metadata: run_metadata: 14 rows where devstage_curation_coarse = "Undetermined" and experiment.platform = "LS454"

14 rows where devstage_curation_coarse = "Undetermined" and experiment.platform = "LS454"

descending

Link	rowid ▼	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.PMIDs	sample.title	sample.alias	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.spot_descriptor	experiment.study_ref	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.nofeature_rate.mate1	seqdetective.sparsity.mate1	seqdetective.pos_strand_rate.mate1	seqdetective.readlen.mate1	seqdetective.judgement.mate1	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
67908	67908	SRR017341	SRX003632	SRS002067	SRP000652	PRJNA79415	Zebrafish IgH Sequencing	Zebrafish IgH	Other	14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.	pubmed:19423829	Generic sample from Danio rerio	Fish N	Zebrafish IgH cDNA preparation	Zebrafish IgH cDNA FishN	Zebrafish IgH 454	About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.	IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime\|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime	AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP000652	NonStandardReadNameUsed:true	N_fish.tar	fastq	40231384.0	173756.0	Zebrafish IgH cDNA FishN	0:4 1:227.54	A:10436935;C:8800020;G:9512025;T:11471941;N:10463	4	227	10436935	8800020	9512025	11471941	10463	SRX003632	SRS002067	SRA008134	Stanford University\|Quake	Stanford University	1	0.26487	0.0663	0.99304	0.01389	229	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-03-31	Undetermined	Undetermined	BCR TCR repertoire	Hematopoietic System
67909	67909	SRR017340	SRX003631	SRS002066	SRP000652	PRJNA79415	Zebrafish IgH Sequencing	Zebrafish IgH	Other	14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.	pubmed:19423829	Generic sample from Danio rerio	Fish M	Zebrafish IgH cDNA preparation	Zebrafish IgH cDNA FishM	Zebrafish IgH 454	About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.	IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime\|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime	AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP000652	NonStandardReadNameUsed:true	M_fish.tar	fastq	37492198.0	161639.0	Zebrafish IgH cDNA FishM	0:4 1:227.95	A:9527141;C:8129088;G:9025760;T:10804127;N:6082	4	227	9527141	8129088	9025760	10804127	6082	SRX003631	SRS002066	SRA008134	Stanford University\|Quake	Stanford University	1	0.31521	0.11394	0.99823	0.00291	208	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-03-31	Undetermined	Undetermined	BCR TCR repertoire	Hematopoietic System
67910	67910	SRR017339	SRX003630	SRS002065	SRP000652	PRJNA79415	Zebrafish IgH Sequencing	Zebrafish IgH	Other	14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.	pubmed:19423829	Generic sample from Danio rerio	Fish L	Zebrafish IgH cDNA preparation	Zebrafish IgH cDNA FishL	Zebrafish IgH 454	About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.	IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime\|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime	AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP000652	NonStandardReadNameUsed:true	L_fish.tar	fastq	37971443.0	163701.0	Zebrafish IgH cDNA FishL	0:4 1:227.96	A:9544875;C:8363123;G:9094601;T:10963684;N:5160	4	227	9544875	8363123	9094601	10963684	5160	SRX003630	SRS002065	SRA008134	Stanford University\|Quake	Stanford University	1	0.29057	0.07862	0.99636	0.00534	245	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-03-31	Undetermined	Undetermined	BCR TCR repertoire	Hematopoietic System
67911	67911	SRR017338	SRX003629	SRS002064	SRP000652	PRJNA79415	Zebrafish IgH Sequencing	Zebrafish IgH	Other	14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.	pubmed:19423829	Generic sample from Danio rerio	Fish K	Zebrafish IgH cDNA preparation	Zebrafish IgH cDNA FishK	Zebrafish IgH 454	About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.	IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime\|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime	AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP000652	NonStandardReadNameUsed:true	K_fish.tar	fastq	54201403.0	234266.0	Zebrafish IgH cDNA FishK	0:4 1:227.37	A:13608677;C:11652239;G:12945164;T:15975205;N:20118	4	227	13608677	11652239	12945164	15975205	20118	SRX003629	SRS002064	SRA008134	Stanford University\|Quake	Stanford University	1	0.27218	0.07987	0.99275	0.01242	244	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-03-31	Undetermined	Undetermined	BCR TCR repertoire	Hematopoietic System
67912	67912	SRR017337	SRX003628	SRS002063	SRP000652	PRJNA79415	Zebrafish IgH Sequencing	Zebrafish IgH	Other	14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.	pubmed:19423829	Generic sample from Danio rerio	Fish J	Zebrafish IgH cDNA preparation	Zebrafish IgH cDNA FishJ	Zebrafish IgH 454	About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.	IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime\|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime	AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP000652	NonStandardReadNameUsed:true	J_fish.tar	fastq	51915342.0	224027.0	Zebrafish IgH cDNA FishJ	0:4 1:227.74	A:12664582;C:12040983;G:12609762;T:14589770;N:10245	4	227	12664582	12040983	12609762	14589770	10245	SRX003628	SRS002063	SRA008134	Stanford University\|Quake	Stanford University	1	0.29028	0.10039	0.9964	0.00625	97	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-03-31	Undetermined	Undetermined	BCR TCR repertoire	Hematopoietic System
67913	67913	SRR017336	SRX003627	SRS002062	SRP000652	PRJNA79415	Zebrafish IgH Sequencing	Zebrafish IgH	Other	14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.	pubmed:19423829	Generic sample from Danio rerio	Fish I	Zebrafish IgH cDNA preparation	Zebrafish IgH cDNA FishI	Zebrafish IgH 454	About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.	IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime\|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime	AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP000652	NonStandardReadNameUsed:true	I_fish.tar	fastq	23436268.0	100120.0	Zebrafish IgH cDNA FishI	0:4 1:230.08	A:5801823;C:5246438;G:5587169;T:6797624;N:3214	4	230	5801823	5246438	5587169	6797624	3214	SRX003627	SRS002062	SRA008134	Stanford University\|Quake	Stanford University	1	0.34362	0.0757	0.99241	0.02647	232	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-03-31	Undetermined	Undetermined	BCR TCR repertoire	Hematopoietic System
67914	67914	SRR017335	SRX003626	SRS002061	SRP000652	PRJNA79415	Zebrafish IgH Sequencing	Zebrafish IgH	Other	14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.	pubmed:19423829	Generic sample from Danio rerio	Fish H	Zebrafish IgH cDNA preparation	Zebrafish IgH cDNA FishH	Zebrafish IgH 454	About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.	IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime\|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime	AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP000652	NonStandardReadNameUsed:true	H_fish.tar	fastq	48443452.0	213531.0	Zebrafish IgH cDNA FishH	0:4 1:222.87	A:12720681;C:10490855;G:11923926;T:13303989;N:4001	4	222	12720681	10490855	11923926	13303989	4001	SRX003626	SRS002061	SRA008134	Stanford University\|Quake	Stanford University	1	0.45847	0.04709	0.98754	0.0161	56	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-03-31	Undetermined	Undetermined	BCR TCR repertoire	Hematopoietic System
67915	67915	SRR017334	SRX003625	SRS002060	SRP000652	PRJNA79415	Zebrafish IgH Sequencing	Zebrafish IgH	Other	14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.	pubmed:19423829	Generic sample from Danio rerio	Fish G	Zebrafish IgH cDNA preparation	Zebrafish IgH cDNA FishG	Zebrafish IgH 454	About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.	IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime\|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime	AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP000652	NonStandardReadNameUsed:true	G_fish.tar	fastq	50095821.0	217866.0	Zebrafish IgH cDNA FishG	0:4 1:225.94	A:13182103;C:11299206;G:11909574;T:13700817;N:4121	4	225	13182103	11299206	11909574	13700817	4121	SRX003625	SRS002060	SRA008134	Stanford University\|Quake	Stanford University	1	0.37294	0.09947	0.99034	0.02245	230	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-03-31	Undetermined	Undetermined	BCR TCR repertoire	Hematopoietic System
67916	67916	SRR017333	SRX003624	SRS002059	SRP000652	PRJNA79415	Zebrafish IgH Sequencing	Zebrafish IgH	Other	14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.	pubmed:19423829	Generic sample from Danio rerio	Fish F	Zebrafish IgH cDNA preparation	Zebrafish IgH cDNA FishF	Zebrafish IgH 454	About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.	IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime\|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime	AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP000652	NonStandardReadNameUsed:true	F_fish.tar	fastq	16577798.0	83387.0	Zebrafish IgH cDNA FishF	0:4 1:194.81	A:4215316;C:3618457;G:4002690;T:4736893;N:4442	4	194	4215316	3618457	4002690	4736893	4442	SRX003624	SRS002059	SRA008134	Stanford University\|Quake	Stanford University	1	0.57361	0.0727	0.99965	0.00026	62	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-03-31	Undetermined	Undetermined	BCR TCR repertoire	Hematopoietic System
67917	67917	SRR017332	SRX003623	SRS002058	SRP000652	PRJNA79415	Zebrafish IgH Sequencing	Zebrafish IgH	Other	14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.	pubmed:19423829	Generic sample from Danio rerio	Fish E	Zebrafish IgH cDNA preparation	Zebrafish IgH cDNA FishE	Zebrafish IgH 454	About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.	IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime\|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime	AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP000652	NonStandardReadNameUsed:true	E_fish.tar	fastq	29705006.0	131553.0	Zebrafish IgH cDNA FishE	0:4 1:221.80	A:7474430;C:6417563;G:7115572;T:8693543;N:3898	4	221	7474430	6417563	7115572	8693543	3898	SRX003623	SRS002058	SRA008134	Stanford University\|Quake	Stanford University	1	0.3099	0.09802	0.99904	0.00099	45	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-03-31	Undetermined	Undetermined	BCR TCR repertoire	Hematopoietic System
67918	67918	SRR017331	SRX003622	SRS002057	SRP000652	PRJNA79415	Zebrafish IgH Sequencing	Zebrafish IgH	Other	14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.	pubmed:19423829	Generic sample from Danio rerio	Fish D	Zebrafish IgH cDNA preparation	Zebrafish IgH cDNA FishD	Zebrafish IgH 454	About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.	IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime\|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime	AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP000652	NonStandardReadNameUsed:true	D_fish.tar	fastq	27611909.0	123468.0	Zebrafish IgH cDNA FishD	0:4 1:219.64	A:6809564;C:6219469;G:6636933;T:7943112;N:2831	4	219	6809564	6219469	6636933	7943112	2831	SRX003622	SRS002057	SRA008134	Stanford University\|Quake	Stanford University	1	0.45962	0.09396	0.99941	0.00026	218	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-03-31	Undetermined	Undetermined	BCR TCR repertoire	Hematopoietic System
67919	67919	SRR017330	SRX003621	SRS002056	SRP000652	PRJNA79415	Zebrafish IgH Sequencing	Zebrafish IgH	Other	14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.	pubmed:19423829	Generic sample from Danio rerio	Fish C	Zebrafish IgH cDNA preparation	Zebrafish IgH cDNA FishC	Zebrafish IgH 454	About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.	IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime\|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime	AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP000652	NonStandardReadNameUsed:true	C_fish.tar	fastq	21845405.0	95733.0	Zebrafish IgH cDNA FishC	0:4 1:224.19	A:5735195;C:4746747;G:5266352;T:6095066;N:2045	4	224	5735195	4746747	5266352	6095066	2045	SRX003621	SRS002056	SRA008134	Stanford University\|Quake	Stanford University	1	0.38908	0.20497	0.99967	0.00047	145	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-03-31	Undetermined	Undetermined	BCR TCR repertoire	Hematopoietic System
67920	67920	SRR017329	SRX003620	SRS002055	SRP000652	PRJNA79415	Zebrafish IgH Sequencing	Zebrafish IgH	Other	14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.	pubmed:19423829	Generic sample from Danio rerio	Fish B	Zebrafish IgH cDNA preparation	Zebrafish IgH cDNA FishB	Zebrafish IgH 454	About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.	IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime\|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime	AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP000652	NonStandardReadNameUsed:true	B_fish.tar	fastq	26680294.0	118385.0	Zebrafish IgH cDNA FishB	0:4 1:221.37	A:6380496;C:6168810;G:6541530;T:7587018;N:2440	4	221	6380496	6168810	6541530	7587018	2440	SRX003620	SRS002055	SRA008134	Stanford University\|Quake	Stanford University	1	0.35498	0.14675	0.99906	0.00098	228	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-03-31	Undetermined	Undetermined	BCR TCR repertoire	Hematopoietic System
67921	67921	SRR017328	SRX003619	SRS002054	SRP000652	PRJNA79415	Zebrafish IgH Sequencing	Zebrafish IgH	Other	14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.	pubmed:19423829	Generic sample from Danio rerio	Fish A	Zebrafish IgH cDNA preparation	Zebrafish IgH cDNA FishA	Zebrafish IgH 454	About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.	IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime\|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime	AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP000652	NonStandardReadNameUsed:true	A_fish.tar	fastq	13497752.0	61111.0	Zebrafish IgH cDNA FishA	0:4 1:216.87	A:3287411;C:3078068;G:3224467;T:3906026;N:1780	4	216	3287411	3078068	3224467	3906026	1780	SRX003619	SRS002054	SRA008134	Stanford University\|Quake	Stanford University	1	0.32333	0.14098	0.99937	0.00169	52	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-03-31	Undetermined	Undetermined	BCR TCR repertoire	Hematopoietic System

Advanced export

JSON shape: default, array, newline-delimited

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;