinformatics Core, Faculty of Health Sciences, University of Macau 2 0.95025 0.95484 0.02351 0.02292 0.74403 0.74566 0.48148 0.48254 100 98 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   China 2017-05-25 Undetermined Undetermined Gonad Reproductive System
42466 42466 SRR5605447 SRX2858035 SRS2228759 SRP108050 PRJNA388086 Transcriptomic Analysis for Differentially Expressed Genes in Ovarian Follicle Activation and Puberty Onset in the Zebrafish GSE99308 Transcriptome Analysis Puberty is a special transition period in sexual maturation and it has been extensively studied in vertebrates in the past decades. In mammals the initiation of puberty involves activation of numerous genes; however there have been few comprehensive reports in small model teleosts such as the zebrafish. In the zebrafish the onset of puberty in females is marked by the appearance of the first wave of pre vitellogenic PV follicles in the ovary during sexual maturation. Using transcriptomics and real time qPCR this study was undertaken to investigate temporal gene expression differences between the primary growth PG follicles and pre vitellogenic PV follicles with particular emphasis on oocyte and follicular cell specific genes as well as several closely associated signaling pathways. Our results showed that totally 1082 genes were significantly upregulated and 530 evidently downregulated during the PG PV transition and among them were some well recognized biomarkers such as cyp19a1a fshr inha and inhbaa and some novel genes like notch3 amh gadd45ga and lpl. Further gene ontology analysis showed that egg coat formation and steroid hormone mediated signaling pathway might be critical for follicle activation from PG to PV stage. In addition KEGG identified several signaling pathways that might play pivotal roles in early folliculogenesis including phosphatidylinositol signaling system glycolsaminoglycan biosynthesis RNA transport and p53 signaling pathways. Overall this study reported a comprehensive analysis for biomarker genes and potential pathways involved in PG PV transition or follicle activation which also marks female puberty onset in the zebrafish when occurring for the first time in sexual maturation. Overall design: Examination of gene expression patterns in 2 different stage follicles PG and PV follicles   pubmed:30364302   PV WT2 GSM2640959   source name:PV WT2|strain:AB|tissue:follicle|developmental stage:pre vitellogenin|genotype:WT PV WT2 Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Danio rerio genome version GRCz10 from Ensembl using Tophat2. Parameters: p 6 StringTie and prepDE.py Python script provided with StringTie tool was used to assemble the alignments into transcripts and extract the raw read counts for reference genomic features respectively. The read count matrix was processed by DeSeq2 package for differential gene expression analysis. Genome build: GRCz10 Ensembl build 84 Supplementary files format and content: PG vs PV rawCounts.csv: Raw read counts for each sample. Supplementary files format and content: PG vs PV normCounts.tab: Normalized read counts for each sample. PV WT2   Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols   strain:AB|tissue:follicle|developmental stage:pre vitellogenin|genotype:WT GSM2640959 GSM2640959: PV WT2; Danio rerio; RNA Seq GSM2640959   1 Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM2640959 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP108050     PV_WT2_R2.fastq.gz PV_WT2_R1.fastq.gz fastq fastq 2021387268.0 10195384.0 GSM2640959 r1 0:99.15 1:99.12 A:517788644;C:487363563;G:485168383;T:530550229;N:516449 99 99     517788644 487363563 485168383 530550229 516449 SRX2858035 SRS2228759 SRA566530 GEO Genomics and Bioinformatics Core, Faculty of Health Sciences, University of Macau 2 0.95112 0.95441 0.02399 0.02367 0.74221 0.74373 0.47995 0.47334 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   China 2017-05-25 Undetermined Undetermined Gonad Reproductive System
42467 42467 SRR5605446 SRX2858034 SRS2228758 SRP108050 PRJNA388086 Transcriptomic Analysis for Differentially Expressed Genes in Ovarian Follicle Activation and Puberty Onset in the Zebrafish GSE99308 Transcriptome Analysis Puberty is a special transition period in sexual maturation and it has been extensively studied in vertebrates in the past decades. In mammals the initiation of puberty involves activation of numerous genes; however there have been few comprehensive reports in small model teleosts such as the zebrafish. In the zebrafish the onset of puberty in females is marked by the appearance of the first wave of pre vitellogenic PV follicles in the ovary during sexual maturation. Using transcriptomics and real time qPCR this study was undertaken to investigate temporal gene expression differences between the primary growth PG follicles and pre vitellogenic PV follicles with particular emphasis on oocyte and follicular cell specific genes as well as several closely associated signaling pathways. Our results showed that totally 1082 genes were significantly upregulated and 530 evidently downregulated during the PG PV transition and among them were some well recognized biomarkers such as cyp19a1a fshr inha and inhbaa and some novel genes like notch3 amh gadd45ga and lpl. Further gene ontology analysis showed that egg coat formation and steroid hormone mediated signaling pathway might be critical for follicle activation from PG to PV stage. In addition KEGG identified several signaling pathways that might play pivotal roles in early folliculogenesis including phosphatidylinositol signaling system glycolsaminoglycan biosynthesis RNA transport and p53 signaling pathways. Overall this study reported a comprehensive analysis for biomarker genes and potential pathways involved in PG PV transition or follicle activation which also marks female puberty onset in the zebrafish when occurring for the first time in sexual maturation. Overall design: Examination of gene expression patterns in 2 different stage follicles PG and PV follicles   pubmed:30364302   PV WT1 GSM2640958   source name:PV WT1|strain:AB|tissue:follicle|developmental stage:pre vitellogenin|genotype:WT PV WT1 Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Danio rerio genome version GRCz10 from Ensembl using Tophat2. Parameters: p 6 StringTie and prepDE.py Python script provided with StringTie tool was used to assemble the alignments into transcripts and extract the raw read counts for reference genomic features respectively. The read count matrix was processed by DeSeq2 package for differential gene expression analysis. Genome build: GRCz10 Ensembl build 84 Supplementary files format and content: PG vs PV rawCounts.csv: Raw read counts for each sample. Supplementary files format and content: PG vs PV normCounts.tab: Normalized read counts for each sample. PV WT1   Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols   strain:AB|tissue:follicle|developmental stage:pre vitellogenin|genotype:WT GSM2640958 GSM2640958: PV WT1; Danio rerio; RNA Seq GSM2640958   1 Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM2640958 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP108050     PV_WT1_R1.fastq.gz PV_WT1_R2.fastq.gz fastq fastq 3244660111.0 16481925.0 GSM2640958 r1 0:98.44 1:98.42 A:831426044;C:781489498;G:779991004;T:848549246;N:3204319 98 98     831426044 781489498 779991004 848549246 3204319 SRX2858034 SRS2228758 SRA566530 GEO Genomics and Bioinformatics Core, Faculty of Health Sciences, University of Macau 2 0.94778 0.95185 0.02323 0.02295 0.7429 0.74385 0.48023 0.47809 95 95 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   China 2017-05-25 Undetermined Undetermined Gonad Reproductive System
42468 42468 SRR5605445 SRX2858033 SRS2228757 SRP108050 PRJNA388086 Transcriptomic Analysis for Differentially Expressed Genes in Ovarian Follicle Activation and Puberty Onset in the Zebrafish GSE99308 Transcriptome Analysis Puberty is a special transition period in sexual maturation and it has been extensively studied in vertebrates in the past decades. In mammals the initiation of puberty involves activation of numerous genes; however there have been few comprehensive reports in small model teleosts such as the zebrafish. In the zebrafish the onset of puberty in females is marked by the appearance of the first wave of pre vitellogenic PV follicles in the ovary during sexual maturation. Using transcriptomics and real time qPCR this study was undertaken to investigate temporal gene expression differences between the primary growth PG follicles and pre vitellogenic PV follicles with particular emphasis on oocyte and follicular cell specific genes as well as several closely associated signaling pathways. Our results showed that totally 1082 genes were significantly upregulated and 530 evidently downregulated during the PG PV transition and among them were some well recognized biomarkers such as cyp19a1a fshr inha and inhbaa and some novel genes like notch3 amh gadd45ga and lpl. Further gene ontology analysis showed that egg coat formation and steroid hormone mediated signaling pathway might be critical for follicle activation from PG to PV stage. In addition KEGG identified several signaling pathways that might play pivotal roles in early folliculogenesis including phosphatidylinositol signaling system glycolsaminoglycan biosynthesis RNA transport and p53 signaling pathways. Overall this study reported a comprehensive analysis for biomarker genes and potential pathways involved in PG PV transition or follicle activation which also marks female puberty onset in the zebrafish when occurring for the first time in sexual maturation. Overall design: Examination of gene expression patterns in 2 different stage follicles PG and PV follicles   pubmed:30364302   PG WT3 GSM2640957   source name:PG WT3|strain:AB|tissue:follicle|developmental stage:primary growth|genotype:WT PG WT3 Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Danio rerio genome version GRCz10 from Ensembl using Tophat2. Parameters: p 6 StringTie and prepDE.py Python script provided with StringTie tool was used to assemble the alignments into transcripts and extract the raw read counts for reference genomic features respectively. The read count matrix was processed by DeSeq2 package for differential gene expression analysis. Genome build: GRCz10 Ensembl build 84 Supplementary files format and content: PG vs PV rawCounts.csv: Raw read counts for each sample. Supplementary files format and content: PG vs PV normCounts.tab: Normalized read counts for each sample. PG WT3   Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols   strain:AB|tissue:follicle|developmental stage:primary growth|genotype:WT GSM2640957 GSM2640957: PG WT3; Danio rerio; RNA Seq GSM2640957   1 Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM2640957 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP108050     PG_WT3_R1.fastq.gz PG_WT3_R2.fastq.gz fastq fastq 1976825713.0 10028723.0 GSM2640957 r1 0:98.57 1:98.54 A:498115588;C:485653640;G:479542298;T:512706941;N:807246 98 98     498115588 485653640 479542298 512706941 807246 SRX2858033 SRS2228757 SRA566530 GEO Genomics and Bioinformatics Core, Faculty of Health Sciences, University of Macau 2 0.93604 0.93923 0.01349 0.01322 0.76921 0.77029 0.4746 0.4742 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   China 2017-05-25 Undetermined Undetermined Gonad Reproductive System
42469 42469 SRR5605444 SRX2858032 SRS2228756 SRP108050 PRJNA388086 Transcriptomic Analysis for Differentially Expressed Genes in Ovarian Follicle Activation and Puberty Onset in the Zebrafish GSE99308 Transcriptome Analysis Puberty is a special transition period in sexual maturation and it has been extensively studied in vertebrates in the past decades. In mammals the initiation of puberty involves activation of numerous genes; however there have been few comprehensive reports in small model teleosts such as the zebrafish. In the zebrafish the onset of puberty in females is marked by the appearance of the first wave of pre vitellogenic PV follicles in the ovary during sexual maturation. Using transcriptomics and real time qPCR this study was undertaken to investigate temporal gene expression differences between the primary growth PG follicles and pre vitellogenic PV follicles with particular emphasis on oocyte and follicular cell specific genes as well as several closely associated signaling pathways. Our results showed that totally 1082 genes were significantly upregulated and 530 evidently downregulated during the PG PV transition and among them were some well recognized biomarkers such as cyp19a1a fshr inha and inhbaa and some novel genes like notch3 amh gadd45ga and lpl. Further gene ontology analysis showed that egg coat formation and steroid hormone mediated signaling pathway might be critical for follicle activation from PG to PV stage. In addition KEGG identified several signaling pathways that might play pivotal roles in early folliculogenesis including phosphatidylinositol signaling system glycolsaminoglycan biosynthesis RNA transport and p53 signaling pathways. Overall this study reported a comprehensive analysis for biomarker genes and potential pathways involved in PG PV transition or follicle activation which also marks female puberty onset in the zebrafish when occurring for the first time in sexual maturation. Overall design: Examination of gene expression patterns in 2 different stage follicles PG and PV follicles   pubmed:30364302   PG WT2 GSM2640956   source name:PG WT2|strain:AB|tissue:follicle|developmental stage:primary growth|genotype:WT PG WT2 Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Danio rerio genome version GRCz10 from Ensembl using Tophat2. Parameters: p 6 StringTie and prepDE.py Python script provided with StringTie tool was used to assemble the alignments into transcripts and extract the raw read counts for reference genomic features respectively. The read count matrix was processed by DeSeq2 package for differential gene expression analysis. Genome build: GRCz10 Ensembl build 84 Supplementary files format and content: PG vs PV rawCounts.csv: Raw read counts for each sample. Supplementary files format and content: PG vs PV normCounts.tab: Normalized read counts for each sample. PG WT2   Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols   strain:AB|tissue:follicle|developmental stage:primary growth|genotype:WT GSM2640956 GSM2640956: PG WT2; Danio rerio; RNA Seq GSM2640956   1 Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM2640956 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP108050     PG_WT2_R1.fastq.gz PG_WT2_R2.fastq.gz fastq fastq 3961495355.0 20078542.0 GSM2640956 r1 0:98.66 1:98.64 A:1001026721;C:972147725;G:960699221;T:1026249480;N:1372208 98 98     1001026721 972147725 960699221 1026249480 1372208 SRX2858032 SRS2228756 SRA566530 GEO Genomics and Bioinformatics Core, Faculty of Health Sciences, University of Macau 2 0.93922 0.94298 0.01416 0.01405 0.77029 0.77106 0.46461 0.46358 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   China 2017-05-25 Undetermined Undetermined Gonad Reproductive System
42470 42470 SRR5605443 SRX2858031 SRS2228755 SRP108050 PRJNA388086 Transcriptomic Analysis for Differentially Expressed Genes in Ovarian Follicle Activation and Puberty Onset in the Zebrafish GSE99308 Transcriptome Analysis Puberty is a special transition period in sexual maturation and it has been extensively studied in vertebrates in the past decades. In mammals the initiation of puberty involves activation of numerous genes; however there have been few comprehensive reports in small model teleosts such as the zebrafish. In the zebrafish the onset of puberty in females is marked by the appearance of the first wave of pre vitellogenic PV follicles in the ovary during sexual maturation. Using transcriptomics and real time qPCR this study was undertaken to investigate temporal gene expression differences between the primary growth PG follicles and pre vitellogenic PV follicles with particular emphasis on oocyte and follicular cell specific genes as well as several closely associated signaling pathways. Our results showed that totally 1082 genes were significantly upregulated and 530 evidently downregulated during the PG PV transition and among them were some well recognized biomarkers such as cyp19a1a fshr inha and inhbaa and some novel genes like notch3 amh gadd45ga and lpl. Further gene ontology analysis showed that egg coat formation and steroid hormone mediated signaling pathway might be critical for follicle activation from PG to PV stage. In addition KEGG identified several signaling pathways that might play pivotal roles in early folliculogenesis including phosphatidylinositol signaling system glycolsaminoglycan biosynthesis RNA transport and p53 signaling pathways. Overall this study reported a comprehensive analysis for biomarker genes and potential pathways involved in PG PV transition or follicle activation which also marks female puberty onset in the zebrafish when occurring for the first time in sexual maturation. Overall design: Examination of gene expression patterns in 2 different stage follicles PG and PV follicles   pubmed:30364302   PG WT1 GSM2640955   source name:PG WT1|strain:AB|tissue:follicle|developmental stage:primary growth|genotype:WT PG WT1 Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Danio rerio genome version GRCz10 from Ensembl using Tophat2. Parameters: p 6 StringTie and prepDE.py Python script provided with StringTie tool was used to assemble the alignments into transcripts and extract the raw read counts for reference genomic features respectively. The read count matrix was processed by DeSeq2 package for differential gene expression analysis. Genome build: GRCz10 Ensembl build 84 Supplementary files format and content: PG vs PV rawCounts.csv: Raw read counts for each sample. Supplementary files format and content: PG vs PV normCounts.tab: Normalized read counts for each sample. PG WT1   Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols   strain:AB|tissue:follicle|developmental stage:primary growth|genotype:WT GSM2640955 GSM2640955: PG WT1; Danio rerio; RNA Seq GSM2640955   1 Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM2640955 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP108050     PG_WT1_R1.fastq.gz PG_WT1_R2.fastq.gz fastq fastq 5007411498.0 25368266.0 GSM2640955 r1 0:98.71 1:98.68 A:1264491896;C:1228178565;G:1216038846;T:1296988060;N:1714131 98 98     1264491896 1228178565 1216038846 1296988060 1714131 SRX2858031 SRS2228755 SRA566530 GEO Genomics and Bioinformatics Core, Faculty of Health Sciences, University of Macau 2 0.93858 0.94172 0.01418 0.01395 0.76871 0.76995 0.46608 0.46312 100 99 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   China 2017-05-25 Undetermined Undetermined Gonad Reproductive System
44967 44967 SRR6345660 SRX3442976 SRS2733636 SRP126106 PRJNA421016 Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] GSE107682 Transcriptome Analysis Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. parent bioproject:PRJNA315403 pubmed:30086300   smRNA seq library of ovary from tdrd6a mut fish GSM2875719   source name:Ovary from tdrd6a mut fish|tissue:whole ovary|genotype:tdrd6a mutant smRNA seq library of ovary from tdrd6a mut fish 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15  6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.    8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.  Supplementary files format and content: Files ending in .bw are bigwig tracks. Ovary from tdrd6a mut fish   RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation   tissue:whole ovary|genotype:tdrd6a mutant GSM2875719 GSM2875719: smRNA seq library of ovary from tdrd6a mut fish; Danio rerio; ncRNA Seq GSM2875719   1 RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation GEO Accession:GSM2875719 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP126106     Tdrd6a-mut-ovary-input-Adult.fastq.gz fastq 817885062.0 16036962.0 GSM2875719 r1 0:51 A:212456064;C:163491733;G:233627239;T:208262707;N:47319 51       212456064 163491733 233627239 208262707 47319 SRX3442976 SRS2733636 SRA636010 GEO Rene Ketting, RNA silencing, IMB 1 0.46308   0.13668   0.83587   0.79104   51   B   usable mapping rate illumina hiseq_era 5prime size_fractionation unknown sc_generic single_cell_generic generic-scrnaseq-only   Germany 2017-12-04 Undetermined Undetermined Gonad Reproductive System
44968 44968 SRR6345659 SRX3442975 SRS2733637 SRP126106 PRJNA421016 Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] GSE107682 Transcriptome Analysis Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. parent bioproject:PRJNA315403 pubmed:30086300   smRNA seq library of ovary from tdrd6a het fish GSM2875718   source name:Ovary from tdrd6a het fish|tissue:whole ovary|genotype:tdrd6a heterozygous smRNA seq library of ovary from tdrd6a het fish 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15  6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.    8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.  Supplementary files format and content: Files ending in .bw are bigwig tracks. Ovary from tdrd6a het fish   RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation   tissue:whole ovary|genotype:tdrd6a heterozygous GSM2875718 GSM2875718: smRNA seq library of ovary from tdrd6a het fish; Danio rerio; ncRNA Seq GSM2875718   1 RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation GEO Accession:GSM2875718 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP126106     Tdrd6a-het-ovary-input-Adult.fastq.gz fastq 1452353571.0 28477521.0 GSM2875718 r1 0:51 A:397993735;C:284194126;G:396142390;T:373939235;N:84085 51       397993735 284194126 396142390 373939235 84085 SRX3442975 SRS2733637 SRA636010 GEO Rene Ketting, RNA silencing, IMB 1 0.3869   0.1369   0.86397   0.77165   51   B   usable mapping rate illumina hiseq_era 5prime size_fractionation unknown sc_generic single_cell_generic generic-scrnaseq-only   Germany 2017-12-04 Undetermined Undetermined Gonad Reproductive System
47717 47717 SRR6841472 SRX3797301 SRS3049359 SRP135774 PRJNA438478 RNAseq of wild type zebrafish germline ovary oocyte testis GSE111882 Transcriptome Analysis Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each   pubmed:30190407;pubmed:34556579   testis rep2 GSM3043290   source name:whole wildtype zebrafish testis dissected from male|tissue:testis|genotype:wild type|strain:TLAB testis rep2 Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o <output directory> p 16  library type fr firststrand –no novel juncs –g 1 –G <Custom gene table> <Bowtie2 genome index> <fastq reads>”.  Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs whole wildtype zebrafish testis dissected from male   Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform. Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection. tissue:testis|genotype:wild type|strain:TLAB GSM3043290 GSM3043290: testis rep2; Danio rerio; RNA Seq GSM3043290   1 Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform. GEO Accession:GSM3043290 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP135774     zf_testis_2_5_F.fq.gz zf_testis_2_5_R.fq.gz fastq fastq 5099627816.0 33550183.0 GSM3043290 r1 0:76 1:76 A:1299059138;C:1244888565;G:1262375980;T:1289309350;N:3994783 76 76     1299059138 1244888565 1262375980 1289309350 3994783 SRX3797301 SRS3049359 SRA666799 GEO IMP 2 0.95446 0.95725 0.13178 0.13422 0.73578 0.74255 0.50147 0.50146 76 76 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Austria 2018-03-15 Undetermined Undetermined Gonad Reproductive System
47718 47718 SRR6841473 SRX3797301 SRS3049359 SRP135774 PRJNA438478 RNAseq of wild type zebrafish germline ovary oocyte testis GSE111882 Transcriptome Analysis Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each   pubmed:30190407;pubmed:34556579   testis rep2 GSM3043290   source name:whole wildtype zebrafish testis dissected from male|tissue:testis|genotype:wild type|strain:TLAB testis rep2 Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o <output directory> p 16  library type fr firststrand –no novel juncs –g 1 –G <Custom gene table> <Bowtie2 genome index> <fastq reads>”.  Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs whole wildtype zebrafish testis dissected from male   Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform. Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection. tissue:testis|genotype:wild type|strain:TLAB GSM3043290 GSM3043290: testis rep2; Danio rerio; RNA Seq GSM3043290   1 Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform. GEO Accession:GSM3043290 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP135774     zf_testis_2_6_R.fq.gz zf_testis_2_6_F.fq.gz fastq fastq 4863124784.0 31994242.0 GSM3043290 r2 0:76 1:76 A:1239366804;C:1186097287;G:1202405036;T:1232271257;N:2984400 76 76     1239366804 1186097287 1202405036 1232271257 2984400 SRX3797301 SRS3049359 SRA666799 GEO IMP 2 0.94462 0.95606 0.13046 0.13473 0.73551 0.74063 0.50501 0.50288 76 76 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Austria 2018-03-15 Undetermined Undetermined Gonad Reproductive System
47719 47719 SRR6841474 SRX3797301 SRS3049359 SRP135774 PRJNA438478 RNAseq of wild type zebrafish germline ovary oocyte testis GSE111882 Transcriptome Analysis Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each   pubmed:30190407;pubmed:34556579   testis rep2 GSM3043290   source name:whole wildtype zebrafish testis dissected from male|tissue:testis|genotype:wild type|strain:TLAB testis rep2 Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o <output directory> p 16  library type fr firststrand –no novel juncs –g 1 –G <Custom gene table> <Bowtie2 genome index> <fastq reads>”.  Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs whole wildtype zebrafish testis dissected from male   Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform. Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection. tissue:testis|genotype:wild type|strain:TLAB GSM3043290 GSM3043290: testis rep2; Danio rerio; RNA Seq GSM3043290   1 Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform. GEO Accession:GSM3043290 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP135774     zf_testis_2_7_F.fq.gz zf_testis_2_7_R.fq.gz fastq fastq 5026658088.0 33070119.0 GSM3043290 r3 0:76 1:76 A:1279542888;C:1226763768;G:1244243364;T:1271608208;N:4499860 76 76     1279542888 1226763768 1244243364 1271608208 4499860 SRX3797301 SRS3049359 SRA666799 GEO IMP 2 0.94351 0.95825 0.12954 0.1332 0.73645 0.7413 0.50092 0.49891 76 76 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Austria 2018-03-15 Undetermined Undetermined Gonad Reproductive System
47720 47720 SRR6841469 SRX3797300 SRS3049358 SRP135774 PRJNA438478 RNAseq of wild type zebrafish germline ovary oocyte testis GSE111882 Transcriptome Analysis Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each   pubmed:30190407;pubmed:34556579   testis rep1 GSM3043289   source name:whole wildtype zebrafish testis dissected from male|tissue:testis|genotype:wild type|strain:TLAB testis rep1 Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o <output directory> p 16  library type fr firststrand –no novel juncs –g 1 –G <Custom gene table> <Bowtie2 genome index> <fastq reads>”.  Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs whole wildtype zebrafish testis dissected from male   Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform. Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection. tissue:testis|genotype:wild type|strain:TLAB GSM3043289 GSM3043289: testis rep1; Danio rerio; RNA Seq GSM3043289   1 Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform. GEO Accession:GSM3043289 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP135774     zf_testis_1_5_F.fq.gz zf_testis_1_5_R.fq.gz fastq fastq 5828604008.0 38346079.0 GSM3043289 r1 0:76 1:76 A:1496363417;C:1405966872;G:1430979231;T:1490547871;N:4746617 76 76     1496363417 1405966872 1430979231 1490547871 4746617 SRX3797300 SRS3049358 SRA666799 GEO IMP 2 0.95085 0.95291 0.13996 0.1422 0.70873 0.71662 0.5006 0.50954 76 76 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Austria 2018-03-15 Undetermined Undetermined Gonad Reproductive System
47721 47721 SRR6841470 SRX3797300 SRS3049358 SRP135774 PRJNA438478 RNAseq of wild type zebrafish germline ovary oocyte testis GSE111882 Transcriptome Analysis Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each   pubmed:30190407;pubmed:34556579   testis rep1 GSM3043289   source name:whole wildtype zebrafish testis dissected from male|tissue:testis|genotype:wild type|strain:TLAB testis rep1 Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o <output directory> p 16  library type fr firststrand –no novel juncs –g 1 –G <Custom gene table> <Bowtie2 genome index> <fastq reads>”.  Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs whole wildtype zebrafish testis dissected from male   Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform. Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection. tissue:testis|genotype:wild type|strain:TLAB GSM3043289 GSM3043289: testis rep1; Danio rerio; RNA Seq GSM3043289   1 Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform. GEO Accession:GSM3043289 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP135774     zf_testis_1_6_F.fq.gz zf_testis_1_6_R.fq.gz fastq fastq 5548288344.0 36501897.0 GSM3043289 r2 0:76 1:76 A:1424701888;C:1337280760;G:1360693266;T:1422058469;N:3553961 76 76     1424701888 1337280760 1360693266 1422058469 3553961 SRX3797300 SRS3049358 SRA666799 GEO IMP 2 0.93973 0.95206 0.13904 0.14259 0.70999 0.7177 0.49362 0.50295 76 76 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Austria 2018-03-15 Undetermined Undetermined Gonad Reproductive System
47722 47722 SRR6841471 SRX3797300 SRS3049358 SRP135774 PRJNA438478 RNAseq of wild type zebrafish germline ovary oocyte testis GSE111882 Transcriptome Analysis Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each   pubmed:30190407;pubmed:34556579   testis rep1 GSM3043289   source name:whole wildtype zebrafish testis dissected from male|tissue:testis|genotype:wild type|strain:TLAB testis rep1 Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o <output directory> p 16  library type fr firststrand –no novel juncs –g 1 –G <Custom gene table> <Bowtie2 genome index> <fastq reads>”.  Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs whole wildtype zebrafish testis dissected from male   Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform. Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection. tissue:testis|genotype:wild type|strain:TLAB GSM3043289 GSM3043289: testis rep1; Danio rerio; RNA Seq GSM3043289   1 Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform. GEO Accession:GSM3043289 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP135774     zf_testis_1_7_F.fq.gz zf_testis_1_7_R.fq.gz fastq fastq 5685121784.0 37402117.0 GSM3043289 r3 0:76 1:76 A:1458152144;C:1370999956;G:1396053726;T:1454648231;N:5267727 76 76     1458152144 1370999956 1396053726 1454648231 5267727 SRX3797300 SRS3049358 SRA666799 GEO IMP 2 0.9388 0.95443 0.13734 0.14167 0.70759 0.71593 0.49681 0.50673 76 76 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Austria 2018-03-15 Undetermined Undetermined Gonad Reproductive System
47729 47729 SRR6841460 SRX3797297 SRS3049356 SRP135774 PRJNA438478 RNAseq of wild type zebrafish germline ovary oocyte testis GSE111882 Transcriptome Analysis Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each   pubmed:30190407;pubmed:34556579   ovary rep2 GSM3043286   source name:whole wildtype zebrafish ovary dissected from female|tissue:ovary|genotype:wild type|strain:TLAB ovary rep2 Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o <output directory> p 16  library type fr firststrand –no novel juncs –g 1 –G <Custom gene table> <Bowtie2 genome index> <fastq reads>”.  Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs whole wildtype zebrafish ovary dissected from female   Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform. Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection. tissue:ovary|genotype:wild type|strain:TLAB GSM3043286 GSM3043286: ovary rep2; Danio rerio; RNA Seq GSM3043286   1 Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform. GEO Accession:GSM3043286 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP135774     zf_ovary_2_5_R.fq.gz zf_ovary_2_5_F.fq.gz fastq fastq 5760370600.0 37897175.0 GSM3043286 r1 0:76 1:76 A:1438701176;C:1432115027;G:1438947886;T:1446014914;N:4591597 76 76     1438701176 1432115027 1438947886 1446014914 4591597 SRX3797297 SRS3049356 SRA666799 GEO IMP 2 0.93588 0.94232 0.0501 0.05082 0.79527 0.79955 0.49845 0.49442 76 76 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Austria 2018-03-15 Undetermined Undetermined Gonad Reproductive System
47730 47730 SRR6841461 SRX3797297 SRS3049356 SRP135774 PRJNA438478 RNAseq of wild type zebrafish germline ovary oocyte testis GSE111882 Transcriptome Analysis Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each   pubmed:30190407;pubmed:34556579   ovary rep2 GSM3043286   source name:whole wildtype zebrafish ovary dissected from female|tissue:ovary|genotype:wild type|strain:TLAB ovary rep2 Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o <output directory> p 16  library type fr firststrand –no novel juncs –g 1 –G <Custom gene table> <Bowtie2 genome index> <fastq reads>”.  Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs whole wildtype zebrafish ovary dissected from female   Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform. Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection. tissue:ovary|genotype:wild type|strain:TLAB GSM3043286 GSM3043286: ovary rep2; Danio rerio; RNA Seq GSM3043286   1 Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform. GEO Accession:GSM3043286 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP135774     zf_ovary_2_6_F.fq.gz zf_ovary_2_6_R.fq.gz fastq fastq 5494881168.0 36150534.0 GSM3043286 r2 0:76 1:76 A:1372809163;C:1365261188;G:1371912460;T:1381448918;N:3449439 76 76     1372809163 1365261188 1371912460 1381448918 3449439 SRX3797297 SRS3049356 SRA666799 GEO IMP 2 0.93073 0.94077 0.04966 0.05048 0.79774 0.80014 0.49517 0.49843 76 76 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Austria 2018-03-15 Undetermined Undetermined Gonad Reproductive System
47731 47731 SRR6841462 SRX3797297 SRS3049356 SRP135774 PRJNA438478 RNAseq of wild type zebrafish germline ovary oocyte testis GSE111882 Transcriptome Analysis Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each   pubmed:30190407;pubmed:34556579   ovary rep2 GSM3043286   source name:whole wildtype zebrafish ovary dissected from female|tissue:ovary|genotype:wild type|strain:TLAB ovary rep2 Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o <output directory> p 16  library type fr firststrand –no novel juncs –g 1 –G <Custom gene table> <Bowtie2 genome index> <fastq reads>”.  Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs whole wildtype zebrafish ovary dissected from female   Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform. Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection. tissue:ovary|genotype:wild type|strain:TLAB GSM3043286 GSM3043286: ovary rep2; Danio rerio; RNA Seq GSM3043286   1 Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform. GEO Accession:GSM3043286 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP135774     zf_ovary_2_7_F.fq.gz zf_ovary_2_7_R.fq.gz fastq fastq 5666410584.0 37279017.0 GSM3043286 r3 0:76 1:76 A:1414483905;C:1408220336;G:1415545424;T:1423029758;N:5131161 76 76     1414483905 1408220336 1415545424 1423029758 5131161 SRX3797297 SRS3049356 SRA666799 GEO IMP 2 0.9299 0.94287 0.04893 0.04939 0.7974 0.80135 0.49935 0.49202 76 76 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Austria 2018-03-15 Undetermined Undetermined Gonad Reproductive System
47732 47732 SRR6841457 SRX3797296 SRS3049354 SRP135774 PRJNA438478 RNAseq of wild type zebrafish germline ovary oocyte testis GSE111882 Transcriptome Analysis Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each   pubmed:30190407;pubmed:34556579   ovary rep1 GSM3043285   source name:whole wildtype zebrafish ovary dissected from female|tissue:ovary|genotype:wild type|strain:TLAB ovary rep1 Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o <output directory> p 16  library type fr firststrand –no novel juncs –g 1 –G <Custom gene table> <Bowtie2 genome index> <fastq reads>”.  Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs whole wildtype zebrafish ovary dissected from female   Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform. Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection. tissue:ovary|genotype:wild type|strain:TLAB GSM3043285 GSM3043285: ovary rep1; Danio rerio; RNA Seq GSM3043285   1 Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform. GEO Accession:GSM3043285 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP135774     zf_ovary_1_5_R.fq.gz zf_ovary_1_5_F.fq.gz fastq fastq 6093708728.0 40090189.0 GSM3043285 r1 0:76 1:76 A:1532089324;C:1504701252;G:1515053503;T:1536814286;N:5050363 76 76     1532089324 1504701252 1515053503 1536814286 5050363 SRX3797296 SRS3049354 SRA666799 GEO IMP 2 0.93785 0.9429 0.0338 0.03321 0.78628 0.7903 0.48856 0.47641 76 76 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Austria 2018-03-15 Undetermined Undetermined Gonad Reproductive System
47733 47733 SRR6841458 SRX3797296 SRS3049354 SRP135774 PRJNA438478 RNAseq of wild type zebrafish germline ovary oocyte testis GSE111882 Transcriptome Analysis Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each   pubmed:30190407;pubmed:34556579   ovary rep1 GSM3043285   source name:whole wildtype zebrafish ovary dissected from female|tissue:ovary|genotype:wild type|strain:TLAB ovary rep1 Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o <output directory> p 16  library type fr firststrand –no novel juncs –g 1 –G <Custom gene table> <Bowtie2 genome index> <fastq reads>”.  Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs whole wildtype zebrafish ovary dissected from female   Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform. Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection. tissue:ovary|genotype:wild type|strain:TLAB GSM3043285 GSM3043285: ovary rep1; Danio rerio; RNA Seq GSM3043285   1 Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform. GEO Accession:GSM3043285 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP135774     zf_ovary_1_6_R.fq.gz zf_ovary_1_6_F.fq.gz fastq fastq 5797092432.0 38138766.0 GSM3043285 r2 0:76 1:76 A:1457841031;C:1430894241;G:1440413370;T:1464148562;N:3795228 76 76     1457841031 1430894241 1440413370 1464148562 3795228 SRX3797296 SRS3049354 SRA666799 GEO IMP 2 0.93123 0.94187 0.03345 0.03344 0.78616 0.78991 0.48359 0.48306 76 76 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Austria 2018-03-15 Undetermined Undetermined Gonad Reproductive System
47734 47734 SRR6841459 SRX3797296 SRS3049354 SRP135774 PRJNA438478 RNAseq of wild type zebrafish germline ovary oocyte testis GSE111882 Transcriptome Analysis Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each   pubmed:30190407;pubmed:34556579   ovary rep1 GSM3043285   source name:whole wildtype zebrafish ovary dissected from female|tissue:ovary|genotype:wild type|strain:TLAB ovary rep1 Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o <output directory> p 16  library type fr firststrand –no novel juncs –g 1 –G <Custom gene table> <Bowtie2 genome index> <fastq reads>”.  Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs whole wildtype zebrafish ovary dissected from female   Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform. Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection. tissue:ovary|genotype:wild type|strain:TLAB GSM3043285 GSM3043285: ovary rep1; Danio rerio; RNA Seq GSM3043285   1 Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform. GEO Accession:GSM3043285 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP135774     zf_ovary_1_7_R.fq.gz zf_ovary_1_7_F.fq.gz fastq fastq 5924015928.0 38973789.0 GSM3043285 r3 0:76 1:76 A:1488452513;C:1462498287;G:1473066232;T:1494401585;N:5597311 76 76     1488452513 1462498287 1473066232 1494401585 5597311 SRX3797296 SRS3049354 SRA666799 GEO IMP 2 0.93218 0.94439 0.03341 0.03312 0.78715 0.79172 0.48512 0.48267 76 76 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Austria 2018-03-15 Undetermined Undetermined Gonad Reproductive System
52326 52326 SRR9119512 SRX5893495 SRS4815090 SRP199448 PRJNA544696 Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells GSE131759 Transcriptome Analysis MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr…   pubmed:31417497   IIIb 3 GSM3816534   source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb IIIb 3 LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample stage IIIb follicular cells   Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols   tissue:ovary|cell type:follicular cells|developmental stage:IIIb GSM3816534 GSM3816534: IIIb 3; Danio rerio; miRNA Seq GSM3816534   1 Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM3816534 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP199448     HI.2030.005.RPI10.IIIb_3_R1.fastq.gz fastq 1449340900.0 28986818.0 GSM3816534 r1 0:50 1:0 A:351029701;C:324452324;G:401722902;T:371889768;N:246205 50 0     351029701 324452324 401722902 371889768 246205 SRX5893495 SRS4815090 SRA890399 GEO Biology, YorkU 1 0.08662   0.01333   0.96213   0.83838   50   B   usable mapping rate illumina hiseq_era unknown size_fractionation unknown bulk unknown unknown   Canada 2019-05-24 Undetermined Undetermined Gonad Reproductive System
52327 52327 SRR9119513 SRX5893495 SRS4815090 SRP199448 PRJNA544696 Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells GSE131759 Transcriptome Analysis MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr…   pubmed:31417497   IIIb 3 GSM3816534   source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb IIIb 3 LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample stage IIIb follicular cells   Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols   tissue:ovary|cell type:follicular cells|developmental stage:IIIb GSM3816534 GSM3816534: IIIb 3; Danio rerio; miRNA Seq GSM3816534   1 Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM3816534 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP199448     HI.2030.006.RPI10.IIIb_3_R1.fastq fastq 1447621100.0 28952422.0 GSM3816534 r2 0:50 1:0 A:350650304;C:324162528;G:401055729;T:371582418;N:170121 50 0     350650304 324162528 401055729 371582418 170121 SRX5893495 SRS4815090 SRA890399 GEO Biology, YorkU 1 0.08676   0.01312   0.96282   0.84604   50   B   usable mapping rate illumina hiseq_era unknown size_fractionation unknown bulk unknown unknown   Canada 2019-05-24 Undetermined Undetermined Gonad Reproductive System
52328 52328 SRR9119510 SRX5893494 SRS4815089 SRP199448 PRJNA544696 Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells GSE131759 Transcriptome Analysis MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr…   pubmed:31417497   IIIb 2 GSM3816533   source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb IIIb 2 LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample stage IIIb follicular cells   Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols   tissue:ovary|cell type:follicular cells|developmental stage:IIIb GSM3816533 GSM3816533: IIIb 2; Danio rerio; miRNA Seq GSM3816533   1 Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM3816533 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP199448     HI.2030.005.RPI9.IIIb_2_R1.fastq.gz fastq 1012538750.0 20250775.0 GSM3816533 r1 0:50 1:0 A:242873339;C:228078637;G:287889366;T:253526026;N:171382 50 0     242873339 228078637 287889366 253526026 171382 SRX5893494 SRS4815089 SRA890399 GEO Biology, YorkU 1 0.04745   0.00802   0.968   0.75298   50   B   usable mapping rate illumina hiseq_era unknown size_fractionation unknown bulk unknown unknown   Canada 2019-05-24 Undetermined Undetermined Gonad Reproductive System
52329 52329 SRR9119511 SRX5893494 SRS4815089 SRP199448 PRJNA544696 Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells GSE131759 Transcriptome Analysis MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr…   pubmed:31417497   IIIb 2 GSM3816533   source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb IIIb 2 LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample stage IIIb follicular cells   Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols   tissue:ovary|cell type:follicular cells|developmental stage:IIIb GSM3816533 GSM3816533: IIIb 2; Danio rerio; miRNA Seq GSM3816533   1 Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM3816533 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP199448     HI.2030.006.RPI9.IIIb_2_R1.fastq fastq 1010559400.0 20211188.0 GSM3816533 r2 0:50 1:0 A:242471282;C:227664296;G:287157957;T:253147388;N:118477 50 0     242471282 227664296 287157957 253147388 118477 SRX5893494 SRS4815089 SRA890399 GEO Biology, YorkU 1 0.04679   0.008   0.96946   0.71268   50   B   usable mapping rate illumina hiseq_era unknown size_fractionation unknown bulk unknown unknown   Canada 2019-05-24 Undetermined Undetermined Gonad Reproductive System
52330 52330 SRR9119508 SRX5893493 SRS4815088 SRP199448 PRJNA544696 Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells GSE131759 Transcriptome Analysis MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr…   pubmed:31417497   IIIb 1 GSM3816532   source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb IIIb 1 LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample stage IIIb follicular cells   Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols   tissue:ovary|cell type:follicular cells|developmental stage:IIIb GSM3816532 GSM3816532: IIIb 1; Danio rerio; miRNA Seq GSM3816532   1 Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM3816532 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP199448     HI.2030.005.RPI8.IIIb_1_R1.fastq.gz fastq 1443846950.0 28876939.0 GSM3816532 r1 0:50 1:0 A:350805103;C:319766230;G:407583206;T:365448522;N:243889 50 0     350805103 319766230 407583206 365448522 243889 SRX5893493 SRS4815088 SRA890399 GEO Biology, YorkU 1 0.02559   0.00389   0.98407   0.82023   50   B   usable mapping rate illumina hiseq_era unknown size_fractionation unknown bulk unknown unknown   Canada 2019-05-24 Undetermined Undetermined Gonad Reproductive System
52331 52331 SRR9119509 SRX5893493 SRS4815088 SRP199448 PRJNA544696 Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells GSE131759 Transcriptome Analysis MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr…   pubmed:31417497   IIIb 1 GSM3816532   source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb IIIb 1 LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample stage IIIb follicular cells   Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols   tissue:ovary|cell type:follicular cells|developmental stage:IIIb GSM3816532 GSM3816532: IIIb 1; Danio rerio; miRNA Seq GSM3816532   1 Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM3816532 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP199448     HI.2030.006.RPI8.IIIb_1_R1.fastq fastq 1442694250.0 28853885.0 GSM3816532 r2 0:50 1:0 A:350607715;C:319569609;G:407049947;T:365297986;N:168993 50 0     350607715 319569609 407049947 365297986 168993 SRX5893493 SRS4815088 SRA890399 GEO Biology, YorkU 1 0.02565   0.00409   0.98417   0.81633   50   B   usable mapping rate illumina hiseq_era unknown size_fractionation unknown bulk unknown unknown   Canada 2019-05-24 Undetermined Undetermined Gonad Reproductive System
52332 52332 SRR9119506 SRX5893492 SRS4815087 SRP199448 PRJNA544696 Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells GSE131759 Transcriptome Analysis MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr…   pubmed:31417497   IIIa 3 GSM3816531   source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa IIIa 3 LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample stage IIIa follicular cells   Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols   tissue:ovary|cell type:follicular cells|developmental stage:IIIa GSM3816531 GSM3816531: IIIa 3; Danio rerio; miRNA Seq GSM3816531   1 Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM3816531 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP199448     HI.2030.005.RPI4.IIIa_3_R1.fastq.gz fastq 1324489100.0 26489782.0 GSM3816531 r1 0:50 1:0 A:333465386;C:289207984;G:364882545;T:336711699;N:221486 50 0     333465386 289207984 364882545 336711699 221486 SRX5893492 SRS4815087 SRA890399 GEO Biology, YorkU 1 0.02703   0.00432   0.98313   0.75385   50   B   usable mapping rate illumina hiseq_era unknown size_fractionation unknown bulk unknown unknown   Canada 2019-05-24 Undetermined Undetermined Gonad Reproductive System
52333 52333 SRR9119507 SRX5893492 SRS4815087 SRP199448 PRJNA544696 Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells GSE131759 Transcriptome Analysis MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr…   pubmed:31417497   IIIa 3 GSM3816531   source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa IIIa 3 LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample stage IIIa follicular cells   Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols   tissue:ovary|cell type:follicular cells|developmental stage:IIIa GSM3816531 GSM3816531: IIIa 3; Danio rerio; miRNA Seq GSM3816531   1 Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM3816531 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP199448     HI.2030.006.RPI4.IIIa_3_R1.fastq fastq 1322554650.0 26451093.0 GSM3816531 r2 0:50 1:0 A:333031673;C:288843797;G:364209143;T:336315522;N:154515 50 0     333031673 288843797 364209143 336315522 154515 SRX5893492 SRS4815087 SRA890399 GEO Biology, YorkU 1 0.02671   0.00422   0.98283   0.76748   50   B   usable mapping rate illumina hiseq_era unknown size_fractionation unknown bulk unknown unknown   Canada 2019-05-24 Undetermined Undetermined Gonad Reproductive System
52334 52334 SRR9119504 SRX5893491 SRS4815086 SRP199448 PRJNA544696 Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells GSE131759 Transcriptome Analysis MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr…   pubmed:31417497   IIIa 2 GSM3816530   source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa IIIa 2 LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample stage IIIa follicular cells   Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols   tissue:ovary|cell type:follicular cells|developmental stage:IIIa GSM3816530 GSM3816530: IIIa 2; Danio rerio; miRNA Seq GSM3816530   1 Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM3816530 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP199448     HI.2030.005.RPI3.IIIa_2_R1.fastq.gz fastq 1382308600.0 27646172.0 GSM3816530 r1 0:50 1:0 A:342206537;C:301597185;G:385756857;T:352517232;N:230789 50 0     342206537 301597185 385756857 352517232 230789 SRX5893491 SRS4815086 SRA890399 GEO Biology, YorkU 1 0.05315   0.00892   0.9643   0.79967   50   B   usable mapping rate illumina hiseq_era unknown size_fractionation unknown bulk unknown unknown   Canada 2019-05-24 Undetermined Undetermined Gonad Reproductive System
52335 52335 SRR9119505 SRX5893491 SRS4815086 SRP199448 PRJNA544696 Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells GSE131759 Transcriptome Analysis MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr…   pubmed:31417497   IIIa 2 GSM3816530   source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa IIIa 2 LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample stage IIIa follicular cells   Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols   tissue:ovary|cell type:follicular cells|developmental stage:IIIa GSM3816530 GSM3816530: IIIa 2; Danio rerio; miRNA Seq GSM3816530   1 Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM3816530 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP199448     HI.2030.006.RPI3.IIIa_2_R1.fastq fastq 1383050750.0 27661015.0 GSM3816530 r2 0:50 1:0 A:342441286;C:301828080;G:385820344;T:352800933;N:160107 50 0     342441286 301828080 385820344 352800933 160107 SRX5893491 SRS4815086 SRA890399 GEO Biology, YorkU 1 0.0533   0.00892   0.96323   0.81292   50   B   usable mapping rate illumina hiseq_era unknown size_fractionation unknown bulk unknown unknown   Canada 2019-05-24 Undetermined Undetermined Gonad Reproductive System
52336 52336 SRR9119502 SRX5893490 SRS4815085 SRP199448 PRJNA544696 Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells GSE131759 Transcriptome Analysis MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr…   pubmed:31417497   IIIa 1 GSM3816529   source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa IIIa 1 LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample stage IIIa follicular cells   Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols   tissue:ovary|cell type:follicular cells|developmental stage:IIIa GSM3816529 GSM3816529: IIIa 1; Danio rerio; miRNA Seq GSM3816529   1 Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM3816529 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP199448     HI.2030.005.RPI2.IIIa_1_R1.fastq.gz fastq 1333818450.0 26676369.0 GSM3816529 r1 0:50 1:0 A:320039883;C:296663387;G:380656068;T:336233800;N:225312 50 0     320039883 296663387 380656068 336233800 225312 SRX5893490 SRS4815085 SRA890399 GEO Biology, YorkU 1 0.0976   0.019   0.93718   0.75404   50   B   usable mapping rate illumina hiseq_era unknown size_fractionation unknown bulk unknown unknown   Canada 2019-05-24 Undetermined Undetermined Gonad Reproductive System
52337 52337 SRR9119503 SRX5893490 SRS4815085 SRP199448 PRJNA544696 Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells GSE131759 Transcriptome Analysis MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr…   pubmed:31417497   IIIa 1 GSM3816529   source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa IIIa 1 LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample stage IIIa follicular cells   Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols   tissue:ovary|cell type:follicular cells|developmental stage:IIIa GSM3816529 GSM3816529: IIIa 1; Danio rerio; miRNA Seq GSM3816529   1 Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM3816529 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP199448     HI.2030.006.RPI2.IIIa_1_R1.fastq fastq 1334152750.0 26683055.0 GSM3816529 r2 0:50 1:0 A:320194547;C:296827909;G:380547854;T:336424243;N:158197 50 0     320194547 296827909 380547854 336424243 158197 SRX5893490 SRS4815085 SRA890399 GEO Biology, YorkU 1 0.09727   0.01947   0.93866   0.76527   50   B   usable mapping rate illumina hiseq_era unknown size_fractionation unknown bulk unknown unknown   Canada 2019-05-24 Undetermined Undetermined Gonad Reproductive System
61505 61505 SRR12786081 SRX9255339 SRS7487541 SRP286633 PRJNA667863 Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs GSE159162 Transcriptome Analysis Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.   pubmed:35532311   Sample WT FG 4 GSM4820795   source name:follicles|tissue:Ovary|stage of follicles:FG|genotype:wild type Sample WT FG 4 Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample follicles   Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.   tissue:Ovary|stage of follicles:FG|genotype:wild type GSM4820795 GSM4820795: Sample WT FG 4; Danio rerio; RNA Seq GSM4820795   1 Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions. GEO Accession:GSM4820795 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA HiSeq X Ten   SRP286633     Sample_WT_FG_4.R1.fq.gz Sample_WT_FG_4.R2.fq.gz fastq fastq 6494839649.0 22379034.0 GSM4820795 r1 0:145.94 1:144.28 A:1649345658;C:1579352648;G:1580948162;T:1685086821;N:106360 145 144     1649345658 1579352648 1580948162 1685086821 106360 SRX9255339 SRS7487541 SRA1139682 GEO Institute of Hydrobiology 2 0.94646 0.94736 0.01915 0.01888 0.75554 0.75566 0.50735 0.50347 150 150 B B biological fallback assumption illumina hiseq_era unknown small_rna trueseq bulk unknown unknown   China 2020-10-07 Undetermined Undetermined Gonad Reproductive System
61506 61506 SRR12786080 SRX9255338 SRS7487540 SRP286633 PRJNA667863 Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs GSE159162 Transcriptome Analysis Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.   pubmed:35532311   Sample WT FG 3 GSM4820794   source name:follicles|tissue:Ovary|stage of follicles:FG|genotype:wild type Sample WT FG 3 Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample follicles   Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.   tissue:Ovary|stage of follicles:FG|genotype:wild type GSM4820794 GSM4820794: Sample WT FG 3; Danio rerio; RNA Seq GSM4820794   1 Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions. GEO Accession:GSM4820794 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA HiSeq X Ten   SRP286633     Sample_WT_FG_3.R1.fq.gz Sample_WT_FG_3.R2.fq.gz fastq fastq 6925670591.0 23930393.0 GSM4820794 r1 0:145.51 1:143.90 A:1758516170;C:1686214780;G:1687326968;T:1793466364;N:146309 145 143     1758516170 1686214780 1687326968 1793466364 146309 SRX9255338 SRS7487540 SRA1139682 GEO Institute of Hydrobiology 2 0.94987 0.95208 0.01972 0.01986 0.75779 0.75891 0.49235 0.49103 150 150 B B biological fallback assumption illumina hiseq_era unknown small_rna trueseq bulk unknown unknown   China 2020-10-07 Undetermined Undetermined Gonad Reproductive System
61507 61507 SRR12786079 SRX9255337 SRS7487539 SRP286633 PRJNA667863 Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs GSE159162 Transcriptome Analysis Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.   pubmed:35532311   Sample WT FG 2 GSM4820793   source name:follicles|tissue:Ovary|stage of follicles:FG|genotype:wild type Sample WT FG 2 Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample follicles   Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.   tissue:Ovary|stage of follicles:FG|genotype:wild type GSM4820793 GSM4820793: Sample WT FG 2; Danio rerio; RNA Seq GSM4820793   1 Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions. GEO Accession:GSM4820793 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA HiSeq X Ten   SRP286633     Sample_WT_FG_2.R1.fq.gz Sample_WT_FG_2.R2.fq.gz fastq fastq 6937720341.0 23868543.0 GSM4820793 r1 0:146.23 1:144.43 A:1760323867;C:1687409068;G:1688288208;T:1801543463;N:155735 146 144     1760323867 1687409068 1688288208 1801543463 155735 SRX9255337 SRS7487539 SRA1139682 GEO Institute of Hydrobiology 2 0.94558 0.94771 0.01901 0.01877 0.75915 0.75893 0.49355 0.49438 86 86 B B biological fallback assumption illumina hiseq_era unknown small_rna trueseq bulk unknown unknown   China 2020-10-07 Undetermined Undetermined Gonad Reproductive System
61508 61508 SRR12786078 SRX9255336 SRS7487538 SRP286633 PRJNA667863 Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs GSE159162 Transcriptome Analysis Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.   pubmed:35532311   Sample WT FG 1 GSM4820792   source name:follicles|tissue:Ovary|stage of follicles:FG|genotype:wild type Sample WT FG 1 Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample follicles   Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.   tissue:Ovary|stage of follicles:FG|genotype:wild type GSM4820792 GSM4820792: Sample WT FG 1; Danio rerio; RNA Seq GSM4820792   1 Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions. GEO Accession:GSM4820792 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA HiSeq X Ten   SRP286633     Sample_WT_FG_1.R1.fq.gz Sample_WT_FG_1.R2.fq.gz fastq fastq 6967269048.0 23937357.0 GSM4820792 r1 0:146.29 1:144.78 A:1778908738;C:1684335965;G:1686285595;T:1817522579;N:216171 146 144     1778908738 1684335965 1686285595 1817522579 216171 SRX9255336 SRS7487538 SRA1139682 GEO Institute of Hydrobiology 2 0.9478 0.94904 0.0209 0.02072 0.75653 0.75716 0.48347 0.48235 150 150 B B biological fallback assumption illumina hiseq_era unknown small_rna trueseq bulk unknown unknown   China 2020-10-07 Undetermined Undetermined Gonad Reproductive System
61509 61509 SRR12786077 SRX9255335 SRS7487537 SRP286633 PRJNA667863 Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs GSE159162 Transcriptome Analysis Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.   pubmed:35532311   Sample WT EGG 5 GSM4820791   source name:follicles|tissue:Ovary|stage of follicles:mature egg|genotype:wild type Sample WT EGG 5 Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample follicles   Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.   tissue:Ovary|stage of follicles:mature egg|genotype:wild type GSM4820791 GSM4820791: Sample WT EGG 5; Danio rerio; RNA Seq GSM4820791   1 Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions. GEO Accession:GSM4820791 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA HiSeq X Ten   SRP286633     Sample_WT_EGG_5.R1.fq.gz Sample_WT_EGG_5.R2.fq.gz fastq fastq 6759669369.0 23484870.0 GSM4820791 r1 0:144.70 1:143.13 A:1779446270;C:1589997978;G:1589479961;T:1800569943;N:175217 144 143     1779446270 1589997978 1589479961 1800569943 175217 SRX9255335 SRS7487537 SRA1139682 GEO Institute of Hydrobiology 2 0.93866 0.94281 0.02922 0.02836 0.81203 0.81211 0.50024 0.50364 150 150 B B biological fallback assumption illumina hiseq_era unknown small_rna trueseq bulk unknown unknown   China 2020-10-07 Undetermined Undetermined Gonad Reproductive System
61510 61510 SRR12786076 SRX9255334 SRS7487536 SRP286633 PRJNA667863 Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs GSE159162 Transcriptome Analysis Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.   pubmed:35532311   Sample WT EGG 4 GSM4820790   source name:follicles|tissue:Ovary|stage of follicles:mature egg|genotype:wild type Sample WT EGG 4 Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample follicles   Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.   tissue:Ovary|stage of follicles:mature egg|genotype:wild type GSM4820790 GSM4820790: Sample WT EGG 4; Danio rerio; RNA Seq GSM4820790   1 Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions. GEO Accession:GSM4820790 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA HiSeq X Ten   SRP286633     Sample_WT_EGG_4.R1.fq.gz Sample_WT_EGG_4.R2.fq.gz fastq fastq 6507516169.0 22482048.0 GSM4820790 r1 0:145.79 1:143.66 A:1716909756;C:1525253185;G:1525859003;T:1739392348;N:101877 145 143     1716909756 1525253185 1525859003 1739392348 101877 SRX9255334 SRS7487536 SRA1139682 GEO Institute of Hydrobiology 2 0.93927 0.94219 0.02868 0.02773 0.81225 0.81268 0.51042 0.50948 150 150 B B biological fallback assumption illumina hiseq_era unknown small_rna trueseq bulk unknown unknown   China 2020-10-07 Undetermined Undetermined Gonad Reproductive System
61511 61511 SRR12786075 SRX9255333 SRS7487535 SRP286633 PRJNA667863 Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs GSE159162 Transcriptome Analysis Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.   pubmed:35532311   Sample WT EGG 3 GSM4820789   source name:follicles|tissue:Ovary|stage of follicles:mature egg|genotype:wild type Sample WT EGG 3 Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample follicles   Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.   tissue:Ovary|stage of follicles:mature egg|genotype:wild type GSM4820789 GSM4820789: Sample WT EGG 3; Danio rerio; RNA Seq GSM4820789   1 Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions. GEO Accession:GSM4820789 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA HiSeq X Ten   SRP286633     Sample_WT_EGG_3.R1.fq.gz Sample_WT_EGG_3.R2.fq.gz fastq fastq 6892017136.0 23794526.0 GSM4820789 r1 0:145.73 1:143.92 A:1860381019;C:1583189044;G:1576215039;T:1872104069;N:127965 145 143     1860381019 1583189044 1576215039 1872104069 127965 SRX9255333 SRS7487535 SRA1139682 GEO Institute of Hydrobiology 2 0.93308 0.93454 0.03385 0.0331 0.82836 0.82862 0.51253 0.52212 150 150 B B biological fallback assumption illumina hiseq_era unknown small_rna trueseq bulk unknown unknown   China 2020-10-07 Undetermined Undetermined Gonad Reproductive System
61512 61512 SRR12786074 SRX9255332 SRS7487534 SRP286633 PRJNA667863 Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs GSE159162 Transcriptome Analysis Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.   pubmed:35532311   Sample WT EGG 2 GSM4820788   source name:follicles|tissue:Ovary|stage of follicles:mature egg|genotype:wild type Sample WT EGG 2 Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample follicles   Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.   tissue:Ovary|stage of follicles:mature egg|genotype:wild type GSM4820788 GSM4820788: Sample WT EGG 2; Danio rerio; RNA Seq GSM4820788   1 Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions. GEO Accession:GSM4820788 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA HiSeq X Ten   SRP286633     Sample_WT_EGG_2.R1.fq.gz Sample_WT_EGG_2.R2.fq.gz fastq fastq 5738534730.0 20501677.0 GSM4820788 r1 0:140.71 1:139.19 A:1521303459;C:1341529264;G:1344606059;T:1531008879;N:87069 140 139     1521303459 1341529264 1344606059 1531008879 87069 SRX9255332 SRS7487534 SRA1139682 GEO Institute of Hydrobiology 2 0.93514 0.93628 0.03038 0.02998 0.82471 0.82477 0.51484 0.52018 78 80 B B biological fallback assumption illumina hiseq_era unknown small_rna trueseq bulk unknown unknown   China 2020-10-07 Undetermined Undetermined Gonad Reproductive System
61513 61513 SRR12786073 SRX9255331 SRS7487533 SRP286633 PRJNA667863 Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs GSE159162 Transcriptome Analysis Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.   pubmed:35532311   Sample WT EGG 1 GSM4820787   source name:follicles|tissue:Ovary|stage of follicles:mature egg|genotype:wild type Sample WT EGG 1 Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample follicles   Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.   tissue:Ovary|stage of follicles:mature egg|genotype:wild type GSM4820787 GSM4820787: Sample WT EGG 1; Danio rerio; RNA Seq GSM4820787   1 Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions. GEO Accession:GSM4820787 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA HiSeq X Ten   SRP286633     Sample_WT_EGG_1.R1.fq.gz Sample_WT_EGG_1.R2.fq.gz fastq fastq 6682134875.0 23188787.0 GSM4820787 r1 0:144.80 1:143.37 A:1781938550;C:1551592731;G:1553675983;T:1794734663;N:192948 144 143     1781938550 1551592731 1553675983 1794734663 192948 SRX9255331 SRS7487533 SRA1139682 GEO Institute of Hydrobiology 2 0.93706 0.94148 0.03062 0.03007 0.82367 0.82292 0.51212 0.5208 150 103 B B biological fallback assumption illumina hiseq_era unknown small_rna trueseq bulk unknown unknown   China 2020-10-07 Undetermined Undetermined Gonad Reproductive System
61514 61514 SRR12786072 SRX9255330 SRS7487532 SRP286633 PRJNA667863 Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs GSE159162 Transcriptome Analysis Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.   pubmed:35532311   Sample KO FG 4 GSM4820786   source name:follicles|tissue:Ovary|stage of follicles:FG|genotype:sinhcaf / Sample KO FG 4 Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample follicles   Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.   tissue:Ovary|stage of follicles:FG|genotype:sinhcaf / GSM4820786 GSM4820786: Sample KO FG 4; Danio rerio; RNA Seq GSM4820786   1 Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions. GEO Accession:GSM4820786 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA HiSeq X Ten   SRP286633     Sample_KO_FG_4.R1.fq.gz Sample_KO_FG_4.R2.fq.gz fastq fastq 6990246097.0 24053336.0 GSM4820786 r1 0:146.17 1:144.44 A:1772105090;C:1700647750;G:1704170604;T:1813260899;N:61754 146 144     1772105090 1700647750 1704170604 1813260899 61754 SRX9255330 SRS7487532 SRA1139682 GEO Institute of Hydrobiology 2 0.93867 0.93848 0.02008 0.02034 0.75442 0.75455 0.48931 0.48777 122 149 B B biological fallback assumption illumina hiseq_era unknown small_rna trueseq bulk unknown unknown   China 2020-10-07 Undetermined Undetermined Gonad Reproductive System
61515 61515 SRR12786071 SRX9255329 SRS7487531 SRP286633 PRJNA667863 Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs GSE159162 Transcriptome Analysis Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.   pubmed:35532311   Sample KO FG 3 GSM4820785   source name:follicles|tissue:Ovary|stage of follicles:FG|genotype:sinhcaf / Sample KO FG 3 Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample follicles   Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.   tissue:Ovary|stage of follicles:FG|genotype:sinhcaf / GSM4820785 GSM4820785: Sample KO FG 3; Danio rerio; RNA Seq GSM4820785   1 Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions. GEO Accession:GSM4820785 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA HiSeq X Ten   SRP286633     Sample_KO_FG_3.R1.fq.gz Sample_KO_FG_3.R2.fq.gz fastq fastq 6981297857.0 24046800.0 GSM4820785 r1 0:146.06 1:144.26 A:1766235294;C:1704937924;G:1705984881;T:1804072922;N:66836 146 144     1766235294 1704937924 1705984881 1804072922 66836 SRX9255329 SRS7487531 SRA1139682 GEO Institute of Hydrobiology 2 0.94371 0.94296 0.018 0.01802 0.75619 0.75633 0.48476 0.48292 150 150 B B biological fallback assumption illumina hiseq_era unknown small_rna trueseq bulk unknown unknown   China 2020-10-07 Undetermined Undetermined Gonad Reproductive System
61516 61516 SRR12786070 SRX9255328 SRS7487530 SRP286633 PRJNA667863 Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs GSE159162 Transcriptome Analysis Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.   pubmed:35532311   Sample KO FG 2 GSM4820784   source name:follicles|tissue:Ovary|stage of follicles:FG|genotype:sinhcaf / Sample KO FG 2 Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample follicles   Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.   tissue:Ovary|stage of follicles:FG|genotype:sinhcaf / GSM4820784 GSM4820784: Sample KO FG 2; Danio rerio; RNA Seq GSM4820784   1 Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions. GEO Accession:GSM4820784 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA HiSeq X Ten   SRP286633     Sample_KO_FG_2.R1.fq.gz Sample_KO_FG_2.R2.fq.gz fastq fastq 6930598112.0 23990854.0 GSM4820784 r1 0:145.36 1:143.52 A:1744825506;C:1697507117;G:1702166327;T:1786036969;N:62193 145 143     1744825506 1697507117 1702166327 1786036969 62193 SRX9255328 SRS7487530 SRA1139682 GEO Institute of Hydrobiology 2 0.93904 0.93857 0.02076 0.02088 0.74673 0.74811 0.48497 0.48206 150 71 B B biological fallback assumption illumina hiseq_era unknown small_rna trueseq bulk unknown unknown   China 2020-10-07 Undetermined Undetermined Gonad Reproductive System
61517 61517 SRR12786069 SRX9255327 SRS7487529 SRP286633 PRJNA667863 Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs GSE159162 Transcriptome Analysis Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.   pubmed:35532311   Sample KO FG 1 GSM4820783   source name:follicles|tissue:Ovary|stage of follicles:FG|genotype:sinhcaf / Sample KO FG 1 Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample follicles   Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.   tissue:Ovary|stage of follicles:FG|genotype:sinhcaf / GSM4820783 GSM4820783: Sample KO FG 1; Danio rerio; RNA Seq GSM4820783   1 Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions. GEO Accession:GSM4820783 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA HiSeq X Ten   SRP286633     Sample_KO_FG_1.R1.fq.gz Sample_KO_FG_1.R2.fq.gz fastq fastq 6974706218.0 24022505.0 GSM4820783 r1 0:146.20 1:144.14 A:1764113248;C:1700352581;G:1706722769;T:1803435223;N:82397 146 144     1764113248 1700352581 1706722769 1803435223 82397 SRX9255327 SRS7487529 SRA1139682 GEO Institute of Hydrobiology 2 0.94176 0.94125 0.01946 0.01953 0.75712 0.75812 0.47734 0.47441 91 97 B B biological fallback assumption illumina hiseq_era unknown small_rna trueseq bulk unknown unknown   China 2020-10-07 Undetermined Undetermined Gonad Reproductive System
61518 61518 SRR12786068 SRX9255326 SRS7487528 SRP286633 PRJNA667863 Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs GSE159162 Transcriptome Analysis Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.   pubmed:35532311   Sample KO EGG 5 GSM4820782   source name:follicles|tissue:Ovary|stage of follicles:mature egg|genotype:sinhcaf / Sample KO EGG 5 Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample follicles   Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.   tissue:Ovary|stage of follicles:mature egg|genotype:sinhcaf / GSM4820782 GSM4820782: Sample KO EGG 5; Danio rerio; RNA Seq GSM4820782   1 Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions. GEO Accession:GSM4820782 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA HiSeq X Ten   SRP286633     Sample_KO_EGG_5.R1.fq.gz Sample_KO_EGG_5.R2.fq.gz fastq fastq 6749303222.0 23750320.0 GSM4820782 r1 0:142.69 1:141.49 A:1797588338;C:1567936329;G:1570091501;T:1813621345;N:65709 142 141     1797588338 1567936329 1570091501 1813621345 65709 SRX9255326 SRS7487528 SRA1139682 GEO Institute of Hydrobiology 2 0.93455 0.9383 0.03024 0.02992 0.80511 0.80509 0.50954 0.49961 122 106 B B biological fallback assumption illumina hiseq_era unknown small_rna trueseq bulk unknown unknown   China 2020-10-07 Undetermined Undetermined Gonad Reproductive System
61519 61519 SRR12786067 SRX9255325 SRS7487527 SRP286633 PRJNA667863 Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs GSE159162 Transcriptome Analysis Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.   pubmed:35532311   Sample KO EGG 4 GSM4820781   source name:follicles|tissue:Ovary|stage of follicles:mature egg|genotype:sinhcaf / Sample KO EGG 4 Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample follicles   Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.   tissue:Ovary|stage of follicles:mature egg|genotype:sinhcaf / GSM4820781 GSM4820781: Sample KO EGG 4; Danio rerio; RNA Seq GSM4820781   1 Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions. GEO Accession:GSM4820781 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA HiSeq X Ten   SRP286633     Sample_KO_EGG_4.R1.fq.gz Sample_KO_EGG_4.R2.fq.gz fastq fastq 6739134452.0 23846811.0 GSM4820781 r1 0:141.87 1:140.73 A:1818980107;C:1542920452;G:1542064995;T:1835112669;N:56229 141 140     1818980107 1542920452 1542064995 1835112669 56229 SRX9255325 SRS7487527 SRA1139682 GEO Institute of Hydrobiology 2 0.93417 0.93848 0.03165 0.03163 0.80251 0.80265 0.52912 0.52756 80 80 B B biological fallback assumption illumina hiseq_era unknown small_rna trueseq bulk unknown unknown   China 2020-10-07 Undetermined Undetermined Gonad Reproductive System
61520 61520 SRR12786066 SRX9255324 SRS7487526 SRP286633 PRJNA667863 Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs GSE159162 Transcriptome Analysis Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.   pubmed:35532311   Sample KO EGG 3 GSM4820780   source name:follicles|tissue:Ovary|stage of follicles:mature egg|genotype:sinhcaf / Sample KO EGG 3 Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample follicles   Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.   tissue:Ovary|stage of follicles:mature egg|genotype:sinhcaf / GSM4820780 GSM4820780: Sample KO EGG 3; Danio rerio; RNA Seq GSM4820780   1 Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions. GEO Accession:GSM4820780 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA HiSeq X Ten   SRP286633     Sample_KO_EGG_3.R1.fq.gz Sample_KO_EGG_3.R2.fq.gz fastq fastq 6722654601.0 23651433.0 GSM4820780 r1 0:142.85 1:141.39 A:1779610219;C:1575265248;G:1573997469;T:1793726817;N:54848 142 141     1779610219 1575265248 1573997469 1793726817 54848 SRX9255324 SRS7487526 SRA1139682 GEO Institute of Hydrobiology 2 0.93308 0.93506 0.02946 0.02904 0.82493 0.82515 0.50828 0.51094 117 141 B B biological fallback assumption illumina hiseq_era unknown small_rna trueseq bulk unknown unknown   China 2020-10-07 Undetermined Undetermined Gonad Reproductive System
61521 61521 SRR12786065 SRX9255323 SRS7487525 SRP286633 PRJNA667863 Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs GSE159162 Transcriptome Analysis Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.   pubmed:35532311   Sample KO EGG 2 GSM4820779   source name:follicles|tissue:Ovary|stage of follicles:mature egg|genotype:sinhcaf / Sample KO EGG 2 Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample follicles   Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.   tissue:Ovary|stage of follicles:mature egg|genotype:sinhcaf / GSM4820779 GSM4820779: Sample KO EGG 2; Danio rerio; RNA Seq GSM4820779   1 Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions. GEO Accession:GSM4820779 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA HiSeq X Ten   SRP286633     Sample_KO_EGG_2.R1.fq.gz Sample_KO_EGG_2.R2.fq.gz fastq fastq 6869785304.0 23728899.0 GSM4820779 r1 0:145.46 1:144.05 A:1833413652;C:1591958740;G:1590596059;T:1853754341;N:62512 145 144     1833413652 1591958740 1590596059 1853754341 62512 SRX9255323 SRS7487525 SRA1139682 GEO Institute of Hydrobiology 2 0.94163 0.9464 0.03014 0.02973 0.81495 0.81436 0.53096 0.53487 122 150 B B biological fallback assumption illumina hiseq_era unknown small_rna trueseq bulk unknown unknown   China 2020-10-07 Undetermined Undetermined Gonad Reproductive System
61522 61522 SRR12786064 SRX9255322 SRS7487524 SRP286633 PRJNA667863 Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs GSE159162 Transcriptome Analysis Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.   pubmed:35532311   Sample KO EGG 1 GSM4820778   source name:follicles|tissue:Ovary|stage of follicles:mature egg|genotype:sinhcaf / Sample KO EGG 1 Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample follicles   Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.   tissue:Ovary|stage of follicles:mature egg|genotype:sinhcaf / GSM4820778 GSM4820778: Sample KO EGG 1; Danio rerio; RNA Seq GSM4820778   1 Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions. GEO Accession:GSM4820778 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA HiSeq X Ten   SRP286633     Sample_KO_EGG_1.R1.fq.gz Sample_KO_EGG_1.R2.fq.gz fastq fastq 6912723848.0 23914158.0 GSM4820778 r1 0:145.64 1:143.42 A:1856194412;C:1592279992;G:1587734358;T:1876445540;N:69546 145 143     1856194412 1592279992 1587734358 1876445540 69546 SRX9255322 SRS7487524 SRA1139682 GEO Institute of Hydrobiology 2 0.94437 0.94757 0.02955 0.0291 0.82266 0.82272 0.53976 0.54604 150 150 B B biological fallback assumption illumina hiseq_era unknown small_rna trueseq bulk unknown unknown   China 2020-10-07 Undetermined Undetermined Gonad Reproductive System
63889 63889 SRR14213377 SRX10579922 SRS8684390 SRP314470 PRJNA721381 RNA Seq from zebrafish adult tissues GSE171906 Transcriptome Analysis The goal of this study was to profile transcript expression levels across zebrafish adult tissues. Overall design: Transcriptome profiles of nine zebrafish adult tissues. Every tissue contains triplicates.   pubmed:34556579   Testis3 GSM5237146   source name:zebrafish testis|genotype:wild type|tissue:testis|strain:TLAB Testis3 Libraries were sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0 using the Ensembl transcriptome release 102. The following parameters were used: hisat2 q dta rna strandness R k 12 no unal Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing TPM zebrafish testis   Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle genotype:wild type|tissue:testis|strain:TLAB GSM5237146 GSM5237146: Testis3; Danio rerio; RNA Seq GSM5237146   1 Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina GEO Accession:GSM5237146 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP314470     Testis3.fastq fastq 16904264700.0 169042647.0 GSM5237146 r1 0:100 A:4166427594;C:4293244634;G:4116245208;T:4327700322;N:646942 100       4166427594 4293244634 4116245208 4327700322 646942 SRX10579922 SRS8684390 SRA1217576 GEO Pauli lab, Research Institute of Molecular Pathology 1 0.94648   0.14489   0.64329   0.5145   100   B   usable mapping rate illumina hiseq_era unknown poly_a nebnext bulk unknown unknown   Austria 2021-04-12 Undetermined Undetermined Gonad Reproductive System
63890 63890 SRR14213376 SRX10579921 SRS8684389 SRP314470 PRJNA721381 RNA Seq from zebrafish adult tissues GSE171906 Transcriptome Analysis The goal of this study was to profile transcript expression levels across zebrafish adult tissues. Overall design: Transcriptome profiles of nine zebrafish adult tissues. Every tissue contains triplicates.   pubmed:34556579   Testis2 GSM5237145   source name:zebrafish testis|genotype:wild type|tissue:testis|strain:TLAB Testis2 Libraries were sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0 using the Ensembl transcriptome release 102. The following parameters were used: hisat2 q dta rna strandness R k 12 no unal Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing TPM zebrafish testis   Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle genotype:wild type|tissue:testis|strain:TLAB GSM5237145 GSM5237145: Testis2; Danio rerio; RNA Seq GSM5237145   1 Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina GEO Accession:GSM5237145 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP314470     Testis2.fastq fastq 2130746600.0 21307466.0 GSM5237145 r1 0:100 A:517817182;C:547187586;G:517803772;T:547856602;N:81458 100       517817182 547187586 517803772 547856602 81458 SRX10579921 SRS8684389 SRA1217576 GEO Pauli lab, Research Institute of Molecular Pathology 1 0.95272   0.13195   0.64112   0.50616   100   B   usable mapping rate illumina hiseq_era unknown poly_a nebnext bulk unknown unknown   Austria 2021-04-12 Undetermined Undetermined Gonad Reproductive System
63891 63891 SRR14213375 SRX10579920 SRS8684388 SRP314470 PRJNA721381 RNA Seq from zebrafish adult tissues GSE171906 Transcriptome Analysis The goal of this study was to profile transcript expression levels across zebrafish adult tissues. Overall design: Transcriptome profiles of nine zebrafish adult tissues. Every tissue contains triplicates.   pubmed:34556579   Testis1 GSM5237144   source name:zebrafish testis|genotype:wild type|tissue:testis|strain:TLAB Testis1 Libraries were sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0 using the Ensembl transcriptome release 102. The following parameters were used: hisat2 q dta rna strandness R k 12 no unal Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing TPM zebrafish testis   Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle genotype:wild type|tissue:testis|strain:TLAB GSM5237144 GSM5237144: Testis1; Danio rerio; RNA Seq GSM5237144   1 Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina GEO Accession:GSM5237144 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP314470     Testis1.fastq fastq 1989342600.0 19893426.0 GSM5237144 r1 0:100 A:511252873;C:487112155;G:465774401;T:525127484;N:75687 100       511252873 487112155 465774401 525127484 75687 SRX10579920 SRS8684388 SRA1217576 GEO Pauli lab, Research Institute of Molecular Pathology 1 0.94514   0.11483   0.63341   0.49832   100   B   usable mapping rate illumina hiseq_era unknown poly_a nebnext bulk unknown unknown   Austria 2021-04-12 Undetermined Undetermined Gonad Reproductive System
71330 71330 SRR21497238 SRX17500547 SRS15052263 SRP396406 PRJNA878705 Effect of chronic stress on zebrafish testicular gene expression GSE212999 Transcriptome Analysis To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue we exposed zebrafish males to chronic stress during 21 days covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.       Sample 7 AU1015 STRSS3 GSM6568314   source name:Testicle|tissue:Testicle|genotype:WT|treatment:Chronically stressed Sample 7 AU1015 STRSS3 Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts Testicle   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:Testicle|genotype:WT|treatment:Chronically stressed GSM6568314 GSM6568314: Sample 7 AU1015 STRSS3; Danio rerio; RNA Seq GSM6568314 r1 GSM6568314 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP396406   loader:fastq load.py AU1015_5714AF_H25T2DMXY_1_219UDI-idt-UMI_1.fastq.gz AU1015_5714AF_H25T2DMXY_1_219UDI-idt-UMI_2.fastq.gz fastq fastq 8390784690.0 82262595.0 GSM6568314 r1 0:51 1:51 A:1932102650;C:2309972245;G:2240600118;T:1908089771;N:19906 51 51     1932102650 2309972245 2240600118 1908089771 19906 SRX17500547 SRS15052263 SRA1494713 CNAG REPROMOL, Molecular Biology, Universidad de León 2 0.942 0.94653 0.33089 0.33002 0.75168 0.75546 0.67992 0.70376 51 51 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified unknown bulk unknown unknown   Spain 2022-09-09 Undetermined Undetermined Gonad Reproductive System
71331 71331 SRR21497239 SRX17500547 SRS15052263 SRP396406 PRJNA878705 Effect of chronic stress on zebrafish testicular gene expression GSE212999 Transcriptome Analysis To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue we exposed zebrafish males to chronic stress during 21 days covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.       Sample 7 AU1015 STRSS3 GSM6568314   source name:Testicle|tissue:Testicle|genotype:WT|treatment:Chronically stressed Sample 7 AU1015 STRSS3 Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts Testicle   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:Testicle|genotype:WT|treatment:Chronically stressed GSM6568314 GSM6568314: Sample 7 AU1015 STRSS3; Danio rerio; RNA Seq GSM6568314 r1 GSM6568314 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP396406   loader:fastq load.py AU1015_5714AF_H25T2DMXY_2_219UDI-idt-UMI_1.fastq.gz AU1015_5714AF_H25T2DMXY_2_219UDI-idt-UMI_2.fastq.gz fastq fastq 8239869162.0 80783031.0 GSM6568314 r2 0:51 1:51 A:1901639522;C:2264655998;G:2196001834;T:1877552622;N:19186 51 51     1901639522 2264655998 2196001834 1877552622 19186 SRX17500547 SRS15052263 SRA1494713 CNAG REPROMOL, Molecular Biology, Universidad de León 2 0.94714 0.94834 0.33142 0.32934 0.74884 0.75179 0.69759 0.67569 51 51 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified unknown bulk unknown unknown   Spain 2022-09-09 Undetermined Undetermined Gonad Reproductive System
71332 71332 SRR21497240 SRX17500546 SRS15052262 SRP396406 PRJNA878705 Effect of chronic stress on zebrafish testicular gene expression GSE212999 Transcriptome Analysis To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue we exposed zebrafish males to chronic stress during 21 days covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.       Sample 6 AU1012 STRSS2 GSM6568313   source name:Testicle|tissue:Testicle|genotype:WT|treatment:Chronically stressed Sample 6 AU1012 STRSS2 Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts Testicle   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:Testicle|genotype:WT|treatment:Chronically stressed GSM6568313 GSM6568313: Sample 6 AU1012 STRSS2; Danio rerio; RNA Seq GSM6568313 r1 GSM6568313 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP396406   loader:fastq load.py AU1012_5712AF_H25T2DMXY_1_195UDI-idt-UMI_1.fastq.gz AU1012_5712AF_H25T2DMXY_1_195UDI-idt-UMI_2.fastq.gz fastq fastq 9626813346.0 94380523.0 GSM6568313 r1 0:51 1:51 A:1984308300;C:2757636814;G:2809501488;T:2075344212;N:22532 51 51     1984308300 2757636814 2809501488 2075344212 22532 SRX17500546 SRS15052262 SRA1494713 CNAG REPROMOL, Molecular Biology, Universidad de León 2 0.95878 0.95625 0.26355 0.2585 0.73659 0.73671 0.68833 0.65567 51 51 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified unknown bulk unknown unknown   Spain 2022-09-09 Undetermined Undetermined Gonad Reproductive System
71333 71333 SRR21497241 SRX17500546 SRS15052262 SRP396406 PRJNA878705 Effect of chronic stress on zebrafish testicular gene expression GSE212999 Transcriptome Analysis To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue we exposed zebrafish males to chronic stress during 21 days covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.       Sample 6 AU1012 STRSS2 GSM6568313   source name:Testicle|tissue:Testicle|genotype:WT|treatment:Chronically stressed Sample 6 AU1012 STRSS2 Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts Testicle   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:Testicle|genotype:WT|treatment:Chronically stressed GSM6568313 GSM6568313: Sample 6 AU1012 STRSS2; Danio rerio; RNA Seq GSM6568313 r1 GSM6568313 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP396406   loader:fastq load.py AU1012_5712AF_H25T2DMXY_2_195UDI-idt-UMI_1.fastq.gz AU1012_5712AF_H25T2DMXY_2_195UDI-idt-UMI_2.fastq.gz fastq fastq 9423267246.0 92384973.0 GSM6568313 r2 0:51 1:51 A:1950259057;C:2693385806;G:2742401178;T:2037199427;N:21778 51 51     1950259057 2693385806 2742401178 2037199427 21778 SRX17500546 SRS15052262 SRA1494713 CNAG REPROMOL, Molecular Biology, Universidad de León 2 0.9593 0.95562 0.26632 0.26197 0.73539 0.73626 0.69745 0.65719 51 51 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified unknown bulk unknown unknown   Spain 2022-09-09 Undetermined Undetermined Gonad Reproductive System
71334 71334 SRR21497242 SRX17500545 SRS15052261 SRP396406 PRJNA878705 Effect of chronic stress on zebrafish testicular gene expression GSE212999 Transcriptome Analysis To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue we exposed zebrafish males to chronic stress during 21 days covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.       Sample 5 AU1011 STRSS1 GSM6568312   source name:Testicle|tissue:Testicle|genotype:WT|treatment:Chronically stressed Sample 5 AU1011 STRSS1 Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts Testicle   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:Testicle|genotype:WT|treatment:Chronically stressed GSM6568312 GSM6568312: Sample 5 AU1011 STRSS1; Danio rerio; RNA Seq GSM6568312 r1 GSM6568312 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP396406   loader:fastq load.py AU1011_5711AF_H25T2DMXY_1_278UDI-idt-UMI_1.fastq.gz AU1011_5711AF_H25T2DMXY_1_278UDI-idt-UMI_2.fastq.gz fastq fastq 5483838852.0 53763126.0 GSM6568312 r1 0:51 1:51 A:1253556120;C:1532837524;G:1470940857;T:1226491317;N:13034 51 51     1253556120 1532837524 1470940857 1226491317 13034 SRX17500545 SRS15052261 SRA1494713 CNAG REPROMOL, Molecular Biology, Universidad de León 2 0.96516 0.95624 0.32358 0.32348 0.77433 0.77674 0.6857 0.71998 51 51 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified unknown bulk unknown unknown   Spain 2022-09-09 Undetermined Undetermined Gonad Reproductive System
71335 71335 SRR21497243 SRX17500545 SRS15052261 SRP396406 PRJNA878705 Effect of chronic stress on zebrafish testicular gene expression GSE212999 Transcriptome Analysis To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue we exposed zebrafish males to chronic stress during 21 days covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.       Sample 5 AU1011 STRSS1 GSM6568312   source name:Testicle|tissue:Testicle|genotype:WT|treatment:Chronically stressed Sample 5 AU1011 STRSS1 Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts Testicle   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:Testicle|genotype:WT|treatment:Chronically stressed GSM6568312 GSM6568312: Sample 5 AU1011 STRSS1; Danio rerio; RNA Seq GSM6568312 r1 GSM6568312 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP396406   loader:fastq load.py AU1011_5711AF_H25T2DMXY_2_278UDI-idt-UMI_1.fastq.gz AU1011_5711AF_H25T2DMXY_2_278UDI-idt-UMI_2.fastq.gz fastq fastq 5408414850.0 53023675.0 GSM6568312 r2 0:51 1:51 A:1239028759;C:1509175771;G:1447989732;T:1212208077;N:12511 51 51     1239028759 1509175771 1447989732 1212208077 12511 SRX17500545 SRS15052261 SRA1494713 CNAG REPROMOL, Molecular Biology, Universidad de León 2 0.96493 0.95575 0.32376 0.32336 0.7726 0.7763 0.70883 0.71826 51 51 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified unknown bulk unknown unknown   Spain 2022-09-09 Undetermined Undetermined Gonad Reproductive System
71336 71336 SRR21497244 SRX17500544 SRS15052260 SRP396406 PRJNA878705 Effect of chronic stress on zebrafish testicular gene expression GSE212999 Transcriptome Analysis To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue we exposed zebrafish males to chronic stress during 21 days covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.       Sample 4 AU1009 CTRL4 GSM6568311   source name:Testicle|tissue:Testicle|genotype:WT|treatment:Control Sample 4 AU1009 CTRL4 Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts Testicle   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:Testicle|genotype:WT|treatment:Control GSM6568311 GSM6568311: Sample 4 AU1009 CTRL4; Danio rerio; RNA Seq GSM6568311 r1 GSM6568311 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP396406   loader:fastq load.py AU1009_6480AF_HFYVNDRXY_1_24UDI-idt-UMI_1.fastq.gz AU1009_6480AF_HFYVNDRXY_1_24UDI-idt-UMI_2.fastq.gz fastq fastq 6509397138.0 63817619.0 GSM6568311 r1 0:51 1:51 A:1479622143;C:1838294826;G:1757992548;T:1433278489;N:209132 51 51     1479622143 1838294826 1757992548 1433278489 209132 SRX17500544 SRS15052260 SRA1494713 CNAG REPROMOL, Molecular Biology, Universidad de León 2 0.97248 0.97046 0.30954 0.31342 0.81199 0.81531 0.72036 0.73561 51 51 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified unknown bulk unknown unknown   Spain 2022-09-09 Undetermined Undetermined Gonad Reproductive System
71337 71337 SRR21497245 SRX17500544 SRS15052260 SRP396406 PRJNA878705 Effect of chronic stress on zebrafish testicular gene expression GSE212999 Transcriptome Analysis To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue we exposed zebrafish males to chronic stress during 21 days covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.       Sample 4 AU1009 CTRL4 GSM6568311   source name:Testicle|tissue:Testicle|genotype:WT|treatment:Control Sample 4 AU1009 CTRL4 Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts Testicle   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:Testicle|genotype:WT|treatment:Control GSM6568311 GSM6568311: Sample 4 AU1009 CTRL4; Danio rerio; RNA Seq GSM6568311 r1 GSM6568311 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP396406   loader:fastq load.py AU1009_6480AF_HFYVNDRXY_2_24UDI-idt-UMI_1.fastq.gz AU1009_6480AF_HFYVNDRXY_2_24UDI-idt-UMI_2.fastq.gz fastq fastq 6371072184.0 62461492.0 GSM6568311 r2 0:51 1:51 A:1449600326;C:1798621683;G:1718988370;T:1403637608;N:224197 51 51     1449600326 1798621683 1718988370 1403637608 224197 SRX17500544 SRS15052260 SRA1494713 CNAG REPROMOL, Molecular Biology, Universidad de León 2 0.97264 0.96982 0.30877 0.31437 0.81335 0.81584 0.71969 0.73176 51 51 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified unknown bulk unknown unknown   Spain 2022-09-09 Undetermined Undetermined Gonad Reproductive System
71338 71338 SRR21497246 SRX17500543 SRS15052259 SRP396406 PRJNA878705 Effect of chronic stress on zebrafish testicular gene expression GSE212999 Transcriptome Analysis To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue we exposed zebrafish males to chronic stress during 21 days covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.       Sample 3 AU1008 CTRL3 GSM6568310   source name:Testicle|tissue:Testicle|genotype:WT|treatment:Control Sample 3 AU1008 CTRL3 Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts Testicle   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:Testicle|genotype:WT|treatment:Control GSM6568310 GSM6568310: Sample 3 AU1008 CTRL3; Danio rerio; RNA Seq GSM6568310 r1 GSM6568310 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP396406   loader:fastq load.py AU1008_6479AF_HFYVNDRXY_1_12UDI-idt-UMI_1.fastq.gz AU1008_6479AF_HFYVNDRXY_1_12UDI-idt-UMI_2.fastq.gz fastq fastq 6145653000.0 60251500.0 GSM6568310 r1 0:51 1:51 A:1412278292;C:1714005085;G:1634673089;T:1384497306;N:199228 51 51     1412278292 1714005085 1634673089 1384497306 199228 SRX17500543 SRS15052259 SRA1494713 CNAG REPROMOL, Molecular Biology, Universidad de León 2 0.96952 0.96837 0.31965 0.32353 0.78287 0.78742 0.71968 0.71522 51 51 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified unknown bulk unknown unknown   Spain 2022-09-09 Undetermined Undetermined Gonad Reproductive System
71339 71339 SRR21497247 SRX17500543 SRS15052259 SRP396406 PRJNA878705 Effect of chronic stress on zebrafish testicular gene expression GSE212999 Transcriptome Analysis To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue we exposed zebrafish males to chronic stress during 21 days covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.       Sample 3 AU1008 CTRL3 GSM6568310   source name:Testicle|tissue:Testicle|genotype:WT|treatment:Control Sample 3 AU1008 CTRL3 Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts Testicle   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:Testicle|genotype:WT|treatment:Control GSM6568310 GSM6568310: Sample 3 AU1008 CTRL3; Danio rerio; RNA Seq GSM6568310 r1 GSM6568310 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP396406   loader:fastq load.py AU1008_6479AF_HFYVNDRXY_2_12UDI-idt-UMI_1.fastq.gz AU1008_6479AF_HFYVNDRXY_2_12UDI-idt-UMI_2.fastq.gz fastq fastq 5986839714.0 58694507.0 GSM6568310 r2 0:51 1:51 A:1376941205;C:1669376884;G:1591045173;T:1349265748;N:210704 51 51     1376941205 1669376884 1591045173 1349265748 210704 SRX17500543 SRS15052259 SRA1494713 CNAG REPROMOL, Molecular Biology, Universidad de León 2 0.96969 0.9685 0.32009 0.32581 0.7849 0.7876 0.71867 0.72919 51 51 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified unknown bulk unknown unknown   Spain 2022-09-09 Undetermined Undetermined Gonad Reproductive System
71340 71340 SRR21497248 SRX17500542 SRS15052258 SRP396406 PRJNA878705 Effect of chronic stress on zebrafish testicular gene expression GSE212999 Transcriptome Analysis To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue we exposed zebrafish males to chronic stress during 21 days covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.       Sample 2 AU1007 CTRL2 GSM6568309   source name:Testicle|tissue:Testicle|genotype:WT|treatment:Control Sample 2 AU1007 CTRL2 Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts Testicle   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:Testicle|genotype:WT|treatment:Control GSM6568309 GSM6568309: Sample 2 AU1007 CTRL2; Danio rerio; RNA Seq GSM6568309 r1 GSM6568309 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP396406   loader:fastq load.py AU1007_5707AF_H25T2DMXY_1_230UDI-idt-UMI_1.fastq.gz AU1007_5707AF_H25T2DMXY_1_230UDI-idt-UMI_2.fastq.gz fastq fastq 7505020362.0 73578631.0 GSM6568309 r1 0:51 1:51 A:1994095154;C:1720542284;G:1716052918;T:2074312037;N:17969 51 51     1994095154 1720542284 1716052918 2074312037 17969 SRX17500542 SRS15052258 SRA1494713 CNAG REPROMOL, Molecular Biology, Universidad de León 2 0.92058 0.91439 0.34835 0.34788 0.63867 0.6392 0.55075 0.54397 51 51 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified unknown bulk unknown unknown   Spain 2022-09-09 Undetermined Undetermined Gonad Reproductive System
71341 71341 SRR21497249 SRX17500542 SRS15052258 SRP396406 PRJNA878705 Effect of chronic stress on zebrafish testicular gene expression GSE212999 Transcriptome Analysis To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue we exposed zebrafish males to chronic stress during 21 days covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.       Sample 2 AU1007 CTRL2 GSM6568309   source name:Testicle|tissue:Testicle|genotype:WT|treatment:Control Sample 2 AU1007 CTRL2 Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts Testicle   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:Testicle|genotype:WT|treatment:Control GSM6568309 GSM6568309: Sample 2 AU1007 CTRL2; Danio rerio; RNA Seq GSM6568309 r1 GSM6568309 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP396406   loader:fastq load.py AU1007_5707AF_H25T2DMXY_2_230UDI-idt-UMI_1.fastq.gz AU1007_5707AF_H25T2DMXY_2_230UDI-idt-UMI_2.fastq.gz fastq fastq 7425266766.0 72796733.0 GSM6568309 r2 0:51 1:51 A:1976937738;C:1698898360;G:1694114006;T:2055299272;N:17390 51 51     1976937738 1698898360 1694114006 2055299272 17390 SRX17500542 SRS15052258 SRA1494713 CNAG REPROMOL, Molecular Biology, Universidad de León 2 0.91956 0.91454 0.35046 0.35127 0.63536 0.63802 0.53838 0.53858 51 51 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified unknown bulk unknown unknown   Spain 2022-09-09 Undetermined Undetermined Gonad Reproductive System
71342 71342 SRR21497250 SRX17500541 SRS15052257 SRP396406 PRJNA878705 Effect of chronic stress on zebrafish testicular gene expression GSE212999 Transcriptome Analysis To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue we exposed zebrafish males to chronic stress during 21 days covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.       Sample 1 AU1006 CTRL1 GSM6568308   source name:Testicle|tissue:Testicle|genotype:WT|treatment:Control Sample 1 AU1006 CTRL1 Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts Testicle   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:Testicle|genotype:WT|treatment:Control GSM6568308 GSM6568308: Sample 1 AU1006 CTRL1; Danio rerio; RNA Seq GSM6568308 r1 GSM6568308 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP396406   loader:fastq load.py AU1006_5706AF_H25T2DMXY_1_218UDI-idt-UMI_1.fastq.gz AU1006_5706AF_H25T2DMXY_1_218UDI-idt-UMI_2.fastq.gz fastq fastq 7688979708.0 75382154.0 GSM6568308 r1 0:51 1:51 A:2058869304;C:1755298338;G:1745020739;T:2129772865;N:18462 51 51     2058869304 1755298338 1745020739 2129772865 18462 SRX17500541 SRS15052257 SRA1494713 CNAG REPROMOL, Molecular Biology, Universidad de León 2 0.91942 0.91596 0.3597 0.358 0.63832 0.63984 0.54181 0.54518 51 51 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified unknown bulk unknown unknown   Spain 2022-09-09 Undetermined Undetermined Gonad Reproductive System
71343 71343 SRR21497251 SRX17500541 SRS15052257 SRP396406 PRJNA878705 Effect of chronic stress on zebrafish testicular gene expression GSE212999 Transcriptome Analysis To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue we exposed zebrafish males to chronic stress during 21 days covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.       Sample 1 AU1006 CTRL1 GSM6568308   source name:Testicle|tissue:Testicle|genotype:WT|treatment:Control Sample 1 AU1006 CTRL1 Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts Testicle   RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   tissue:Testicle|genotype:WT|treatment:Control GSM6568308 GSM6568308: Sample 1 AU1006 CTRL1; Danio rerio; RNA Seq GSM6568308 r1 GSM6568308 1 RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP396406   loader:fastq load.py AU1006_5706AF_H25T2DMXY_2_218UDI-idt-UMI_1.fastq.gz AU1006_5706AF_H25T2DMXY_2_218UDI-idt-UMI_2.fastq.gz fastq fastq 7604731992.0 74556196.0 GSM6568308 r2 0:51 1:51 A:2040184020;C:1732865855;G:1722331901;T:2109332679;N:17537 51 51     2040184020 1732865855 1722331901 2109332679 17537 SRX17500541 SRS15052257 SRA1494713 CNAG REPROMOL, Molecular Biology, Universidad de León 2 0.91853 0.91507 0.36358 0.36043 0.63832 0.63968 0.53976 0.54937 51 51 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified unknown bulk unknown unknown   Spain 2022-09-09 Undetermined Undetermined Gonad Reproductive System
71390 71390 SRR21529724 SRX17532083 SRS15080530 SRP396693 PRJNA879314 Transcriptome analysis of WT and cdk1 / zebrafish testis. PRJNA879314 Other Transcriptome analysis of WT and cdk1 / zebrafish testis. To explore the effect of cdk1 deletion on testis development and cell cycle in zebrafish.       Danio rerio zebrafish   strain:Wild population|age:1|sex:male|tissue:testis|geo loc name:China:Wuhan|BioSampleModel:Model organism or animal                 Transcriptome analysis of WT and cdk1 / zebrafish testis WT and cdk1 / zebrafish testis WT and cdk1 / zebrafish testis Total RNAs were extracted from the spermatogonia of experimental fish using Trizol. The construction of the cDNA library and sequencing were performed using Illumina NovaSeq 6000 HiSeq     RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP396693     L1EFK171176--WT_1.R1.raw.fastq.gz L1EFK171176--WT_1.R2.raw.fastq.gz L1EFK171177--WT_2.R1.raw.fastq.gz L1EFK171177--WT_2.R2.raw.fastq.gz L1EFK171178--WT_3.R1.raw.fastq.gz L1EFK171178--WT_3.R2.raw.fastq.gz L1EFK171179--cdk_1.R1.raw.fastq.gz L1EFK171179--cdk_1.R2.raw.fastq.gz L1EFK171180--cdk_2.R1.raw.fastq.gz L1EFK171180--cdk_2.R2.raw.fastq.gz L1EFK171181--cdk_3.R1.raw.fastq.gz L1EFK171181--cdk_3.R2.raw.fastq.gz fastq fastq fastq fastq fastq fastq fastq fastq fastq fastq fastq fastq 42093812772.0 139383486.0 L1EFK171176 WT 1.R1.raw.fastq.gz 0:151 1:151 A:11032877415;C:9928091970;G:10375381857;T:10756803003;N:658527 151 151     11032877415 9928091970 10375381857 10756803003 658527 SRX17532083 SRS15080530 SRA1495115 Huazhong Agricultural University|College of Fisheries Huazhong Agricultural University 2 0.93915 0.93965 0.06748 0.06739 0.65652 0.65537 0.49084 0.49358 151 151 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified unknown bulk unknown unknown   China 2022-09-12 Undetermined Undetermined Gonad Reproductive System
74613 74613 SRR23868264 SRX19680348 SRS17049789 SRP427394 PRJNA944944 Comparative transcriptome analysis of testes and ovaries reveals sex biased genes and pathways in zebrafish GSE227389 Transcriptome Analysis The goals of this study are to compare the differentially expressed genes between testes and ovaries of zebrafish based on RNA seq data and some of these genes were validated by qRT–PCR.Further the differentially expressed genes were devided into up regulated and down regulated genes for GO and KEGG analysis. Overall design: Testes and ovaries mRNA profiles of adult zebrafish were generated by deep sequencing. Every sample was compose of three adult individuals.   pubmed:38242380   testes GSM7099751   source name:testis|tissue:testis|genotype:WT|geo loc name:missing|collection date:missing testes Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to GRCz10 whole genome using HISAT mapped to genes using Bowtie2. fragments per kilo bases per million fragments FPKM were calculated using RSEM. Assembly: GRCz10 Supplementary files format and content: The text files include the Ensembl ID of genes and the FPKM values for each Sample. testis   Testes and ovaries were isolated frozen on dry ice and RNA was harvested using Trizol reagent. Agilent RNA 6000 nano Reagents Port 1 was used for RNA qualities analysis by Agilent 2100 Bioanalyzer. RNA libraries were prepared for sequencing using standard BGISEQ 500 protocols.   tissue:testis|genotype:WT GSM7099751 GSM7099751: testes; Danio rerio; RNA Seq GSM7099751 r1 GSM7099751 1 Testes and ovaries were isolated frozen on dry ice and RNA was harvested using Trizol reagent. Agilent RNA 6000 nano Reagents Port 1 was used for RNA qualities analysis by Agilent 2100 Bioanalyzer. RNA libraries were prepared for sequencing using standard BGISEQ 500 protocols.   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE BGISEQ BGISEQ-500   SRP427394     WT-testis.fq.gz fastq 1176068400.0 23521368.0 GSM7099751 r1 0:50 A:323799672;C:262049848;G:273563529;T:316045968;N:609383 50       323799672 262049848 273563529 316045968 609383 SRX19680348 SRS17049789 SRA1687194 Wuhan university Wuhan university 1 0.93023   0.11308   0.6462   0.49784   50   B   usable mapping rate bgi bgi unknown cdna_unspecified unknown bulk unknown unknown   China 2023-03-15 Undetermined Undetermined Gonad Reproductive System
74614 74614 SRR23868265 SRX19680347 SRS17049788 SRP427394 PRJNA944944 Comparative transcriptome analysis of testes and ovaries reveals sex biased genes and pathways in zebrafish GSE227389 Transcriptome Analysis The goals of this study are to compare the differentially expressed genes between testes and ovaries of zebrafish based on RNA seq data and some of these genes were validated by qRT–PCR.Further the differentially expressed genes were devided into up regulated and down regulated genes for GO and KEGG analysis. Overall design: Testes and ovaries mRNA profiles of adult zebrafish were generated by deep sequencing. Every sample was compose of three adult individuals.   pubmed:38242380   ovaries GSM7099752   source name:ovary|tissue:ovary|genotype:WT|geo loc name:missing|collection date:missing ovaries Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to GRCz10 whole genome using HISAT mapped to genes using Bowtie2. fragments per kilo bases per million fragments FPKM were calculated using RSEM. Assembly: GRCz10 Supplementary files format and content: The text files include the Ensembl ID of genes and the FPKM values for each Sample. ovary   Testes and ovaries were isolated frozen on dry ice and RNA was harvested using Trizol reagent. Agilent RNA 6000 nano Reagents Port 1 was used for RNA qualities analysis by Agilent 2100 Bioanalyzer. RNA libraries were prepared for sequencing using standard BGISEQ 500 protocols.   tissue:ovary|genotype:WT GSM7099752 GSM7099752: ovaries; Danio rerio; RNA Seq GSM7099752 r1 GSM7099752 1 Testes and ovaries were isolated frozen on dry ice and RNA was harvested using Trizol reagent. Agilent RNA 6000 nano Reagents Port 1 was used for RNA qualities analysis by Agilent 2100 Bioanalyzer. RNA libraries were prepared for sequencing using standard BGISEQ 500 protocols.   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE BGISEQ BGISEQ-500   SRP427394     WT-ovary.fq.gz fastq 1176463600.0 23529272.0 GSM7099752 r1 0:50 A:311869864;C:270650722;G:289863261;T:303489229;N:590524 50       311869864 270650722 289863261 303489229 590524 SRX19680347 SRS17049788 SRA1687194 Wuhan university Wuhan university 1 0.93488   0.02755   0.75601   0.46986   50   B   usable mapping rate bgi bgi unknown cdna_unspecified unknown bulk unknown unknown   China 2023-03-15 Undetermined Undetermined Gonad Reproductive System

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;