RNAquarium Metadata Server
Institute Website Terms of Use Privacy Policy

run_metadata

99 rows where devstage_curation_coarse = "Undetermined" and experiment.library_selection = "PCR"

✎ View and edit SQL

This data as json, CSV (advanced)

tissue_curation 7

technology 3

experiment.library_strategy 3

experiment.platform 2

experiment.library_layout 2

experiment.library_source 1

experiment.library_selection 1

  • PCR · 99 ✖

devstage_curation_coarse 1

  • Undetermined · 99 ✖

devstage_curation 1

Link rowid ▼ run.accession experiment.accession sample.accession study.accession bioproject study.title study.alias study.type study.abstract study.attributes study.PMIDs sample.description sample.title sample.alias sample.centername sample.attributes GEOsample.title GEOsample.dataprocessing GEOsample.source GEOsample.treatmentprotocol GEOsample.extractprotocol GEOsample.growthprotocol GEOsample.characteristics GEOsample.accession experiment.title experiment.alias experiment.library_name experiment.design_description experiment.library_construction_protocol experiment.attributes experiment.library_strategy experiment.library_source experiment.library_selection experiment.library_layout experiment.platform experiment.instrument_model experiment.spot_descriptor experiment.study_ref run.title run.attributes run.filename run.semantic_name run.total_bases run.total_spots run.alias run.read_lengths run.base_counts run.r1_length run.r2_length run.r3_length run.r4_length run.Acount run.Ccount run.Gcount run.Tcount run.Ncount run.experiment run.pool_member submission.accession submission.srasource submission.bioprojectsource seqdetective.n_mates seqdetective.mapping_rate.mate1 seqdetective.mapping_rate.mate2 seqdetective.nofeature_rate.mate1 seqdetective.nofeature_rate.mate2 seqdetective.sparsity.mate1 seqdetective.sparsity.mate2 seqdetective.pos_strand_rate.mate1 seqdetective.pos_strand_rate.mate2 seqdetective.readlen.mate1 seqdetective.readlen.mate2 seqdetective.judgement.mate1 seqdetective.judgement.mate2 seqdetective.judgement.reason platform_family instrument_generation read_bias selection_class prep_kit sc_or_bulk tech_class technology tech_variant submission.bioprojectsource.country earliest_date devstage_curation devstage_curation_coarse tissue_curation tissue_curation_coarse
28470 28470 SRR26253203 SRX21963295 SRS19039869 SRP464138 PRJNA1022587 Danio rerio Raw sequence reads PRJNA1022587 Whole Genome Sequencing In teleost type I IFNs are categorized into 2 subgroups containing one or two pairs of disulphide bond. However their functional differences have not been fully unveiled. It has been shown that IFN1 can be induced by viruses and trigger strong antiviral response in inducing hundreds of IFN stimulated genes conferring cell resistance to viruses. However the antiviral functions of IFN4 have been debated. To investigate the genes modulated by IFN1 and IFN4 ZF4 cells were stimulated with recombinant IFN1 and IFN4 and were performed transcriptome analysis of the small RNA.         Small RNA IFN4 2   strain:not collected|age:not collected|collection date:2023 08 20|geo loc name:not collected|sex:not collected|tissue:not collected|cell line:ZF4|replicate:biological replicate 22|BioSampleModel:Model organism or animal                 Small RNAseq of zebrafish Small RNA IFND2 Small RNA IFND2 small RNA seq of zebrafish     miRNA-Seq TRANSCRIPTOMIC PCR SINGLE ILLUMINA Illumina NovaSeq 6000   SRP464138     IFN4-2.deadaptor.fq.gz fastq 278362309.0 11056139.0 IFN4 2.deadaptor.fq.gz 0:25.18 A:71944968;C:54562141;G:73333701;T:78511075;N:10424 25       71944968 54562141 73333701 78511075 10424 SRX21963295 SRS19039869 SRA1724093 Shanghai Ocean University|College of Fisheries and Life Science Shanghai Ocean University 1 0.93133   0.07401   0.96181   0.74558   31   B   usable mapping rate illumina novaseq_era unknown random_priming unknown bulk unknown unknown   China 2023-10-02 Undetermined Undetermined Cell Line Cell Line
28471 28471 SRR26253204 SRX21963294 SRS19039868 SRP464138 PRJNA1022587 Danio rerio Raw sequence reads PRJNA1022587 Whole Genome Sequencing In teleost type I IFNs are categorized into 2 subgroups containing one or two pairs of disulphide bond. However their functional differences have not been fully unveiled. It has been shown that IFN1 can be induced by viruses and trigger strong antiviral response in inducing hundreds of IFN stimulated genes conferring cell resistance to viruses. However the antiviral functions of IFN4 have been debated. To investigate the genes modulated by IFN1 and IFN4 ZF4 cells were stimulated with recombinant IFN1 and IFN4 and were performed transcriptome analysis of the small RNA.         Small RNA IFN4 1   strain:not collected|age:not collected|collection date:2023 08 20|geo loc name:not collected|sex:not collected|tissue:not collected|cell line:ZF4|replicate:biological replicate 21|BioSampleModel:Model organism or animal                 Small RNAseq of zebrafish Small RNA IFND1 Small RNA IFND1 small RNA seq of zebrafish     miRNA-Seq TRANSCRIPTOMIC PCR SINGLE ILLUMINA Illumina NovaSeq 6000   SRP464138     IFN4-1.deadaptor.fq.gz fastq 289362334.0 11048590.0 IFN4 1.deadaptor.fq.gz 0:26.19 A:73933649;C:59386039;G:76847534;T:79184583;N:10529 26       73933649 59386039 76847534 79184583 10529 SRX21963294 SRS19039868 SRA1724093 Shanghai Ocean University|College of Fisheries and Life Science Shanghai Ocean University 1 0.91683   0.07099   0.96132   0.64882   25   B   usable mapping rate illumina novaseq_era unknown random_priming unknown bulk unknown unknown   China 2023-10-02 Undetermined Undetermined Cell Line Cell Line
28472 28472 SRR26253205 SRX21963293 SRS19039867 SRP464138 PRJNA1022587 Danio rerio Raw sequence reads PRJNA1022587 Whole Genome Sequencing In teleost type I IFNs are categorized into 2 subgroups containing one or two pairs of disulphide bond. However their functional differences have not been fully unveiled. It has been shown that IFN1 can be induced by viruses and trigger strong antiviral response in inducing hundreds of IFN stimulated genes conferring cell resistance to viruses. However the antiviral functions of IFN4 have been debated. To investigate the genes modulated by IFN1 and IFN4 ZF4 cells were stimulated with recombinant IFN1 and IFN4 and were performed transcriptome analysis of the small RNA.         Small RNA IFN1 4   strain:not collected|age:not collected|collection date:2023 08 20|geo loc name:not collected|sex:not collected|tissue:not collected|cell line:ZF4|replicate:biological replicate 20|BioSampleModel:Model organism or animal                 Small RNAseq of zebrafish Small RNA IFNA4 Small RNA IFNA4 small RNA seq of zebrafish     miRNA-Seq TRANSCRIPTOMIC PCR SINGLE ILLUMINA Illumina NovaSeq 6000   SRP464138     IFN1-4.deadaptor.fq.gz fastq 270529395.0 11070360.0 IFN1 4.deadaptor.fq.gz 0:24.44 A:69759888;C:54924667;G:71358091;T:74470720;N:16029 24       69759888 54924667 71358091 74470720 16029 SRX21963293 SRS19039867 SRA1724093 Shanghai Ocean University|College of Fisheries and Life Science Shanghai Ocean University 1 0.88469   0.06696   0.96664   0.74853   22   B   usable mapping rate illumina novaseq_era unknown random_priming unknown bulk unknown unknown   China 2023-10-02 Undetermined Undetermined Cell Line Cell Line
28473 28473 SRR26253206 SRX21963292 SRS19039866 SRP464138 PRJNA1022587 Danio rerio Raw sequence reads PRJNA1022587 Whole Genome Sequencing In teleost type I IFNs are categorized into 2 subgroups containing one or two pairs of disulphide bond. However their functional differences have not been fully unveiled. It has been shown that IFN1 can be induced by viruses and trigger strong antiviral response in inducing hundreds of IFN stimulated genes conferring cell resistance to viruses. However the antiviral functions of IFN4 have been debated. To investigate the genes modulated by IFN1 and IFN4 ZF4 cells were stimulated with recombinant IFN1 and IFN4 and were performed transcriptome analysis of the small RNA.         Small RNA IFN1 3   strain:not collected|age:not collected|collection date:2023 08 20|geo loc name:not collected|sex:not collected|tissue:not collected|cell line:ZF4|replicate:biological replicate 19|BioSampleModel:Model organism or animal                 Small RNAseq of zebrafish Small RNA IFNA3 Small RNA IFNA3 small RNA seq of zebrafish     miRNA-Seq TRANSCRIPTOMIC PCR SINGLE ILLUMINA Illumina NovaSeq 6000   SRP464138     IFN1-3.deadaptor.fq.gz fastq 353291957.0 11740560.0 IFN1 3.deadaptor.fq.gz 0:30.09 A:89026549;C:76490337;G:94719420;T:93036955;N:18696 30       89026549 76490337 94719420 93036955 18696 SRX21963292 SRS19039866 SRA1724093 Shanghai Ocean University|College of Fisheries and Life Science Shanghai Ocean University 1 0.83151   0.07199   0.96471   0.71641   22   B   usable mapping rate illumina novaseq_era unknown random_priming unknown bulk unknown unknown   China 2023-10-02 Undetermined Undetermined Cell Line Cell Line
28474 28474 SRR26253207 SRX21963291 SRS19039865 SRP464138 PRJNA1022587 Danio rerio Raw sequence reads PRJNA1022587 Whole Genome Sequencing In teleost type I IFNs are categorized into 2 subgroups containing one or two pairs of disulphide bond. However their functional differences have not been fully unveiled. It has been shown that IFN1 can be induced by viruses and trigger strong antiviral response in inducing hundreds of IFN stimulated genes conferring cell resistance to viruses. However the antiviral functions of IFN4 have been debated. To investigate the genes modulated by IFN1 and IFN4 ZF4 cells were stimulated with recombinant IFN1 and IFN4 and were performed transcriptome analysis of the small RNA.         Small RNA IFN1 2   strain:not collected|age:not collected|collection date:2023 08 20|geo loc name:not collected|sex:not collected|tissue:not collected|cell line:ZF4|replicate:biological replicate 18|BioSampleModel:Model organism or animal                 Small RNAseq of zebrafish Small RNA IFNA2 Small RNA IFNA2 small RNA seq of zebrafish     miRNA-Seq TRANSCRIPTOMIC PCR SINGLE ILLUMINA Illumina NovaSeq 6000   SRP464138     IFN1-2.deadaptor.fq.gz fastq 257949577.0 11213774.0 IFN1 2.deadaptor.fq.gz 0:23.00 A:67371681;C:51128621;G:67605590;T:71826657;N:17028 23       67371681 51128621 67605590 71826657 17028 SRX21963291 SRS19039865 SRA1724093 Shanghai Ocean University|College of Fisheries and Life Science Shanghai Ocean University 1 0.91396   0.06536   0.97197   0.76269   23   B   usable mapping rate illumina novaseq_era unknown random_priming unknown bulk unknown unknown   China 2023-10-02 Undetermined Undetermined Cell Line Cell Line
28475 28475 SRR26253208 SRX21963290 SRS19039864 SRP464138 PRJNA1022587 Danio rerio Raw sequence reads PRJNA1022587 Whole Genome Sequencing In teleost type I IFNs are categorized into 2 subgroups containing one or two pairs of disulphide bond. However their functional differences have not been fully unveiled. It has been shown that IFN1 can be induced by viruses and trigger strong antiviral response in inducing hundreds of IFN stimulated genes conferring cell resistance to viruses. However the antiviral functions of IFN4 have been debated. To investigate the genes modulated by IFN1 and IFN4 ZF4 cells were stimulated with recombinant IFN1 and IFN4 and were performed transcriptome analysis of the small RNA.         Small RNA IFN1 1   strain:not collected|age:not collected|collection date:2023 08 20|geo loc name:not collected|sex:not collected|tissue:not collected|cell line:ZF4|replicate:biological replicate 17|BioSampleModel:Model organism or animal                 Small RNAseq of zebrafish Small RNA IFNA1 Small RNA IFNA1 small RNA seq of zebrafish     miRNA-Seq TRANSCRIPTOMIC PCR SINGLE ILLUMINA Illumina NovaSeq 6000   SRP464138     IFN1-1.deadaptor.fq.gz fastq 329358383.0 11799176.0 IFN1 1.deadaptor.fq.gz 0:27.91 A:84093681;C:68961271;G:86502739;T:89779605;N:21087 27       84093681 68961271 86502739 89779605 21087 SRX21963290 SRS19039864 SRA1724093 Shanghai Ocean University|College of Fisheries and Life Science Shanghai Ocean University 1 0.92116   0.07483   0.96796   0.75179   22   B   usable mapping rate illumina novaseq_era unknown random_priming unknown bulk unknown unknown   China 2023-10-02 Undetermined Undetermined Cell Line Cell Line
28476 28476 SRR26253209 SRX21963289 SRS19039863 SRP464138 PRJNA1022587 Danio rerio Raw sequence reads PRJNA1022587 Whole Genome Sequencing In teleost type I IFNs are categorized into 2 subgroups containing one or two pairs of disulphide bond. However their functional differences have not been fully unveiled. It has been shown that IFN1 can be induced by viruses and trigger strong antiviral response in inducing hundreds of IFN stimulated genes conferring cell resistance to viruses. However the antiviral functions of IFN4 have been debated. To investigate the genes modulated by IFN1 and IFN4 ZF4 cells were stimulated with recombinant IFN1 and IFN4 and were performed transcriptome analysis of the small RNA.         Small RNA Control 4   strain:not collected|age:not collected|collection date:2023 08 20|geo loc name:not collected|sex:not collected|tissue:not collected|cell line:ZF4|replicate:biological replicate 16|BioSampleModel:Model organism or animal                 Small RNAseq of zebrafish Small RNA C4 Small RNA C4 small RNA seq of zebrafish     miRNA-Seq TRANSCRIPTOMIC PCR SINGLE ILLUMINA Illumina NovaSeq 6000   SRP464138     Control-4.deadaptor.fq.gz fastq 251577736.0 10951659.0 Control 4.deadaptor.fq.gz 0:22.97 A:65382449;C:50041232;G:66038625;T:70106464;N:8966 22       65382449 50041232 66038625 70106464 8966 SRX21963289 SRS19039863 SRA1724093 Shanghai Ocean University|College of Fisheries and Life Science Shanghai Ocean University 1 0.89744   0.06821   0.96607   0.63829   22   B   usable mapping rate illumina novaseq_era unknown random_priming unknown bulk unknown unknown   China 2023-10-02 Undetermined Undetermined Cell Line Cell Line
28477 28477 SRR26253210 SRX21963288 SRS19039862 SRP464138 PRJNA1022587 Danio rerio Raw sequence reads PRJNA1022587 Whole Genome Sequencing In teleost type I IFNs are categorized into 2 subgroups containing one or two pairs of disulphide bond. However their functional differences have not been fully unveiled. It has been shown that IFN1 can be induced by viruses and trigger strong antiviral response in inducing hundreds of IFN stimulated genes conferring cell resistance to viruses. However the antiviral functions of IFN4 have been debated. To investigate the genes modulated by IFN1 and IFN4 ZF4 cells were stimulated with recombinant IFN1 and IFN4 and were performed transcriptome analysis of the small RNA.         Small RNA Control 3   strain:not collected|age:not collected|collection date:2023 08 20|geo loc name:not collected|sex:not collected|tissue:not collected|cell line:ZF4|replicate:biological replicate 15|BioSampleModel:Model organism or animal                 Small RNAseq of zebrafish Small RNA C3 Small RNA C3 small RNA seq of zebrafish     miRNA-Seq TRANSCRIPTOMIC PCR SINGLE ILLUMINA Illumina NovaSeq 6000   SRP464138     Control-3.deadaptor.fq.gz fastq 252164979.0 11004167.0 Control 3.deadaptor.fq.gz 0:22.92 A:65850899;C:48466665;G:66708038;T:71130786;N:8591 22       65850899 48466665 66708038 71130786 8591 SRX21963288 SRS19039862 SRA1724093 Shanghai Ocean University|College of Fisheries and Life Science Shanghai Ocean University 1 0.91567   0.06804   0.96278   0.75579   22   B   usable mapping rate illumina novaseq_era unknown random_priming unknown bulk unknown unknown   China 2023-10-02 Undetermined Undetermined Cell Line Cell Line
28478 28478 SRR26253211 SRX21963287 SRS19039861 SRP464138 PRJNA1022587 Danio rerio Raw sequence reads PRJNA1022587 Whole Genome Sequencing In teleost type I IFNs are categorized into 2 subgroups containing one or two pairs of disulphide bond. However their functional differences have not been fully unveiled. It has been shown that IFN1 can be induced by viruses and trigger strong antiviral response in inducing hundreds of IFN stimulated genes conferring cell resistance to viruses. However the antiviral functions of IFN4 have been debated. To investigate the genes modulated by IFN1 and IFN4 ZF4 cells were stimulated with recombinant IFN1 and IFN4 and were performed transcriptome analysis of the small RNA.         Small RNA IFN4 4   strain:not collected|age:not collected|collection date:2023 08 20|geo loc name:not collected|sex:not collected|tissue:not collected|cell line:ZF4|replicate:biological replicate 24|BioSampleModel:Model organism or animal                 Small RNAseq of zebrafish Small RNA IFND4 Small RNA IFND4 small RNA seq of zebrafish     miRNA-Seq TRANSCRIPTOMIC PCR SINGLE ILLUMINA Illumina NovaSeq 6000   SRP464138     IFN4-4.deadaptor.fq.gz fastq 291708053.0 11503883.0 IFN4 4.deadaptor.fq.gz 0:25.36 A:74079231;C:61368459;G:76898572;T:79351225;N:10566 25       74079231 61368459 76898572 79351225 10566 SRX21963287 SRS19039861 SRA1724093 Shanghai Ocean University|College of Fisheries and Life Science Shanghai Ocean University 1 0.88888   0.0633   0.97305   0.74862   23   B   usable mapping rate illumina novaseq_era unknown random_priming unknown bulk unknown unknown   China 2023-10-02 Undetermined Undetermined Cell Line Cell Line
28479 28479 SRR26253212 SRX21963286 SRS19039860 SRP464138 PRJNA1022587 Danio rerio Raw sequence reads PRJNA1022587 Whole Genome Sequencing In teleost type I IFNs are categorized into 2 subgroups containing one or two pairs of disulphide bond. However their functional differences have not been fully unveiled. It has been shown that IFN1 can be induced by viruses and trigger strong antiviral response in inducing hundreds of IFN stimulated genes conferring cell resistance to viruses. However the antiviral functions of IFN4 have been debated. To investigate the genes modulated by IFN1 and IFN4 ZF4 cells were stimulated with recombinant IFN1 and IFN4 and were performed transcriptome analysis of the small RNA.         Small RNA IFN4 3   strain:not collected|age:not collected|collection date:2023 08 20|geo loc name:not collected|sex:not collected|tissue:not collected|cell line:ZF4|replicate:biological replicate 23|BioSampleModel:Model organism or animal                 Small RNAseq of zebrafish Small RNA IFND3 Small RNA IFND3 small RNA seq of zebrafish     miRNA-Seq TRANSCRIPTOMIC PCR SINGLE ILLUMINA Illumina NovaSeq 6000   SRP464138     IFN4-3.deadaptor.fq.gz fastq 349995495.0 11885662.0 IFN4 3.deadaptor.fq.gz 0:29.45 A:87443709;C:76373108;G:92741296;T:93425866;N:11516 29       87443709 76373108 92741296 93425866 11516 SRX21963286 SRS19039860 SRA1724093 Shanghai Ocean University|College of Fisheries and Life Science Shanghai Ocean University 1 0.92619   0.06843   0.9709   0.74977   73   B   usable mapping rate illumina novaseq_era unknown random_priming unknown bulk unknown unknown   China 2023-10-02 Undetermined Undetermined Cell Line Cell Line
28480 28480 SRR26253213 SRX21963285 SRS19039859 SRP464138 PRJNA1022587 Danio rerio Raw sequence reads PRJNA1022587 Whole Genome Sequencing In teleost type I IFNs are categorized into 2 subgroups containing one or two pairs of disulphide bond. However their functional differences have not been fully unveiled. It has been shown that IFN1 can be induced by viruses and trigger strong antiviral response in inducing hundreds of IFN stimulated genes conferring cell resistance to viruses. However the antiviral functions of IFN4 have been debated. To investigate the genes modulated by IFN1 and IFN4 ZF4 cells were stimulated with recombinant IFN1 and IFN4 and were performed transcriptome analysis of the small RNA.         Small RNA Control 2   strain:not collected|age:not collected|collection date:2023 08 20|geo loc name:not collected|sex:not collected|tissue:not collected|cell line:ZF4|replicate:biological replicate 14|BioSampleModel:Model organism or animal                 Small RNAseq of zebrafish Small RNA C2 Small RNA C2 small RNA seq of zebrafish     miRNA-Seq TRANSCRIPTOMIC PCR SINGLE ILLUMINA Illumina NovaSeq 6000   SRP464138     Control-2.deadaptor.fq.gz fastq 254163676.0 10744164.0 Control 2.deadaptor.fq.gz 0:23.66 A:66003417;C:49309846;G:67463940;T:71377644;N:8829 23       66003417 49309846 67463940 71377644 8829 SRX21963285 SRS19039859 SRA1724093 Shanghai Ocean University|College of Fisheries and Life Science Shanghai Ocean University 1 0.93068   0.06626   0.96441   0.7492   22   B   usable mapping rate illumina novaseq_era unknown random_priming unknown bulk unknown unknown   China 2023-10-02 Undetermined Undetermined Cell Line Cell Line
28481 28481 SRR26253214 SRX21963284 SRS19039858 SRP464138 PRJNA1022587 Danio rerio Raw sequence reads PRJNA1022587 Whole Genome Sequencing In teleost type I IFNs are categorized into 2 subgroups containing one or two pairs of disulphide bond. However their functional differences have not been fully unveiled. It has been shown that IFN1 can be induced by viruses and trigger strong antiviral response in inducing hundreds of IFN stimulated genes conferring cell resistance to viruses. However the antiviral functions of IFN4 have been debated. To investigate the genes modulated by IFN1 and IFN4 ZF4 cells were stimulated with recombinant IFN1 and IFN4 and were performed transcriptome analysis of the small RNA.         Small RNA Control 1   strain:not collected|age:not collected|collection date:2023 08 20|geo loc name:not collected|sex:not collected|tissue:not collected|cell line:ZF4|replicate:biological replicate 13|BioSampleModel:Model organism or animal                 Small RNAseq of zebrafish Small RNA C1 Small RNA C1 small RNA seq of zebrafish     miRNA-Seq TRANSCRIPTOMIC PCR SINGLE ILLUMINA Illumina NovaSeq 6000   SRP464138     Control-1.deadaptor.fq.gz fastq 267090429.0 11027241.0 Control 1.deadaptor.fq.gz 0:24.22 A:70162511;C:50705437;G:69872659;T:76339682;N:10140 24       70162511 50705437 69872659 76339682 10140 SRX21963284 SRS19039858 SRA1724093 Shanghai Ocean University|College of Fisheries and Life Science Shanghai Ocean University 1 0.93267   0.07189   0.96735   0.75447   21   B   usable mapping rate illumina novaseq_era unknown random_priming unknown bulk unknown unknown   China 2023-10-02 Undetermined Undetermined Cell Line Cell Line
30250 30250 SRR27756860 SRX23421865 SRS20276790 SRP486416 PRJNA1069604 Danio rerio strain:TL | breed:Danio rerio Raw sequence reads PRJNA1069604 Other To study the effect of a gene deletion in zebrafish       Model organism or animal sample from danio rerio cobll1a   ecotype:missing|dev stage:missing|collection date:2023 02 21|geo loc name:missing|sex:neuter|tissue:FISH|biomaterial provider:missing|z:1000|BioSampleModel:Model organism or animal                 Sample A 1 1 common method     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP486416     cobll1a1.R2.fq.gz cobll1a1.R1.fq.gz fastq fastq 7119566009.0 24893517.0 cobll1a1.R1.fq.gz 0:143.02 1:142.98 A:1899718926;C:1652762152;G:1669973661;T:1897092278;N:18992 143 142     1899718926 1652762152 1669973661 1897092278 18992 SRX23421865 SRS20276790 SRA1792726 Hunan Normal University|Hunan Normal University Hunan Normal University Hunan Normal University Hunan Normal University 2 0.95825 0.95956 0.0788 0.07795 0.67894 0.67884 0.48342 0.48268 150 150 B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2024-01-29 Undetermined Undetermined Undetermined Undetermined
30251 30251 SRR27756861 SRX23421864 SRS20276789 SRP486416 PRJNA1069604 Danio rerio strain:TL | breed:Danio rerio Raw sequence reads PRJNA1069604 Other To study the effect of a gene deletion in zebrafish       MIMARKS Specimen sample from Danio rerio WT   strain:WT|collection date:2023 02 28|depth:missing|elev:missing|env broad scale:missing|env local scale:missing|env medium:missing|geo loc name:missing|isol growth condt:missing|lat lon:missing|BioSampleModel:MIMARKS.specimen|BioSampleModel:MIGS/MIMS/MIMARKS.microbial                 Sample L 11 11 common method     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP486416     tu3.R1.fq.gz tu3.R2.fq.gz fastq fastq 6881670461.0 24208326.0 tu3.R1.fq.gz 0:142.15 1:142.12 A:1820714788;C:1612866668;G:1629078247;T:1818992861;N:17897 142 142     1820714788 1612866668 1629078247 1818992861 17897 SRX23421864 SRS20276789 SRA1792726 Hunan Normal University|Hunan Normal University Hunan Normal University Hunan Normal University Hunan Normal University 2 0.95713 0.95821 0.07191 0.07071 0.67801 0.67726 0.48591 0.48501 150 150 B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2024-01-29 Undetermined Undetermined Undetermined Undetermined
30252 30252 SRR27756862 SRX23421863 SRS20276790 SRP486416 PRJNA1069604 Danio rerio strain:TL | breed:Danio rerio Raw sequence reads PRJNA1069604 Other To study the effect of a gene deletion in zebrafish       Model organism or animal sample from danio rerio cobll1a   ecotype:missing|dev stage:missing|collection date:2023 02 21|geo loc name:missing|sex:neuter|tissue:FISH|biomaterial provider:missing|z:1000|BioSampleModel:Model organism or animal                 Sample C 3 3 common method     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP486416     cobll1a2.R1.fq.gz cobll1a2.R2.fq.gz fastq fastq 6639076778.0 23213579.0 cobll1a2.R1.fq.gz 0:143.02 1:142.98 A:1799749408;C:1513051586;G:1530064901;T:1796193421;N:17462 143 142     1799749408 1513051586 1530064901 1796193421 17462 SRX23421863 SRS20276790 SRA1792726 Hunan Normal University|Hunan Normal University Hunan Normal University Hunan Normal University Hunan Normal University 2 0.95695 0.95781 0.091 0.0896 0.68199 0.68075 0.49051 0.49057 150 150 B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2024-01-29 Undetermined Undetermined Undetermined Undetermined
30253 30253 SRR27756863 SRX23421862 SRS20276790 SRP486416 PRJNA1069604 Danio rerio strain:TL | breed:Danio rerio Raw sequence reads PRJNA1069604 Other To study the effect of a gene deletion in zebrafish       Model organism or animal sample from danio rerio cobll1a   ecotype:missing|dev stage:missing|collection date:2023 02 21|geo loc name:missing|sex:neuter|tissue:FISH|biomaterial provider:missing|z:1000|BioSampleModel:Model organism or animal                 Sample E 5 5 common method     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP486416     cobll1a3.R2.fq.gz cobll1a3.R1.fq.gz fastq fastq 6697695084.0 23490214.0 cobll1a3.R1.fq.gz 0:142.58 1:142.55 A:1755043056;C:1586242926;G:1602146148;T:1754245480;N:17474 142 142     1755043056 1586242926 1602146148 1754245480 17474 SRX23421862 SRS20276790 SRA1792726 Hunan Normal University|Hunan Normal University Hunan Normal University Hunan Normal University Hunan Normal University 2 0.96007 0.96224 0.06487 0.06404 0.66939 0.66906 0.48829 0.48765 130 130 B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2024-01-29 Undetermined Undetermined Undetermined Undetermined
30254 30254 SRR27756864 SRX23421861 SRS20276789 SRP486416 PRJNA1069604 Danio rerio strain:TL | breed:Danio rerio Raw sequence reads PRJNA1069604 Other To study the effect of a gene deletion in zebrafish       MIMARKS Specimen sample from Danio rerio WT   strain:WT|collection date:2023 02 28|depth:missing|elev:missing|env broad scale:missing|env local scale:missing|env medium:missing|geo loc name:missing|isol growth condt:missing|lat lon:missing|BioSampleModel:MIMARKS.specimen|BioSampleModel:MIGS/MIMS/MIMARKS.microbial                 Sample G 7 7 common method     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP486416     tu1.R1.fq.gz tu1.R2.fq.gz fastq fastq 7124072376.0 25020568.0 tu1.R1.fq.gz 0:142.38 1:142.35 A:1889928651;C:1664950324;G:1681768417;T:1887406325;N:18659 142 142     1889928651 1664950324 1681768417 1887406325 18659 SRX23421861 SRS20276789 SRA1792726 Hunan Normal University|Hunan Normal University Hunan Normal University Hunan Normal University Hunan Normal University 2 0.96032 0.96145 0.07398 0.07359 0.68503 0.6843 0.48524 0.48933 116 116 B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2024-01-29 Undetermined Undetermined Undetermined Undetermined
30255 30255 SRR27756865 SRX23421860 SRS20276789 SRP486416 PRJNA1069604 Danio rerio strain:TL | breed:Danio rerio Raw sequence reads PRJNA1069604 Other To study the effect of a gene deletion in zebrafish       MIMARKS Specimen sample from Danio rerio WT   strain:WT|collection date:2023 02 28|depth:missing|elev:missing|env broad scale:missing|env local scale:missing|env medium:missing|geo loc name:missing|isol growth condt:missing|lat lon:missing|BioSampleModel:MIMARKS.specimen|BioSampleModel:MIGS/MIMS/MIMARKS.microbial                 Sample J 9 9 common method     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP486416     tu2.R1.fq.gz tu2.R2.fq.gz fastq fastq 7024719799.0 24627933.0 tu2.R1.fq.gz 0:142.63 1:142.60 A:1841519314;C:1662861553;G:1679614735;T:1840705226;N:18971 142 142     1841519314 1662861553 1679614735 1840705226 18971 SRX23421860 SRS20276789 SRA1792726 Hunan Normal University|Hunan Normal University Hunan Normal University Hunan Normal University Hunan Normal University 2 0.96006 0.96141 0.06713 0.06631 0.67464 0.67426 0.48684 0.48648 150 150 B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2024-01-29 Undetermined Undetermined Undetermined Undetermined
30702 30702 SRR28328136 SRX23936571 SRS20740255 SRP494948 PRJNA1086823 Danio rerio Raw sequence reads PRJNA1086823 Whole Genome Sequencing Study the effects on the body when this gene is lost     Study the effects on the body when this gene is lost Model organism or animal sample from Danio rerio tu   strain:FISH|age:2|collection date:2023 02 28|geo loc name:missing|sex:missing|tissue:missing|biomaterial provider:missing|BioSampleModel:Model organism or animal                 SampleF 6 6 control     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP494948     tu_3.R1.raw.fastq.gz tu_3.R2.raw.fastq.gz fastq fastq 6836795894.0 22638397.0 tu 3.R1.raw.fastq.gz 0:151 1:151 A:1911756035;C:1496221872;G:1563235044;T:1865509810;N:73133 151 151     1911756035 1496221872 1563235044 1865509810 73133 SRX23936571 SRS20740255 SRA1823374 Hunan Normal University|Hunan Normal University Hunan Normal University                       B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2024-03-13 Undetermined Undetermined Trunk Surface Structure
30703 30703 SRR28328137 SRX23936570 SRS20740255 SRP494948 PRJNA1086823 Danio rerio Raw sequence reads PRJNA1086823 Whole Genome Sequencing Study the effects on the body when this gene is lost     Study the effects on the body when this gene is lost Model organism or animal sample from Danio rerio tu   strain:FISH|age:2|collection date:2023 02 28|geo loc name:missing|sex:missing|tissue:missing|biomaterial provider:missing|BioSampleModel:Model organism or animal                 SampleE 5 5 control     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP494948     tu_2.R1.raw.fastq.gz tu_2.R2.raw.fastq.gz fastq fastq 6933313282.0 22957991.0 tu 2.R1.raw.fastq.gz 0:151 1:151 A:1895897966;C:1562896362;G:1633152399;T:1841286721;N:79834 151 151     1895897966 1562896362 1633152399 1841286721 79834 SRX23936570 SRS20740255 SRA1823374 Hunan Normal University|Hunan Normal University Hunan Normal University                       B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2024-03-13 Undetermined Undetermined Trunk Surface Structure
30704 30704 SRR28328138 SRX23936569 SRS20740255 SRP494948 PRJNA1086823 Danio rerio Raw sequence reads PRJNA1086823 Whole Genome Sequencing Study the effects on the body when this gene is lost     Study the effects on the body when this gene is lost Model organism or animal sample from Danio rerio tu   strain:FISH|age:2|collection date:2023 02 28|geo loc name:missing|sex:missing|tissue:missing|biomaterial provider:missing|BioSampleModel:Model organism or animal                 SampleD 4 4 control     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP494948     tu_1.R1.raw.fastq.gz tu_1.R2.raw.fastq.gz fastq fastq 6953463930.0 23024715.0 tu 1.R1.raw.fastq.gz 0:151 1:151 A:1914281996;C:1558685345;G:1630355775;T:1850061551;N:79263 151 151     1914281996 1558685345 1630355775 1850061551 79263 SRX23936569 SRS20740255 SRA1823374 Hunan Normal University|Hunan Normal University Hunan Normal University                       B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2024-03-13 Undetermined Undetermined Trunk Surface Structure
30705 30705 SRR28328139 SRX23936568 SRS20740254 SRP494948 PRJNA1086823 Danio rerio Raw sequence reads PRJNA1086823 Whole Genome Sequencing Study the effects on the body when this gene is lost     Study the effects on the body when this gene is lost Model organism or animal sample from Danio rerio myo7aa   strain:FISH|age:2|collection date:2023 02 28|geo loc name:missing|sex:missing|tissue:missing|BioSampleModel:Model organism or animal                 SampleC 3 3 treatment     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP494948     myo7aa_3.R1.raw.fastq.gz myo7aa_3.R2.raw.fastq.gz fastq fastq 6793366180.0 22494590.0 myo7aa 3.R1.raw.fastq.gz 0:151 1:151 A:1786353133;C:1602317410;G:1674855786;T:1729822151;N:17700 151 151     1786353133 1602317410 1674855786 1729822151 17700 SRX23936568 SRS20740254 SRA1823374 Hunan Normal University|Hunan Normal University Hunan Normal University                       B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2024-03-13 Undetermined Undetermined Trunk Surface Structure
30706 30706 SRR28328140 SRX23936567 SRS20740254 SRP494948 PRJNA1086823 Danio rerio Raw sequence reads PRJNA1086823 Whole Genome Sequencing Study the effects on the body when this gene is lost     Study the effects on the body when this gene is lost Model organism or animal sample from Danio rerio myo7aa   strain:FISH|age:2|collection date:2023 02 28|geo loc name:missing|sex:missing|tissue:missing|BioSampleModel:Model organism or animal                 SampleB 2 2 treatment     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP494948     myo7aa_2.R1.raw.fastq.gz myo7aa_2.R2.raw.fastq.gz fastq fastq 6762797438.0 22393369.0 myo7aa 2.R1.raw.fastq.gz 0:151 1:151 A:1816704062;C:1557768239;G:1627373716;T:1760926609;N:24812 151 151     1816704062 1557768239 1627373716 1760926609 24812 SRX23936567 SRS20740254 SRA1823374 Hunan Normal University|Hunan Normal University Hunan Normal University                       B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2024-03-13 Undetermined Undetermined Trunk Surface Structure
30707 30707 SRR28328141 SRX23936566 SRS20740254 SRP494948 PRJNA1086823 Danio rerio Raw sequence reads PRJNA1086823 Whole Genome Sequencing Study the effects on the body when this gene is lost     Study the effects on the body when this gene is lost Model organism or animal sample from Danio rerio myo7aa   strain:FISH|age:2|collection date:2023 02 28|geo loc name:missing|sex:missing|tissue:missing|BioSampleModel:Model organism or animal                 SampleA 1 1 treatment     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP494948     myo7aa_1.R1.raw.fastq.gz myo7aa_1.R2.raw.fastq.gz fastq fastq 6605710628.0 21873214.0 myo7aa 1.R1.raw.fastq.gz 0:151 1:151 A:1728796843;C:1565920605;G:1629477870;T:1681497978;N:17332 151 151     1728796843 1565920605 1629477870 1681497978 17332 SRX23936566 SRS20740254 SRA1823374 Hunan Normal University|Hunan Normal University Hunan Normal University                       B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2024-03-13 Undetermined Undetermined Trunk Surface Structure
32476 32476 SRR29270149 SRX24787634 SRS21505104 SRP511487 PRJNA1119569 RNA seq of zebrafish foxl2l mutant PRJNA1119569 Other Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.         foxl2l Mut 20 1   strain:AB|age:20|collection date:2023 06 10|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal                 foxl2l Mut 20 1 E10 E10 50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA NextSeq 500   SRP511487     foxl2l_Mut-20-1_S162_R1.fastq.gz foxl2l_Mut-20-1_S162_R2.fastq.gz fastq fastq 8940963680.0 29605840.0 foxl2l Mut 20 1 S162 R1.fastq.gz 0:151 1:151 A:2232167098;C:2229744850;G:2271326718;T:2207692629;N:32385 151 151     2232167098 2229744850 2271326718 2207692629 32385 SRX24787634 SRS21505104 SRA1887976 Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology Institute of Hydrobiology, Chinese Academy of Sciences                       B B biological fallback assumption illumina nextseq unknown random_priming unknown bulk bulk bulk   China 2024-06-03 Undetermined Undetermined Gonad Reproductive System
32477 32477 SRR29270150 SRX24787633 SRS21505103 SRP511487 PRJNA1119569 RNA seq of zebrafish foxl2l mutant PRJNA1119569 Other Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.         foxl2l Het 20 3   strain:AB|age:20|collection date:2023 06 09|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal                 foxl2l Het 20 3 E9 E9 50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA NextSeq 500   SRP511487     foxl2l_Het-20-3_S161_R1.fastq.gz foxl2l_Het-20-3_S161_R2.fastq.gz fastq fastq 7038409282.0 23305991.0 foxl2l Het 20 3 S161 R1.fastq.gz 0:151 1:151 A:1766863186;C:1740008639;G:1787471686;T:1744039429;N:26342 151 151     1766863186 1740008639 1787471686 1744039429 26342 SRX24787633 SRS21505103 SRA1887976 Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology Institute of Hydrobiology, Chinese Academy of Sciences                       B B biological fallback assumption illumina nextseq unknown random_priming unknown bulk bulk bulk   China 2024-06-03 Undetermined Undetermined Gonad Reproductive System
32478 32478 SRR29270151 SRX24787632 SRS21505102 SRP511487 PRJNA1119569 RNA seq of zebrafish foxl2l mutant PRJNA1119569 Other Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.         foxl2l Het 20 2   strain:AB|age:20|collection date:2023 06 08|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal                 foxl2l Het 20 2 E8 E8 50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA NextSeq 500   SRP511487     foxl2l_Het-20-2_S160_R1.fastq.gz foxl2l_Het-20-2_S160_R2.fastq.gz fastq fastq 6772505832.0 22425516.0 foxl2l Het 20 2 S160 R1.fastq.gz 0:151 1:151 A:1704124986;C:1673138074;G:1713003931;T:1682214009;N:24832 151 151     1704124986 1673138074 1713003931 1682214009 24832 SRX24787632 SRS21505102 SRA1887976 Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology Institute of Hydrobiology, Chinese Academy of Sciences                       B B biological fallback assumption illumina nextseq unknown random_priming unknown bulk bulk bulk   China 2024-06-03 Undetermined Undetermined Gonad Reproductive System
32479 32479 SRR29270152 SRX24787631 SRS21505101 SRP511487 PRJNA1119569 RNA seq of zebrafish foxl2l mutant PRJNA1119569 Other Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.         foxl2l Het 20 1   strain:AB|age:20|collection date:2023 06 07|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal                 foxl2l Het 20 1 E7 E7 50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA NextSeq 500   SRP511487     foxl2l_Het-20-1_S159_R1.fastq.gz foxl2l_Het-20-1_S159_R2.fastq.gz fastq fastq 11685740812.0 38694506.0 foxl2l Het 20 1 S159 R1.fastq.gz 0:151 1:151 A:2939618668;C:2888861085;G:2958173208;T:2899044704;N:43147 151 151     2939618668 2888861085 2958173208 2899044704 43147 SRX24787631 SRS21505101 SRA1887976 Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology Institute of Hydrobiology, Chinese Academy of Sciences                       B B biological fallback assumption illumina nextseq unknown random_priming unknown bulk bulk bulk   China 2024-06-03 Undetermined Undetermined Gonad Reproductive System
32480 32480 SRR29270153 SRX24787630 SRS21505100 SRP511487 PRJNA1119569 RNA seq of zebrafish foxl2l mutant PRJNA1119569 Other Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.         foxl2l Mut 15 3   strain:AB|age:15|collection date:2023 06 06|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal                 foxl2l Mut 15 3 E6 E6 50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA NextSeq 500   SRP511487     foxl2l_Mut-15-3_S158_R1.fastq.gz foxl2l_Mut-15-3_S158_R2.fastq.gz fastq fastq 9503789604.0 31469502.0 foxl2l Mut 15 3 S158 R1.fastq.gz 0:151 1:151 A:2393052443;C:2340958111;G:2411502428;T:2358240313;N:36309 151 151     2393052443 2340958111 2411502428 2358240313 36309 SRX24787630 SRS21505100 SRA1887976 Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology Institute of Hydrobiology, Chinese Academy of Sciences                       B B biological fallback assumption illumina nextseq unknown random_priming unknown bulk bulk bulk   China 2024-06-03 Undetermined Undetermined Gonad Reproductive System
32481 32481 SRR29270154 SRX24787629 SRS21505099 SRP511487 PRJNA1119569 RNA seq of zebrafish foxl2l mutant PRJNA1119569 Other Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.         foxl2l Mut 15 2   strain:AB|age:15|collection date:2023 06 05|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal                 foxl2l Mut 15 2 E5 E5 50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA NextSeq 500   SRP511487     foxl2l_Mut-15-2_S157_R1.fastq.gz foxl2l_Mut-15-2_S157_R2.fastq.gz fastq fastq 7416837026.0 24559063.0 foxl2l Mut 15 2 S157 R1.fastq.gz 0:151 1:151 A:1865711045;C:1830489703;G:1881612508;T:1838995980;N:27790 151 151     1865711045 1830489703 1881612508 1838995980 27790 SRX24787629 SRS21505099 SRA1887976 Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology Institute of Hydrobiology, Chinese Academy of Sciences                       B B biological fallback assumption illumina nextseq unknown random_priming unknown bulk bulk bulk   China 2024-06-03 Undetermined Undetermined Gonad Reproductive System
32482 32482 SRR29270155 SRX24787628 SRS21505098 SRP511487 PRJNA1119569 RNA seq of zebrafish foxl2l mutant PRJNA1119569 Other Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.         foxl2l Mut 15 1   strain:AB|age:15|collection date:2023 06 04|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal                 foxl2l Mut 15 1 E4 E4 50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA NextSeq 500   SRP511487     foxl2l_Mut-15-1_S156_R1.fastq.gz foxl2l_Mut-15-1_S156_R2.fastq.gz fastq fastq 7092721868.0 23485834.0 foxl2l Mut 15 1 S156 R1.fastq.gz 0:151 1:151 A:1764166761;C:1770534219;G:1820397492;T:1737597123;N:26273 151 151     1764166761 1770534219 1820397492 1737597123 26273 SRX24787628 SRS21505098 SRA1887976 Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology Institute of Hydrobiology, Chinese Academy of Sciences                       B B biological fallback assumption illumina nextseq unknown random_priming unknown bulk bulk bulk   China 2024-06-03 Undetermined Undetermined Gonad Reproductive System
32483 32483 SRR29270156 SRX24787627 SRS21505097 SRP511487 PRJNA1119569 RNA seq of zebrafish foxl2l mutant PRJNA1119569 Other Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.         foxl2l Het 15 3   strain:AB|age:15|collection date:2023 06 03|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal                 foxl2l Het 15 3 E3 E3 50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA NextSeq 500   SRP511487     foxl2l_Het-15-3_S155_R1.fastq.gz foxl2l_Het-15-3_S155_R2.fastq.gz fastq fastq 8083606820.0 26766910.0 foxl2l Het 15 3 S155 R1.fastq.gz 0:151 1:151 A:2028557443;C:2001113164;G:2050610840;T:2003295953;N:29420 151 151     2028557443 2001113164 2050610840 2003295953 29420 SRX24787627 SRS21505097 SRA1887976 Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology Institute of Hydrobiology, Chinese Academy of Sciences                       B B biological fallback assumption illumina nextseq unknown random_priming unknown bulk bulk bulk   China 2024-06-03 Undetermined Undetermined Gonad Reproductive System
32484 32484 SRR29270157 SRX24787626 SRS21505096 SRP511487 PRJNA1119569 RNA seq of zebrafish foxl2l mutant PRJNA1119569 Other Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.         foxl2l Mut 20 3   strain:AB|age:20|collection date:2023 06 12|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal                 foxl2l Mut 20 3 E12 E12 50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA NextSeq 500   SRP511487     foxl2l_Mut-20-3_S164_R1.fastq.gz foxl2l_Mut-20-3_S164_R2.fastq.gz fastq fastq 7474861796.0 24751198.0 foxl2l Mut 20 3 S164 R1.fastq.gz 0:151 1:151 A:1878881650;C:1849512621;G:1891142525;T:1855296720;N:28280 151 151     1878881650 1849512621 1891142525 1855296720 28280 SRX24787626 SRS21505096 SRA1887976 Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology Institute of Hydrobiology, Chinese Academy of Sciences                       B B biological fallback assumption illumina nextseq unknown random_priming unknown bulk bulk bulk   China 2024-06-03 Undetermined Undetermined Gonad Reproductive System
32485 32485 SRR29270158 SRX24787625 SRS21505095 SRP511487 PRJNA1119569 RNA seq of zebrafish foxl2l mutant PRJNA1119569 Other Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.         foxl2l Mut 20 2   strain:AB|age:20|collection date:2023 06 11|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal                 foxl2l Mut 20 2 E11 E11 50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA NextSeq 500   SRP511487     foxl2l_Mut-20-2_S163_R1.fastq.gz foxl2l_Mut-20-2_S163_R2.fastq.gz fastq fastq 8203704066.0 27164583.0 foxl2l Mut 20 2 S163 R1.fastq.gz 0:151 1:151 A:2061693689;C:2030126562;G:2072980952;T:2038873198;N:29665 151 151     2061693689 2030126562 2072980952 2038873198 29665 SRX24787625 SRS21505095 SRA1887976 Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology Institute of Hydrobiology, Chinese Academy of Sciences                       B B biological fallback assumption illumina nextseq unknown random_priming unknown bulk bulk bulk   China 2024-06-03 Undetermined Undetermined Gonad Reproductive System
32486 32486 SRR29270159 SRX24787624 SRS21505094 SRP511487 PRJNA1119569 RNA seq of zebrafish foxl2l mutant PRJNA1119569 Other Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.         foxl2l Het 15 2   strain:AB|age:15|collection date:2023 06 02|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal                 foxl2l Het 15 2 E2 E2 50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA NextSeq 500   SRP511487     foxl2l_Het-15-2_S154_R1.fastq.gz foxl2l_Het-15-2_S154_R2.fastq.gz fastq fastq 7868286860.0 26053930.0 foxl2l Het 15 2 S154 R1.fastq.gz 0:151 1:151 A:1972210357;C:1946891859;G:2008091153;T:1941064817;N:28674 151 151     1972210357 1946891859 2008091153 1941064817 28674 SRX24787624 SRS21505094 SRA1887976 Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology Institute of Hydrobiology, Chinese Academy of Sciences                       B B biological fallback assumption illumina nextseq unknown random_priming unknown bulk bulk bulk   China 2024-06-03 Undetermined Undetermined Gonad Reproductive System
32487 32487 SRR29270160 SRX24787623 SRS21505093 SRP511487 PRJNA1119569 RNA seq of zebrafish foxl2l mutant PRJNA1119569 Other Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.         foxl2l Het 15 1   strain:AB|age:15|collection date:2023 06 01|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal                 foxl2l Het 15 1 E1 E1 50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA NextSeq 500   SRP511487     foxl2l_Het-15-1_S153_R1.fastq.gz foxl2l_Het-15-1_S153_R2.fastq.gz fastq fastq 7117391946.0 23567523.0 foxl2l Het 15 1 S153 R1.fastq.gz 0:151 1:151 A:1795668098;C:1752824783;G:1793720116;T:1775153584;N:25365 151 151     1795668098 1752824783 1793720116 1775153584 25365 SRX24787623 SRS21505093 SRA1887976 Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology Institute of Hydrobiology, Chinese Academy of Sciences                       B B biological fallback assumption illumina nextseq unknown random_priming unknown bulk bulk bulk   China 2024-06-03 Undetermined Undetermined Gonad Reproductive System
48115 48115 SRR7252252 SRX4156979 SRS3369496 SRP149646 PRJNA453111 Danio rerio Transcriptome or Gene expression PRJNA453111 Other The effect of oligosaccharides on zebrafish genes       Model organism or animal sample from Danio rerio 02 zebrafish 2   breed:zebrafish|dev stage:sexual maturity|sex:not determined|tissue:the whole fish|BioSampleModel:Model organism or animal                 Danio rerio Raw sequence reads T02 T02 Liver of FOS exposure     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA Illumina HiSeq 2000   SRP149646     Zebrafish_G017-T02_good_2.fq Zebrafish_G017-T02_good_1.fq fastq fastq 14376728630.0 48016590.0 Zebrafish G017 T02 good 2.fq 0:149.71 1:149.71 A:3691193836;C:3492856068;G:3505759208;T:3686065491;N:854027 149 149     3691193836 3492856068 3505759208 3686065491 854027 SRX4156979 SRS3369496 SRA714653 Henan University of Scientific and Technology|College of Animal Science and Technology Henan University of Scientific and Technology 2 0.91739 0.92142 0.02484 0.02505 0.6873 0.69402 0.47704 0.47922 150 150 B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2018-06-04 Undetermined Undetermined Whole Organism All anatomical structures
48116 48116 SRR7252253 SRX4156978 SRS3369495 SRP149646 PRJNA453111 Danio rerio Transcriptome or Gene expression PRJNA453111 Other The effect of oligosaccharides on zebrafish genes       Model organism or animal sample from Danio rerio zebrafish   breed:zebrafish|dev stage:sexual maturity|sex:not determined|tissue:the whole fish|BioSampleModel:Model organism or animal                 Danio rerio Raw sequence reads T01 T01 Liver of control     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA Illumina HiSeq 2000   SRP149646     Zebrafish_G017-T01_good_1.fq Zebrafish_G017-T01_good_2.fq fastq fastq 14807578386.0 49468651.0 Zebrafish G017 T01 good 2.fq 0:149.67 1:149.67 A:3802207986;C:3595045362;G:3614407174;T:3795034464;N:883400 149 149     3802207986 3595045362 3614407174 3795034464 883400 SRX4156978 SRS3369495 SRA714653 Henan University of Scientific and Technology|College of Animal Science and Technology Henan University of Scientific and Technology 2 0.92048 0.92419 0.03167 0.03195 0.67105 0.67489 0.43695 0.44187 150 150 B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2018-06-04 Undetermined Undetermined Whole Organism All anatomical structures
49815 49815 SRR8987978 SRX5767074 SRS4701368 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       24h 6 sample exposed to microcystin for xxxh replicate #6   ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh replicate #6|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxxh replicate #6 24h 3 24h 3 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     24h3_clean_R2.fq.gz 24h3_clean_R1.fq.gz fastq fastq 6275458528.0 20779664.0 24h3 clean R1.fq.gz 0:151 1:151 A:1685303886;C:1437291030;G:1447147160;T:1702856463;N:2859989 151 151     1685303886 1437291030 1447147160 1702856463 2859989 SRX5767074 SRS4701368 SRA880742 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.92675 0.92679 0.13415 0.13431 0.73945 0.74213 0.50477 0.50726 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-04-29 Undetermined Undetermined Cell Line Cell Line
49816 49816 SRR8987979 SRX5767073 SRS4701367 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       24h 4 sample exposed to microcystin for xxxh replicate #4   ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh replicate #4|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxxh replicate #4 24h 1 24h 1 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     24h1_clean_R1.fq.gz 24h1_clean_R2.fq.gz fastq fastq 6373552356.0 21104478.0 24h1 clean R1.fq.gz 0:151 1:151 A:1712827186;C:1458408871;G:1470508604;T:1728973011;N:2834684 151 151     1712827186 1458408871 1470508604 1728973011 2834684 SRX5767073 SRS4701367 SRA880742 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.9248 0.92582 0.13207 0.13239 0.73839 0.74038 0.49865 0.50119 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-04-29 Undetermined Undetermined Cell Line Cell Line
49817 49817 SRR8987980 SRX5767072 SRS4701366 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       24h 5 sample exposed to microcystin for xxxh replicate #5   ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh replicate #5|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxxh replicate #5 24h 2 24h 2 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     24h2_clean_R2.fq.gz 24h2_clean_R1.fq.gz fastq fastq 6303822066.0 20873583.0 24h2 clean R1.fq.gz 0:151 1:151 A:1694366688;C:1441733171;G:1453717629;T:1711017538;N:2987040 151 151     1694366688 1441733171 1453717629 1711017538 2987040 SRX5767072 SRS4701366 SRA880742 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.9264 0.92591 0.13121 0.13204 0.7385 0.74227 0.50323 0.49357 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-04-29 Undetermined Undetermined Cell Line Cell Line
49818 49818 SRR8983315 SRX5762615 SRS4697269 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       12h 5 sample exposed to microcystin for xxxh replicate #5   ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh replicate #5|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxxh replicate #5 12h 5 12h 5 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     12h2_clean_R1.fq.gz 12h2_clean_R2.fq.gz fastq fastq 5637564766.0 18667433.0 12h2 clean R1.fq.gz 0:151 1:151 A:1484457309;C:1319928521;G:1331480348;T:1498547286;N:3151302 151 151     1484457309 1319928521 1331480348 1498547286 3151302 SRX5762615 SRS4697269 SRA880316 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.93974 0.93913 0.09518 0.09588 0.74982 0.75331 0.49858 0.49712 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-04-29 Undetermined Undetermined Cell Line Cell Line
49819 49819 SRR8983316 SRX5762614 SRS4697268 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       12h 4 sample exposed to microcystin for xxxh replicate #4   ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh replicate #4|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxxh replicate #4 12h 4 12h 4 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     12h1_clean_R2.fq.gz 12h1_clean_R1.fq.gz fastq fastq 5742037438.0 19013369.0 12h1 clean R1.fq.gz 0:151 1:151 A:1505967171;C:1350499061;G:1361100937;T:1521258216;N:3212053 151 151     1505967171 1350499061 1361100937 1521258216 3212053 SRX5762614 SRS4697268 SRA880316 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.9408 0.93974 0.09145 0.09155 0.75146 0.75501 0.49821 0.49267 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-04-29 Undetermined Undetermined Cell Line Cell Line
49820 49820 SRR8983317 SRX5762613 SRS4697267 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       12h 6 sample exposed to microcystin for xxxh replicate #6   ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh replicate #6|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxxh replicate #6 12h 6 12h 6 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     12h3_clean_R2.fq.gz 12h3_clean_R1.fq.gz fastq fastq 5456135246.0 18066673.0 12h3 clean R1.fq.gz 0:151 1:151 A:1445780220;C:1268483624;G:1278423072;T:1460394475;N:3053855 151 151     1445780220 1268483624 1278423072 1460394475 3053855 SRX5762613 SRS4697267 SRA880316 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.93632 0.93624 0.10093 0.1015 0.7499 0.75367 0.50485 0.50164 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-04-29 Undetermined Undetermined Cell Line Cell Line
49821 49821 SRR8982954 SRX5762254 SRS4696966 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       6h 6 sample exposed to microcystin for xxxh replicate #6   ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh replicate #6|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxxh replicate #6 6h 6 6h 6 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     6h3_clean_R1.fq.gz 6h3_clean_R2.fq.gz fastq fastq 7939056332.0 26288266.0 6h3 clean R1.fq.gz 0:151 1:151 A:2043932346;C:1908038526;G:1925388013;T:2058202469;N:3494978 151 151     2043932346 1908038526 1925388013 2058202469 3494978 SRX5762254 SRS4696966 SRA880287 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.94661 0.94661 0.07559 0.07638 0.76134 0.76394 0.49736 0.50336 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-04-29 Undetermined Undetermined Cell Line Cell Line
49822 49822 SRR8982955 SRX5762253 SRS4696965 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       6h 5 sample exposed to microcystin for xxxh replicate #5   ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh replicate #5|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxxh replicate #5 6h 5 6h 5 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     6h2_clean_R1.fq.gz 6h2_clean_R2.fq.gz fastq fastq 5431283968.0 17984384.0 6h2 clean R1.fq.gz 0:151 1:151 A:1432960105;C:1269588003;G:1284040697;T:1441657813;N:3037350 151 151     1432960105 1269588003 1284040697 1441657813 3037350 SRX5762253 SRS4696965 SRA880287 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.9325 0.93223 0.11537 0.11461 0.7433 0.7457 0.49688 0.50558 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-04-29 Undetermined Undetermined Cell Line Cell Line
49823 49823 SRR8982956 SRX5762252 SRS4696964 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       6h 4 sample exposed to microcystin for xxxh replicate #4   ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh replicate #4|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxxh replicate #4 6h 4 6h 4 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     6h1_clean_R1.fq.gz 6h1_clean_R2.fq.gz fastq fastq 5561923128.0 18416964.0 6h1 clean R1.fq.gz 0:151 1:151 A:1439698401;C:1327963901;G:1340151064;T:1450995064;N:3114698 151 151     1439698401 1327963901 1340151064 1450995064 3114698 SRX5762252 SRS4696964 SRA880287 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.9438 0.94314 0.08661 0.08624 0.75613 0.75858 0.49468 0.47945 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-04-29 Undetermined Undetermined Cell Line Cell Line
49824 49824 SRR8981191 SRX5760491 SRS4695477 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       3h 5 sample exposed to microcystin for xxxh replicate #5   ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh replicate #5|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxxh replicate #5 3h 5 3h 5 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     3h2_clean_R1.fq.gz 3h2_clean_R2.fq.gz fastq fastq 5426694474.0 17969187.0 3h2 clean R1.fq.gz 0:151 1:151 A:1455679038;C:1243463586;G:1253806438;T:1470703342;N:3042070 151 151     1455679038 1243463586 1253806438 1470703342 3042070 SRX5760491 SRS4695477 SRA880231 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.92775 0.9265 0.13003 0.13039 0.74257 0.74679 0.48728 0.50236 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-04-28 Undetermined Undetermined Cell Line Cell Line
49825 49825 SRR8981192 SRX5760490 SRS4695476 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       3h 4 sample exposed to microcystin for xxxh replicate #4   ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh replicate #4|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxxh replicate #4 3h 4 3h 4 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     3h1_clean_R1.fq.gz 3h1_clean_R2.fq.gz fastq fastq 6381408584.0 21130492.0 3h1 clean R1.fq.gz 0:151 1:151 A:1704493392;C:1471437290;G:1482728107;T:1720014953;N:2734842 151 151     1704493392 1471437290 1482728107 1720014953 2734842 SRX5760490 SRS4695476 SRA880231 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.93 0.93014 0.11977 0.12069 0.74434 0.74864 0.49627 0.50428 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-04-28 Undetermined Undetermined Cell Line Cell Line
49826 49826 SRR8981193 SRX5760489 SRS4695475 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       3h 6 sample exposed to microcystin for xxxh replicate #6   ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh replicate #6|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxxh replicate #6 3h 6 3h 6 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     3h3_clean_R1.fq.gz 3h3_clean_R2.fq.gz fastq fastq 6058080740.0 20059870.0 3h3 clean R1.fq.gz 0:151 1:151 A:1623401423;C:1391994584;G:1400166489;T:1639132542;N:3385702 151 151     1623401423 1391994584 1400166489 1639132542 3385702 SRX5760489 SRS4695475 SRA880231 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.93298 0.93201 0.10907 0.10885 0.75059 0.75463 0.50656 0.49273 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-04-28 Undetermined Undetermined Cell Line Cell Line
49827 49827 SRR8961086 SRX5740640 SRS4676161 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       1h 6 sample exposed to microcystin for xxxh replicate #6   ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh replicate #6|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxxh replicate #6 1h 6 1h 6 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     1h3_clean_R1.fq.gz 1h3_clean_R2.fq.gz fastq fastq 6472187368.0 21431084.0 1h3 clean R1.fq.gz 0:151 1:151 A:1780621052;C:1438221849;G:1453983421;T:1796459482;N:2901564 151 151     1780621052 1438221849 1453983421 1796459482 2901564 SRX5740640 SRS4676161 SRA879791 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.92158 0.91814 0.14503 0.14358 0.75775 0.75982 0.50094 0.49955 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-04-26 Undetermined Undetermined Cell Line Cell Line
49828 49828 SRR8961087 SRX5740639 SRS4676160 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       1h 4 sample exposed to microcystin for xxxh replicate #4   ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh replicate #4|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxxh replicate #4 1h 4 1h 4 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     1h1_clean_R1.fq.gz 1h1_clean_R2.fq.gz fastq fastq 6177620796.0 20455698.0 1h1 clean R1.fq.gz 0:151 1:151 A:1646973061;C:1422549043;G:1441385824;T:1663912518;N:2800350 151 151     1646973061 1422549043 1441385824 1663912518 2800350 SRX5740639 SRS4676160 SRA879791 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.93085 0.92866 0.12633 0.12579 0.75812 0.76136 0.48992 0.50959 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-04-26 Undetermined Undetermined Cell Line Cell Line
49829 49829 SRR8961088 SRX5740638 SRS4676159 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       1h 5 sample exposed to microcystin for xxxh replicate #5   ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh replicate #5|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxxh replicate #5 1h 5 1h 5 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     1h2_clean_R2.fq.gz 1h2_clean_R1.fq.gz fastq fastq 5616651266.0 18598183.0 1h2 clean R1.fq.gz 0:151 1:151 A:1492544948;C:1296049637;G:1317613246;T:1507292547;N:3150888 151 151     1492544948 1296049637 1317613246 1507292547 3150888 SRX5740638 SRS4676159 SRA879791 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.93168 0.93082 0.12771 0.12751 0.75653 0.75964 0.508 0.51051 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-04-26 Undetermined Undetermined Cell Line Cell Line
49830 49830 SRR8959882 SRX5739436 SRS4675912 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       control replicate #6 ck 6   replicate:replicate=#6|ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|BioSampleModel:Model organism or animal                 replicate 6 ck 6 ck 6 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     CK3_clean_R1.fq.gz CK3_clean_R2.fq.gz fastq fastq 6417346282.0 21249491.0 CK3 clean R1.fq.gz 0:151 1:151 A:1753073270;C:1445910840;G:1452693305;T:1762084157;N:3584710 151 151     1753073270 1445910840 1452693305 1762084157 3584710 SRX5739436 SRS4675912 SRA879767 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.92653 0.92662 0.11696 0.11682 0.75166 0.75379 0.50678 0.50594 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-04-26 Undetermined Undetermined Cell Line Cell Line
49831 49831 SRR8959883 SRX5739435 SRS4675911 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       control replicate #4 ck 4   replicate:replicate=#4|ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|BioSampleModel:Model organism or animal                 replicate 4 ck 4 ck 4 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     CK1_clean_R1.fq.gz CK1_clean_R2.fq.gz fastq fastq 5659831830.0 18741165.0 CK1 clean R1.fq.gz 0:151 1:151 A:1532952307;C:1289729700;G:1295220307;T:1538761250;N:3168266 151 151     1532952307 1289729700 1295220307 1538761250 3168266 SRX5739435 SRS4675911 SRA879767 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.92518 0.92535 0.11332 0.11378 0.74919 0.75235 0.50223 0.49803 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-04-26 Undetermined Undetermined Cell Line Cell Line
49832 49832 SRR8959884 SRX5739434 SRS4675910 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       control replicate #5 ck 5   replicate:replicate=#5|ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|BioSampleModel:Model organism or animal                 replicate 5 ck 5 ck 5 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     CK2_clean_R1.fq.gz CK2_clean_R2.fq.gz fastq fastq 5880727616.0 19472608.0 CK2 clean R1.fq.gz 0:151 1:151 A:1575999691;C:1352057289;G:1366253556;T:1583120335;N:3296745 151 151     1575999691 1352057289 1366253556 1583120335 3296745 SRX5739434 SRS4675910 SRA879767 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.93653 0.9349 0.09037 0.09026 0.76262 0.76572 0.51143 0.50376 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-04-26 Undetermined Undetermined Cell Line Cell Line
49833 49833 SRR8133154 SRX4954244 SRS3995636 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       sample exposed to microcystin for xxx hour replicate #1 24h 1   isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour replicate #1|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxx hour replicate #1 24h 1 24h 1 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     24h-1_R1.fastq.gz 24h-1_R2.fastq.gz fastq fastq 6408674352.0 21220776.0 24h 1 R1.fastq.gz 0:151 1:151 A:1752104547;C:1447174976;G:1451968217;T:1757298923;N:127689 151 151     1752104547 1447174976 1451968217 1757298923 127689 SRX4954244 SRS3995636 SRA800477 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.9212 0.91969 0.14419 0.14446 0.73677 0.74363 0.49228 0.49725 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2018-10-30 Undetermined Undetermined Cell Line Cell Line
49834 49834 SRR8133155 SRX4954243 SRS3995635 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       sample exposed to microcystin for xxx hour replicate #2 24h 2   isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour replicate #2|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxx hour replicate #2 24h 2 24h 2 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     24h-2_R1.fastq.gz 24h-2_R2.fastq.gz fastq fastq 6331528754.0 20965327.0 24h 2 R1.fastq.gz 0:151 1:151 A:1725083256;C:1436372645;G:1442486884;T:1727457912;N:128057 151 151     1725083256 1436372645 1442486884 1727457912 128057 SRX4954243 SRS3995635 SRA800477 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.92281 0.92303 0.13905 0.14045 0.73708 0.74401 0.50843 0.50295 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-01-01 Undetermined Undetermined Cell Line Cell Line
49835 49835 SRR8133156 SRX4954242 SRS3995634 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       sample exposed to microcystin for xxx hour replicate #3 24h 3   isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour replicate #3|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxx hour replicate #3 24h 3 24h 3 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     24h-3_R1.fastq.gz 24h-3_R2.fastq.gz fastq fastq 6723114940.0 22261970.0 24h 3 R1.fastq.gz 0:151 1:151 A:1833689339;C:1522824611;G:1529534136;T:1836931192;N:135662 151 151     1833689339 1522824611 1529534136 1836931192 135662 SRX4954242 SRS3995634 SRA800477 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.91356 0.91347 0.13955 0.14059 0.73898 0.74399 0.49776 0.50087 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-01-01 Undetermined Undetermined Cell Line Cell Line
49836 49836 SRR8133151 SRX4954241 SRS3995633 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       sample exposed to microcystin for xxx hour replicate #3 12h 3   isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour replicate #3|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxx hour replicate #3 12h 3 12h 3 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     12h-3_R1.fastq.gz 12h-3_R2.fastq.gz fastq fastq 6249709404.0 20694402.0 12h 3 R1.fastq.gz 0:151 1:151 A:1679876276;C:1439210018;G:1449953029;T:1680544537;N:125544 151 151     1679876276 1439210018 1449953029 1680544537 125544 SRX4954241 SRS3995633 SRA800476 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.9318 0.93185 0.10315 0.10397 0.7499 0.75513 0.49669 0.50516 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-01-01 Undetermined Undetermined Cell Line Cell Line
49837 49837 SRR8133152 SRX4954240 SRS3995632 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       sample exposed to microcystin for xxx hour replicate #1 12h 1   isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour replicate #1|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxx hour replicate #1 12h 1 12h 1 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     12h-1_R1.fastq.gz 12h-1_R2.fastq.gz fastq fastq 6040713928.0 20002364.0 12h 1 R1.fastq.gz 0:151 1:151 A:1604304459;C:1407301760;G:1430569355;T:1597934265;N:604089 151 151     1604304459 1407301760 1430569355 1597934265 604089 SRX4954240 SRS3995632 SRA800476 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.93665 0.93821 0.09301 0.0957 0.75284 0.77169 0.49115 0.48606 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-01-01 Undetermined Undetermined Cell Line Cell Line
49838 49838 SRR8133153 SRX4954239 SRS3995631 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       sample exposed to microcystin for xxx hour replicate #2 12h 2   isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour replicate #2|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxx hour replicate #2 12h 2 12h 2 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     12h-2_R1.fastq.gz 12h-2_R2.fastq.gz fastq fastq 6340973200.0 20996600.0 12h 2 R1.fastq.gz 0:151 1:151 A:1704338617;C:1461869913;G:1470728810;T:1703906206;N:129654 151 151     1704338617 1461869913 1470728810 1703906206 129654 SRX4954239 SRS3995631 SRA800476 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.93272 0.93343 0.10216 0.10338 0.74978 0.75513 0.50094 0.51045 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-01-01 Undetermined Undetermined Cell Line Cell Line
49839 49839 SRR8132757 SRX4953863 SRS3995402 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       sample exposed to microcystin for xxx hour replicate #3 6h 3   isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour replicate #3|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxx hour replicate #3 6h 3 6h 3 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     6h-3_R1.fastq.gz 6h-3_R2.fastq.gz fastq fastq 6533368340.0 21633670.0 6h 3 R1.fastq.gz 0:151 1:151 A:1684379253;C:1575728468;G:1593737205;T:1678875387;N:648027 151 151     1684379253 1575728468 1593737205 1678875387 648027 SRX4953863 SRS3995402 SRA800451 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.94744 0.94959 0.06681 0.06774 0.76459 0.77711 0.4873 0.49779 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-01-01 Undetermined Undetermined Cell Line Cell Line
49840 49840 SRR8132756 SRX4953862 SRS3995403 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       sample exposed to microcystin for xxx hour replicate #1 6h 1   isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour replicate #1|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxx hour replicate #1 6h 1 6h 1 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     6h-1_R1.fastq.gz 6h-1_R2.fastq.gz fastq fastq 6686156482.0 22139591.0 6h 1 R1.fastq.gz 0:151 1:151 A:1712757343;C:1622803789;G:1646819107;T:1703094369;N:681874 151 151     1712757343 1622803789 1646819107 1703094369 681874 SRX4953862 SRS3995403 SRA800449 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.95018 0.95234 0.0661 0.06774 0.77268 0.78652 0.49287 0.48663 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2018-10-29 Undetermined Undetermined Cell Line Cell Line
49841 49841 SRR8132755 SRX4953861 SRS3995401 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       sample exposed to microcystin for xxx hour replicate #2 6h 2   isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour replicate #2|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxx hour replicate #2 6h 2 6h 2 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     6h-2_R1.fastq.gz 6h-2_R2.fastq.gz fastq fastq 5551304204.0 18381802.0 6h 2 R1.fastq.gz 0:151 1:151 A:1408740987;C:1361721973;G:1380328727;T:1399965481;N:547036 151 151     1408740987 1361721973 1380328727 1399965481 547036 SRX4953861 SRS3995401 SRA800450 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.9506 0.95313 0.07031 0.07155 0.7739 0.78591 0.50125 0.49851 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2018-10-29 Undetermined Undetermined Cell Line Cell Line
49842 49842 SRR8119911 SRX4946208 SRS3988532 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       sample exposed to microcystin for xxx hour replicate #3 3h 3   isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour replicate #3|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxx hour replicate #3 3h 3 3h 3 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     3h-3_R1.fastq.gz 3h-3_R2.fastq.gz fastq fastq 6249422202.0 20693451.0 3h 3 R1.fastq.gz 0:151 1:151 A:1700610088;C:1416827975;G:1436930329;T:1694433965;N:619845 151 151     1700610088 1416827975 1436930329 1694433965 619845 SRX4946208 SRS3988532 SRA799983 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.924 0.92633 0.13412 0.13864 0.74158 0.76489 0.49551 0.49903 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2018-10-29 Undetermined Undetermined Cell Line Cell Line
49843 49843 SRR8119910 SRX4946207 SRS3988531 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       sample exposed to microcystin for xxx hour replicate #2 3h 2   isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour replicate #2|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxx hour replicate #2 3h 2 3h 2 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     3h-2_R1.fastq.gz 3h-2_R2.fastq.gz fastq fastq 6691460508.0 22157154.0 3h 2 R2.fastq.gz 0:151 1:151 A:1817827404;C:1520902100;G:1534921644;T:1817122657;N:686703 151 151     1817827404 1520902100 1534921644 1817122657 686703 SRX4946207 SRS3988531 SRA799982 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.92541 0.92734 0.13003 0.1321 0.7443 0.76019 0.50143 0.4998 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-01-01 Undetermined Undetermined Cell Line Cell Line
49844 49844 SRR8117643 SRX4943940 SRS3986328 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       sample exposed to microcystin for xxx hour replicate #1 3h 1   isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour replicate #1|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxx hour replicate #1 3h 1 3h 1 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     3h-1_R1.fastq.gz 3h-1_R2.fastq.gz fastq fastq 6151798890.0 20370195.0 3h 1 R1.fastq.gz 0:151 1:151 A:1649142984;C:1419068750;G:1435991843;T:1646989815;N:605498 151 151     1649142984 1419068750 1435991843 1646989815 605498 SRX4943940 SRS3986328 SRA799824 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.92965 0.93287 0.12221 0.12677 0.73397 0.75278 0.50535 0.50378 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2018-10-28 Undetermined Undetermined Cell Line Cell Line
49845 49845 SRR8115441 SRX4941738 SRS3985539 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       sample exposed to microcystin for xxx hour replicate #3 1h 3   isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour replicate #3|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxx hour replicate #3 1h 3 1h 3 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     1h-3_R2.fastq.gz 1h-3_R1.fastq.gz fastq fastq 7655572254.0 25349577.0 1h 3 R2.fastq.gz 0:151 1:151 A:2078212614;C:1742053699;G:1754520045;T:2080018836;N:767060 151 151     2078212614 1742053699 1754520045 2080018836 767060 SRX4941738 SRS3985539 SRA799651 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.92526 0.92744 0.12977 0.13298 0.75743 0.77061 0.50353 0.50471 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-01-01 Undetermined Undetermined Cell Line Cell Line
49846 49846 SRR8115440 SRX4941737 SRS3985538 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       sample exposed to microcystin for xxx hour replicate #2 1h 2   isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour replicate #2|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxx hour replicate #2 1h 2 1h 2 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     1h-2_R1.fastq.gz 1h-2_R2.fastq.gz fastq fastq 7594153306.0 25146203.0 1h 2 R1.fastq.gz 0:151 1:151 A:2048228795;C:1739666332;G:1763496812;T:2041988124;N:773243 151 151     2048228795 1739666332 1763496812 2041988124 773243 SRX4941737 SRS3985538 SRA799650 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.92922 0.93046 0.12988 0.1333 0.75657 0.77684 0.50439 0.49684 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-01-01 Undetermined Undetermined Cell Line Cell Line
49847 49847 SRR8109598 SRX4936168 SRS3980334 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       sample exposed to microcystin for xxx hour replicate #1 1h 1   isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour replicate #1|BioSampleModel:Model organism or animal                 sample exposed to microcystin for xxx hour replicate #1 1h 1 1h 1 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     1h-1_R1.fastq.gz 1h-1_R2.fastq.gz fastq fastq 6505465654.0 21541277.0 1h 1 R2.fastq.gz 0:151 1:151 A:1772064909;C:1473729340;G:1487273483;T:1771747419;N:650503 151 151     1772064909 1473729340 1487273483 1771747419 650503 SRX4936168 SRS3980334 SRA798650 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.92342 0.92707 0.13549 0.13873 0.7555 0.77106 0.49839 0.50202 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2018-10-25 Undetermined Undetermined Cell Line Cell Line
49848 49848 SRR8109308 SRX4935890 SRS3980091 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       sample not treated replicate #3 ck 3   isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:not treated replicate #3|BioSampleModel:Model organism or animal                 sample not treated replicate #3 ck 3 ck 3 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     CK-3_R1.fastq.gz CK-3_R2.fastq.gz fastq fastq 6691086632.0 22155916.0 CK 3 R2.fastq.gz 0:151 1:151 A:1817102254;C:1525946318;G:1537285128;T:1810073033;N:679899 151 151     1817102254 1525946318 1537285128 1810073033 679899 SRX4935890 SRS3980091 SRA798632 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.93213 0.93388 0.10099 0.10342 0.75828 0.77035 0.49928 0.49506 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2018-10-25 Undetermined Undetermined Cell Line Cell Line
49849 49849 SRR8109041 SRX4935630 SRS3979958 SRP166817 PRJNA498018 Danio rerio strain:ZFL cell line Genome sequencing PRJNA498018 Whole Genome Sequencing Transcriptional responses of ZFL exposed to microcystin LR       sample not treated replicate #2 ck 2   isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:not treated replicate #1|BioSampleModel:Model organism or animal                 sample not treated replicate #2 ck 2 ck 2 Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA HiSeq X Ten   SRP166817     CK-2_R2.fastq.gz CK-2_R1.fastq.gz fastq fastq 6135368580.0 20315790.0 CK 2 R2.fastq.gz 0:151 1:151 A:1659190299;C:1402338038;G:1422425283;T:1650808795;N:606165 151 151     1659190299 1402338038 1422425283 1650808795 606165 SRX4935630 SRS3979958 SRA798622 Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute Chinese Academy of Fishery Sciences 2 0.93276 0.93529 0.09768 0.1008 0.75905 0.77512 0.48616 0.50755 151 151 B B biological fallback assumption illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2019-01-01 Undetermined Undetermined Cell Line Cell Line
67908 67908 SRR017341 SRX003632 SRS002067 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish N                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishN Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true N_fish.tar fastq 40231384.0 173756.0 Zebrafish IgH cDNA FishN 0:4 1:227.54 A:10436935;C:8800020;G:9512025;T:11471941;N:10463 4 227     10436935 8800020 9512025 11471941 10463 SRX003632 SRS002067 SRA008134 Stanford University|Quake Stanford University 1 0.26487   0.0663   0.99304   0.01389   229   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67909 67909 SRR017340 SRX003631 SRS002066 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish M                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishM Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true M_fish.tar fastq 37492198.0 161639.0 Zebrafish IgH cDNA FishM 0:4 1:227.95 A:9527141;C:8129088;G:9025760;T:10804127;N:6082 4 227     9527141 8129088 9025760 10804127 6082 SRX003631 SRS002066 SRA008134 Stanford University|Quake Stanford University 1 0.31521   0.11394   0.99823   0.00291   208   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67910 67910 SRR017339 SRX003630 SRS002065 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish L                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishL Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true L_fish.tar fastq 37971443.0 163701.0 Zebrafish IgH cDNA FishL 0:4 1:227.96 A:9544875;C:8363123;G:9094601;T:10963684;N:5160 4 227     9544875 8363123 9094601 10963684 5160 SRX003630 SRS002065 SRA008134 Stanford University|Quake Stanford University 1 0.29057   0.07862   0.99636   0.00534   245   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67911 67911 SRR017338 SRX003629 SRS002064 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish K                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishK Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true K_fish.tar fastq 54201403.0 234266.0 Zebrafish IgH cDNA FishK 0:4 1:227.37 A:13608677;C:11652239;G:12945164;T:15975205;N:20118 4 227     13608677 11652239 12945164 15975205 20118 SRX003629 SRS002064 SRA008134 Stanford University|Quake Stanford University 1 0.27218   0.07987   0.99275   0.01242   244   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67912 67912 SRR017337 SRX003628 SRS002063 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish J                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishJ Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true J_fish.tar fastq 51915342.0 224027.0 Zebrafish IgH cDNA FishJ 0:4 1:227.74 A:12664582;C:12040983;G:12609762;T:14589770;N:10245 4 227     12664582 12040983 12609762 14589770 10245 SRX003628 SRS002063 SRA008134 Stanford University|Quake Stanford University 1 0.29028   0.10039   0.9964   0.00625   97   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67913 67913 SRR017336 SRX003627 SRS002062 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish I                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishI Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true I_fish.tar fastq 23436268.0 100120.0 Zebrafish IgH cDNA FishI 0:4 1:230.08 A:5801823;C:5246438;G:5587169;T:6797624;N:3214 4 230     5801823 5246438 5587169 6797624 3214 SRX003627 SRS002062 SRA008134 Stanford University|Quake Stanford University 1 0.34362   0.0757   0.99241   0.02647   232   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67914 67914 SRR017335 SRX003626 SRS002061 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish H                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishH Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true H_fish.tar fastq 48443452.0 213531.0 Zebrafish IgH cDNA FishH 0:4 1:222.87 A:12720681;C:10490855;G:11923926;T:13303989;N:4001 4 222     12720681 10490855 11923926 13303989 4001 SRX003626 SRS002061 SRA008134 Stanford University|Quake Stanford University 1 0.45847   0.04709   0.98754   0.0161   56   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67915 67915 SRR017334 SRX003625 SRS002060 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish G                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishG Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true G_fish.tar fastq 50095821.0 217866.0 Zebrafish IgH cDNA FishG 0:4 1:225.94 A:13182103;C:11299206;G:11909574;T:13700817;N:4121 4 225     13182103 11299206 11909574 13700817 4121 SRX003625 SRS002060 SRA008134 Stanford University|Quake Stanford University 1 0.37294   0.09947   0.99034   0.02245   230   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67916 67916 SRR017333 SRX003624 SRS002059 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish F                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishF Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true F_fish.tar fastq 16577798.0 83387.0 Zebrafish IgH cDNA FishF 0:4 1:194.81 A:4215316;C:3618457;G:4002690;T:4736893;N:4442 4 194     4215316 3618457 4002690 4736893 4442 SRX003624 SRS002059 SRA008134 Stanford University|Quake Stanford University 1 0.57361   0.0727   0.99965   0.00026   62   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67917 67917 SRR017332 SRX003623 SRS002058 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish E                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishE Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true E_fish.tar fastq 29705006.0 131553.0 Zebrafish IgH cDNA FishE 0:4 1:221.80 A:7474430;C:6417563;G:7115572;T:8693543;N:3898 4 221     7474430 6417563 7115572 8693543 3898 SRX003623 SRS002058 SRA008134 Stanford University|Quake Stanford University 1 0.3099   0.09802   0.99904   0.00099   45   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67918 67918 SRR017331 SRX003622 SRS002057 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish D                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishD Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true D_fish.tar fastq 27611909.0 123468.0 Zebrafish IgH cDNA FishD 0:4 1:219.64 A:6809564;C:6219469;G:6636933;T:7943112;N:2831 4 219     6809564 6219469 6636933 7943112 2831 SRX003622 SRS002057 SRA008134 Stanford University|Quake Stanford University 1 0.45962   0.09396   0.99941   0.00026   218   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67919 67919 SRR017330 SRX003621 SRS002056 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish C                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishC Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true C_fish.tar fastq 21845405.0 95733.0 Zebrafish IgH cDNA FishC 0:4 1:224.19 A:5735195;C:4746747;G:5266352;T:6095066;N:2045 4 224     5735195 4746747 5266352 6095066 2045 SRX003621 SRS002056 SRA008134 Stanford University|Quake Stanford University 1 0.38908   0.20497   0.99967   0.00047   145   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67920 67920 SRR017329 SRX003620 SRS002055 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish B                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishB Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true B_fish.tar fastq 26680294.0 118385.0 Zebrafish IgH cDNA FishB 0:4 1:221.37 A:6380496;C:6168810;G:6541530;T:7587018;N:2440 4 221     6380496 6168810 6541530 7587018 2440 SRX003620 SRS002055 SRA008134 Stanford University|Quake Stanford University 1 0.35498   0.14675   0.99906   0.00098   228   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67921 67921 SRR017328 SRX003619 SRS002054 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish A                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishA Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true A_fish.tar fastq 13497752.0 61111.0 Zebrafish IgH cDNA FishA 0:4 1:216.87 A:3287411;C:3078068;G:3224467;T:3906026;N:1780 4 216     3287411 3078068 3224467 3906026 1780 SRX003619 SRS002054 SRA008134 Stanford University|Quake Stanford University 1 0.32333   0.14098   0.99937   0.00169   52   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
70464 70464 SRR19897787 SRX15940767 SRS13627793 SRP384180 PRJNA854078 The eyes of Danio rerio RNA seq data from white light group blue light group white light + cold group and blue light + cold group PRJNA854078 Other zebrafish were placed in a white light emitting diode and a blue light emitting diode and 26 degrees centigrade water body. post pretreatment for two weeks fish were then transferred to white light and 11degrees centigrade water respectively.         CW1   strain:missing|age:missing|sex:missing|tissue:eye|repulicate:cold + white light repulicate 1|BioSampleModel:Model organism or animal                 RNA Seq of Danio rerio CW1 CW1 cold + white light     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA Illumina HiSeq 2000   SRP384180     CW1_1.fq.gz CW1_2.fq.gz fastq fastq 6739882500.0 22466275.0 CW1 1.fq.gz 0:150 1:150 A:1848237756;C:1519101210;G:1513969331;T:1858563022;N:11181 150 150     1848237756 1519101210 1513969331 1858563022 11181 SRX15940767 SRS13627793 SRA1445974 Zhejiang Ocean University|National Engineering Research Center of Marine Fac Zhejiang Ocean University 2 0.9202 0.92005 0.10845 0.10844 0.68603 0.68696 0.52694 0.5273 150 150 B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2022-06-29 Undetermined Undetermined Eye Sensory System
70465 70465 SRR19897788 SRX15940766 SRS13627792 SRP384180 PRJNA854078 The eyes of Danio rerio RNA seq data from white light group blue light group white light + cold group and blue light + cold group PRJNA854078 Other zebrafish were placed in a white light emitting diode and a blue light emitting diode and 26 degrees centigrade water body. post pretreatment for two weeks fish were then transferred to white light and 11degrees centigrade water respectively.         CB3   strain:missing|age:missing|sex:missing|tissue:eye|repulicate:cold + blue light repulicate 3|BioSampleModel:Model organism or animal                 RNA Seq of Danio rerio CB3 CB3 cold + blue light     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA Illumina HiSeq 2000   SRP384180     CB3_1.fq.gz CB3_2.fq.gz fastq fastq 6616936500.0 22056455.0 CB3 1.fq.gz 0:150 1:150 A:1808345659;C:1499214022;G:1492074811;T:1817144348;N:157660 150 150     1808345659 1499214022 1492074811 1817144348 157660 SRX15940766 SRS13627792 SRA1445974 Zhejiang Ocean University|National Engineering Research Center of Marine Fac Zhejiang Ocean University 2 0.92167 0.92063 0.10246 0.10193 0.6883 0.68832 0.51958 0.52373 150 150 B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2022-06-29 Undetermined Undetermined Eye Sensory System
70466 70466 SRR19897789 SRX15940765 SRS13627791 SRP384180 PRJNA854078 The eyes of Danio rerio RNA seq data from white light group blue light group white light + cold group and blue light + cold group PRJNA854078 Other zebrafish were placed in a white light emitting diode and a blue light emitting diode and 26 degrees centigrade water body. post pretreatment for two weeks fish were then transferred to white light and 11degrees centigrade water respectively.         CB2   strain:missing|age:missing|sex:missing|tissue:eye|repulicate:cold + blue light repulicate 2|BioSampleModel:Model organism or animal                 RNA Seq of Danio rerio CB2 CB2 cold + blue light     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA Illumina HiSeq 2000   SRP384180     CB2_1.fq.gz CB2_2.fq.gz fastq fastq 6643125000.0 22143750.0 CB2 1.fq.gz 0:150 1:150 A:1834995141;C:1484447017;G:1478473640;T:1845045394;N:163808 150 150     1834995141 1484447017 1478473640 1845045394 163808 SRX15940765 SRS13627791 SRA1445974 Zhejiang Ocean University|National Engineering Research Center of Marine Fac Zhejiang Ocean University 2 0.91587 0.91485 0.10928 0.10908 0.67271 0.67284 0.53214 0.51839 150 150 B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2022-06-29 Undetermined Undetermined Eye Sensory System
70467 70467 SRR19897790 SRX15940764 SRS13627790 SRP384180 PRJNA854078 The eyes of Danio rerio RNA seq data from white light group blue light group white light + cold group and blue light + cold group PRJNA854078 Other zebrafish were placed in a white light emitting diode and a blue light emitting diode and 26 degrees centigrade water body. post pretreatment for two weeks fish were then transferred to white light and 11degrees centigrade water respectively.         CB1   strain:missing|age:missing|sex:missing|tissue:eye|repulicate:cold + blue light repulicate 1|BioSampleModel:Model organism or animal                 RNA Seq of Danio rerio CB1 CB1 cold + blue light     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA Illumina HiSeq 2000   SRP384180     CB1_1.fq.gz CB1_2.fq.gz fastq fastq 6726735900.0 22422453.0 CB1 1.fq.gz 0:150 1:150 A:1854984195;C:1506200798;G:1500739385;T:1864656690;N:154832 150 150     1854984195 1506200798 1500739385 1864656690 154832 SRX15940764 SRS13627790 SRA1445974 Zhejiang Ocean University|National Engineering Research Center of Marine Fac Zhejiang Ocean University 2 0.92107 0.92013 0.11091 0.11046 0.68416 0.68369 0.52205 0.51943 150 150 B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2022-06-29 Undetermined Undetermined Eye Sensory System
70468 70468 SRR19897791 SRX15940763 SRS13627789 SRP384180 PRJNA854078 The eyes of Danio rerio RNA seq data from white light group blue light group white light + cold group and blue light + cold group PRJNA854078 Other zebrafish were placed in a white light emitting diode and a blue light emitting diode and 26 degrees centigrade water body. post pretreatment for two weeks fish were then transferred to white light and 11degrees centigrade water respectively.         W3   strain:missing|age:missing|sex:missing|tissue:eye|repulicate:white repulicate 3|BioSampleModel:Model organism or animal                 RNA Seq of Danio rerio W3 W3 white light     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA Illumina HiSeq 2000   SRP384180     W3_1.fq.gz W3_2.fq.gz fastq fastq 6768510900.0 22561703.0 W3 1.fq.gz 0:150 1:150 A:1854668626;C:1528356228;G:1523098237;T:1862376595;N:11214 150 150     1854668626 1528356228 1523098237 1862376595 11214 SRX15940763 SRS13627789 SRA1445974 Zhejiang Ocean University|National Engineering Research Center of Marine Fac Zhejiang Ocean University 2 0.92284 0.92018 0.10477 0.10423 0.68032 0.68105 0.52004 0.52091 150 150 B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2022-06-29 Undetermined Undetermined Eye Sensory System
70469 70469 SRR19897792 SRX15940762 SRS13627788 SRP384180 PRJNA854078 The eyes of Danio rerio RNA seq data from white light group blue light group white light + cold group and blue light + cold group PRJNA854078 Other zebrafish were placed in a white light emitting diode and a blue light emitting diode and 26 degrees centigrade water body. post pretreatment for two weeks fish were then transferred to white light and 11degrees centigrade water respectively.         W2   strain:missing|age:missing|sex:missing|tissue:eye|repulicate:white repulicate 2|BioSampleModel:Model organism or animal                 RNA Seq of Danio rerio W2 W2 white light     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA Illumina HiSeq 2000   SRP384180     W2_1.fq.gz W2_2.fq.gz fastq fastq 6680260200.0 22267534.0 W2 1.fq.gz 0:150 1:150 A:1823317259;C:1515290462;G:1509530485;T:1832110882;N:11112 150 150     1823317259 1515290462 1509530485 1832110882 11112 SRX15940762 SRS13627788 SRA1445974 Zhejiang Ocean University|National Engineering Research Center of Marine Fac Zhejiang Ocean University 2 0.92292 0.92065 0.09554 0.09545 0.67551 0.6757 0.50849 0.51222 150 150 B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2022-06-29 Undetermined Undetermined Eye Sensory System
70470 70470 SRR19897793 SRX15940761 SRS13627787 SRP384180 PRJNA854078 The eyes of Danio rerio RNA seq data from white light group blue light group white light + cold group and blue light + cold group PRJNA854078 Other zebrafish were placed in a white light emitting diode and a blue light emitting diode and 26 degrees centigrade water body. post pretreatment for two weeks fish were then transferred to white light and 11degrees centigrade water respectively.         W1   strain:missing|age:missing|sex:missing|tissue:eye|repulicate:white repulicate 1|BioSampleModel:Model organism or animal                 RNA Seq of Danio rerio W1 W1 white light     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA Illumina HiSeq 2000   SRP384180     W1_1.fq.gz W1_2.fq.gz fastq fastq 6781992000.0 22606640.0 W1 1.fq.gz 0:150 1:150 A:1844053579;C:1544613499;G:1543816397;T:1849496814;N:11711 150 150     1844053579 1544613499 1543816397 1849496814 11711 SRX15940761 SRS13627787 SRA1445974 Zhejiang Ocean University|National Engineering Research Center of Marine Fac Zhejiang Ocean University 2 0.92064 0.91964 0.09713 0.09743 0.67667 0.67746 0.5212 0.50218 150 150 B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2022-06-29 Undetermined Undetermined Eye Sensory System
70471 70471 SRR19897794 SRX15940760 SRS13627786 SRP384180 PRJNA854078 The eyes of Danio rerio RNA seq data from white light group blue light group white light + cold group and blue light + cold group PRJNA854078 Other zebrafish were placed in a white light emitting diode and a blue light emitting diode and 26 degrees centigrade water body. post pretreatment for two weeks fish were then transferred to white light and 11degrees centigrade water respectively.         B3   strain:missing|age:missing|sex:missing|tissue:eye|repulicate:blue repulicate 3|BioSampleModel:Model organism or animal                 RNA Seq of Danio rerio B3 B3 blue light     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA Illumina HiSeq 2000   SRP384180     B3_1.fq.gz B3_2.fq.gz fastq fastq 6656595900.0 22188653.0 B3 1.fq.gz 0:150 1:150 A:1805784355;C:1520422218;G:1518168444;T:1812078392;N:142491 150 150     1805784355 1520422218 1518168444 1812078392 142491 SRX15940760 SRS13627786 SRA1445974 Zhejiang Ocean University|National Engineering Research Center of Marine Fac Zhejiang Ocean University 2 0.92236 0.91914 0.09522 0.09395 0.67661 0.67722 0.518 0.51697 150 150 B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2022-06-29 Undetermined Undetermined Eye Sensory System
70472 70472 SRR19897795 SRX15940759 SRS13627785 SRP384180 PRJNA854078 The eyes of Danio rerio RNA seq data from white light group blue light group white light + cold group and blue light + cold group PRJNA854078 Other zebrafish were placed in a white light emitting diode and a blue light emitting diode and 26 degrees centigrade water body. post pretreatment for two weeks fish were then transferred to white light and 11degrees centigrade water respectively.         CW3   strain:missing|age:missing|sex:missing|tissue:eye|repulicate:cold + white light repulicate 3|BioSampleModel:Model organism or animal                 RNA Seq of Danio rerio CW3 CW3 cold + white light     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA Illumina HiSeq 2000   SRP384180     CW3_1.fq.gz CW3_2.fq.gz fastq fastq 6747757500.0 22492525.0 CW3 1.fq.gz 0:150 1:150 A:1879771229;C:1493093261;G:1485694977;T:1889044111;N:153922 150 150     1879771229 1493093261 1485694977 1889044111 153922 SRX15940759 SRS13627785 SRA1445974 Zhejiang Ocean University|National Engineering Research Center of Marine Fac Zhejiang Ocean University 2 0.91511 0.9134 0.11866 0.11919 0.67667 0.67744 0.53077 0.53216 150 150 B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2022-06-29 Undetermined Undetermined Eye Sensory System
70473 70473 SRR19897796 SRX15940758 SRS13627784 SRP384180 PRJNA854078 The eyes of Danio rerio RNA seq data from white light group blue light group white light + cold group and blue light + cold group PRJNA854078 Other zebrafish were placed in a white light emitting diode and a blue light emitting diode and 26 degrees centigrade water body. post pretreatment for two weeks fish were then transferred to white light and 11degrees centigrade water respectively.         CW2   strain:missing|age:missing|sex:missing|tissue:eye|repulicate:cold + white light repulicate 2|BioSampleModel:Model organism or animal                 RNA Seq of Danio rerio CW2 CW2 cold + white light     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA Illumina HiSeq 2000   SRP384180     CW2_1.fq.gz CW2_2.fq.gz fastq fastq 6683398200.0 22277994.0 CW2 1.fq.gz 0:150 1:150 A:1843667678;C:1495135303;G:1486210450;T:1858373680;N:11089 150 150     1843667678 1495135303 1486210450 1858373680 11089 SRX15940758 SRS13627784 SRA1445974 Zhejiang Ocean University|National Engineering Research Center of Marine Fac Zhejiang Ocean University 2 0.91857 0.91787 0.11123 0.11217 0.68753 0.68858 0.5306 0.49945 150 150 B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2022-06-29 Undetermined Undetermined Eye Sensory System
70474 70474 SRR19897797 SRX15940757 SRS13627783 SRP384180 PRJNA854078 The eyes of Danio rerio RNA seq data from white light group blue light group white light + cold group and blue light + cold group PRJNA854078 Other zebrafish were placed in a white light emitting diode and a blue light emitting diode and 26 degrees centigrade water body. post pretreatment for two weeks fish were then transferred to white light and 11degrees centigrade water respectively.         B2   strain:missing|age:missing|sex:missing|tissue:eye|repulicate:blue repulicate 2|BioSampleModel:Model organism or animal                 RNA Seq of Danio rerio B2 B2 blue light     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA Illumina HiSeq 2000   SRP384180     B2_1.fq.gz B2_2.fq.gz fastq fastq 6727692000.0 22425640.0 B2 1.fq.gz 0:150 1:150 A:1850003227;C:1513202517;G:1506953883;T:1857378373;N:154000 150 150     1850003227 1513202517 1506953883 1857378373 154000 SRX15940757 SRS13627783 SRA1445974 Zhejiang Ocean University|National Engineering Research Center of Marine Fac Zhejiang Ocean University 2 0.91912 0.91906 0.1068 0.10681 0.6733 0.67247 0.52417 0.51448 150 150 B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2022-06-29 Undetermined Undetermined Eye Sensory System
70475 70475 SRR19897798 SRX15940756 SRS13627782 SRP384180 PRJNA854078 The eyes of Danio rerio RNA seq data from white light group blue light group white light + cold group and blue light + cold group PRJNA854078 Other zebrafish were placed in a white light emitting diode and a blue light emitting diode and 26 degrees centigrade water body. post pretreatment for two weeks fish were then transferred to white light and 11degrees centigrade water respectively.         B1   strain:missing|age:missing|sex:missing|tissue:eye|repulicate:blue repulicate 1|BioSampleModel:Model organism or animal                 RNA Seq of Danio rerio B1 B1 blue light     RNA-Seq TRANSCRIPTOMIC PCR PAIRED ILLUMINA Illumina HiSeq 2000   SRP384180     B1_1.fq.gz B1_2.fq.gz fastq fastq 6763694400.0 22545648.0 B1 1.fq.gz 0:150 1:150 A:1864141494;C:1516607505;G:1508752023;T:1874030068;N:163310 150 150     1864141494 1516607505 1508752023 1874030068 163310 SRX15940756 SRS13627782 SRA1445974 Zhejiang Ocean University|National Engineering Research Center of Marine Fac Zhejiang Ocean University 2 0.91777 0.91753 0.11235 0.11188 0.68065 0.68069 0.51959 0.52086 150 150 B B biological fallback assumption illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2022-06-29 Undetermined Undetermined Eye Sensory System

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;