run_metadata
1,137 rows where devstage_curation_coarse = "Embryo" and tissue_curation_coarse = "Nervous System"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 5795 | 5795 | ERR1698352 | ERX1767860 | ERS1417534 | ERP018188 | PRJEB16335 | RNA seq of the zebrafish danio rerio brain post developmental exposure to 17a ethinylestradiol | E-MTAB-5173 | Transcriptome Analysis | 17a ethinylestradiol EE2 is a synthetic estrogen commonly used as an active substance in oral contraceptives. It is frequently found in waste water effluent and raise concern due to its persistent nature. EE2 binds to estrogen receptors with similar affinity to oestradiol and acts as one of the most potent hormone mimics found in the environment. Estrogen is involved in many aspects of the development of the neuroendocrine system influencing both brain structure and behavior. We and others have reported a significant effect on non reproductive behaviors in adult fish and in recent studies we found that developmental exposure to EE2 resulted in an anxiogenic phenotype as adults even post a long remediation period. In this study we aim to study possible mechanisms behind the behavior alterations of zebrafish developmentally exposed to EE2 by sequencing the whole brain transcriptome. Zebrafish embryos were exposed to 0 2.14 and 7.34 ng/L EE2 from 1 day to 80 dpf post the exposure period a remediation period of 120 days followed before the fish were sampled. 3 male brains from the control group 0 ng/L and the 2.14 ng/L group were sampled and 3 female brains from the control group 0 ng/L and 7.34 ng/L were sampled. | ENA FIRST PUBLIC:2017 10 02|ENA LAST UPDATE:2016 10 19|ArrayExpress:E MTAB 5173 | Protocols: RNA extraction Whole brains homogenized in TriReagent according to the manufacturer 0.8 ml/sample Sigma Aldrich Germany EE2 exposure. Fish exposed to 0 2.14 or 7.34 ng/L EE2 for 80 days starting 1 dpf Ion Whole transcriptome analysis kit on RiboZero eukaryote depleted total RNA | IonXpressRNA 012 up 058 12 | SAMEA4518355 | School of Natural Science, Technology and Environmental Studies Sodertorn University | ENA first public:2017 10 02|ENA last update:2016 10 19|External Id:SAMEA4518355|INSDC center alias:School of Natural Science Technology and Environmental Studies Sodertorn University|INSDC center name:School of Natural Science Technology and Environmental Studies Sodertorn University|INSDC first public:2017 10 02T17:05:16Z|INSDC last update:2016 10 19T13:53:59Z|INSDC status:public|Submitter Id:E MTAB 5173:IonXpressRNA 012 up 058 12|age:200|broker name:ArrayExpress|common name:zebrafish|organism part:brain|sample name:E MTAB 5173:IonXpressRNA 012 up 058 12|sex:male | Ion Torrent Proton sequencing; RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | E MTAB 5173:IonXpressRNA 012 up 058 12 s | IonXpressRNA 012 up 058 12 s | RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | RNA extraction Whole brains homogenized in TriReagent according to the manufacturer 0.8 ml/sample Sigma Aldrich Germany EE2 exposure. Fish exposed to 0 2.14 or 7.34 ng/L EE2 for 80 days starting 1 dpf Ion Whole transcriptome analysis kit on RiboZero eukaryote depleted total RNA | Experimental Factor: male:sex|Experimental Factor: 17 ethinylestradiol:compound|Experimental Factor: 2.14:dose | RNA-Seq | TRANSCRIPTOMIC | RANDOM | SINGLE | ION_TORRENT | Ion Torrent Proton | ERP018188 | Ion Torrent Proton sequencing; RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | ENA FIRST PUBLIC:2017 10 02|ENA LAST UPDATE:2018 11 16 | IonXpressRNA_012_up_058_12.fastq.gz | fastq | 2535299006.0 | 33956077.0 | E MTAB 5173:IonXpressRNA 012 up 058 12 | 0:74.66 | A:719061985;C:581906269;G:579932234;T:654398518;N:0 | 74 | 719061985 | 581906269 | 579932234 | 654398518 | 0 | ERX1767860 | ERS1417534 | ERA739176 | School of Natural Science, Technology and Environmental Studies Sodertorn University|European Nucleotide Archive | School of Natural Science, Technology and Environmental Studies Sodertorn University|European Nucleotide Archive | 1 | 0.7343 | 0.34119 | 0.7359 | 0.48406 | 66 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | random_priming | ribozero | bulk | unknown | unknown | Sweden | 2016-10-19 | Pharyngula | Embryo | Brain | Nervous System | ||||||||||||||||||||
| 5796 | 5796 | ERR1698351 | ERX1767859 | ERS1417533 | ERP018188 | PRJEB16335 | RNA seq of the zebrafish danio rerio brain post developmental exposure to 17a ethinylestradiol | E-MTAB-5173 | Transcriptome Analysis | 17a ethinylestradiol EE2 is a synthetic estrogen commonly used as an active substance in oral contraceptives. It is frequently found in waste water effluent and raise concern due to its persistent nature. EE2 binds to estrogen receptors with similar affinity to oestradiol and acts as one of the most potent hormone mimics found in the environment. Estrogen is involved in many aspects of the development of the neuroendocrine system influencing both brain structure and behavior. We and others have reported a significant effect on non reproductive behaviors in adult fish and in recent studies we found that developmental exposure to EE2 resulted in an anxiogenic phenotype as adults even post a long remediation period. In this study we aim to study possible mechanisms behind the behavior alterations of zebrafish developmentally exposed to EE2 by sequencing the whole brain transcriptome. Zebrafish embryos were exposed to 0 2.14 and 7.34 ng/L EE2 from 1 day to 80 dpf post the exposure period a remediation period of 120 days followed before the fish were sampled. 3 male brains from the control group 0 ng/L and the 2.14 ng/L group were sampled and 3 female brains from the control group 0 ng/L and 7.34 ng/L were sampled. | ENA FIRST PUBLIC:2017 10 02|ENA LAST UPDATE:2016 10 19|ArrayExpress:E MTAB 5173 | Protocols: RNA extraction Whole brains homogenized in TriReagent according to the manufacturer 0.8 ml/sample Sigma Aldrich Germany EE2 exposure. Fish exposed to 0 2.14 or 7.34 ng/L EE2 for 80 days starting 1 dpf Ion Whole transcriptome analysis kit on RiboZero eukaryote depleted total RNA | IonXpressRNA 011 up 058 11 | SAMEA4518354 | School of Natural Science, Technology and Environmental Studies Sodertorn University | ENA first public:2017 10 02|ENA last update:2016 10 19|External Id:SAMEA4518354|INSDC center alias:School of Natural Science Technology and Environmental Studies Sodertorn University|INSDC center name:School of Natural Science Technology and Environmental Studies Sodertorn University|INSDC first public:2017 10 02T17:05:16Z|INSDC last update:2016 10 19T13:53:59Z|INSDC status:public|Submitter Id:E MTAB 5173:IonXpressRNA 011 up 058 11|age:200|broker name:ArrayExpress|common name:zebrafish|organism part:brain|sample name:E MTAB 5173:IonXpressRNA 011 up 058 11|sex:male | Ion Torrent Proton sequencing; RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | E MTAB 5173:IonXpressRNA 011 up 058 11 s | IonXpressRNA 011 up 058 11 s | RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | RNA extraction Whole brains homogenized in TriReagent according to the manufacturer 0.8 ml/sample Sigma Aldrich Germany EE2 exposure. Fish exposed to 0 2.14 or 7.34 ng/L EE2 for 80 days starting 1 dpf Ion Whole transcriptome analysis kit on RiboZero eukaryote depleted total RNA | Experimental Factor: male:sex|Experimental Factor: 17 ethinylestradiol:compound|Experimental Factor: 2.14:dose | RNA-Seq | TRANSCRIPTOMIC | RANDOM | SINGLE | ION_TORRENT | Ion Torrent Proton | ERP018188 | Ion Torrent Proton sequencing; RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | ENA FIRST PUBLIC:2017 10 02|ENA LAST UPDATE:2018 11 16 | IonXpressRNA_011_up_058_11.fastq.gz | fastq | 3400774471.0 | 38709756.0 | E MTAB 5173:IonXpressRNA 011 up 058 11 | 0:87.85 | A:948991439;C:793389977;G:792539547;T:865853508;N:0 | 87 | 948991439 | 793389977 | 792539547 | 865853508 | 0 | ERX1767859 | ERS1417533 | ERA739176 | School of Natural Science, Technology and Environmental Studies Sodertorn University|European Nucleotide Archive | School of Natural Science, Technology and Environmental Studies Sodertorn University|European Nucleotide Archive | 1 | 0.63968 | 0.27033 | 0.75213 | 0.47966 | 139 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | random_priming | ribozero | bulk | unknown | unknown | Sweden | 2016-10-19 | Pharyngula | Embryo | Brain | Nervous System | ||||||||||||||||||||
| 5797 | 5797 | ERR1698350 | ERX1767858 | ERS1417532 | ERP018188 | PRJEB16335 | RNA seq of the zebrafish danio rerio brain post developmental exposure to 17a ethinylestradiol | E-MTAB-5173 | Transcriptome Analysis | 17a ethinylestradiol EE2 is a synthetic estrogen commonly used as an active substance in oral contraceptives. It is frequently found in waste water effluent and raise concern due to its persistent nature. EE2 binds to estrogen receptors with similar affinity to oestradiol and acts as one of the most potent hormone mimics found in the environment. Estrogen is involved in many aspects of the development of the neuroendocrine system influencing both brain structure and behavior. We and others have reported a significant effect on non reproductive behaviors in adult fish and in recent studies we found that developmental exposure to EE2 resulted in an anxiogenic phenotype as adults even post a long remediation period. In this study we aim to study possible mechanisms behind the behavior alterations of zebrafish developmentally exposed to EE2 by sequencing the whole brain transcriptome. Zebrafish embryos were exposed to 0 2.14 and 7.34 ng/L EE2 from 1 day to 80 dpf post the exposure period a remediation period of 120 days followed before the fish were sampled. 3 male brains from the control group 0 ng/L and the 2.14 ng/L group were sampled and 3 female brains from the control group 0 ng/L and 7.34 ng/L were sampled. | ENA FIRST PUBLIC:2017 10 02|ENA LAST UPDATE:2016 10 19|ArrayExpress:E MTAB 5173 | Protocols: RNA extraction Whole brains homogenized in TriReagent according to the manufacturer 0.8 ml/sample Sigma Aldrich Germany EE2 exposure. Fish exposed to 0 2.14 or 7.34 ng/L EE2 for 80 days starting 1 dpf Ion Whole transcriptome analysis kit on RiboZero eukaryote depleted total RNA | IonXpressRNA 010 up 058 10 | SAMEA4518353 | School of Natural Science, Technology and Environmental Studies Sodertorn University | ENA first public:2017 10 02|ENA last update:2016 10 19|External Id:SAMEA4518353|INSDC center alias:School of Natural Science Technology and Environmental Studies Sodertorn University|INSDC center name:School of Natural Science Technology and Environmental Studies Sodertorn University|INSDC first public:2017 10 02T17:05:16Z|INSDC last update:2016 10 19T13:53:59Z|INSDC status:public|Submitter Id:E MTAB 5173:IonXpressRNA 010 up 058 10|age:200|broker name:ArrayExpress|common name:zebrafish|organism part:brain|sample name:E MTAB 5173:IonXpressRNA 010 up 058 10|sex:male | Ion Torrent Proton sequencing; RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | E MTAB 5173:IonXpressRNA 010 up 058 10 s | IonXpressRNA 010 up 058 10 s | RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | RNA extraction Whole brains homogenized in TriReagent according to the manufacturer 0.8 ml/sample Sigma Aldrich Germany EE2 exposure. Fish exposed to 0 2.14 or 7.34 ng/L EE2 for 80 days starting 1 dpf Ion Whole transcriptome analysis kit on RiboZero eukaryote depleted total RNA | Experimental Factor: male:sex|Experimental Factor: 17 ethinylestradiol:compound|Experimental Factor: 2.14:dose | RNA-Seq | TRANSCRIPTOMIC | RANDOM | SINGLE | ION_TORRENT | Ion Torrent Proton | ERP018188 | Ion Torrent Proton sequencing; RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | ENA FIRST PUBLIC:2017 10 02|ENA LAST UPDATE:2018 11 16 | IonXpressRNA_010_up_058_10.fastq.gz | fastq | 3502667998.0 | 39204781.0 | E MTAB 5173:IonXpressRNA 010 up 058 10 | 0:89.34 | A:976977303;C:803330255;G:808731995;T:913628445;N:0 | 89 | 976977303 | 803330255 | 808731995 | 913628445 | 0 | ERX1767858 | ERS1417532 | ERA739176 | School of Natural Science, Technology and Environmental Studies Sodertorn University|European Nucleotide Archive | School of Natural Science, Technology and Environmental Studies Sodertorn University|European Nucleotide Archive | 1 | 0.65846 | 0.2815 | 0.74028 | 0.47784 | 86 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | random_priming | ribozero | bulk | unknown | unknown | Sweden | 2016-10-19 | Pharyngula | Embryo | Brain | Nervous System | ||||||||||||||||||||
| 5798 | 5798 | ERR1698349 | ERX1767857 | ERS1417531 | ERP018188 | PRJEB16335 | RNA seq of the zebrafish danio rerio brain post developmental exposure to 17a ethinylestradiol | E-MTAB-5173 | Transcriptome Analysis | 17a ethinylestradiol EE2 is a synthetic estrogen commonly used as an active substance in oral contraceptives. It is frequently found in waste water effluent and raise concern due to its persistent nature. EE2 binds to estrogen receptors with similar affinity to oestradiol and acts as one of the most potent hormone mimics found in the environment. Estrogen is involved in many aspects of the development of the neuroendocrine system influencing both brain structure and behavior. We and others have reported a significant effect on non reproductive behaviors in adult fish and in recent studies we found that developmental exposure to EE2 resulted in an anxiogenic phenotype as adults even post a long remediation period. In this study we aim to study possible mechanisms behind the behavior alterations of zebrafish developmentally exposed to EE2 by sequencing the whole brain transcriptome. Zebrafish embryos were exposed to 0 2.14 and 7.34 ng/L EE2 from 1 day to 80 dpf post the exposure period a remediation period of 120 days followed before the fish were sampled. 3 male brains from the control group 0 ng/L and the 2.14 ng/L group were sampled and 3 female brains from the control group 0 ng/L and 7.34 ng/L were sampled. | ENA FIRST PUBLIC:2017 10 02|ENA LAST UPDATE:2016 10 19|ArrayExpress:E MTAB 5173 | Protocols: RNA extraction Whole brains homogenized in TriReagent according to the manufacturer 0.8 ml/sample Sigma Aldrich Germany EE2 exposure. Fish exposed to 0 2.14 or 7.34 ng/L EE2 for 80 days starting 1 dpf Ion Whole transcriptome analysis kit on RiboZero eukaryote depleted total RNA | IonXpressRNA 009 up 058 9 | SAMEA4518352 | School of Natural Science, Technology and Environmental Studies Sodertorn University | ENA first public:2017 10 02|ENA last update:2016 10 19|External Id:SAMEA4518352|INSDC center alias:School of Natural Science Technology and Environmental Studies Sodertorn University|INSDC center name:School of Natural Science Technology and Environmental Studies Sodertorn University|INSDC first public:2017 10 02T17:05:16Z|INSDC last update:2016 10 19T13:53:59Z|INSDC status:public|Submitter Id:E MTAB 5173:IonXpressRNA 009 up 058 9|age:200|broker name:ArrayExpress|common name:zebrafish|organism part:brain|sample name:E MTAB 5173:IonXpressRNA 009 up 058 9|sex:male | Ion Torrent Proton sequencing; RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | E MTAB 5173:IonXpressRNA 009 up 058 9 s | IonXpressRNA 009 up 058 9 s | RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | RNA extraction Whole brains homogenized in TriReagent according to the manufacturer 0.8 ml/sample Sigma Aldrich Germany EE2 exposure. Fish exposed to 0 2.14 or 7.34 ng/L EE2 for 80 days starting 1 dpf Ion Whole transcriptome analysis kit on RiboZero eukaryote depleted total RNA | Experimental Factor: male:sex|Experimental Factor: n1:compound | RNA-Seq | TRANSCRIPTOMIC | RANDOM | SINGLE | ION_TORRENT | Ion Torrent Proton | ERP018188 | Ion Torrent Proton sequencing; RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | ENA FIRST PUBLIC:2017 10 02|ENA LAST UPDATE:2018 11 16 | IonXpressRNA_009_up_058_9.fastq.gz | fastq | 3575088264.0 | 39745481.0 | E MTAB 5173:IonXpressRNA 009 up 058 9 | 0:89.95 | A:1011474126;C:809896078;G:807471974;T:946246086;N:0 | 89 | 1011474126 | 809896078 | 807471974 | 946246086 | 0 | ERX1767857 | ERS1417531 | ERA739176 | School of Natural Science, Technology and Environmental Studies Sodertorn University|European Nucleotide Archive | School of Natural Science, Technology and Environmental Studies Sodertorn University|European Nucleotide Archive | 1 | 0.65266 | 0.30274 | 0.75286 | 0.48527 | 94 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | random_priming | ribozero | bulk | unknown | unknown | Sweden | 2016-10-19 | Pharyngula | Embryo | Brain | Nervous System | ||||||||||||||||||||
| 5799 | 5799 | ERR1698348 | ERX1767856 | ERS1417530 | ERP018188 | PRJEB16335 | RNA seq of the zebrafish danio rerio brain post developmental exposure to 17a ethinylestradiol | E-MTAB-5173 | Transcriptome Analysis | 17a ethinylestradiol EE2 is a synthetic estrogen commonly used as an active substance in oral contraceptives. It is frequently found in waste water effluent and raise concern due to its persistent nature. EE2 binds to estrogen receptors with similar affinity to oestradiol and acts as one of the most potent hormone mimics found in the environment. Estrogen is involved in many aspects of the development of the neuroendocrine system influencing both brain structure and behavior. We and others have reported a significant effect on non reproductive behaviors in adult fish and in recent studies we found that developmental exposure to EE2 resulted in an anxiogenic phenotype as adults even post a long remediation period. In this study we aim to study possible mechanisms behind the behavior alterations of zebrafish developmentally exposed to EE2 by sequencing the whole brain transcriptome. Zebrafish embryos were exposed to 0 2.14 and 7.34 ng/L EE2 from 1 day to 80 dpf post the exposure period a remediation period of 120 days followed before the fish were sampled. 3 male brains from the control group 0 ng/L and the 2.14 ng/L group were sampled and 3 female brains from the control group 0 ng/L and 7.34 ng/L were sampled. | ENA FIRST PUBLIC:2017 10 02|ENA LAST UPDATE:2016 10 19|ArrayExpress:E MTAB 5173 | Protocols: RNA extraction Whole brains homogenized in TriReagent according to the manufacturer 0.8 ml/sample Sigma Aldrich Germany EE2 exposure. Fish exposed to 0 2.14 or 7.34 ng/L EE2 for 80 days starting 1 dpf Ion Whole transcriptome analysis kit on RiboZero eukaryote depleted total RNA | IonXpressRNA 008 up 058 8 | SAMEA4518351 | School of Natural Science, Technology and Environmental Studies Sodertorn University | ENA first public:2017 10 02|ENA last update:2016 10 19|External Id:SAMEA4518351|INSDC center alias:School of Natural Science Technology and Environmental Studies Sodertorn University|INSDC center name:School of Natural Science Technology and Environmental Studies Sodertorn University|INSDC first public:2017 10 02T17:05:16Z|INSDC last update:2016 10 19T13:53:59Z|INSDC status:public|Submitter Id:E MTAB 5173:IonXpressRNA 008 up 058 8|age:200|broker name:ArrayExpress|common name:zebrafish|organism part:brain|sample name:E MTAB 5173:IonXpressRNA 008 up 058 8|sex:male | Ion Torrent Proton sequencing; RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | E MTAB 5173:IonXpressRNA 008 up 058 8 s | IonXpressRNA 008 up 058 8 s | RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | RNA extraction Whole brains homogenized in TriReagent according to the manufacturer 0.8 ml/sample Sigma Aldrich Germany EE2 exposure. Fish exposed to 0 2.14 or 7.34 ng/L EE2 for 80 days starting 1 dpf Ion Whole transcriptome analysis kit on RiboZero eukaryote depleted total RNA | Experimental Factor: male:sex|Experimental Factor: n1:compound | RNA-Seq | TRANSCRIPTOMIC | RANDOM | SINGLE | ION_TORRENT | Ion Torrent Proton | ERP018188 | Ion Torrent Proton sequencing; RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | ENA FIRST PUBLIC:2017 10 02|ENA LAST UPDATE:2018 11 16 | IonXpressRNA_008_up_058_8.fastq.gz | fastq | 3259710114.0 | 38530802.0 | E MTAB 5173:IonXpressRNA 008 up 058 8 | 0:84.60 | A:916053004;C:755694888;G:751125332;T:836836890;N:0 | 84 | 916053004 | 755694888 | 751125332 | 836836890 | 0 | ERX1767856 | ERS1417530 | ERA739176 | School of Natural Science, Technology and Environmental Studies Sodertorn University|European Nucleotide Archive | School of Natural Science, Technology and Environmental Studies Sodertorn University|European Nucleotide Archive | 1 | 0.70995 | 0.31365 | 0.74781 | 0.48846 | 61 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | random_priming | ribozero | bulk | unknown | unknown | Sweden | 2016-10-19 | Pharyngula | Embryo | Brain | Nervous System | ||||||||||||||||||||
| 5800 | 5800 | ERR1698347 | ERX1767855 | ERS1417529 | ERP018188 | PRJEB16335 | RNA seq of the zebrafish danio rerio brain post developmental exposure to 17a ethinylestradiol | E-MTAB-5173 | Transcriptome Analysis | 17a ethinylestradiol EE2 is a synthetic estrogen commonly used as an active substance in oral contraceptives. It is frequently found in waste water effluent and raise concern due to its persistent nature. EE2 binds to estrogen receptors with similar affinity to oestradiol and acts as one of the most potent hormone mimics found in the environment. Estrogen is involved in many aspects of the development of the neuroendocrine system influencing both brain structure and behavior. We and others have reported a significant effect on non reproductive behaviors in adult fish and in recent studies we found that developmental exposure to EE2 resulted in an anxiogenic phenotype as adults even post a long remediation period. In this study we aim to study possible mechanisms behind the behavior alterations of zebrafish developmentally exposed to EE2 by sequencing the whole brain transcriptome. Zebrafish embryos were exposed to 0 2.14 and 7.34 ng/L EE2 from 1 day to 80 dpf post the exposure period a remediation period of 120 days followed before the fish were sampled. 3 male brains from the control group 0 ng/L and the 2.14 ng/L group were sampled and 3 female brains from the control group 0 ng/L and 7.34 ng/L were sampled. | ENA FIRST PUBLIC:2017 10 02|ENA LAST UPDATE:2016 10 19|ArrayExpress:E MTAB 5173 | Protocols: RNA extraction Whole brains homogenized in TriReagent according to the manufacturer 0.8 ml/sample Sigma Aldrich Germany EE2 exposure. Fish exposed to 0 2.14 or 7.34 ng/L EE2 for 80 days starting 1 dpf Ion Whole transcriptome analysis kit on RiboZero eukaryote depleted total RNA | IonXpressRNA 007 up 058 7 | SAMEA4518350 | School of Natural Science, Technology and Environmental Studies Sodertorn University | ENA first public:2017 10 02|ENA last update:2016 10 19|External Id:SAMEA4518350|INSDC center alias:School of Natural Science Technology and Environmental Studies Sodertorn University|INSDC center name:School of Natural Science Technology and Environmental Studies Sodertorn University|INSDC first public:2017 10 02T17:05:16Z|INSDC last update:2016 10 19T13:53:59Z|INSDC status:public|Submitter Id:E MTAB 5173:IonXpressRNA 007 up 058 7|age:200|broker name:ArrayExpress|common name:zebrafish|organism part:brain|sample name:E MTAB 5173:IonXpressRNA 007 up 058 7|sex:male | Ion Torrent Proton sequencing; RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | E MTAB 5173:IonXpressRNA 007 up 058 7 s | IonXpressRNA 007 up 058 7 s | RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | RNA extraction Whole brains homogenized in TriReagent according to the manufacturer 0.8 ml/sample Sigma Aldrich Germany EE2 exposure. Fish exposed to 0 2.14 or 7.34 ng/L EE2 for 80 days starting 1 dpf Ion Whole transcriptome analysis kit on RiboZero eukaryote depleted total RNA | Experimental Factor: male:sex|Experimental Factor: n1:compound | RNA-Seq | TRANSCRIPTOMIC | RANDOM | SINGLE | ION_TORRENT | Ion Torrent Proton | ERP018188 | Ion Torrent Proton sequencing; RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | ENA FIRST PUBLIC:2017 10 02|ENA LAST UPDATE:2018 11 16 | IonXpressRNA_007_up_058_7.fastq.gz | fastq | 2307842164.0 | 28984666.0 | E MTAB 5173:IonXpressRNA 007 up 058 7 | 0:79.62 | A:634041732;C:548565089;G:545418985;T:579816358;N:0 | 79 | 634041732 | 548565089 | 545418985 | 579816358 | 0 | ERX1767855 | ERS1417529 | ERA739176 | School of Natural Science, Technology and Environmental Studies Sodertorn University|European Nucleotide Archive | School of Natural Science, Technology and Environmental Studies Sodertorn University|European Nucleotide Archive | 1 | 0.67542 | 0.2817 | 0.74168 | 0.47224 | 37 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | random_priming | ribozero | bulk | unknown | unknown | Sweden | 2016-10-19 | Pharyngula | Embryo | Brain | Nervous System | ||||||||||||||||||||
| 5801 | 5801 | ERR1698346 | ERX1767854 | ERS1417528 | ERP018188 | PRJEB16335 | RNA seq of the zebrafish danio rerio brain post developmental exposure to 17a ethinylestradiol | E-MTAB-5173 | Transcriptome Analysis | 17a ethinylestradiol EE2 is a synthetic estrogen commonly used as an active substance in oral contraceptives. It is frequently found in waste water effluent and raise concern due to its persistent nature. EE2 binds to estrogen receptors with similar affinity to oestradiol and acts as one of the most potent hormone mimics found in the environment. Estrogen is involved in many aspects of the development of the neuroendocrine system influencing both brain structure and behavior. We and others have reported a significant effect on non reproductive behaviors in adult fish and in recent studies we found that developmental exposure to EE2 resulted in an anxiogenic phenotype as adults even post a long remediation period. In this study we aim to study possible mechanisms behind the behavior alterations of zebrafish developmentally exposed to EE2 by sequencing the whole brain transcriptome. Zebrafish embryos were exposed to 0 2.14 and 7.34 ng/L EE2 from 1 day to 80 dpf post the exposure period a remediation period of 120 days followed before the fish were sampled. 3 male brains from the control group 0 ng/L and the 2.14 ng/L group were sampled and 3 female brains from the control group 0 ng/L and 7.34 ng/L were sampled. | ENA FIRST PUBLIC:2017 10 02|ENA LAST UPDATE:2016 10 19|ArrayExpress:E MTAB 5173 | Protocols: RNA extraction Whole brains homogenized in TriReagent according to the manufacturer 0.8 ml/sample Sigma Aldrich Germany EE2 exposure. Fish exposed to 0 2.14 or 7.34 ng/L EE2 for 80 days starting 1 dpf Ion Whole transcriptome analysis kit on RiboZero eukaryote depleted total RNA | IonXpressRNA 006 up 058 6 | SAMEA4518349 | School of Natural Science, Technology and Environmental Studies Sodertorn University | ENA first public:2017 10 02|ENA last update:2016 10 19|External Id:SAMEA4518349|INSDC center alias:School of Natural Science Technology and Environmental Studies Sodertorn University|INSDC center name:School of Natural Science Technology and Environmental Studies Sodertorn University|INSDC first public:2017 10 02T17:05:16Z|INSDC last update:2016 10 19T13:53:59Z|INSDC status:public|Submitter Id:E MTAB 5173:IonXpressRNA 006 up 058 6|age:200|broker name:ArrayExpress|common name:zebrafish|organism part:brain|sample name:E MTAB 5173:IonXpressRNA 006 up 058 6|sex:female | Ion Torrent Proton sequencing; RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | E MTAB 5173:IonXpressRNA 006 up 058 6 s | IonXpressRNA 006 up 058 6 s | RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | RNA extraction Whole brains homogenized in TriReagent according to the manufacturer 0.8 ml/sample Sigma Aldrich Germany EE2 exposure. Fish exposed to 0 2.14 or 7.34 ng/L EE2 for 80 days starting 1 dpf Ion Whole transcriptome analysis kit on RiboZero eukaryote depleted total RNA | Experimental Factor: female:sex|Experimental Factor: 17 ethinylestradiol:compound|Experimental Factor: 7.34:dose | RNA-Seq | TRANSCRIPTOMIC | RANDOM | SINGLE | ION_TORRENT | Ion Torrent Proton | ERP018188 | Ion Torrent Proton sequencing; RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | ENA FIRST PUBLIC:2017 10 02|ENA LAST UPDATE:2018 11 16 | IonXpressRNA_006_up_058_6.fastq.gz | fastq | 2239484857.0 | 27021234.0 | E MTAB 5173:IonXpressRNA 006 up 058 6 | 0:82.88 | A:637326624;C:506830056;G:503508207;T:591819970;N:0 | 82 | 637326624 | 506830056 | 503508207 | 591819970 | 0 | ERX1767854 | ERS1417528 | ERA739176 | School of Natural Science, Technology and Environmental Studies Sodertorn University|European Nucleotide Archive | School of Natural Science, Technology and Environmental Studies Sodertorn University|European Nucleotide Archive | 1 | 0.66441 | 0.31904 | 0.74905 | 0.47154 | 122 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | random_priming | ribozero | bulk | unknown | unknown | Sweden | 2016-10-19 | Pharyngula | Embryo | Brain | Nervous System | ||||||||||||||||||||
| 5802 | 5802 | ERR1698345 | ERX1767853 | ERS1417527 | ERP018188 | PRJEB16335 | RNA seq of the zebrafish danio rerio brain post developmental exposure to 17a ethinylestradiol | E-MTAB-5173 | Transcriptome Analysis | 17a ethinylestradiol EE2 is a synthetic estrogen commonly used as an active substance in oral contraceptives. It is frequently found in waste water effluent and raise concern due to its persistent nature. EE2 binds to estrogen receptors with similar affinity to oestradiol and acts as one of the most potent hormone mimics found in the environment. Estrogen is involved in many aspects of the development of the neuroendocrine system influencing both brain structure and behavior. We and others have reported a significant effect on non reproductive behaviors in adult fish and in recent studies we found that developmental exposure to EE2 resulted in an anxiogenic phenotype as adults even post a long remediation period. In this study we aim to study possible mechanisms behind the behavior alterations of zebrafish developmentally exposed to EE2 by sequencing the whole brain transcriptome. Zebrafish embryos were exposed to 0 2.14 and 7.34 ng/L EE2 from 1 day to 80 dpf post the exposure period a remediation period of 120 days followed before the fish were sampled. 3 male brains from the control group 0 ng/L and the 2.14 ng/L group were sampled and 3 female brains from the control group 0 ng/L and 7.34 ng/L were sampled. | ENA FIRST PUBLIC:2017 10 02|ENA LAST UPDATE:2016 10 19|ArrayExpress:E MTAB 5173 | Protocols: RNA extraction Whole brains homogenized in TriReagent according to the manufacturer 0.8 ml/sample Sigma Aldrich Germany EE2 exposure. Fish exposed to 0 2.14 or 7.34 ng/L EE2 for 80 days starting 1 dpf Ion Whole transcriptome analysis kit on RiboZero eukaryote depleted total RNA | IonXpressRNA 005 up 058 5 | SAMEA4518348 | School of Natural Science, Technology and Environmental Studies Sodertorn University | ENA first public:2017 10 02|ENA last update:2016 10 19|External Id:SAMEA4518348|INSDC center alias:School of Natural Science Technology and Environmental Studies Sodertorn University|INSDC center name:School of Natural Science Technology and Environmental Studies Sodertorn University|INSDC first public:2017 10 02T17:05:16Z|INSDC last update:2016 10 19T13:53:59Z|INSDC status:public|Submitter Id:E MTAB 5173:IonXpressRNA 005 up 058 5|age:200|broker name:ArrayExpress|common name:zebrafish|organism part:brain|sample name:E MTAB 5173:IonXpressRNA 005 up 058 5|sex:female | Ion Torrent Proton sequencing; RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | E MTAB 5173:IonXpressRNA 005 up 058 5 s | IonXpressRNA 005 up 058 5 s | RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | RNA extraction Whole brains homogenized in TriReagent according to the manufacturer 0.8 ml/sample Sigma Aldrich Germany EE2 exposure. Fish exposed to 0 2.14 or 7.34 ng/L EE2 for 80 days starting 1 dpf Ion Whole transcriptome analysis kit on RiboZero eukaryote depleted total RNA | Experimental Factor: female:sex|Experimental Factor: 17 ethinylestradiol:compound|Experimental Factor: 7.34:dose | RNA-Seq | TRANSCRIPTOMIC | RANDOM | SINGLE | ION_TORRENT | Ion Torrent Proton | ERP018188 | Ion Torrent Proton sequencing; RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | ENA FIRST PUBLIC:2017 10 02|ENA LAST UPDATE:2018 11 16 | IonXpressRNA_005_up_058_5.fastq.gz | fastq | 2920608487.0 | 39573075.0 | E MTAB 5173:IonXpressRNA 005 up 058 5 | 0:73.80 | A:814851327;C:678116994;G:691911192;T:735728974;N:0 | 73 | 814851327 | 678116994 | 691911192 | 735728974 | 0 | ERX1767853 | ERS1417527 | ERA739176 | School of Natural Science, Technology and Environmental Studies Sodertorn University|European Nucleotide Archive | School of Natural Science, Technology and Environmental Studies Sodertorn University|European Nucleotide Archive | 1 | 0.60005 | 0.25542 | 0.76481 | 0.4886 | 12 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | random_priming | ribozero | bulk | unknown | unknown | Sweden | 2016-10-19 | Pharyngula | Embryo | Brain | Nervous System | ||||||||||||||||||||
| 5803 | 5803 | ERR1698344 | ERX1767852 | ERS1417526 | ERP018188 | PRJEB16335 | RNA seq of the zebrafish danio rerio brain post developmental exposure to 17a ethinylestradiol | E-MTAB-5173 | Transcriptome Analysis | 17a ethinylestradiol EE2 is a synthetic estrogen commonly used as an active substance in oral contraceptives. It is frequently found in waste water effluent and raise concern due to its persistent nature. EE2 binds to estrogen receptors with similar affinity to oestradiol and acts as one of the most potent hormone mimics found in the environment. Estrogen is involved in many aspects of the development of the neuroendocrine system influencing both brain structure and behavior. We and others have reported a significant effect on non reproductive behaviors in adult fish and in recent studies we found that developmental exposure to EE2 resulted in an anxiogenic phenotype as adults even post a long remediation period. In this study we aim to study possible mechanisms behind the behavior alterations of zebrafish developmentally exposed to EE2 by sequencing the whole brain transcriptome. Zebrafish embryos were exposed to 0 2.14 and 7.34 ng/L EE2 from 1 day to 80 dpf post the exposure period a remediation period of 120 days followed before the fish were sampled. 3 male brains from the control group 0 ng/L and the 2.14 ng/L group were sampled and 3 female brains from the control group 0 ng/L and 7.34 ng/L were sampled. | ENA FIRST PUBLIC:2017 10 02|ENA LAST UPDATE:2016 10 19|ArrayExpress:E MTAB 5173 | Protocols: RNA extraction Whole brains homogenized in TriReagent according to the manufacturer 0.8 ml/sample Sigma Aldrich Germany EE2 exposure. Fish exposed to 0 2.14 or 7.34 ng/L EE2 for 80 days starting 1 dpf Ion Whole transcriptome analysis kit on RiboZero eukaryote depleted total RNA | IonXpressRNA 004 up 058 4 | SAMEA4518347 | School of Natural Science, Technology and Environmental Studies Sodertorn University | ENA first public:2017 10 02|ENA last update:2016 10 19|External Id:SAMEA4518347|INSDC center alias:School of Natural Science Technology and Environmental Studies Sodertorn University|INSDC center name:School of Natural Science Technology and Environmental Studies Sodertorn University|INSDC first public:2017 10 02T17:05:16Z|INSDC last update:2016 10 19T13:53:59Z|INSDC status:public|Submitter Id:E MTAB 5173:IonXpressRNA 004 up 058 4|age:200|broker name:ArrayExpress|common name:zebrafish|organism part:brain|sample name:E MTAB 5173:IonXpressRNA 004 up 058 4|sex:female | Ion Torrent Proton sequencing; RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | E MTAB 5173:IonXpressRNA 004 up 058 4 s | IonXpressRNA 004 up 058 4 s | RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | RNA extraction Whole brains homogenized in TriReagent according to the manufacturer 0.8 ml/sample Sigma Aldrich Germany EE2 exposure. Fish exposed to 0 2.14 or 7.34 ng/L EE2 for 80 days starting 1 dpf Ion Whole transcriptome analysis kit on RiboZero eukaryote depleted total RNA | Experimental Factor: female:sex|Experimental Factor: 17 ethinylestradiol:compound|Experimental Factor: 7.34:dose | RNA-Seq | TRANSCRIPTOMIC | RANDOM | SINGLE | ION_TORRENT | Ion Torrent Proton | ERP018188 | Ion Torrent Proton sequencing; RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | ENA FIRST PUBLIC:2017 10 02|ENA LAST UPDATE:2018 11 16 | IonXpressRNA_004_up_058_4.fastq.gz | fastq | 2989727396.0 | 37953454.0 | E MTAB 5173:IonXpressRNA 004 up 058 4 | 0:78.77 | A:802963810;C:722434772;G:742850530;T:721478284;N:0 | 78 | 802963810 | 722434772 | 742850530 | 721478284 | 0 | ERX1767852 | ERS1417526 | ERA739176 | School of Natural Science, Technology and Environmental Studies Sodertorn University|European Nucleotide Archive | School of Natural Science, Technology and Environmental Studies Sodertorn University|European Nucleotide Archive | 1 | 0.76402 | 0.32503 | 0.74241 | 0.4815 | 128 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | random_priming | ribozero | bulk | unknown | unknown | Sweden | 2016-10-19 | Pharyngula | Embryo | Brain | Nervous System | ||||||||||||||||||||
| 5804 | 5804 | ERR1698343 | ERX1767851 | ERS1417525 | ERP018188 | PRJEB16335 | RNA seq of the zebrafish danio rerio brain post developmental exposure to 17a ethinylestradiol | E-MTAB-5173 | Transcriptome Analysis | 17a ethinylestradiol EE2 is a synthetic estrogen commonly used as an active substance in oral contraceptives. It is frequently found in waste water effluent and raise concern due to its persistent nature. EE2 binds to estrogen receptors with similar affinity to oestradiol and acts as one of the most potent hormone mimics found in the environment. Estrogen is involved in many aspects of the development of the neuroendocrine system influencing both brain structure and behavior. We and others have reported a significant effect on non reproductive behaviors in adult fish and in recent studies we found that developmental exposure to EE2 resulted in an anxiogenic phenotype as adults even post a long remediation period. In this study we aim to study possible mechanisms behind the behavior alterations of zebrafish developmentally exposed to EE2 by sequencing the whole brain transcriptome. Zebrafish embryos were exposed to 0 2.14 and 7.34 ng/L EE2 from 1 day to 80 dpf post the exposure period a remediation period of 120 days followed before the fish were sampled. 3 male brains from the control group 0 ng/L and the 2.14 ng/L group were sampled and 3 female brains from the control group 0 ng/L and 7.34 ng/L were sampled. | ENA FIRST PUBLIC:2017 10 02|ENA LAST UPDATE:2016 10 19|ArrayExpress:E MTAB 5173 | Protocols: RNA extraction Whole brains homogenized in TriReagent according to the manufacturer 0.8 ml/sample Sigma Aldrich Germany EE2 exposure. Fish exposed to 0 2.14 or 7.34 ng/L EE2 for 80 days starting 1 dpf Ion Whole transcriptome analysis kit on RiboZero eukaryote depleted total RNA | IonXpressRNA 003 up 058 3 | SAMEA4518346 | School of Natural Science, Technology and Environmental Studies Sodertorn University | ENA first public:2017 10 02|ENA last update:2016 10 19|External Id:SAMEA4518346|INSDC center alias:School of Natural Science Technology and Environmental Studies Sodertorn University|INSDC center name:School of Natural Science Technology and Environmental Studies Sodertorn University|INSDC first public:2017 10 02T17:05:16Z|INSDC last update:2016 10 19T13:53:59Z|INSDC status:public|Submitter Id:E MTAB 5173:IonXpressRNA 003 up 058 3|age:200|broker name:ArrayExpress|common name:zebrafish|organism part:brain|sample name:E MTAB 5173:IonXpressRNA 003 up 058 3|sex:female | Ion Torrent Proton sequencing; RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | E MTAB 5173:IonXpressRNA 003 up 058 3 s | IonXpressRNA 003 up 058 3 s | RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | RNA extraction Whole brains homogenized in TriReagent according to the manufacturer 0.8 ml/sample Sigma Aldrich Germany EE2 exposure. Fish exposed to 0 2.14 or 7.34 ng/L EE2 for 80 days starting 1 dpf Ion Whole transcriptome analysis kit on RiboZero eukaryote depleted total RNA | Experimental Factor: female:sex|Experimental Factor: n1:compound | RNA-Seq | TRANSCRIPTOMIC | RANDOM | SINGLE | ION_TORRENT | Ion Torrent Proton | ERP018188 | Ion Torrent Proton sequencing; RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | ENA FIRST PUBLIC:2017 10 02|ENA LAST UPDATE:2018 11 16 | IonXpressRNA_003_up_058_3.fastq.gz | fastq | 4068383115.0 | 41996847.0 | E MTAB 5173:IonXpressRNA 003 up 058 3 | 0:96.87 | A:1133167706;C:944306379;G:948626944;T:1042282086;N:0 | 96 | 1133167706 | 944306379 | 948626944 | 1042282086 | 0 | ERX1767851 | ERS1417525 | ERA739176 | School of Natural Science, Technology and Environmental Studies Sodertorn University|European Nucleotide Archive | School of Natural Science, Technology and Environmental Studies Sodertorn University|European Nucleotide Archive | 1 | 0.54804 | 0.22334 | 0.76353 | 0.49163 | 93 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | random_priming | ribozero | bulk | unknown | unknown | Sweden | 2016-10-19 | Pharyngula | Embryo | Brain | Nervous System | ||||||||||||||||||||
| 5805 | 5805 | ERR1698342 | ERX1767850 | ERS1417524 | ERP018188 | PRJEB16335 | RNA seq of the zebrafish danio rerio brain post developmental exposure to 17a ethinylestradiol | E-MTAB-5173 | Transcriptome Analysis | 17a ethinylestradiol EE2 is a synthetic estrogen commonly used as an active substance in oral contraceptives. It is frequently found in waste water effluent and raise concern due to its persistent nature. EE2 binds to estrogen receptors with similar affinity to oestradiol and acts as one of the most potent hormone mimics found in the environment. Estrogen is involved in many aspects of the development of the neuroendocrine system influencing both brain structure and behavior. We and others have reported a significant effect on non reproductive behaviors in adult fish and in recent studies we found that developmental exposure to EE2 resulted in an anxiogenic phenotype as adults even post a long remediation period. In this study we aim to study possible mechanisms behind the behavior alterations of zebrafish developmentally exposed to EE2 by sequencing the whole brain transcriptome. Zebrafish embryos were exposed to 0 2.14 and 7.34 ng/L EE2 from 1 day to 80 dpf post the exposure period a remediation period of 120 days followed before the fish were sampled. 3 male brains from the control group 0 ng/L and the 2.14 ng/L group were sampled and 3 female brains from the control group 0 ng/L and 7.34 ng/L were sampled. | ENA FIRST PUBLIC:2017 10 02|ENA LAST UPDATE:2016 10 19|ArrayExpress:E MTAB 5173 | Protocols: RNA extraction Whole brains homogenized in TriReagent according to the manufacturer 0.8 ml/sample Sigma Aldrich Germany EE2 exposure. Fish exposed to 0 2.14 or 7.34 ng/L EE2 for 80 days starting 1 dpf Ion Whole transcriptome analysis kit on RiboZero eukaryote depleted total RNA | IonXpressRNA 002 up 058 2 | SAMEA4518345 | School of Natural Science, Technology and Environmental Studies Sodertorn University | ENA first public:2017 10 02|ENA last update:2016 10 19|External Id:SAMEA4518345|INSDC center alias:School of Natural Science Technology and Environmental Studies Sodertorn University|INSDC center name:School of Natural Science Technology and Environmental Studies Sodertorn University|INSDC first public:2017 10 02T17:05:16Z|INSDC last update:2016 10 19T13:53:59Z|INSDC status:public|Submitter Id:E MTAB 5173:IonXpressRNA 002 up 058 2|age:200|broker name:ArrayExpress|common name:zebrafish|organism part:brain|sample name:E MTAB 5173:IonXpressRNA 002 up 058 2|sex:female | Ion Torrent Proton sequencing; RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | E MTAB 5173:IonXpressRNA 002 up 058 2 s | IonXpressRNA 002 up 058 2 s | RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | RNA extraction Whole brains homogenized in TriReagent according to the manufacturer 0.8 ml/sample Sigma Aldrich Germany EE2 exposure. Fish exposed to 0 2.14 or 7.34 ng/L EE2 for 80 days starting 1 dpf Ion Whole transcriptome analysis kit on RiboZero eukaryote depleted total RNA | Experimental Factor: female:sex|Experimental Factor: n1:compound | RNA-Seq | TRANSCRIPTOMIC | RANDOM | SINGLE | ION_TORRENT | Ion Torrent Proton | ERP018188 | Ion Torrent Proton sequencing; RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | ENA FIRST PUBLIC:2017 10 02|ENA LAST UPDATE:2018 11 16 | IonXpressRNA_002_up_058_2.fastq.gz | fastq | 2679963893.0 | 33552723.0 | E MTAB 5173:IonXpressRNA 002 up 058 2 | 0:79.87 | A:709092431;C:635329399;G:670478210;T:665063853;N:0 | 79 | 709092431 | 635329399 | 670478210 | 665063853 | 0 | ERX1767850 | ERS1417524 | ERA739176 | School of Natural Science, Technology and Environmental Studies Sodertorn University|European Nucleotide Archive | School of Natural Science, Technology and Environmental Studies Sodertorn University|European Nucleotide Archive | 1 | 0.43283 | 0.18649 | 0.81178 | 0.52885 | 116 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | random_priming | ribozero | bulk | unknown | unknown | Sweden | 2016-10-19 | Pharyngula | Embryo | Brain | Nervous System | ||||||||||||||||||||
| 5806 | 5806 | ERR1698341 | ERX1767849 | ERS1417523 | ERP018188 | PRJEB16335 | RNA seq of the zebrafish danio rerio brain post developmental exposure to 17a ethinylestradiol | E-MTAB-5173 | Transcriptome Analysis | 17a ethinylestradiol EE2 is a synthetic estrogen commonly used as an active substance in oral contraceptives. It is frequently found in waste water effluent and raise concern due to its persistent nature. EE2 binds to estrogen receptors with similar affinity to oestradiol and acts as one of the most potent hormone mimics found in the environment. Estrogen is involved in many aspects of the development of the neuroendocrine system influencing both brain structure and behavior. We and others have reported a significant effect on non reproductive behaviors in adult fish and in recent studies we found that developmental exposure to EE2 resulted in an anxiogenic phenotype as adults even post a long remediation period. In this study we aim to study possible mechanisms behind the behavior alterations of zebrafish developmentally exposed to EE2 by sequencing the whole brain transcriptome. Zebrafish embryos were exposed to 0 2.14 and 7.34 ng/L EE2 from 1 day to 80 dpf post the exposure period a remediation period of 120 days followed before the fish were sampled. 3 male brains from the control group 0 ng/L and the 2.14 ng/L group were sampled and 3 female brains from the control group 0 ng/L and 7.34 ng/L were sampled. | ENA FIRST PUBLIC:2017 10 02|ENA LAST UPDATE:2016 10 19|ArrayExpress:E MTAB 5173 | Protocols: RNA extraction Whole brains homogenized in TriReagent according to the manufacturer 0.8 ml/sample Sigma Aldrich Germany EE2 exposure. Fish exposed to 0 2.14 or 7.34 ng/L EE2 for 80 days starting 1 dpf Ion Whole transcriptome analysis kit on RiboZero eukaryote depleted total RNA | IonXpressRNA 001 up 058 1 | SAMEA4518344 | School of Natural Science, Technology and Environmental Studies Sodertorn University | ENA first public:2017 10 02|ENA last update:2016 10 19|External Id:SAMEA4518344|INSDC center alias:School of Natural Science Technology and Environmental Studies Sodertorn University|INSDC center name:School of Natural Science Technology and Environmental Studies Sodertorn University|INSDC first public:2017 10 02T17:05:16Z|INSDC last update:2016 10 19T13:53:59Z|INSDC status:public|Submitter Id:E MTAB 5173:IonXpressRNA 001 up 058 1|age:200|broker name:ArrayExpress|common name:zebrafish|organism part:brain|sample name:E MTAB 5173:IonXpressRNA 001 up 058 1|sex:female | Ion Torrent Proton sequencing; RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | E MTAB 5173:IonXpressRNA 001 up 058 1 s | IonXpressRNA 001 up 058 1 s | RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | RNA extraction Whole brains homogenized in TriReagent according to the manufacturer 0.8 ml/sample Sigma Aldrich Germany EE2 exposure. Fish exposed to 0 2.14 or 7.34 ng/L EE2 for 80 days starting 1 dpf Ion Whole transcriptome analysis kit on RiboZero eukaryote depleted total RNA | Experimental Factor: female:sex|Experimental Factor: n1:compound | RNA-Seq | TRANSCRIPTOMIC | RANDOM | SINGLE | ION_TORRENT | Ion Torrent Proton | ERP018188 | Ion Torrent Proton sequencing; RNA seq of the zebrafish danio rerio brain post developmental exposure to 17α ethinylestradiol | ENA FIRST PUBLIC:2017 10 02|ENA LAST UPDATE:2018 11 16 | IonXpressRNA_001_up_058_1.fastq.gz | fastq | 3358902499.0 | 39857024.0 | E MTAB 5173:IonXpressRNA 001 up 058 1 | 0:84.27 | A:933405205;C:784111716;G:780404241;T:860981337;N:0 | 84 | 933405205 | 784111716 | 780404241 | 860981337 | 0 | ERX1767849 | ERS1417523 | ERA739176 | School of Natural Science, Technology and Environmental Studies Sodertorn University|European Nucleotide Archive | School of Natural Science, Technology and Environmental Studies Sodertorn University|European Nucleotide Archive | 1 | 0.71789 | 0.33159 | 0.76619 | 0.514 | 56 | B | usable mapping rate | ion_torrent | ion_torrent | full_length | random_priming | ribozero | bulk | unknown | unknown | Sweden | 2016-10-19 | Pharyngula | Embryo | Brain | Nervous System | ||||||||||||||||||||
| 24927 | 24927 | SRR25557778 | SRX21286665 | SRS18536778 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant XI | GSM7688794 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant XI | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688794 | GSM7688794: Morphant XI; Danio rerio; RNA Seq | GSM7688794 r1 | GSM7688794 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-XI_S7_L001_R1_001.fastq.gz | fastq | 420092501.0 | 5668059.0 | GSM7688794 r1 | 0:74.12 | A:113006440;C:96725832;G:99320773;T:110915967;N:123489 | 74 | 113006440 | 96725832 | 99320773 | 110915967 | 123489 | SRX21286665 | SRS18536778 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94757 | 0.06229 | 0.72364 | 0.46676 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24928 | 24928 | SRR25557779 | SRX21286665 | SRS18536778 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant XI | GSM7688794 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant XI | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688794 | GSM7688794: Morphant XI; Danio rerio; RNA Seq | GSM7688794 r1 | GSM7688794 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-XI_S7_L002_R1_001.fastq.gz | fastq | 421869780.0 | 5690053.0 | GSM7688794 r2 | 0:74.14 | A:113530489;C:97144227;G:99697959;T:111388539;N:108566 | 74 | 113530489 | 97144227 | 99697959 | 111388539 | 108566 | SRX21286665 | SRS18536778 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94921 | 0.06226 | 0.72462 | 0.4738 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24929 | 24929 | SRR25557780 | SRX21286665 | SRS18536778 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant XI | GSM7688794 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant XI | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688794 | GSM7688794: Morphant XI; Danio rerio; RNA Seq | GSM7688794 r1 | GSM7688794 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-XI_S7_L003_R1_001.fastq.gz | fastq | 425064659.0 | 5734041.0 | GSM7688794 r3 | 0:74.13 | A:114342253;C:97873100;G:100532599;T:112196433;N:120274 | 74 | 114342253 | 97873100 | 100532599 | 112196433 | 120274 | SRX21286665 | SRS18536778 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94886 | 0.06112 | 0.72425 | 0.47055 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24930 | 24930 | SRR25557781 | SRX21286665 | SRS18536778 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant XI | GSM7688794 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant XI | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688794 | GSM7688794: Morphant XI; Danio rerio; RNA Seq | GSM7688794 r1 | GSM7688794 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-XI_S7_L004_R1_001.fastq.gz | fastq | 416990548.0 | 5624902.0 | GSM7688794 r4 | 0:74.13 | A:112153356;C:96009158;G:98613145;T:110097476;N:117413 | 74 | 112153356 | 96009158 | 98613145 | 110097476 | 117413 | SRX21286665 | SRS18536778 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94869 | 0.06229 | 0.72506 | 0.47222 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24931 | 24931 | SRR25557782 | SRX21286664 | SRS18536777 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant X | GSM7688793 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant X | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688793 | GSM7688793: Morphant X; Danio rerio; RNA Seq | GSM7688793 r1 | GSM7688793 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-X_S6_L001_R1_001.fastq.gz | fastq | 434485284.0 | 5881416.0 | GSM7688793 r1 | 0:73.87 | A:116640351;C:100176557;G:102659919;T:114799536;N:208921 | 73 | 116640351 | 100176557 | 102659919 | 114799536 | 208921 | SRX21286664 | SRS18536777 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94533 | 0.07176 | 0.72464 | 0.47632 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24932 | 24932 | SRR25557783 | SRX21286664 | SRS18536777 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant X | GSM7688793 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant X | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688793 | GSM7688793: Morphant X; Danio rerio; RNA Seq | GSM7688793 r1 | GSM7688793 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-X_S6_L002_R1_001.fastq.gz | fastq | 435203869.0 | 5886556.0 | GSM7688793 r2 | 0:73.93 | A:116869356;C:100363580;G:102830644;T:114973504;N:166785 | 73 | 116869356 | 100363580 | 102830644 | 114973504 | 166785 | SRX21286664 | SRS18536777 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94542 | 0.07203 | 0.72421 | 0.47733 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24933 | 24933 | SRR25557784 | SRX21286664 | SRS18536777 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant X | GSM7688793 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant X | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688793 | GSM7688793: Morphant X; Danio rerio; RNA Seq | GSM7688793 r1 | GSM7688793 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-X_S6_L003_R1_001.fastq.gz | fastq | 439897269.0 | 5951878.0 | GSM7688793 r3 | 0:73.91 | A:118101648;C:101426657;G:103990006;T:116184480;N:194478 | 73 | 118101648 | 101426657 | 103990006 | 116184480 | 194478 | SRX21286664 | SRS18536777 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94486 | 0.07224 | 0.72448 | 0.47915 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24934 | 24934 | SRR25557785 | SRX21286664 | SRS18536777 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant X | GSM7688793 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant X | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688793 | GSM7688793: Morphant X; Danio rerio; RNA Seq | GSM7688793 r1 | GSM7688793 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-X_S6_L004_R1_001.fastq.gz | fastq | 431385256.0 | 5836029.0 | GSM7688793 r4 | 0:73.92 | A:115804970;C:99459059;G:101962932;T:113975935;N:182360 | 73 | 115804970 | 99459059 | 101962932 | 113975935 | 182360 | SRX21286664 | SRS18536777 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94432 | 0.07229 | 0.7261 | 0.47463 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24935 | 24935 | SRR25557786 | SRX21286663 | SRS18536776 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant IX | GSM7688792 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant IX | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688792 | GSM7688792: Morphant IX; Danio rerio; RNA Seq | GSM7688792 r1 | GSM7688792 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-IX_S16_L001_R1_001.fastq.gz | fastq | 513309395.0 | 6929648.0 | GSM7688792 r1 | 0:74.07 | A:137428462;C:118688804;G:122019962;T:134991729;N:180438 | 74 | 137428462 | 118688804 | 122019962 | 134991729 | 180438 | SRX21286663 | SRS18536776 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94188 | 0.07029 | 0.73772 | 0.47692 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24936 | 24936 | SRR25557787 | SRX21286663 | SRS18536776 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant IX | GSM7688792 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant IX | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688792 | GSM7688792: Morphant IX; Danio rerio; RNA Seq | GSM7688792 r1 | GSM7688792 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-IX_S16_L002_R1_001.fastq.gz | fastq | 517356735.0 | 6982196.0 | GSM7688792 r2 | 0:74.10 | A:138524037;C:119650852;G:122965491;T:136056171;N:160184 | 74 | 138524037 | 119650852 | 122965491 | 136056171 | 160184 | SRX21286663 | SRS18536776 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94281 | 0.06967 | 0.73963 | 0.48142 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24937 | 24937 | SRR25557788 | SRX21286663 | SRS18536776 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant IX | GSM7688792 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant IX | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688792 | GSM7688792: Morphant IX; Danio rerio; RNA Seq | GSM7688792 r1 | GSM7688792 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-IX_S16_L003_R1_001.fastq.gz | fastq | 519422328.0 | 7010631.0 | GSM7688792 r3 | 0:74.09 | A:139040684;C:120128748;G:123529198;T:136551898;N:171800 | 74 | 139040684 | 120128748 | 123529198 | 136551898 | 171800 | SRX21286663 | SRS18536776 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94297 | 0.06942 | 0.73726 | 0.47499 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24938 | 24938 | SRR25557789 | SRX21286663 | SRS18536776 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant IX | GSM7688792 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant IX | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688792 | GSM7688792: Morphant IX; Danio rerio; RNA Seq | GSM7688792 r1 | GSM7688792 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-IX_S16_L004_R1_001.fastq.gz | fastq | 511640294.0 | 6905748.0 | GSM7688792 r4 | 0:74.09 | A:136914638;C:118302866;G:121704665;T:134543505;N:174620 | 74 | 136914638 | 118302866 | 121704665 | 134543505 | 174620 | SRX21286663 | SRS18536776 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94176 | 0.07029 | 0.73868 | 0.47987 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24939 | 24939 | SRR25557790 | SRX21286662 | SRS18536775 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant VIII | GSM7688791 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant VIII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688791 | GSM7688791: Morphant VIII; Danio rerio; RNA Seq | GSM7688791 r1 | GSM7688791 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-VIII_S14_L001_R1_001.fastq.gz | fastq | 429446821.0 | 5803178.0 | GSM7688791 r1 | 0:74.00 | A:114793535;C:99506379;G:102226914;T:112748761;N:171232 | 74 | 114793535 | 99506379 | 102226914 | 112748761 | 171232 | SRX21286662 | SRS18536775 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94175 | 0.06669 | 0.73673 | 0.48179 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24940 | 24940 | SRR25557791 | SRX21286662 | SRS18536775 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant VIII | GSM7688791 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant VIII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688791 | GSM7688791: Morphant VIII; Danio rerio; RNA Seq | GSM7688791 r1 | GSM7688791 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-VIII_S14_L002_R1_001.fastq.gz | fastq | 434629893.0 | 5870828.0 | GSM7688791 r2 | 0:74.03 | A:116216940;C:100703527;G:103463365;T:114092681;N:153380 | 74 | 116216940 | 100703527 | 103463365 | 114092681 | 153380 | SRX21286662 | SRS18536775 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94143 | 0.0676 | 0.73791 | 0.48091 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24941 | 24941 | SRR25557792 | SRX21286662 | SRS18536775 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant VIII | GSM7688791 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant VIII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688791 | GSM7688791: Morphant VIII; Danio rerio; RNA Seq | GSM7688791 r1 | GSM7688791 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-VIII_S14_L003_R1_001.fastq.gz | fastq | 435879881.0 | 5888685.0 | GSM7688791 r3 | 0:74.02 | A:116548094;C:100971153;G:103794902;T:114400770;N:164962 | 74 | 116548094 | 100971153 | 103794902 | 114400770 | 164962 | SRX21286662 | SRS18536775 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94195 | 0.06686 | 0.73785 | 0.48044 | 73 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24942 | 24942 | SRR25557793 | SRX21286662 | SRS18536775 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant VIII | GSM7688791 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant VIII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688791 | GSM7688791: Morphant VIII; Danio rerio; RNA Seq | GSM7688791 r1 | GSM7688791 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-VIII_S14_L004_R1_001.fastq.gz | fastq | 429478475.0 | 5801978.0 | GSM7688791 r4 | 0:74.02 | A:114799280;C:99474677;G:102302775;T:112737475;N:164268 | 74 | 114799280 | 99474677 | 102302775 | 112737475 | 164268 | SRX21286662 | SRS18536775 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94118 | 0.06706 | 0.73892 | 0.47732 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24943 | 24943 | SRR25557794 | SRX21286661 | SRS18536774 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant VII | GSM7688790 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant VII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688790 | GSM7688790: Morphant VII; Danio rerio; RNA Seq | GSM7688790 r1 | GSM7688790 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-VII_S15_L001_R1_001.fastq.gz | fastq | 459545188.0 | 6215897.0 | GSM7688790 r1 | 0:73.93 | A:121926568;C:107379723;G:110263606;T:119766429;N:208862 | 73 | 121926568 | 107379723 | 110263606 | 119766429 | 208862 | SRX21286661 | SRS18536774 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94273 | 0.06072 | 0.74582 | 0.47499 | 73 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24944 | 24944 | SRR25557795 | SRX21286661 | SRS18536774 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant VII | GSM7688790 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant VII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688790 | GSM7688790: Morphant VII; Danio rerio; RNA Seq | GSM7688790 r1 | GSM7688790 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-VII_S15_L002_R1_001.fastq.gz | fastq | 463143624.0 | 6261406.0 | GSM7688790 r2 | 0:73.97 | A:122917997;C:108229793;G:111099867;T:120713978;N:181989 | 73 | 122917997 | 108229793 | 111099867 | 120713978 | 181989 | SRX21286661 | SRS18536774 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94387 | 0.06093 | 0.74341 | 0.47351 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24945 | 24945 | SRR25557796 | SRX21286661 | SRS18536774 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant VII | GSM7688790 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant VII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688790 | GSM7688790: Morphant VII; Danio rerio; RNA Seq | GSM7688790 r1 | GSM7688790 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-VII_S15_L003_R1_001.fastq.gz | fastq | 465959664.0 | 6300929.0 | GSM7688790 r3 | 0:73.95 | A:123689364;C:108847593;G:111847868;T:121377463;N:197376 | 73 | 123689364 | 108847593 | 111847868 | 121377463 | 197376 | SRX21286661 | SRS18536774 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94322 | 0.06219 | 0.74357 | 0.47977 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24946 | 24946 | SRR25557797 | SRX21286661 | SRS18536774 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant VII | GSM7688790 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant VII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688790 | GSM7688790: Morphant VII; Danio rerio; RNA Seq | GSM7688790 r1 | GSM7688790 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-VII_S15_L004_R1_001.fastq.gz | fastq | 459075430.0 | 6207363.0 | GSM7688790 r4 | 0:73.96 | A:121797426;C:107221116;G:110209684;T:119657308;N:189896 | 73 | 121797426 | 107221116 | 110209684 | 119657308 | 189896 | SRX21286661 | SRS18536774 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94313 | 0.06211 | 0.74343 | 0.47801 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24947 | 24947 | SRR25557798 | SRX21286660 | SRS18536773 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control XI | GSM7688787 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control XI | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688787 | GSM7688787: Control XI; Danio rerio; RNA Seq | GSM7688787 r1 | GSM7688787 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-XI_S2_L001_R1_001.fastq.gz | fastq | 439719566.0 | 5947052.0 | GSM7688787 r1 | 0:73.94 | A:117482073;C:102083665;G:104685444;T:115272860;N:195524 | 73 | 117482073 | 102083665 | 104685444 | 115272860 | 195524 | SRX21286660 | SRS18536773 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94829 | 0.06278 | 0.72525 | 0.46494 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24948 | 24948 | SRR25557799 | SRX21286660 | SRS18536773 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control XI | GSM7688787 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control XI | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688787 | GSM7688787: Control XI; Danio rerio; RNA Seq | GSM7688787 r1 | GSM7688787 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-XI_S2_L002_R1_001.fastq.gz | fastq | 438533503.0 | 5927990.0 | GSM7688787 r2 | 0:73.98 | A:117199594;C:101810881;G:104402169;T:114946611;N:174248 | 73 | 117199594 | 101810881 | 104402169 | 114946611 | 174248 | SRX21286660 | SRS18536773 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94887 | 0.06387 | 0.72827 | 0.46616 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24949 | 24949 | SRR25557800 | SRX21286660 | SRS18536773 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control XI | GSM7688787 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control XI | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688787 | GSM7688787: Control XI; Danio rerio; RNA Seq | GSM7688787 r1 | GSM7688787 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-XI_S2_L003_R1_001.fastq.gz | fastq | 443995554.0 | 6003540.0 | GSM7688787 r3 | 0:73.96 | A:118663936;C:103031716;G:105723574;T:116387834;N:188494 | 73 | 118663936 | 103031716 | 105723574 | 116387834 | 188494 | SRX21286660 | SRS18536773 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94788 | 0.06232 | 0.72693 | 0.46653 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24950 | 24950 | SRR25557801 | SRX21286660 | SRS18536773 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control XI | GSM7688787 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control XI | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688787 | GSM7688787: Control XI; Danio rerio; RNA Seq | GSM7688787 r1 | GSM7688787 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-XI_S2_L004_R1_001.fastq.gz | fastq | 435088869.0 | 5882642.0 | GSM7688787 r4 | 0:73.96 | A:116261447;C:100986653;G:103615584;T:114042354;N:182831 | 73 | 116261447 | 100986653 | 103615584 | 114042354 | 182831 | SRX21286660 | SRS18536773 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94914 | 0.06241 | 0.72829 | 0.4546 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24951 | 24951 | SRR25557802 | SRX21286659 | SRS18536772 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control X | GSM7688785 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control X | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688785 | GSM7688785: Control X; Danio rerio; RNA Seq | GSM7688785 r1 | GSM7688785 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-X_S1_L001_R1_001.fastq.gz | fastq | 395130702.0 | 5338263.0 | GSM7688785 r1 | 0:74.02 | A:107005793;C:90183031;G:92316770;T:105476481;N:148627 | 74 | 107005793 | 90183031 | 92316770 | 105476481 | 148627 | SRX21286659 | SRS18536772 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94534 | 0.07625 | 0.73888 | 0.48135 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24952 | 24952 | SRR25557803 | SRX21286659 | SRS18536772 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control X | GSM7688785 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control X | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688785 | GSM7688785: Control X; Danio rerio; RNA Seq | GSM7688785 r1 | GSM7688785 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-X_S1_L002_R1_001.fastq.gz | fastq | 396764458.0 | 5358448.0 | GSM7688785 r2 | 0:74.04 | A:107513717;C:90540282;G:92658504;T:105917444;N:134511 | 74 | 107513717 | 90540282 | 92658504 | 105917444 | 134511 | SRX21286659 | SRS18536772 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94374 | 0.07709 | 0.73878 | 0.47615 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24953 | 24953 | SRR25557804 | SRX21286659 | SRS18536772 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control X | GSM7688785 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control X | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688785 | GSM7688785: Control X; Danio rerio; RNA Seq | GSM7688785 r1 | GSM7688785 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-X_S1_L003_R1_001.fastq.gz | fastq | 399623551.0 | 5397520.0 | GSM7688785 r3 | 0:74.04 | A:108230540;C:91192011;G:93388052;T:106665106;N:147842 | 74 | 108230540 | 91192011 | 93388052 | 106665106 | 147842 | SRX21286659 | SRS18536772 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94399 | 0.07657 | 0.73797 | 0.4794 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24954 | 24954 | SRR25557805 | SRX21286659 | SRS18536772 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control X | GSM7688785 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control X | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688785 | GSM7688785: Control X; Danio rerio; RNA Seq | GSM7688785 r1 | GSM7688785 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-X_S1_L004_R1_001.fastq.gz | fastq | 393298978.0 | 5312101.0 | GSM7688785 r4 | 0:74.04 | A:106518845;C:89734564;G:91901232;T:105004490;N:139847 | 74 | 106518845 | 89734564 | 91901232 | 105004490 | 139847 | SRX21286659 | SRS18536772 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94423 | 0.07599 | 0.73884 | 0.47905 | 71 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24955 | 24955 | SRR25557806 | SRX21286658 | SRS18536771 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control IX | GSM7688783 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control IX | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688783 | GSM7688783: Control IX; Danio rerio; RNA Seq | GSM7688783 r1 | GSM7688783 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-IX_S22_L001_R1_001.fastq.gz | fastq | 366045799.0 | 4944832.0 | GSM7688783 r1 | 0:74.03 | A:98000119;C:84654222;G:86951226;T:96295351;N:144881 | 74 | 98000119 | 84654222 | 86951226 | 96295351 | 144881 | SRX21286658 | SRS18536771 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94303 | 0.07499 | 0.73085 | 0.47881 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24956 | 24956 | SRR25557807 | SRX21286658 | SRS18536771 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control IX | GSM7688783 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control IX | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688783 | GSM7688783: Control IX; Danio rerio; RNA Seq | GSM7688783 r1 | GSM7688783 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-IX_S22_L002_R1_001.fastq.gz | fastq | 369429068.0 | 4988719.0 | GSM7688783 r2 | 0:74.05 | A:98907882;C:85446993;G:87729593;T:97216477;N:128123 | 74 | 98907882 | 85446993 | 87729593 | 97216477 | 128123 | SRX21286658 | SRS18536771 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94261 | 0.07335 | 0.72969 | 0.47867 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24957 | 24957 | SRR25557808 | SRX21286658 | SRS18536771 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control IX | GSM7688783 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control IX | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688783 | GSM7688783: Control IX; Danio rerio; RNA Seq | GSM7688783 r1 | GSM7688783 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-IX_S22_L003_R1_001.fastq.gz | fastq | 369967330.0 | 4996710.0 | GSM7688783 r3 | 0:74.04 | A:99035743;C:85549878;G:87926587;T:97310812;N:144310 | 74 | 99035743 | 85549878 | 87926587 | 97310812 | 144310 | SRX21286658 | SRS18536771 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94328 | 0.0743 | 0.73034 | 0.47133 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24958 | 24958 | SRR25557809 | SRX21286658 | SRS18536771 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control IX | GSM7688783 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control IX | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688783 | GSM7688783: Control IX; Danio rerio; RNA Seq | GSM7688783 r1 | GSM7688783 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-IX_S22_L004_R1_001.fastq.gz | fastq | 365499176.0 | 4936305.0 | GSM7688783 r4 | 0:74.04 | A:97825658;C:84517732;G:86863655;T:96157429;N:134702 | 74 | 97825658 | 84517732 | 86863655 | 96157429 | 134702 | SRX21286658 | SRS18536771 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94286 | 0.07288 | 0.72999 | 0.4783 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24959 | 24959 | SRR25557810 | SRX21286657 | SRS18536770 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control VIII | GSM7688782 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control VIII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688782 | GSM7688782: Control VIII; Danio rerio; RNA Seq | GSM7688782 r1 | GSM7688782 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-VIII_S20_L001_R1_001.fastq.gz | fastq | 488585907.0 | 6585668.0 | GSM7688782 r1 | 0:74.19 | A:131727468;C:112349971;G:115189425;T:129203159;N:115884 | 74 | 131727468 | 112349971 | 115189425 | 129203159 | 115884 | SRX21286657 | SRS18536770 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.93794 | 0.07381 | 0.7315 | 0.47355 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24960 | 24960 | SRR25557811 | SRX21286657 | SRS18536770 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control VIII | GSM7688782 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control VIII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688782 | GSM7688782: Control VIII; Danio rerio; RNA Seq | GSM7688782 r1 | GSM7688782 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-VIII_S20_L002_R1_001.fastq.gz | fastq | 493766544.0 | 6653820.0 | GSM7688782 r2 | 0:74.21 | A:133135166;C:113551418;G:116398455;T:130575771;N:105734 | 74 | 133135166 | 113551418 | 116398455 | 130575771 | 105734 | SRX21286657 | SRS18536770 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.93729 | 0.07312 | 0.7307 | 0.47966 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24961 | 24961 | SRR25557812 | SRX21286657 | SRS18536770 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control VIII | GSM7688782 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control VIII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688782 | GSM7688782: Control VIII; Danio rerio; RNA Seq | GSM7688782 r1 | GSM7688782 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-VIII_S20_L003_R1_001.fastq.gz | fastq | 494935071.0 | 6670024.0 | GSM7688782 r3 | 0:74.20 | A:133406912;C:113769494;G:116771560;T:130871612;N:115493 | 74 | 133406912 | 113769494 | 116771560 | 130871612 | 115493 | SRX21286657 | SRS18536770 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.93847 | 0.07383 | 0.73194 | 0.47646 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24962 | 24962 | SRR25557813 | SRX21286657 | SRS18536770 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control VIII | GSM7688782 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control VIII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688782 | GSM7688782: Control VIII; Danio rerio; RNA Seq | GSM7688782 r1 | GSM7688782 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-VIII_S20_L004_R1_001.fastq.gz | fastq | 487644286.0 | 6572100.0 | GSM7688782 r4 | 0:74.20 | A:131423055;C:112092623;G:115067911;T:128945959;N:114738 | 74 | 131423055 | 112092623 | 115067911 | 128945959 | 114738 | SRX21286657 | SRS18536770 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.93708 | 0.0732 | 0.73186 | 0.4781 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24963 | 24963 | SRR25557814 | SRX21286656 | SRS18536769 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control VII | GSM7688781 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control VII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688781 | GSM7688781: Control VII; Danio rerio; RNA Seq | GSM7688781 r1 | GSM7688781 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-VII_S21_L001_R1_001.fastq.gz | fastq | 419048369.0 | 5664168.0 | GSM7688781 r1 | 0:73.98 | A:111569757;C:97553687;G:100228004;T:109523480;N:173441 | 73 | 111569757 | 97553687 | 100228004 | 109523480 | 173441 | SRX21286656 | SRS18536769 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94179 | 0.06596 | 0.74499 | 0.46809 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24964 | 24964 | SRR25557815 | SRX21286656 | SRS18536769 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control VII | GSM7688781 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control VII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688781 | GSM7688781: Control VII; Danio rerio; RNA Seq | GSM7688781 r1 | GSM7688781 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-VII_S21_L002_R1_001.fastq.gz | fastq | 422419362.0 | 5707444.0 | GSM7688781 r2 | 0:74.01 | A:112476977;C:98366185;G:101046586;T:110369882;N:159732 | 74 | 112476977 | 98366185 | 101046586 | 110369882 | 159732 | SRX21286656 | SRS18536769 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94275 | 0.06539 | 0.74523 | 0.47247 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24965 | 24965 | SRR25557816 | SRX21286656 | SRS18536769 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control VII | GSM7688781 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control VII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688781 | GSM7688781: Control VII; Danio rerio; RNA Seq | GSM7688781 r1 | GSM7688781 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-VII_S21_L003_R1_001.fastq.gz | fastq | 424260551.0 | 5733133.0 | GSM7688781 r3 | 0:74.00 | A:112957538;C:98789480;G:101496747;T:110850186;N:166600 | 74 | 112957538 | 98789480 | 101496747 | 110850186 | 166600 | SRX21286656 | SRS18536769 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94174 | 0.06482 | 0.74304 | 0.46935 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24966 | 24966 | SRR25557817 | SRX21286656 | SRS18536769 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control VII | GSM7688781 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control VII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688781 | GSM7688781: Control VII; Danio rerio; RNA Seq | GSM7688781 r1 | GSM7688781 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-VII_S21_L004_R1_001.fastq.gz | fastq | 417875320.0 | 5646817.0 | GSM7688781 r4 | 0:74.00 | A:111226895;C:97273168;G:100030641;T:109182520;N:162096 | 74 | 111226895 | 97273168 | 100030641 | 109182520 | 162096 | SRX21286656 | SRS18536769 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94352 | 0.06524 | 0.74442 | 0.47095 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24967 | 24967 | SRR25557924 | SRX21286763 | SRS18536876 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 AllGFP S5 | GSM7688796 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 AllGFP S5 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688796 | GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq | GSM7688796 r1 | GSM7688796 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_AllGFP-S5_S3_L001_I1_001.fastq.gz MUTSU2_AllGFP-S5_S3_L001_R1_001.fastq.gz MUTSU2_AllGFP-S5_S3_L001_R2_001.fastq.gz | fastq fastq fastq | 783833459.0 | 6171917.0 | GSM7688796 r1 | 0:8 1:28 2:91 | A:165863131;C:117191802;G:128146802;T:150173329;N:269383 | 8 | 28 | 91 | 165863131 | 117191802 | 128146802 | 150173329 | 269383 | SRX21286763 | SRS18536876 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.89127 | 0.221 | 0.78317 | 0.52195 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24968 | 24968 | SRR25557925 | SRX21286763 | SRS18536876 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 AllGFP S5 | GSM7688796 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 AllGFP S5 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688796 | GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq | GSM7688796 r1 | GSM7688796 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_AllGFP-S5-3_S2_L002_I1_001.fastq.gz MUTSU2_AllGFP-S5-3_S2_L002_R1_001.fastq.gz MUTSU2_AllGFP-S5-3_S2_L002_R2_001.fastq.gz | fastq fastq fastq | 7208342327.0 | 56758601.0 | GSM7688796 r10 | 0:8 1:28 2:91 | A:1518008610;C:1083228714;G:1190089577;T:1369772782;N:3933008 | 8 | 28 | 91 | 1518008610 | 1083228714 | 1190089577 | 1369772782 | 3933008 | SRX21286763 | SRS18536876 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.88938 | 0.21991 | 0.79088 | 0.53044 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24969 | 24969 | SRR25557926 | SRX21286763 | SRS18536876 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 AllGFP S5 | GSM7688796 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 AllGFP S5 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688796 | GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq | GSM7688796 r1 | GSM7688796 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_AllGFP-S5-3_S2_L003_I1_001.fastq.gz MUTSU2_AllGFP-S5-3_S2_L003_R1_001.fastq.gz MUTSU2_AllGFP-S5-3_S2_L003_R2_001.fastq.gz | fastq fastq fastq | 7337435414.0 | 57775082.0 | GSM7688796 r11 | 0:8 1:28 2:91 | A:1545051667;C:1103394058;G:1211577972;T:1395133564;N:2375201 | 8 | 28 | 91 | 1545051667 | 1103394058 | 1211577972 | 1395133564 | 2375201 | SRX21286763 | SRS18536876 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.88966 | 0.2211 | 0.78961 | 0.53156 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24970 | 24970 | SRR25557927 | SRX21286763 | SRS18536876 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 AllGFP S5 | GSM7688796 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 AllGFP S5 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688796 | GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq | GSM7688796 r1 | GSM7688796 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_AllGFP-S5-3_S2_L004_I1_001.fastq.gz MUTSU2_AllGFP-S5-3_S2_L004_R1_001.fastq.gz MUTSU2_AllGFP-S5-3_S2_L004_R2_001.fastq.gz | fastq fastq fastq | 7218240453.0 | 56836539.0 | GSM7688796 r12 | 0:8 1:28 2:91 | A:1521442237;C:1084242714;G:1191469584;T:1372277539;N:2692975 | 8 | 28 | 91 | 1521442237 | 1084242714 | 1191469584 | 1372277539 | 2692975 | SRX21286763 | SRS18536876 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.8888 | 0.2174 | 0.79172 | 0.53311 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24971 | 24971 | SRR25557928 | SRX21286763 | SRS18536876 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 AllGFP S5 | GSM7688796 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 AllGFP S5 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688796 | GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq | GSM7688796 r1 | GSM7688796 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_AllGFP-S5_S3_L002_I1_001.fastq.gz MUTSU2_AllGFP-S5_S3_L002_R1_001.fastq.gz MUTSU2_AllGFP-S5_S3_L002_R2_001.fastq.gz | fastq fastq fastq | 774302109.0 | 6096867.0 | GSM7688796 r2 | 0:8 1:28 2:91 | A:163989105;C:115793536;G:126358958;T:148430473;N:242825 | 8 | 28 | 91 | 163989105 | 115793536 | 126358958 | 148430473 | 242825 | SRX21286763 | SRS18536876 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.89371 | 0.2215 | 0.78253 | 0.53282 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24972 | 24972 | SRR25557929 | SRX21286763 | SRS18536876 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 AllGFP S5 | GSM7688796 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 AllGFP S5 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688796 | GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq | GSM7688796 r1 | GSM7688796 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_AllGFP-S5_S3_L003_I1_001.fastq.gz MUTSU2_AllGFP-S5_S3_L003_R1_001.fastq.gz MUTSU2_AllGFP-S5_S3_L003_R2_001.fastq.gz | fastq fastq fastq | 790430093.0 | 6223859.0 | GSM7688796 r3 | 0:8 1:28 2:91 | A:167465790;C:118269595;G:129024496;T:151447225;N:164063 | 8 | 28 | 91 | 167465790 | 118269595 | 129024496 | 151447225 | 164063 | SRX21286763 | SRS18536876 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.89284 | 0.21955 | 0.78356 | 0.53369 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24973 | 24973 | SRR25557930 | SRX21286763 | SRS18536876 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 AllGFP S5 | GSM7688796 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 AllGFP S5 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688796 | GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq | GSM7688796 r1 | GSM7688796 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_AllGFP-S5_S3_L004_I1_001.fastq.gz MUTSU2_AllGFP-S5_S3_L004_R1_001.fastq.gz MUTSU2_AllGFP-S5_S3_L004_R2_001.fastq.gz | fastq fastq fastq | 778936974.0 | 6133362.0 | GSM7688796 r4 | 0:8 1:28 2:91 | A:165013558;C:116498474;G:127146290;T:149314806;N:162814 | 8 | 28 | 91 | 165013558 | 116498474 | 127146290 | 149314806 | 162814 | SRX21286763 | SRS18536876 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.89195 | 0.2209 | 0.78196 | 0.53121 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24974 | 24974 | SRR25557931 | SRX21286763 | SRS18536876 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 AllGFP S5 | GSM7688796 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 AllGFP S5 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688796 | GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq | GSM7688796 r1 | GSM7688796 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_AllGFP-S5-2_S2_L001_I1_001.fastq.gz MUTSU2_AllGFP-S5-2_S2_L001_R1_001.fastq.gz MUTSU2_AllGFP-S5-2_S2_L001_R2_001.fastq.gz | fastq fastq fastq | 4174244890.0 | 32868070.0 | GSM7688796 r5 | 0:8 1:28 2:91 | A:882060228;C:627098568;G:684890393;T:795503862;N:1441319 | 8 | 28 | 91 | 882060228 | 627098568 | 684890393 | 795503862 | 1441319 | SRX21286763 | SRS18536876 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.89137 | 0.22041 | 0.77926 | 0.52991 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24975 | 24975 | SRR25557932 | SRX21286763 | SRS18536876 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 AllGFP S5 | GSM7688796 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 AllGFP S5 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688796 | GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq | GSM7688796 r1 | GSM7688796 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_AllGFP-S5-2_S2_L002_I1_001.fastq.gz MUTSU2_AllGFP-S5-2_S2_L002_R1_001.fastq.gz MUTSU2_AllGFP-S5-2_S2_L002_R2_001.fastq.gz | fastq fastq fastq | 4150210902.0 | 32678826.0 | GSM7688796 r6 | 0:8 1:28 2:91 | A:878218072;C:623662333;G:679977758;T:790589138;N:1325865 | 8 | 28 | 91 | 878218072 | 623662333 | 679977758 | 790589138 | 1325865 | SRX21286763 | SRS18536876 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.89264 | 0.22159 | 0.78121 | 0.52989 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24976 | 24976 | SRR25557933 | SRX21286763 | SRS18536876 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 AllGFP S5 | GSM7688796 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 AllGFP S5 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688796 | GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq | GSM7688796 r1 | GSM7688796 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_AllGFP-S5-2_S2_L003_I1_001.fastq.gz MUTSU2_AllGFP-S5-2_S2_L003_R1_001.fastq.gz MUTSU2_AllGFP-S5-2_S2_L003_R2_001.fastq.gz | fastq fastq fastq | 4198043547.0 | 33055461.0 | GSM7688796 r7 | 0:8 1:28 2:91 | A:888287475;C:630914324;G:688006958;T:799794077;N:1044117 | 8 | 28 | 91 | 888287475 | 630914324 | 688006958 | 799794077 | 1044117 | SRX21286763 | SRS18536876 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.8912 | 0.21889 | 0.7822 | 0.52774 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24977 | 24977 | SRR25557934 | SRX21286763 | SRS18536876 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 AllGFP S5 | GSM7688796 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 AllGFP S5 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688796 | GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq | GSM7688796 r1 | GSM7688796 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_AllGFP-S5-2_S2_L004_I1_001.fastq.gz MUTSU2_AllGFP-S5-2_S2_L004_R1_001.fastq.gz MUTSU2_AllGFP-S5-2_S2_L004_R2_001.fastq.gz | fastq fastq fastq | 4154784553.0 | 32714839.0 | GSM7688796 r8 | 0:8 1:28 2:91 | A:880520885;C:624179045;G:680076172;T:791297938;N:976309 | 8 | 28 | 91 | 880520885 | 624179045 | 680076172 | 791297938 | 976309 | SRX21286763 | SRS18536876 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.8927 | 0.22063 | 0.78216 | 0.5346 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24978 | 24978 | SRR25557935 | SRX21286763 | SRS18536876 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 AllGFP S5 | GSM7688796 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 AllGFP S5 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688796 | GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq | GSM7688796 r1 | GSM7688796 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_AllGFP-S5-3_S2_L001_I1_001.fastq.gz MUTSU2_AllGFP-S5-3_S2_L001_R1_001.fastq.gz MUTSU2_AllGFP-S5-3_S2_L001_R2_001.fastq.gz | fastq fastq fastq | 7231973725.0 | 56944675.0 | GSM7688796 r9 | 0:8 1:28 2:91 | A:1522035629;C:1085783001;G:1195535350;T:1374885853;N:3725592 | 8 | 28 | 91 | 1522035629 | 1085783001 | 1195535350 | 1374885853 | 3725592 | SRX21286763 | SRS18536876 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.88833 | 0.22076 | 0.79056 | 0.52744 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24979 | 24979 | SRR25557936 | SRX21286762 | SRS18536875 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 OtherGFP G8 | GSM7688795 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 OtherGFP G8 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688795 | GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq | GSM7688795 r1 | GSM7688795 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_OtherGFP-G8_S2_L001_I1_001.fastq.gz MUTSU2_OtherGFP-G8_S2_L001_R1_001.fastq.gz MUTSU2_OtherGFP-G8_S2_L001_R2_001.fastq.gz | fastq fastq fastq | 699161670.0 | 5505210.0 | GSM7688795 r1 | 0:8 1:28 2:91 | A:149927051;C:100829317;G:116075103;T:133908276;N:234363 | 8 | 28 | 91 | 149927051 | 100829317 | 116075103 | 133908276 | 234363 | SRX21286762 | SRS18536875 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.85081 | 0.21257 | 0.80426 | 0.52779 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24980 | 24980 | SRR25557937 | SRX21286762 | SRS18536875 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 OtherGFP G8 | GSM7688795 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 OtherGFP G8 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688795 | GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq | GSM7688795 r1 | GSM7688795 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_OtherGFP-G8-3_S1_L002_I1_001.fastq.gz MUTSU2_OtherGFP-G8-3_S1_L002_R1_001.fastq.gz MUTSU2_OtherGFP-G8-3_S1_L002_R2_001.fastq.gz | fastq fastq fastq | 8174836330.0 | 64368790.0 | GSM7688795 r10 | 0:8 1:28 2:91 | A:1748532358;C:1187854561;G:1356279755;T:1560491610;N:4401606 | 8 | 28 | 91 | 1748532358 | 1187854561 | 1356279755 | 1560491610 | 4401606 | SRX21286762 | SRS18536875 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.85069 | 0.20989 | 0.81049 | 0.52069 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24981 | 24981 | SRR25557938 | SRX21286762 | SRS18536875 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 OtherGFP G8 | GSM7688795 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 OtherGFP G8 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688795 | GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq | GSM7688795 r1 | GSM7688795 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_OtherGFP-G8-3_S1_L003_I1_001.fastq.gz MUTSU2_OtherGFP-G8-3_S1_L003_R1_001.fastq.gz MUTSU2_OtherGFP-G8-3_S1_L003_R2_001.fastq.gz | fastq fastq fastq | 8307872640.0 | 65416320.0 | GSM7688795 r11 | 0:8 1:28 2:91 | A:1778112295;C:1207569588;G:1377139686;T:1587359299;N:2704252 | 8 | 28 | 91 | 1778112295 | 1207569588 | 1377139686 | 1587359299 | 2704252 | SRX21286762 | SRS18536875 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.85151 | 0.21054 | 0.80813 | 0.52675 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24982 | 24982 | SRR25557939 | SRX21286762 | SRS18536875 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 OtherGFP G8 | GSM7688795 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 OtherGFP G8 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688795 | GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq | GSM7688795 r1 | GSM7688795 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_OtherGFP-G8-3_S1_L004_R2_001.fastq.gz MUTSU2_OtherGFP-G8-3_S1_L004_R1_001.fastq.gz MUTSU2_OtherGFP-G8-3_S1_L004_I1_001.fastq.gz | fastq fastq fastq | 8197523483.0 | 64547429.0 | GSM7688795 r12 | 0:8 1:28 2:91 | A:1755321680;C:1190415496;G:1359502433;T:1565500310;N:3076120 | 8 | 28 | 91 | 1755321680 | 1190415496 | 1359502433 | 1565500310 | 3076120 | SRX21286762 | SRS18536875 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.84956 | 0.20968 | 0.81113 | 0.52382 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24983 | 24983 | SRR25557940 | SRX21286762 | SRS18536875 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 OtherGFP G8 | GSM7688795 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 OtherGFP G8 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688795 | GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq | GSM7688795 r1 | GSM7688795 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_OtherGFP-G8_S2_L002_R2_001.fastq.gz MUTSU2_OtherGFP-G8_S2_L002_R1_001.fastq.gz MUTSU2_OtherGFP-G8_S2_L002_I1_001.fastq.gz | fastq fastq fastq | 690198899.0 | 5434637.0 | GSM7688795 r2 | 0:8 1:28 2:91 | A:147896108;C:99606794;G:114681063;T:132140792;N:227210 | 8 | 28 | 91 | 147896108 | 99606794 | 114681063 | 132140792 | 227210 | SRX21286762 | SRS18536875 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.85228 | 0.21261 | 0.803 | 0.52382 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24984 | 24984 | SRR25557941 | SRX21286762 | SRS18536875 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 OtherGFP G8 | GSM7688795 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 OtherGFP G8 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688795 | GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq | GSM7688795 r1 | GSM7688795 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_OtherGFP-G8_S2_L003_I1_001.fastq.gz MUTSU2_OtherGFP-G8_S2_L003_R1_001.fastq.gz MUTSU2_OtherGFP-G8_S2_L003_R2_001.fastq.gz | fastq fastq fastq | 702239515.0 | 5529445.0 | GSM7688795 r3 | 0:8 1:28 2:91 | A:150477574;C:101266550;G:116878466;T:134415299;N:141606 | 8 | 28 | 91 | 150477574 | 101266550 | 116878466 | 134415299 | 141606 | SRX21286762 | SRS18536875 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.85364 | 0.21344 | 0.80346 | 0.52158 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24985 | 24985 | SRR25557942 | SRX21286762 | SRS18536875 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 OtherGFP G8 | GSM7688795 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 OtherGFP G8 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688795 | GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq | GSM7688795 r1 | GSM7688795 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_OtherGFP-G8_S2_L004_I1_001.fastq.gz MUTSU2_OtherGFP-G8_S2_L004_R1_001.fastq.gz MUTSU2_OtherGFP-G8_S2_L004_R2_001.fastq.gz | fastq fastq fastq | 694537346.0 | 5468798.0 | GSM7688795 r4 | 0:8 1:28 2:91 | A:148876263;C:100202441;G:115455212;T:132982029;N:144673 | 8 | 28 | 91 | 148876263 | 100202441 | 115455212 | 132982029 | 144673 | SRX21286762 | SRS18536875 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.85238 | 0.2138 | 0.80379 | 0.52691 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24986 | 24986 | SRR25557943 | SRX21286762 | SRS18536875 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 OtherGFP G8 | GSM7688795 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 OtherGFP G8 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688795 | GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq | GSM7688795 r1 | GSM7688795 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_OtherGFP-G8-2_S1_L001_R2_001.fastq.gz MUTSU2_OtherGFP-G8-2_S1_L001_R1_001.fastq.gz MUTSU2_OtherGFP-G8-2_S1_L001_I1_001.fastq.gz | fastq fastq fastq | 4324997954.0 | 34055102.0 | GSM7688795 r5 | 0:8 1:28 2:91 | A:924471384;C:626141120;G:722856562;T:824050239;N:1494977 | 8 | 28 | 91 | 924471384 | 626141120 | 722856562 | 824050239 | 1494977 | SRX21286762 | SRS18536875 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.85083 | 0.21122 | 0.80472 | 0.524 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24987 | 24987 | SRR25557944 | SRX21286762 | SRS18536875 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 OtherGFP G8 | GSM7688795 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 OtherGFP G8 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688795 | GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq | GSM7688795 r1 | GSM7688795 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_OtherGFP-G8-2_S1_L002_R2_001.fastq.gz MUTSU2_OtherGFP-G8-2_S1_L002_R1_001.fastq.gz MUTSU2_OtherGFP-G8-2_S1_L002_I1_001.fastq.gz | fastq fastq fastq | 4306232942.0 | 33907346.0 | GSM7688795 r6 | 0:8 1:28 2:91 | A:920615353;C:623090513;G:721201055;T:819291149;N:1370416 | 8 | 28 | 91 | 920615353 | 623090513 | 721201055 | 819291149 | 1370416 | SRX21286762 | SRS18536875 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.85335 | 0.21315 | 0.80206 | 0.51508 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24988 | 24988 | SRR25557945 | SRX21286762 | SRS18536875 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 OtherGFP G8 | GSM7688795 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 OtherGFP G8 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688795 | GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq | GSM7688795 r1 | GSM7688795 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_OtherGFP-G8-2_S1_L003_R2_001.fastq.gz MUTSU2_OtherGFP-G8-2_S1_L003_R1_001.fastq.gz MUTSU2_OtherGFP-G8-2_S1_L003_I1_001.fastq.gz | fastq fastq fastq | 4348436312.0 | 34239656.0 | GSM7688795 r7 | 0:8 1:28 2:91 | A:930204208;C:629005094;G:727756813;T:827747478;N:1095103 | 8 | 28 | 91 | 930204208 | 629005094 | 727756813 | 827747478 | 1095103 | SRX21286762 | SRS18536875 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.85369 | 0.21216 | 0.80503 | 0.52219 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24989 | 24989 | SRR25557946 | SRX21286762 | SRS18536875 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 OtherGFP G8 | GSM7688795 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 OtherGFP G8 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688795 | GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq | GSM7688795 r1 | GSM7688795 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_OtherGFP-G8-2_S1_L004_R2_001.fastq.gz MUTSU2_OtherGFP-G8-2_S1_L004_R1_001.fastq.gz MUTSU2_OtherGFP-G8-2_S1_L004_I1_001.fastq.gz | fastq fastq fastq | 4313915172.0 | 33967836.0 | GSM7688795 r8 | 0:8 1:28 2:91 | A:922742754;C:623127831;G:724345885;T:819819593;N:1037013 | 8 | 28 | 91 | 922742754 | 623127831 | 724345885 | 819819593 | 1037013 | SRX21286762 | SRS18536875 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.85456 | 0.21236 | 0.80223 | 0.5216 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24990 | 24990 | SRR25557947 | SRX21286762 | SRS18536875 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 OtherGFP G8 | GSM7688795 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 OtherGFP G8 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688795 | GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq | GSM7688795 r1 | GSM7688795 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_OtherGFP-G8-3_S1_L001_R2_001.fastq.gz MUTSU2_OtherGFP-G8-3_S1_L001_R1_001.fastq.gz MUTSU2_OtherGFP-G8-3_S1_L001_I1_001.fastq.gz | fastq fastq fastq | 8184961024.0 | 64448512.0 | GSM7688795 r9 | 0:8 1:28 2:91 | A:1748819280;C:1187802244;G:1360994184;T:1562975470;N:4223414 | 8 | 28 | 91 | 1748819280 | 1187802244 | 1360994184 | 1562975470 | 4223414 | SRX21286762 | SRS18536875 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.8493 | 0.21072 | 0.80967 | 0.52593 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 28692 | 28692 | SRR26535343 | SRX22238470 | SRS19292731 | SRP468564 | PRJNA1032461 | A syngeneic spontaneous zebrafish model oftp53 deficient EGFRviii and PI3KCAH1047R driven glioblastoma reveals inhibitory roles for inflammation during tumor initiation and relapsein vivo | GSE246295 | Transcriptome Analysis | To build a patient relevantin vivomodel of human glioblastoma we expressed common oncogenic variants including activated human EGFRviii or KRAS and PI3KCAH1047Runder the control of the radial glial specific promoterher4.1in syngeneictp53loss of function mutant zebrafish.Robust tumor formation was observed prior to 45 days of life with a gene expression signature similar to human glioblastoma of the mesenchymal subtype along with a strong inflammatory component. Within early stage tumor lesions and in an intact and endogenous tumor microenvironment we visualized infiltration of phagocytic cells as well as internalization of tumor cells bympeg1.1:GFP+ microglia/macrophages suggesting negative regulatory pressure by pro inflammatory cell types on tumor growth at early stages of glioblastoma initiationin vivo. Furthermore CRISPR/Cas9 mediated gene targeting of master inflammatory transcription factorsirf7andirf8led to increased tumor formation in the primary context while suppression of microglial/macrophage activity led to enhanced tumor cell engraftment following transplantation into otherwise immune competent zebrafish hosts. Altogether we developed a genetically relevant model of aggressive human glioblastoma and harnessed the unique advantages of zebrafish including live imaging high throughput genetic and chemical manipulations to highlight important tumor suppressive roles for the innate immune system on glioblastoma initiation with important future significance for therapeutic discovery and optimizations. Overall design: To capture broad transcriptomic differences in tumor burdened brains versus normal brains we performed bulk RNA sequencing and gene expression analysis of whole brains and sorted cells. EGFRviii derived tumors were induced by microinjection of EGFRviii PI3KCAH1047R and mScarlet constructs defined as EPS. KRAS derived tumors were induced by microinjection of KRAS PI3KCAH1047R GFP constructs defined as KPG. Three whole brains positive for fluorescent tumors EPS 1 3 KPG 1 3 a… | pubmed:39052000 | EGFRviii PI3KCAH1047R mScarlet tumor negative control brain 2 | GSM7866394 | source name:Whole Brain|strain:CG1 p53null|tissue:Whole Brain|geo loc name:missing|collection date:missing | EGFRviii PI3KCAH1047R mScarlet tumor negative control brain 2 | Raw .fastq data was processed using Salmon quantification of transcripts for each sample. A “decoy aware” index was built with the Danio rerio transcriptome and genome using the GRCz11 assembly with a k mers length of 23 with entries manually added for GFP mScarlet EGFRviii KRAS and PI3KCAH1047R transcripts. Samples were then quantified with the following arguments: r seqBias mp 3 validateMappings rangeFactorizationBins 4. Differential gene expression was compared utilizing DESeq2 and GSEA. Assembly: GRCz11 Supplementary files format and content: Tab delimited .csv file including raw counts for all conditions. | Whole Brain | Fertilized embryos injected with either EPS or KPG construct mix | Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer’s recommendations | Zebrafish were housed and reared following approved animal use protocol | strain:CG1 p53null|tissue:Whole Brain | GSM7866394 | GSM7866394: EGFRviii PI3KCAH1047R mScarlet tumor negative control brain 2; Danio rerio; RNA Seq | GSM7866394 r1 | GSM7866394 | 1 | Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer's recommendations | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina NovaSeq 6000 | SRP468564 | loader:fastq load.py | CTRL_3.fastq.gz | fastq | 7081948098.0 | 70118298.0 | GSM7866394 r1 | 0:101 | A:1894557984;C:1627945034;G:1550203852;T:2009224463;N:16765 | 101 | 1894557984 | 1627945034 | 1550203852 | 2009224463 | 16765 | SRX22238470 | SRS19292731 | SRA1740017 | Hayes Lab, DSCB, Sickkids Research | Hayes Lab, DSCB, Sickkids Research | 1 | 0.94543 | 0.14646 | 0.68883 | 0.49451 | 101 | B | usable mapping rate | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | Canada | 2023-10-26 | Undetermined | Embryo | Brain | Nervous System | ||||||||||||||||
| 28693 | 28693 | SRR26535344 | SRX22238469 | SRS19292730 | SRP468564 | PRJNA1032461 | A syngeneic spontaneous zebrafish model oftp53 deficient EGFRviii and PI3KCAH1047R driven glioblastoma reveals inhibitory roles for inflammation during tumor initiation and relapsein vivo | GSE246295 | Transcriptome Analysis | To build a patient relevantin vivomodel of human glioblastoma we expressed common oncogenic variants including activated human EGFRviii or KRAS and PI3KCAH1047Runder the control of the radial glial specific promoterher4.1in syngeneictp53loss of function mutant zebrafish.Robust tumor formation was observed prior to 45 days of life with a gene expression signature similar to human glioblastoma of the mesenchymal subtype along with a strong inflammatory component. Within early stage tumor lesions and in an intact and endogenous tumor microenvironment we visualized infiltration of phagocytic cells as well as internalization of tumor cells bympeg1.1:GFP+ microglia/macrophages suggesting negative regulatory pressure by pro inflammatory cell types on tumor growth at early stages of glioblastoma initiationin vivo. Furthermore CRISPR/Cas9 mediated gene targeting of master inflammatory transcription factorsirf7andirf8led to increased tumor formation in the primary context while suppression of microglial/macrophage activity led to enhanced tumor cell engraftment following transplantation into otherwise immune competent zebrafish hosts. Altogether we developed a genetically relevant model of aggressive human glioblastoma and harnessed the unique advantages of zebrafish including live imaging high throughput genetic and chemical manipulations to highlight important tumor suppressive roles for the innate immune system on glioblastoma initiation with important future significance for therapeutic discovery and optimizations. Overall design: To capture broad transcriptomic differences in tumor burdened brains versus normal brains we performed bulk RNA sequencing and gene expression analysis of whole brains and sorted cells. EGFRviii derived tumors were induced by microinjection of EGFRviii PI3KCAH1047R and mScarlet constructs defined as EPS. KRAS derived tumors were induced by microinjection of KRAS PI3KCAH1047R GFP constructs defined as KPG. Three whole brains positive for fluorescent tumors EPS 1 3 KPG 1 3 a… | pubmed:39052000 | EGFRviii PI3KCAH1047R mScarlet tumor negative control brain 1 | GSM7866393 | source name:Whole Brain|strain:CG1 p53null|tissue:Whole Brain|geo loc name:missing|collection date:missing | EGFRviii PI3KCAH1047R mScarlet tumor negative control brain 1 | Raw .fastq data was processed using Salmon quantification of transcripts for each sample. A “decoy aware” index was built with the Danio rerio transcriptome and genome using the GRCz11 assembly with a k mers length of 23 with entries manually added for GFP mScarlet EGFRviii KRAS and PI3KCAH1047R transcripts. Samples were then quantified with the following arguments: r seqBias mp 3 validateMappings rangeFactorizationBins 4. Differential gene expression was compared utilizing DESeq2 and GSEA. Assembly: GRCz11 Supplementary files format and content: Tab delimited .csv file including raw counts for all conditions. | Whole Brain | Fertilized embryos injected with either EPS or KPG construct mix | Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer’s recommendations | Zebrafish were housed and reared following approved animal use protocol | strain:CG1 p53null|tissue:Whole Brain | GSM7866393 | GSM7866393: EGFRviii PI3KCAH1047R mScarlet tumor negative control brain 1; Danio rerio; RNA Seq | GSM7866393 r1 | GSM7866393 | 1 | Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer's recommendations | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina NovaSeq 6000 | SRP468564 | loader:fastq load.py | CTRL_2.fastq.gz | fastq | 7840572329.0 | 77629429.0 | GSM7866393 r1 | 0:101 | A:2099360211;C:1783653297;G:1717681461;T:2239858766;N:18594 | 101 | 2099360211 | 1783653297 | 1717681461 | 2239858766 | 18594 | SRX22238469 | SRS19292730 | SRA1740017 | Hayes Lab, DSCB, Sickkids Research | Hayes Lab, DSCB, Sickkids Research | 1 | 0.93984 | 0.1663 | 0.69033 | 0.484 | 101 | B | usable mapping rate | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | Canada | 2023-10-26 | Undetermined | Embryo | Brain | Nervous System | ||||||||||||||||
| 28694 | 28694 | SRR26535345 | SRX22238468 | SRS19292729 | SRP468564 | PRJNA1032461 | A syngeneic spontaneous zebrafish model oftp53 deficient EGFRviii and PI3KCAH1047R driven glioblastoma reveals inhibitory roles for inflammation during tumor initiation and relapsein vivo | GSE246295 | Transcriptome Analysis | To build a patient relevantin vivomodel of human glioblastoma we expressed common oncogenic variants including activated human EGFRviii or KRAS and PI3KCAH1047Runder the control of the radial glial specific promoterher4.1in syngeneictp53loss of function mutant zebrafish.Robust tumor formation was observed prior to 45 days of life with a gene expression signature similar to human glioblastoma of the mesenchymal subtype along with a strong inflammatory component. Within early stage tumor lesions and in an intact and endogenous tumor microenvironment we visualized infiltration of phagocytic cells as well as internalization of tumor cells bympeg1.1:GFP+ microglia/macrophages suggesting negative regulatory pressure by pro inflammatory cell types on tumor growth at early stages of glioblastoma initiationin vivo. Furthermore CRISPR/Cas9 mediated gene targeting of master inflammatory transcription factorsirf7andirf8led to increased tumor formation in the primary context while suppression of microglial/macrophage activity led to enhanced tumor cell engraftment following transplantation into otherwise immune competent zebrafish hosts. Altogether we developed a genetically relevant model of aggressive human glioblastoma and harnessed the unique advantages of zebrafish including live imaging high throughput genetic and chemical manipulations to highlight important tumor suppressive roles for the innate immune system on glioblastoma initiation with important future significance for therapeutic discovery and optimizations. Overall design: To capture broad transcriptomic differences in tumor burdened brains versus normal brains we performed bulk RNA sequencing and gene expression analysis of whole brains and sorted cells. EGFRviii derived tumors were induced by microinjection of EGFRviii PI3KCAH1047R and mScarlet constructs defined as EPS. KRAS derived tumors were induced by microinjection of KRAS PI3KCAH1047R GFP constructs defined as KPG. Three whole brains positive for fluorescent tumors EPS 1 3 KPG 1 3 a… | pubmed:39052000 | KRAS PI3KCAH1047R GFP tumor negative control brain | GSM7866392 | source name:Whole Brain|strain:CG1 p53null|tissue:Whole Brain|geo loc name:missing|collection date:missing | KRAS PI3KCAH1047R GFP tumor negative control brain | Raw .fastq data was processed using Salmon quantification of transcripts for each sample. A “decoy aware” index was built with the Danio rerio transcriptome and genome using the GRCz11 assembly with a k mers length of 23 with entries manually added for GFP mScarlet EGFRviii KRAS and PI3KCAH1047R transcripts. Samples were then quantified with the following arguments: r seqBias mp 3 validateMappings rangeFactorizationBins 4. Differential gene expression was compared utilizing DESeq2 and GSEA. Assembly: GRCz11 Supplementary files format and content: Tab delimited .csv file including raw counts for all conditions. | Whole Brain | Fertilized embryos injected with either EPS or KPG construct mix | Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer’s recommendations | Zebrafish were housed and reared following approved animal use protocol | strain:CG1 p53null|tissue:Whole Brain | GSM7866392 | GSM7866392: KRAS PI3KCAH1047R GFP tumor negative control brain; Danio rerio; RNA Seq | GSM7866392 r1 | GSM7866392 | 1 | Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer's recommendations | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina NovaSeq 6000 | SRP468564 | loader:fastq load.py | CTRL_1.fastq.gz | fastq | 10164914720.0 | 100642720.0 | GSM7866392 r1 | 0:101 | A:2650336113;C:2354113843;G:2276252979;T:2884188285;N:23500 | 101 | 2650336113 | 2354113843 | 2276252979 | 2884188285 | 23500 | SRX22238468 | SRS19292729 | SRA1740017 | Hayes Lab, DSCB, Sickkids Research | Hayes Lab, DSCB, Sickkids Research | 1 | 0.94271 | 0.10831 | 0.68527 | 0.50207 | 101 | B | usable mapping rate | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | Canada | 2023-10-26 | Undetermined | Embryo | Brain | Nervous System | ||||||||||||||||
| 28695 | 28695 | SRR26535346 | SRX22238467 | SRS19292728 | SRP468564 | PRJNA1032461 | A syngeneic spontaneous zebrafish model oftp53 deficient EGFRviii and PI3KCAH1047R driven glioblastoma reveals inhibitory roles for inflammation during tumor initiation and relapsein vivo | GSE246295 | Transcriptome Analysis | To build a patient relevantin vivomodel of human glioblastoma we expressed common oncogenic variants including activated human EGFRviii or KRAS and PI3KCAH1047Runder the control of the radial glial specific promoterher4.1in syngeneictp53loss of function mutant zebrafish.Robust tumor formation was observed prior to 45 days of life with a gene expression signature similar to human glioblastoma of the mesenchymal subtype along with a strong inflammatory component. Within early stage tumor lesions and in an intact and endogenous tumor microenvironment we visualized infiltration of phagocytic cells as well as internalization of tumor cells bympeg1.1:GFP+ microglia/macrophages suggesting negative regulatory pressure by pro inflammatory cell types on tumor growth at early stages of glioblastoma initiationin vivo. Furthermore CRISPR/Cas9 mediated gene targeting of master inflammatory transcription factorsirf7andirf8led to increased tumor formation in the primary context while suppression of microglial/macrophage activity led to enhanced tumor cell engraftment following transplantation into otherwise immune competent zebrafish hosts. Altogether we developed a genetically relevant model of aggressive human glioblastoma and harnessed the unique advantages of zebrafish including live imaging high throughput genetic and chemical manipulations to highlight important tumor suppressive roles for the innate immune system on glioblastoma initiation with important future significance for therapeutic discovery and optimizations. Overall design: To capture broad transcriptomic differences in tumor burdened brains versus normal brains we performed bulk RNA sequencing and gene expression analysis of whole brains and sorted cells. EGFRviii derived tumors were induced by microinjection of EGFRviii PI3KCAH1047R and mScarlet constructs defined as EPS. KRAS derived tumors were induced by microinjection of KRAS PI3KCAH1047R GFP constructs defined as KPG. Three whole brains positive for fluorescent tumors EPS 1 3 KPG 1 3 a… | pubmed:39052000 | EGFRviii PI3KCAH1047R mScarlet tumor positive whole brain 3 | GSM7866391 | source name:Whole Brain|strain:CG1 p53null|tissue:Whole Brain|geo loc name:missing|collection date:missing | EGFRviii PI3KCAH1047R mScarlet tumor positive whole brain 3 | Raw .fastq data was processed using Salmon quantification of transcripts for each sample. A “decoy aware” index was built with the Danio rerio transcriptome and genome using the GRCz11 assembly with a k mers length of 23 with entries manually added for GFP mScarlet EGFRviii KRAS and PI3KCAH1047R transcripts. Samples were then quantified with the following arguments: r seqBias mp 3 validateMappings rangeFactorizationBins 4. Differential gene expression was compared utilizing DESeq2 and GSEA. Assembly: GRCz11 Supplementary files format and content: Tab delimited .csv file including raw counts for all conditions. | Whole Brain | Fertilized embryos injected with either EPS or KPG construct mix | Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer’s recommendations | Zebrafish were housed and reared following approved animal use protocol | strain:CG1 p53null|tissue:Whole Brain | GSM7866391 | GSM7866391: EGFRviii PI3KCAH1047R mScarlet tumor positive whole brain 3; Danio rerio; RNA Seq | GSM7866391 r1 | GSM7866391 | 1 | Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer's recommendations | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina NovaSeq 6000 | SRP468564 | loader:fastq load.py | EPS_3.fastq.gz | fastq | 9796714170.0 | 96997170.0 | GSM7866391 r1 | 0:101 | A:2627522717;C:2223655583;G:2134761894;T:2810751194;N:22782 | 101 | 2627522717 | 2223655583 | 2134761894 | 2810751194 | 22782 | SRX22238467 | SRS19292728 | SRA1740017 | Hayes Lab, DSCB, Sickkids Research | Hayes Lab, DSCB, Sickkids Research | 1 | 0.92543 | 0.1876 | 0.67308 | 0.4886 | 101 | B | usable mapping rate | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | Canada | 2023-10-26 | Undetermined | Embryo | Brain | Nervous System | ||||||||||||||||
| 28696 | 28696 | SRR26535347 | SRX22238466 | SRS19292727 | SRP468564 | PRJNA1032461 | A syngeneic spontaneous zebrafish model oftp53 deficient EGFRviii and PI3KCAH1047R driven glioblastoma reveals inhibitory roles for inflammation during tumor initiation and relapsein vivo | GSE246295 | Transcriptome Analysis | To build a patient relevantin vivomodel of human glioblastoma we expressed common oncogenic variants including activated human EGFRviii or KRAS and PI3KCAH1047Runder the control of the radial glial specific promoterher4.1in syngeneictp53loss of function mutant zebrafish.Robust tumor formation was observed prior to 45 days of life with a gene expression signature similar to human glioblastoma of the mesenchymal subtype along with a strong inflammatory component. Within early stage tumor lesions and in an intact and endogenous tumor microenvironment we visualized infiltration of phagocytic cells as well as internalization of tumor cells bympeg1.1:GFP+ microglia/macrophages suggesting negative regulatory pressure by pro inflammatory cell types on tumor growth at early stages of glioblastoma initiationin vivo. Furthermore CRISPR/Cas9 mediated gene targeting of master inflammatory transcription factorsirf7andirf8led to increased tumor formation in the primary context while suppression of microglial/macrophage activity led to enhanced tumor cell engraftment following transplantation into otherwise immune competent zebrafish hosts. Altogether we developed a genetically relevant model of aggressive human glioblastoma and harnessed the unique advantages of zebrafish including live imaging high throughput genetic and chemical manipulations to highlight important tumor suppressive roles for the innate immune system on glioblastoma initiation with important future significance for therapeutic discovery and optimizations. Overall design: To capture broad transcriptomic differences in tumor burdened brains versus normal brains we performed bulk RNA sequencing and gene expression analysis of whole brains and sorted cells. EGFRviii derived tumors were induced by microinjection of EGFRviii PI3KCAH1047R and mScarlet constructs defined as EPS. KRAS derived tumors were induced by microinjection of KRAS PI3KCAH1047R GFP constructs defined as KPG. Three whole brains positive for fluorescent tumors EPS 1 3 KPG 1 3 a… | pubmed:39052000 | EGFRviii PI3KCAH1047R mScarlet tumor positive whole brain 2 | GSM7866390 | source name:Whole Brain|strain:CG1 p53null|tissue:Whole Brain|geo loc name:missing|collection date:missing | EGFRviii PI3KCAH1047R mScarlet tumor positive whole brain 2 | Raw .fastq data was processed using Salmon quantification of transcripts for each sample. A “decoy aware” index was built with the Danio rerio transcriptome and genome using the GRCz11 assembly with a k mers length of 23 with entries manually added for GFP mScarlet EGFRviii KRAS and PI3KCAH1047R transcripts. Samples were then quantified with the following arguments: r seqBias mp 3 validateMappings rangeFactorizationBins 4. Differential gene expression was compared utilizing DESeq2 and GSEA. Assembly: GRCz11 Supplementary files format and content: Tab delimited .csv file including raw counts for all conditions. | Whole Brain | Fertilized embryos injected with either EPS or KPG construct mix | Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer’s recommendations | Zebrafish were housed and reared following approved animal use protocol | strain:CG1 p53null|tissue:Whole Brain | GSM7866390 | GSM7866390: EGFRviii PI3KCAH1047R mScarlet tumor positive whole brain 2; Danio rerio; RNA Seq | GSM7866390 r1 | GSM7866390 | 1 | Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer's recommendations | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina NovaSeq 6000 | SRP468564 | loader:fastq load.py | EPS_2.fastq.gz | fastq | 7839595861.0 | 77619761.0 | GSM7866390 r1 | 0:101 | A:2093456023;C:1792947580;G:1718784421;T:2234389453;N:18384 | 101 | 2093456023 | 1792947580 | 1718784421 | 2234389453 | 18384 | SRX22238466 | SRS19292727 | SRA1740017 | Hayes Lab, DSCB, Sickkids Research | Hayes Lab, DSCB, Sickkids Research | 1 | 0.93807 | 0.14978 | 0.68854 | 0.47786 | 101 | B | usable mapping rate | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | Canada | 2023-10-26 | Undetermined | Embryo | Brain | Nervous System | ||||||||||||||||
| 28697 | 28697 | SRR26535348 | SRX22238465 | SRS19292726 | SRP468564 | PRJNA1032461 | A syngeneic spontaneous zebrafish model oftp53 deficient EGFRviii and PI3KCAH1047R driven glioblastoma reveals inhibitory roles for inflammation during tumor initiation and relapsein vivo | GSE246295 | Transcriptome Analysis | To build a patient relevantin vivomodel of human glioblastoma we expressed common oncogenic variants including activated human EGFRviii or KRAS and PI3KCAH1047Runder the control of the radial glial specific promoterher4.1in syngeneictp53loss of function mutant zebrafish.Robust tumor formation was observed prior to 45 days of life with a gene expression signature similar to human glioblastoma of the mesenchymal subtype along with a strong inflammatory component. Within early stage tumor lesions and in an intact and endogenous tumor microenvironment we visualized infiltration of phagocytic cells as well as internalization of tumor cells bympeg1.1:GFP+ microglia/macrophages suggesting negative regulatory pressure by pro inflammatory cell types on tumor growth at early stages of glioblastoma initiationin vivo. Furthermore CRISPR/Cas9 mediated gene targeting of master inflammatory transcription factorsirf7andirf8led to increased tumor formation in the primary context while suppression of microglial/macrophage activity led to enhanced tumor cell engraftment following transplantation into otherwise immune competent zebrafish hosts. Altogether we developed a genetically relevant model of aggressive human glioblastoma and harnessed the unique advantages of zebrafish including live imaging high throughput genetic and chemical manipulations to highlight important tumor suppressive roles for the innate immune system on glioblastoma initiation with important future significance for therapeutic discovery and optimizations. Overall design: To capture broad transcriptomic differences in tumor burdened brains versus normal brains we performed bulk RNA sequencing and gene expression analysis of whole brains and sorted cells. EGFRviii derived tumors were induced by microinjection of EGFRviii PI3KCAH1047R and mScarlet constructs defined as EPS. KRAS derived tumors were induced by microinjection of KRAS PI3KCAH1047R GFP constructs defined as KPG. Three whole brains positive for fluorescent tumors EPS 1 3 KPG 1 3 a… | pubmed:39052000 | EGFRviii PI3KCAH1047R mScarlet tumor positive whole brain 1 | GSM7866389 | source name:Whole Brain|strain:CG1 p53null|tissue:Whole Brain|geo loc name:missing|collection date:missing | EGFRviii PI3KCAH1047R mScarlet tumor positive whole brain 1 | Raw .fastq data was processed using Salmon quantification of transcripts for each sample. A “decoy aware” index was built with the Danio rerio transcriptome and genome using the GRCz11 assembly with a k mers length of 23 with entries manually added for GFP mScarlet EGFRviii KRAS and PI3KCAH1047R transcripts. Samples were then quantified with the following arguments: r seqBias mp 3 validateMappings rangeFactorizationBins 4. Differential gene expression was compared utilizing DESeq2 and GSEA. Assembly: GRCz11 Supplementary files format and content: Tab delimited .csv file including raw counts for all conditions. | Whole Brain | Fertilized embryos injected with either EPS or KPG construct mix | Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer’s recommendations | Zebrafish were housed and reared following approved animal use protocol | strain:CG1 p53null|tissue:Whole Brain | GSM7866389 | GSM7866389: EGFRviii PI3KCAH1047R mScarlet tumor positive whole brain 1; Danio rerio; RNA Seq | GSM7866389 r1 | GSM7866389 | 1 | Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer's recommendations | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina NovaSeq 6000 | SRP468564 | loader:fastq load.py | EPS_1.fastq.gz | fastq | 8403475528.0 | 83202728.0 | GSM7866389 r1 | 0:101 | A:2217465507;C:1940028683;G:1857031218;T:2388930530;N:19590 | 101 | 2217465507 | 1940028683 | 1857031218 | 2388930530 | 19590 | SRX22238465 | SRS19292726 | SRA1740017 | Hayes Lab, DSCB, Sickkids Research | Hayes Lab, DSCB, Sickkids Research | 1 | 0.94596 | 0.12916 | 0.68619 | 0.4957 | 101 | B | usable mapping rate | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | Canada | 2023-10-26 | Undetermined | Embryo | Brain | Nervous System | ||||||||||||||||
| 28698 | 28698 | SRR26535349 | SRX22238464 | SRS19292725 | SRP468564 | PRJNA1032461 | A syngeneic spontaneous zebrafish model oftp53 deficient EGFRviii and PI3KCAH1047R driven glioblastoma reveals inhibitory roles for inflammation during tumor initiation and relapsein vivo | GSE246295 | Transcriptome Analysis | To build a patient relevantin vivomodel of human glioblastoma we expressed common oncogenic variants including activated human EGFRviii or KRAS and PI3KCAH1047Runder the control of the radial glial specific promoterher4.1in syngeneictp53loss of function mutant zebrafish.Robust tumor formation was observed prior to 45 days of life with a gene expression signature similar to human glioblastoma of the mesenchymal subtype along with a strong inflammatory component. Within early stage tumor lesions and in an intact and endogenous tumor microenvironment we visualized infiltration of phagocytic cells as well as internalization of tumor cells bympeg1.1:GFP+ microglia/macrophages suggesting negative regulatory pressure by pro inflammatory cell types on tumor growth at early stages of glioblastoma initiationin vivo. Furthermore CRISPR/Cas9 mediated gene targeting of master inflammatory transcription factorsirf7andirf8led to increased tumor formation in the primary context while suppression of microglial/macrophage activity led to enhanced tumor cell engraftment following transplantation into otherwise immune competent zebrafish hosts. Altogether we developed a genetically relevant model of aggressive human glioblastoma and harnessed the unique advantages of zebrafish including live imaging high throughput genetic and chemical manipulations to highlight important tumor suppressive roles for the innate immune system on glioblastoma initiation with important future significance for therapeutic discovery and optimizations. Overall design: To capture broad transcriptomic differences in tumor burdened brains versus normal brains we performed bulk RNA sequencing and gene expression analysis of whole brains and sorted cells. EGFRviii derived tumors were induced by microinjection of EGFRviii PI3KCAH1047R and mScarlet constructs defined as EPS. KRAS derived tumors were induced by microinjection of KRAS PI3KCAH1047R GFP constructs defined as KPG. Three whole brains positive for fluorescent tumors EPS 1 3 KPG 1 3 a… | pubmed:39052000 | KRAS PI3KCAH1047R GFP tumor positive whole brain 3 | GSM7866388 | source name:Whole Brain|strain:CG1 p53null|tissue:Whole Brain|geo loc name:missing|collection date:missing | KRAS PI3KCAH1047R GFP tumor positive whole brain 3 | Raw .fastq data was processed using Salmon quantification of transcripts for each sample. A “decoy aware” index was built with the Danio rerio transcriptome and genome using the GRCz11 assembly with a k mers length of 23 with entries manually added for GFP mScarlet EGFRviii KRAS and PI3KCAH1047R transcripts. Samples were then quantified with the following arguments: r seqBias mp 3 validateMappings rangeFactorizationBins 4. Differential gene expression was compared utilizing DESeq2 and GSEA. Assembly: GRCz11 Supplementary files format and content: Tab delimited .csv file including raw counts for all conditions. | Whole Brain | Fertilized embryos injected with either EPS or KPG construct mix | Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer’s recommendations | Zebrafish were housed and reared following approved animal use protocol | strain:CG1 p53null|tissue:Whole Brain | GSM7866388 | GSM7866388: KRAS PI3KCAH1047R GFP tumor positive whole brain 3; Danio rerio; RNA Seq | GSM7866388 r1 | GSM7866388 | 1 | Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer's recommendations | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina NovaSeq 6000 | SRP468564 | loader:fastq load.py | KPG_3.fastq.gz | fastq | 7609183450.0 | 75338450.0 | GSM7866388 r1 | 0:101 | A:2040241047;C:1721563382;G:1666400346;T:2180961056;N:17619 | 101 | 2040241047 | 1721563382 | 1666400346 | 2180961056 | 17619 | SRX22238464 | SRS19292725 | SRA1740017 | Hayes Lab, DSCB, Sickkids Research | Hayes Lab, DSCB, Sickkids Research | 1 | 0.93555 | 0.16895 | 0.68199 | 0.50032 | 101 | B | usable mapping rate | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | Canada | 2023-10-26 | Undetermined | Embryo | Brain | Nervous System | ||||||||||||||||
| 28699 | 28699 | SRR26535350 | SRX22238463 | SRS19292724 | SRP468564 | PRJNA1032461 | A syngeneic spontaneous zebrafish model oftp53 deficient EGFRviii and PI3KCAH1047R driven glioblastoma reveals inhibitory roles for inflammation during tumor initiation and relapsein vivo | GSE246295 | Transcriptome Analysis | To build a patient relevantin vivomodel of human glioblastoma we expressed common oncogenic variants including activated human EGFRviii or KRAS and PI3KCAH1047Runder the control of the radial glial specific promoterher4.1in syngeneictp53loss of function mutant zebrafish.Robust tumor formation was observed prior to 45 days of life with a gene expression signature similar to human glioblastoma of the mesenchymal subtype along with a strong inflammatory component. Within early stage tumor lesions and in an intact and endogenous tumor microenvironment we visualized infiltration of phagocytic cells as well as internalization of tumor cells bympeg1.1:GFP+ microglia/macrophages suggesting negative regulatory pressure by pro inflammatory cell types on tumor growth at early stages of glioblastoma initiationin vivo. Furthermore CRISPR/Cas9 mediated gene targeting of master inflammatory transcription factorsirf7andirf8led to increased tumor formation in the primary context while suppression of microglial/macrophage activity led to enhanced tumor cell engraftment following transplantation into otherwise immune competent zebrafish hosts. Altogether we developed a genetically relevant model of aggressive human glioblastoma and harnessed the unique advantages of zebrafish including live imaging high throughput genetic and chemical manipulations to highlight important tumor suppressive roles for the innate immune system on glioblastoma initiation with important future significance for therapeutic discovery and optimizations. Overall design: To capture broad transcriptomic differences in tumor burdened brains versus normal brains we performed bulk RNA sequencing and gene expression analysis of whole brains and sorted cells. EGFRviii derived tumors were induced by microinjection of EGFRviii PI3KCAH1047R and mScarlet constructs defined as EPS. KRAS derived tumors were induced by microinjection of KRAS PI3KCAH1047R GFP constructs defined as KPG. Three whole brains positive for fluorescent tumors EPS 1 3 KPG 1 3 a… | pubmed:39052000 | KRAS PI3KCAH1047R GFP tumor positive whole brain 2 | GSM7866387 | source name:Whole Brain|strain:CG1 p53null|tissue:Whole Brain|geo loc name:missing|collection date:missing | KRAS PI3KCAH1047R GFP tumor positive whole brain 2 | Raw .fastq data was processed using Salmon quantification of transcripts for each sample. A “decoy aware” index was built with the Danio rerio transcriptome and genome using the GRCz11 assembly with a k mers length of 23 with entries manually added for GFP mScarlet EGFRviii KRAS and PI3KCAH1047R transcripts. Samples were then quantified with the following arguments: r seqBias mp 3 validateMappings rangeFactorizationBins 4. Differential gene expression was compared utilizing DESeq2 and GSEA. Assembly: GRCz11 Supplementary files format and content: Tab delimited .csv file including raw counts for all conditions. | Whole Brain | Fertilized embryos injected with either EPS or KPG construct mix | Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer’s recommendations | Zebrafish were housed and reared following approved animal use protocol | strain:CG1 p53null|tissue:Whole Brain | GSM7866387 | GSM7866387: KRAS PI3KCAH1047R GFP tumor positive whole brain 2; Danio rerio; RNA Seq | GSM7866387 r1 | GSM7866387 | 1 | Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer's recommendations | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina NovaSeq 6000 | SRP468564 | loader:fastq load.py | KPG_2.fastq.gz | fastq | 8446573339.0 | 83629439.0 | GSM7866387 r1 | 0:101 | A:2223763293;C:1944013929;G:1869828652;T:2408947564;N:19901 | 101 | 2223763293 | 1944013929 | 1869828652 | 2408947564 | 19901 | SRX22238463 | SRS19292724 | SRA1740017 | Hayes Lab, DSCB, Sickkids Research | Hayes Lab, DSCB, Sickkids Research | 1 | 0.94943 | 0.11539 | 0.68428 | 0.51019 | 101 | B | usable mapping rate | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | Canada | 2023-10-26 | Undetermined | Embryo | Brain | Nervous System | ||||||||||||||||
| 28700 | 28700 | SRR26535351 | SRX22238462 | SRS19292723 | SRP468564 | PRJNA1032461 | A syngeneic spontaneous zebrafish model oftp53 deficient EGFRviii and PI3KCAH1047R driven glioblastoma reveals inhibitory roles for inflammation during tumor initiation and relapsein vivo | GSE246295 | Transcriptome Analysis | To build a patient relevantin vivomodel of human glioblastoma we expressed common oncogenic variants including activated human EGFRviii or KRAS and PI3KCAH1047Runder the control of the radial glial specific promoterher4.1in syngeneictp53loss of function mutant zebrafish.Robust tumor formation was observed prior to 45 days of life with a gene expression signature similar to human glioblastoma of the mesenchymal subtype along with a strong inflammatory component. Within early stage tumor lesions and in an intact and endogenous tumor microenvironment we visualized infiltration of phagocytic cells as well as internalization of tumor cells bympeg1.1:GFP+ microglia/macrophages suggesting negative regulatory pressure by pro inflammatory cell types on tumor growth at early stages of glioblastoma initiationin vivo. Furthermore CRISPR/Cas9 mediated gene targeting of master inflammatory transcription factorsirf7andirf8led to increased tumor formation in the primary context while suppression of microglial/macrophage activity led to enhanced tumor cell engraftment following transplantation into otherwise immune competent zebrafish hosts. Altogether we developed a genetically relevant model of aggressive human glioblastoma and harnessed the unique advantages of zebrafish including live imaging high throughput genetic and chemical manipulations to highlight important tumor suppressive roles for the innate immune system on glioblastoma initiation with important future significance for therapeutic discovery and optimizations. Overall design: To capture broad transcriptomic differences in tumor burdened brains versus normal brains we performed bulk RNA sequencing and gene expression analysis of whole brains and sorted cells. EGFRviii derived tumors were induced by microinjection of EGFRviii PI3KCAH1047R and mScarlet constructs defined as EPS. KRAS derived tumors were induced by microinjection of KRAS PI3KCAH1047R GFP constructs defined as KPG. Three whole brains positive for fluorescent tumors EPS 1 3 KPG 1 3 a… | pubmed:39052000 | KRAS PI3KCAH1047R GFP tumor positive whole brain 1 | GSM7866386 | source name:Whole Brain|strain:CG1 p53null|tissue:Whole Brain|geo loc name:missing|collection date:missing | KRAS PI3KCAH1047R GFP tumor positive whole brain 1 | Raw .fastq data was processed using Salmon quantification of transcripts for each sample. A “decoy aware” index was built with the Danio rerio transcriptome and genome using the GRCz11 assembly with a k mers length of 23 with entries manually added for GFP mScarlet EGFRviii KRAS and PI3KCAH1047R transcripts. Samples were then quantified with the following arguments: r seqBias mp 3 validateMappings rangeFactorizationBins 4. Differential gene expression was compared utilizing DESeq2 and GSEA. Assembly: GRCz11 Supplementary files format and content: Tab delimited .csv file including raw counts for all conditions. | Whole Brain | Fertilized embryos injected with either EPS or KPG construct mix | Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer’s recommendations | Zebrafish were housed and reared following approved animal use protocol | strain:CG1 p53null|tissue:Whole Brain | GSM7866386 | GSM7866386: KRAS PI3KCAH1047R GFP tumor positive whole brain 1; Danio rerio; RNA Seq | GSM7866386 r1 | GSM7866386 | 1 | Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer's recommendations | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina NovaSeq 6000 | SRP468564 | loader:fastq load.py | KPG_1.fastq.gz | fastq | 4326209053.0 | 42833753.0 | GSM7866386 r1 | 0:101 | A:1143856405;C:993993009;G:951829931;T:1236519669;N:10039 | 101 | 1143856405 | 993993009 | 951829931 | 1236519669 | 10039 | SRX22238462 | SRS19292723 | SRA1740017 | Hayes Lab, DSCB, Sickkids Research | Hayes Lab, DSCB, Sickkids Research | 1 | 0.94443 | 0.13057 | 0.68503 | 0.50149 | 101 | B | usable mapping rate | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | Canada | 2023-10-26 | Undetermined | Embryo | Brain | Nervous System | ||||||||||||||||
| 31871 | 31871 | SRR33650039 | SRX28877239 | SRS25103945 | SRP502657 | PRJNA1101966 | Pioneer neurons are molecularly distinct and their axon targeting is regulated by retinoic acid signaling | GSE264323 | Transcriptome Analysis | During nervous system development pioneer neurons are the first to extend their axons into target tissues creating a scaffold for follower neurons. Despite years of study whether pioneer neurons are a molecularly distinct population is unknown. Analysis of zebrafish posterior lateral line pLL sensory neurons during axon growth using single cell RNA sequencing scRNA seq revealed that pioneer and follower neurons are transcriptionally distinct. Expression profiling of differentiating pLL progenitors defined follower as the ground state whereas “pioneer” is a later developmental state. The scRNA seq data revealed active retinoic acid RA signaling in followers but not in pioneers. Modulation of RA signaling within single pLL neurons showed that its downregulation in pioneers is necessary for expression of neurotrophic factor receptor ret which is required for correct targeting of pioneer axons. Our study provided insights into the molecular landscape of pioneer neurons and revealed the regulatory role of RA signaling in their development. Overall design: Fourteen hpf eighteen hpf twenty two hpf forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer's solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer's solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 7… | WT zebrafish neurons | GSM8997253 | source name:neuron|tissue:neuron|genotype:mixed|geo loc name:missing|collection date:missing | WT zebrafish neurons | using Cell Ranger version 3.1.0; 10X Genomics Pleasanton CA. USA Assembly: ZebraFishGRCz11 Supplementary files format and content: Tab separated values files and matrix files | neuron | Twenty two old TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer’s solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer’s solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 700 μl of chilled suspension solution was added and cells were resuspended by pipetting. Cells were passed through a 40 μm cell strainer into a FACs tube and kept on ice. GFP and RFP+ cells were FAC sorted on a BD Symphony cell sorter into sorting buffer 50 μl PBS/ 2% BSA in a siliconized 1.5mL tube. Library was performed according to the manufacter’s instructions single cell 3’ v3 protocol 10x Genomics. | tissue:neuron|genotype:mixed | GSM8997253 | GSM8997253: WT zebrafish neurons; Danio rerio; RNA Seq | GSM8997253 r1 | GSM8997253 | 1 | Twenty two old TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer's solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer's solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 700 μl of chilled suspension solution was added and cells were resuspended by pipetting. Cells were passed through a 40 μm cell strainer into a FACs tube and kept on ice. GFP and RFP+ cells were FAC sorted on a BD Symphony cell sorter into sorting buffer 50 μl PBS/ 2% BSA in a siliconized 1.5mL tube. Library was performed according to the manufacter's instructions single cell three prime v3 protocol 10x Genomics. | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP502657 | CEL221031AN_WT_18s_S3_L001_I1_001.fastq.gz CEL221031AN_WT_18s_S3_L001_I2_001.fastq.gz CEL221031AN_WT_18s_S3_L001_R1_001.fastq.gz CEL221031AN_WT_18s_S3_L001_R2_001.fastq.gz | fastq fastq fastq fastq | 76460696208.0 | 554063016.0 | GSM8997253 r1 | 0:10 1:10 2:28 3:90 | A:15627919564;C:9793027889;G:11041478751;T:13400880335;N:2364901 | 10 | 10 | 28 | 90 | 15627919564 | 9793027889 | 11041478751 | 13400880335 | 2364901 | SRX28877239 | SRS25103945 | SRA2133742 | Oregon Health and Science Univ | Oregon Health and Science Univ | B | usable mapping rate | illumina | novaseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2025-05-20 | Undetermined | Embryo | Brain | Nervous System | |||||||||||||||||||||||
| 32806 | 32806 | SRR29478752 | SRX24989905 | SRS21691708 | SRP515053 | PRJNA1126173 | Endolysosomal dysfunction in radial glia progenitor cells leads to defective cerebral angiogenesis and compromised blood brain barrier integrity | GSE270309 | Transcriptome Analysis | The neurovascular unit NVU is a complex multicellular structure that helps maintain cerebral homeostasis and blood brain barrier BBB integrity. While extensive evidence links NVU alterations to cerebrovascular diseases and neurodegeneration the underlying molecular mechanisms remain unclear. Here we use zebrafish embryos carrying a mutation in Scavenger Receptor B2 a highly conserved endolysosomal protein expressed predominantly in Radial Glia Cells RGCs to investigate the interplay among different NVU components. Through live imaging and genetic manipulations we demonstrate that compromised acidification of the endolysosomal compartment in mutant RGCs leads to impaired Notch3 signaling thereby inducing excessive neurogenesis and reduced glial differentiation. We further demonstrate that alterations to the neuron/glia balance result in impaired VEGF and Wnt signaling leading to severe vascular defects hemorrhages and a leaky BBB. Altogether our findings provide novel insights into NVU formation and function and offer new avenues for investigating diseases involving white matter defects and vascular abnormalities. The neurovascular unit NVU is a complex multicellular structure that helps maintain cerebral homeostasis and blood brain barrier BBB integrity. While extensive evidence links NVU alterations to cerebrovascular diseases and neurodegeneration the underlying molecular mechanisms remain unclear. Here we use zebrafish embryos carrying a mutation in Scavenger Receptor B2 a highly conserved endolysosomal protein expressed predominantly in Radial Glia Cells RGCs to investigate the interplay among different NVU components. Through live imaging and genetic manipulations we demonstrate that compromised acidification of the endolysosomal compartment in mutant RGCs leads to impaired Notch3 signaling thereby inducing excessive neurogenesis and reduced glial differentiation. We further demonstrate that alterations to the neuron/glia balance result in impaired VEGF and Wnt signaling leading to sever… | pubmed:39289367 | head scarb2a mut rep 3 | GSM8339369 | source name:head|tissue:head|cell type:scarb2a+ cells|genotype:scarb2a mut|geo loc name:missing|collection date:missing | head scarb2a mut rep 3 | done using the User friendly Transcriptomic Analysis Pipeline Assembly: danRer11 Supplementary files format and content: countsMatrix normalized.txt: expression dataset txt file contaning normalized UMI counts table for all samples. | head | For each experimental condition a pool of 50 heads 3 biological replicates was dissected from euthanized 48 hpf scarb2a mutants and wt siblings and dissociated into a single cell suspension. post a brief enzymatic treatment with a cocktail of Liberase Blendzyme 3 Roche trypsin B BI and DNAseI Roche the cell suspension was strained through a 70µm filter and stained with SYTOXTM blue ThermoFisher for live/dead discrimination. 5000 live scarb2a+ single cells were sorted into 40 µl of lysis/binding buffer solution ThermoFisher containing RNase inhibitor RNasinTM Promega. FACS analysis and sorting were performed on a BD FACS Aria III using a 70µm nozzle. RNA was captured using Dynabeads™ mRNA DIRECT™ Purification Kit ThermoFisher prior to library preparation. A bulk adaptation of the MARS seq protocol was used to generate RNA libraries for the expression profile of scarb2+ mutant and wt cells. The RNA was further fragmented and transformed into a sequencing ready library by tagging the samples with Illumina sequences during ligation RT and PCR. The final library concentration was measured by Qubit TapeStation and qPCR for zebrafish actin as previously described. Sequencing was performed on a Nextseq500/550 High Output Kit v2.5 75 cycles Illumina; paired end sequencing and each sample was sequenced for 6M reads. | tissue:head|cell type:scarb2a+ cells|genotype:scarb2a mut | GSM8339369 | GSM8339369: head scarb2a mut rep 3; Danio rerio; RNA Seq | GSM8339369 r1 | GSM8339369 | 1 | For each experimental condition a pool of 50 heads 3 biological replicates was dissected from euthanized 48 hpf scarb2a mutants and wt siblings and dissociated into a single cell suspension. post a brief enzymatic treatment with a cocktail of Liberase Blendzyme 3 Roche trypsin B BI and DNAseI Roche the cell suspension was strained through a 70µm filter and stained with SYTOXTM blue ThermoFisher for live/dead discrimination. 5000 live scarb2a+ single cells were sorted into 40 µl of lysis/binding buffer solution ThermoFisher containing RNase inhibitor RNasinTM Promega. FACS analysis and sorting were performed on a BD FACS Aria III using a 70µm nozzle. RNA was captured using Dynabeads™ mRNA DIRECT™ Purification Kit ThermoFisher prior to library preparation. A bulk adaptation of the MARS seq protocol was used to generate RNA libraries for the expression profile of scarb2+ mutant and wt cells. The RNA was further fragmented and transformed into a sequencing ready library by tagging the samples with Illumina sequences during ligation RT and PCR. The final library concentration was measured by Qubit TapeStation and qPCR for zebrafish actin as previously described. Sequencing was performed on a Nextseq500/550 High Output Kit v2.5 75 cycles Illumina; paired end sequencing and each sample was sequenced for 6M reads. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP515053 | scarb2_mut3_R2.fastq.gz scarb2_mut3_R1.fastq.gz | fastq fastq | 590803877.0 | 7118119.0 | GSM8339369 r1 | 0:75 1:8 | A:171152826;C:118382558;G:138973475;T:162287717;N:7301 | 75 | 8 | 171152826 | 118382558 | 138973475 | 162287717 | 7301 | SRX24989905 | SRS21691708 | SRA1904886 | Karina Yaniv lab, Immunology and Regenerative Biology, Weizmann Institute of Science | Karina Yaniv lab, Immunology and Regenerative Biology, Weizmann Institute of Science | 2 | 0.86187 | 0.0 | 0.06751 | 0.0 | 0.80081 | 1.0 | 0.47421 | 75 | 8 | B | T | sc-like readlen | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_plate | marsseq | Israel | 2024-06-20 | Hatching | Embryo | Head | Nervous System | |||||||||||||
| 32807 | 32807 | SRR29478753 | SRX24989904 | SRS21691707 | SRP515053 | PRJNA1126173 | Endolysosomal dysfunction in radial glia progenitor cells leads to defective cerebral angiogenesis and compromised blood brain barrier integrity | GSE270309 | Transcriptome Analysis | The neurovascular unit NVU is a complex multicellular structure that helps maintain cerebral homeostasis and blood brain barrier BBB integrity. While extensive evidence links NVU alterations to cerebrovascular diseases and neurodegeneration the underlying molecular mechanisms remain unclear. Here we use zebrafish embryos carrying a mutation in Scavenger Receptor B2 a highly conserved endolysosomal protein expressed predominantly in Radial Glia Cells RGCs to investigate the interplay among different NVU components. Through live imaging and genetic manipulations we demonstrate that compromised acidification of the endolysosomal compartment in mutant RGCs leads to impaired Notch3 signaling thereby inducing excessive neurogenesis and reduced glial differentiation. We further demonstrate that alterations to the neuron/glia balance result in impaired VEGF and Wnt signaling leading to severe vascular defects hemorrhages and a leaky BBB. Altogether our findings provide novel insights into NVU formation and function and offer new avenues for investigating diseases involving white matter defects and vascular abnormalities. The neurovascular unit NVU is a complex multicellular structure that helps maintain cerebral homeostasis and blood brain barrier BBB integrity. While extensive evidence links NVU alterations to cerebrovascular diseases and neurodegeneration the underlying molecular mechanisms remain unclear. Here we use zebrafish embryos carrying a mutation in Scavenger Receptor B2 a highly conserved endolysosomal protein expressed predominantly in Radial Glia Cells RGCs to investigate the interplay among different NVU components. Through live imaging and genetic manipulations we demonstrate that compromised acidification of the endolysosomal compartment in mutant RGCs leads to impaired Notch3 signaling thereby inducing excessive neurogenesis and reduced glial differentiation. We further demonstrate that alterations to the neuron/glia balance result in impaired VEGF and Wnt signaling leading to sever… | pubmed:39289367 | head scarb2a mut rep 2 | GSM8339368 | source name:head|tissue:head|cell type:scarb2a+ cells|genotype:scarb2a mut|geo loc name:missing|collection date:missing | head scarb2a mut rep 2 | done using the User friendly Transcriptomic Analysis Pipeline Assembly: danRer11 Supplementary files format and content: countsMatrix normalized.txt: expression dataset txt file contaning normalized UMI counts table for all samples. | head | For each experimental condition a pool of 50 heads 3 biological replicates was dissected from euthanized 48 hpf scarb2a mutants and wt siblings and dissociated into a single cell suspension. post a brief enzymatic treatment with a cocktail of Liberase Blendzyme 3 Roche trypsin B BI and DNAseI Roche the cell suspension was strained through a 70µm filter and stained with SYTOXTM blue ThermoFisher for live/dead discrimination. 5000 live scarb2a+ single cells were sorted into 40 µl of lysis/binding buffer solution ThermoFisher containing RNase inhibitor RNasinTM Promega. FACS analysis and sorting were performed on a BD FACS Aria III using a 70µm nozzle. RNA was captured using Dynabeads™ mRNA DIRECT™ Purification Kit ThermoFisher prior to library preparation. A bulk adaptation of the MARS seq protocol was used to generate RNA libraries for the expression profile of scarb2+ mutant and wt cells. The RNA was further fragmented and transformed into a sequencing ready library by tagging the samples with Illumina sequences during ligation RT and PCR. The final library concentration was measured by Qubit TapeStation and qPCR for zebrafish actin as previously described. Sequencing was performed on a Nextseq500/550 High Output Kit v2.5 75 cycles Illumina; paired end sequencing and each sample was sequenced for 6M reads. | tissue:head|cell type:scarb2a+ cells|genotype:scarb2a mut | GSM8339368 | GSM8339368: head scarb2a mut rep 2; Danio rerio; RNA Seq | GSM8339368 r1 | GSM8339368 | 1 | For each experimental condition a pool of 50 heads 3 biological replicates was dissected from euthanized 48 hpf scarb2a mutants and wt siblings and dissociated into a single cell suspension. post a brief enzymatic treatment with a cocktail of Liberase Blendzyme 3 Roche trypsin B BI and DNAseI Roche the cell suspension was strained through a 70µm filter and stained with SYTOXTM blue ThermoFisher for live/dead discrimination. 5000 live scarb2a+ single cells were sorted into 40 µl of lysis/binding buffer solution ThermoFisher containing RNase inhibitor RNasinTM Promega. FACS analysis and sorting were performed on a BD FACS Aria III using a 70µm nozzle. RNA was captured using Dynabeads™ mRNA DIRECT™ Purification Kit ThermoFisher prior to library preparation. A bulk adaptation of the MARS seq protocol was used to generate RNA libraries for the expression profile of scarb2+ mutant and wt cells. The RNA was further fragmented and transformed into a sequencing ready library by tagging the samples with Illumina sequences during ligation RT and PCR. The final library concentration was measured by Qubit TapeStation and qPCR for zebrafish actin as previously described. Sequencing was performed on a Nextseq500/550 High Output Kit v2.5 75 cycles Illumina; paired end sequencing and each sample was sequenced for 6M reads. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP515053 | scarb2_mut2_R2.fastq.gz scarb2_mut2_R1.fastq.gz | fastq fastq | 560228337.0 | 6749739.0 | GSM8339368 r1 | 0:75 1:8 | A:161395198;C:113034644;G:131199008;T:154592664;N:6823 | 75 | 8 | 161395198 | 113034644 | 131199008 | 154592664 | 6823 | SRX24989904 | SRS21691707 | SRA1904886 | Karina Yaniv lab, Immunology and Regenerative Biology, Weizmann Institute of Science | Karina Yaniv lab, Immunology and Regenerative Biology, Weizmann Institute of Science | 2 | 0.85633 | 0.0 | 0.06116 | 0.0 | 0.80438 | 1.0 | 0.47226 | 75 | 8 | B | T | sc-like readlen | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_plate | marsseq | Israel | 2024-06-20 | Hatching | Embryo | Head | Nervous System | |||||||||||||
| 32808 | 32808 | SRR29478754 | SRX24989903 | SRS21691706 | SRP515053 | PRJNA1126173 | Endolysosomal dysfunction in radial glia progenitor cells leads to defective cerebral angiogenesis and compromised blood brain barrier integrity | GSE270309 | Transcriptome Analysis | The neurovascular unit NVU is a complex multicellular structure that helps maintain cerebral homeostasis and blood brain barrier BBB integrity. While extensive evidence links NVU alterations to cerebrovascular diseases and neurodegeneration the underlying molecular mechanisms remain unclear. Here we use zebrafish embryos carrying a mutation in Scavenger Receptor B2 a highly conserved endolysosomal protein expressed predominantly in Radial Glia Cells RGCs to investigate the interplay among different NVU components. Through live imaging and genetic manipulations we demonstrate that compromised acidification of the endolysosomal compartment in mutant RGCs leads to impaired Notch3 signaling thereby inducing excessive neurogenesis and reduced glial differentiation. We further demonstrate that alterations to the neuron/glia balance result in impaired VEGF and Wnt signaling leading to severe vascular defects hemorrhages and a leaky BBB. Altogether our findings provide novel insights into NVU formation and function and offer new avenues for investigating diseases involving white matter defects and vascular abnormalities. The neurovascular unit NVU is a complex multicellular structure that helps maintain cerebral homeostasis and blood brain barrier BBB integrity. While extensive evidence links NVU alterations to cerebrovascular diseases and neurodegeneration the underlying molecular mechanisms remain unclear. Here we use zebrafish embryos carrying a mutation in Scavenger Receptor B2 a highly conserved endolysosomal protein expressed predominantly in Radial Glia Cells RGCs to investigate the interplay among different NVU components. Through live imaging and genetic manipulations we demonstrate that compromised acidification of the endolysosomal compartment in mutant RGCs leads to impaired Notch3 signaling thereby inducing excessive neurogenesis and reduced glial differentiation. We further demonstrate that alterations to the neuron/glia balance result in impaired VEGF and Wnt signaling leading to sever… | pubmed:39289367 | head scarb2a mut rep 1 | GSM8339367 | source name:head|tissue:head|cell type:scarb2a+ cells|genotype:scarb2a mut|geo loc name:missing|collection date:missing | head scarb2a mut rep 1 | done using the User friendly Transcriptomic Analysis Pipeline Assembly: danRer11 Supplementary files format and content: countsMatrix normalized.txt: expression dataset txt file contaning normalized UMI counts table for all samples. | head | For each experimental condition a pool of 50 heads 3 biological replicates was dissected from euthanized 48 hpf scarb2a mutants and wt siblings and dissociated into a single cell suspension. post a brief enzymatic treatment with a cocktail of Liberase Blendzyme 3 Roche trypsin B BI and DNAseI Roche the cell suspension was strained through a 70µm filter and stained with SYTOXTM blue ThermoFisher for live/dead discrimination. 5000 live scarb2a+ single cells were sorted into 40 µl of lysis/binding buffer solution ThermoFisher containing RNase inhibitor RNasinTM Promega. FACS analysis and sorting were performed on a BD FACS Aria III using a 70µm nozzle. RNA was captured using Dynabeads™ mRNA DIRECT™ Purification Kit ThermoFisher prior to library preparation. A bulk adaptation of the MARS seq protocol was used to generate RNA libraries for the expression profile of scarb2+ mutant and wt cells. The RNA was further fragmented and transformed into a sequencing ready library by tagging the samples with Illumina sequences during ligation RT and PCR. The final library concentration was measured by Qubit TapeStation and qPCR for zebrafish actin as previously described. Sequencing was performed on a Nextseq500/550 High Output Kit v2.5 75 cycles Illumina; paired end sequencing and each sample was sequenced for 6M reads. | tissue:head|cell type:scarb2a+ cells|genotype:scarb2a mut | GSM8339367 | GSM8339367: head scarb2a mut rep 1; Danio rerio; RNA Seq | GSM8339367 r1 | GSM8339367 | 1 | For each experimental condition a pool of 50 heads 3 biological replicates was dissected from euthanized 48 hpf scarb2a mutants and wt siblings and dissociated into a single cell suspension. post a brief enzymatic treatment with a cocktail of Liberase Blendzyme 3 Roche trypsin B BI and DNAseI Roche the cell suspension was strained through a 70µm filter and stained with SYTOXTM blue ThermoFisher for live/dead discrimination. 5000 live scarb2a+ single cells were sorted into 40 µl of lysis/binding buffer solution ThermoFisher containing RNase inhibitor RNasinTM Promega. FACS analysis and sorting were performed on a BD FACS Aria III using a 70µm nozzle. RNA was captured using Dynabeads™ mRNA DIRECT™ Purification Kit ThermoFisher prior to library preparation. A bulk adaptation of the MARS seq protocol was used to generate RNA libraries for the expression profile of scarb2+ mutant and wt cells. The RNA was further fragmented and transformed into a sequencing ready library by tagging the samples with Illumina sequences during ligation RT and PCR. The final library concentration was measured by Qubit TapeStation and qPCR for zebrafish actin as previously described. Sequencing was performed on a Nextseq500/550 High Output Kit v2.5 75 cycles Illumina; paired end sequencing and each sample was sequenced for 6M reads. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP515053 | scarb2_mut1_R1.fastq.gz scarb2_mut1_R2.fastq.gz | fastq fastq | 536045042.0 | 6458374.0 | GSM8339367 r1 | 0:75 1:8 | A:152863781;C:109210501;G:126922310;T:147041910;N:6540 | 75 | 8 | 152863781 | 109210501 | 126922310 | 147041910 | 6540 | SRX24989903 | SRS21691706 | SRA1904886 | Karina Yaniv lab, Immunology and Regenerative Biology, Weizmann Institute of Science | Karina Yaniv lab, Immunology and Regenerative Biology, Weizmann Institute of Science | 2 | 0.86464 | 0.0 | 0.06577 | 0.0 | 0.80359 | 1.0 | 0.48395 | 75 | 8 | B | T | sc-like readlen | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_plate | marsseq | Israel | 2024-06-20 | Hatching | Embryo | Head | Nervous System | |||||||||||||
| 32809 | 32809 | SRR29478755 | SRX24989902 | SRS21691705 | SRP515053 | PRJNA1126173 | Endolysosomal dysfunction in radial glia progenitor cells leads to defective cerebral angiogenesis and compromised blood brain barrier integrity | GSE270309 | Transcriptome Analysis | The neurovascular unit NVU is a complex multicellular structure that helps maintain cerebral homeostasis and blood brain barrier BBB integrity. While extensive evidence links NVU alterations to cerebrovascular diseases and neurodegeneration the underlying molecular mechanisms remain unclear. Here we use zebrafish embryos carrying a mutation in Scavenger Receptor B2 a highly conserved endolysosomal protein expressed predominantly in Radial Glia Cells RGCs to investigate the interplay among different NVU components. Through live imaging and genetic manipulations we demonstrate that compromised acidification of the endolysosomal compartment in mutant RGCs leads to impaired Notch3 signaling thereby inducing excessive neurogenesis and reduced glial differentiation. We further demonstrate that alterations to the neuron/glia balance result in impaired VEGF and Wnt signaling leading to severe vascular defects hemorrhages and a leaky BBB. Altogether our findings provide novel insights into NVU formation and function and offer new avenues for investigating diseases involving white matter defects and vascular abnormalities. The neurovascular unit NVU is a complex multicellular structure that helps maintain cerebral homeostasis and blood brain barrier BBB integrity. While extensive evidence links NVU alterations to cerebrovascular diseases and neurodegeneration the underlying molecular mechanisms remain unclear. Here we use zebrafish embryos carrying a mutation in Scavenger Receptor B2 a highly conserved endolysosomal protein expressed predominantly in Radial Glia Cells RGCs to investigate the interplay among different NVU components. Through live imaging and genetic manipulations we demonstrate that compromised acidification of the endolysosomal compartment in mutant RGCs leads to impaired Notch3 signaling thereby inducing excessive neurogenesis and reduced glial differentiation. We further demonstrate that alterations to the neuron/glia balance result in impaired VEGF and Wnt signaling leading to sever… | pubmed:39289367 | head wt rep 4 | GSM8339366 | source name:head|tissue:head|cell type:scarb2a+ cells|genotype:wt|geo loc name:missing|collection date:missing | head wt rep 4 | done using the User friendly Transcriptomic Analysis Pipeline Assembly: danRer11 Supplementary files format and content: countsMatrix normalized.txt: expression dataset txt file contaning normalized UMI counts table for all samples. | head | For each experimental condition a pool of 50 heads 3 biological replicates was dissected from euthanized 48 hpf scarb2a mutants and wt siblings and dissociated into a single cell suspension. post a brief enzymatic treatment with a cocktail of Liberase Blendzyme 3 Roche trypsin B BI and DNAseI Roche the cell suspension was strained through a 70µm filter and stained with SYTOXTM blue ThermoFisher for live/dead discrimination. 5000 live scarb2a+ single cells were sorted into 40 µl of lysis/binding buffer solution ThermoFisher containing RNase inhibitor RNasinTM Promega. FACS analysis and sorting were performed on a BD FACS Aria III using a 70µm nozzle. RNA was captured using Dynabeads™ mRNA DIRECT™ Purification Kit ThermoFisher prior to library preparation. A bulk adaptation of the MARS seq protocol was used to generate RNA libraries for the expression profile of scarb2+ mutant and wt cells. The RNA was further fragmented and transformed into a sequencing ready library by tagging the samples with Illumina sequences during ligation RT and PCR. The final library concentration was measured by Qubit TapeStation and qPCR for zebrafish actin as previously described. Sequencing was performed on a Nextseq500/550 High Output Kit v2.5 75 cycles Illumina; paired end sequencing and each sample was sequenced for 6M reads. | tissue:head|cell type:scarb2a+ cells|genotype:wt | GSM8339366 | GSM8339366: head wt rep 4; Danio rerio; RNA Seq | GSM8339366 r1 | GSM8339366 | 1 | For each experimental condition a pool of 50 heads 3 biological replicates was dissected from euthanized 48 hpf scarb2a mutants and wt siblings and dissociated into a single cell suspension. post a brief enzymatic treatment with a cocktail of Liberase Blendzyme 3 Roche trypsin B BI and DNAseI Roche the cell suspension was strained through a 70µm filter and stained with SYTOXTM blue ThermoFisher for live/dead discrimination. 5000 live scarb2a+ single cells were sorted into 40 µl of lysis/binding buffer solution ThermoFisher containing RNase inhibitor RNasinTM Promega. FACS analysis and sorting were performed on a BD FACS Aria III using a 70µm nozzle. RNA was captured using Dynabeads™ mRNA DIRECT™ Purification Kit ThermoFisher prior to library preparation. A bulk adaptation of the MARS seq protocol was used to generate RNA libraries for the expression profile of scarb2+ mutant and wt cells. The RNA was further fragmented and transformed into a sequencing ready library by tagging the samples with Illumina sequences during ligation RT and PCR. The final library concentration was measured by Qubit TapeStation and qPCR for zebrafish actin as previously described. Sequencing was performed on a Nextseq500/550 High Output Kit v2.5 75 cycles Illumina; paired end sequencing and each sample was sequenced for 6M reads. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP515053 | scarb2_wt4_R1.fastq.gz scarb2_wt4_R2.fastq.gz | fastq fastq | 723943430.0 | 8722210.0 | GSM8339366 r1 | 0:75 1:8 | A:206155698;C:145344454;G:172171717;T:200262536;N:9025 | 75 | 8 | 206155698 | 145344454 | 172171717 | 200262536 | 9025 | SRX24989902 | SRS21691705 | SRA1904886 | Karina Yaniv lab, Immunology and Regenerative Biology, Weizmann Institute of Science | Karina Yaniv lab, Immunology and Regenerative Biology, Weizmann Institute of Science | 2 | 0.86958 | 0.0 | 0.0737 | 0.0 | 0.79928 | 1.0 | 0.47906 | 75 | 8 | B | T | sc-like readlen | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_plate | marsseq | Israel | 2024-06-20 | Hatching | Embryo | Head | Nervous System | |||||||||||||
| 32810 | 32810 | SRR29478756 | SRX24989901 | SRS21691704 | SRP515053 | PRJNA1126173 | Endolysosomal dysfunction in radial glia progenitor cells leads to defective cerebral angiogenesis and compromised blood brain barrier integrity | GSE270309 | Transcriptome Analysis | The neurovascular unit NVU is a complex multicellular structure that helps maintain cerebral homeostasis and blood brain barrier BBB integrity. While extensive evidence links NVU alterations to cerebrovascular diseases and neurodegeneration the underlying molecular mechanisms remain unclear. Here we use zebrafish embryos carrying a mutation in Scavenger Receptor B2 a highly conserved endolysosomal protein expressed predominantly in Radial Glia Cells RGCs to investigate the interplay among different NVU components. Through live imaging and genetic manipulations we demonstrate that compromised acidification of the endolysosomal compartment in mutant RGCs leads to impaired Notch3 signaling thereby inducing excessive neurogenesis and reduced glial differentiation. We further demonstrate that alterations to the neuron/glia balance result in impaired VEGF and Wnt signaling leading to severe vascular defects hemorrhages and a leaky BBB. Altogether our findings provide novel insights into NVU formation and function and offer new avenues for investigating diseases involving white matter defects and vascular abnormalities. The neurovascular unit NVU is a complex multicellular structure that helps maintain cerebral homeostasis and blood brain barrier BBB integrity. While extensive evidence links NVU alterations to cerebrovascular diseases and neurodegeneration the underlying molecular mechanisms remain unclear. Here we use zebrafish embryos carrying a mutation in Scavenger Receptor B2 a highly conserved endolysosomal protein expressed predominantly in Radial Glia Cells RGCs to investigate the interplay among different NVU components. Through live imaging and genetic manipulations we demonstrate that compromised acidification of the endolysosomal compartment in mutant RGCs leads to impaired Notch3 signaling thereby inducing excessive neurogenesis and reduced glial differentiation. We further demonstrate that alterations to the neuron/glia balance result in impaired VEGF and Wnt signaling leading to sever… | pubmed:39289367 | head wt rep 3 | GSM8339365 | source name:head|tissue:head|cell type:scarb2a+ cells|genotype:wt|geo loc name:missing|collection date:missing | head wt rep 3 | done using the User friendly Transcriptomic Analysis Pipeline Assembly: danRer11 Supplementary files format and content: countsMatrix normalized.txt: expression dataset txt file contaning normalized UMI counts table for all samples. | head | For each experimental condition a pool of 50 heads 3 biological replicates was dissected from euthanized 48 hpf scarb2a mutants and wt siblings and dissociated into a single cell suspension. post a brief enzymatic treatment with a cocktail of Liberase Blendzyme 3 Roche trypsin B BI and DNAseI Roche the cell suspension was strained through a 70µm filter and stained with SYTOXTM blue ThermoFisher for live/dead discrimination. 5000 live scarb2a+ single cells were sorted into 40 µl of lysis/binding buffer solution ThermoFisher containing RNase inhibitor RNasinTM Promega. FACS analysis and sorting were performed on a BD FACS Aria III using a 70µm nozzle. RNA was captured using Dynabeads™ mRNA DIRECT™ Purification Kit ThermoFisher prior to library preparation. A bulk adaptation of the MARS seq protocol was used to generate RNA libraries for the expression profile of scarb2+ mutant and wt cells. The RNA was further fragmented and transformed into a sequencing ready library by tagging the samples with Illumina sequences during ligation RT and PCR. The final library concentration was measured by Qubit TapeStation and qPCR for zebrafish actin as previously described. Sequencing was performed on a Nextseq500/550 High Output Kit v2.5 75 cycles Illumina; paired end sequencing and each sample was sequenced for 6M reads. | tissue:head|cell type:scarb2a+ cells|genotype:wt | GSM8339365 | GSM8339365: head wt rep 3; Danio rerio; RNA Seq | GSM8339365 r1 | GSM8339365 | 1 | For each experimental condition a pool of 50 heads 3 biological replicates was dissected from euthanized 48 hpf scarb2a mutants and wt siblings and dissociated into a single cell suspension. post a brief enzymatic treatment with a cocktail of Liberase Blendzyme 3 Roche trypsin B BI and DNAseI Roche the cell suspension was strained through a 70µm filter and stained with SYTOXTM blue ThermoFisher for live/dead discrimination. 5000 live scarb2a+ single cells were sorted into 40 µl of lysis/binding buffer solution ThermoFisher containing RNase inhibitor RNasinTM Promega. FACS analysis and sorting were performed on a BD FACS Aria III using a 70µm nozzle. RNA was captured using Dynabeads™ mRNA DIRECT™ Purification Kit ThermoFisher prior to library preparation. A bulk adaptation of the MARS seq protocol was used to generate RNA libraries for the expression profile of scarb2+ mutant and wt cells. The RNA was further fragmented and transformed into a sequencing ready library by tagging the samples with Illumina sequences during ligation RT and PCR. The final library concentration was measured by Qubit TapeStation and qPCR for zebrafish actin as previously described. Sequencing was performed on a Nextseq500/550 High Output Kit v2.5 75 cycles Illumina; paired end sequencing and each sample was sequenced for 6M reads. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP515053 | scarb2_wt3_R1.fastq.gz scarb2_wt3_R2.fastq.gz | fastq fastq | 560881132.0 | 6757604.0 | GSM8339365 r1 | 0:75 1:8 | A:158992539;C:112696361;G:133852695;T:155332822;N:6715 | 75 | 8 | 158992539 | 112696361 | 133852695 | 155332822 | 6715 | SRX24989901 | SRS21691704 | SRA1904886 | Karina Yaniv lab, Immunology and Regenerative Biology, Weizmann Institute of Science | Karina Yaniv lab, Immunology and Regenerative Biology, Weizmann Institute of Science | 2 | 0.8706 | 0.0 | 0.07425 | 0.0 | 0.80038 | 1.0 | 0.47161 | 75 | 8 | B | T | sc-like readlen | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_plate | marsseq | Israel | 2024-06-20 | Hatching | Embryo | Head | Nervous System | |||||||||||||
| 32811 | 32811 | SRR29478757 | SRX24989900 | SRS21691703 | SRP515053 | PRJNA1126173 | Endolysosomal dysfunction in radial glia progenitor cells leads to defective cerebral angiogenesis and compromised blood brain barrier integrity | GSE270309 | Transcriptome Analysis | The neurovascular unit NVU is a complex multicellular structure that helps maintain cerebral homeostasis and blood brain barrier BBB integrity. While extensive evidence links NVU alterations to cerebrovascular diseases and neurodegeneration the underlying molecular mechanisms remain unclear. Here we use zebrafish embryos carrying a mutation in Scavenger Receptor B2 a highly conserved endolysosomal protein expressed predominantly in Radial Glia Cells RGCs to investigate the interplay among different NVU components. Through live imaging and genetic manipulations we demonstrate that compromised acidification of the endolysosomal compartment in mutant RGCs leads to impaired Notch3 signaling thereby inducing excessive neurogenesis and reduced glial differentiation. We further demonstrate that alterations to the neuron/glia balance result in impaired VEGF and Wnt signaling leading to severe vascular defects hemorrhages and a leaky BBB. Altogether our findings provide novel insights into NVU formation and function and offer new avenues for investigating diseases involving white matter defects and vascular abnormalities. The neurovascular unit NVU is a complex multicellular structure that helps maintain cerebral homeostasis and blood brain barrier BBB integrity. While extensive evidence links NVU alterations to cerebrovascular diseases and neurodegeneration the underlying molecular mechanisms remain unclear. Here we use zebrafish embryos carrying a mutation in Scavenger Receptor B2 a highly conserved endolysosomal protein expressed predominantly in Radial Glia Cells RGCs to investigate the interplay among different NVU components. Through live imaging and genetic manipulations we demonstrate that compromised acidification of the endolysosomal compartment in mutant RGCs leads to impaired Notch3 signaling thereby inducing excessive neurogenesis and reduced glial differentiation. We further demonstrate that alterations to the neuron/glia balance result in impaired VEGF and Wnt signaling leading to sever… | pubmed:39289367 | head wt rep 1 | GSM8339364 | source name:head|tissue:head|cell type:scarb2a+ cells|genotype:wt|geo loc name:missing|collection date:missing | head wt rep 1 | done using the User friendly Transcriptomic Analysis Pipeline Assembly: danRer11 Supplementary files format and content: countsMatrix normalized.txt: expression dataset txt file contaning normalized UMI counts table for all samples. | head | For each experimental condition a pool of 50 heads 3 biological replicates was dissected from euthanized 48 hpf scarb2a mutants and wt siblings and dissociated into a single cell suspension. post a brief enzymatic treatment with a cocktail of Liberase Blendzyme 3 Roche trypsin B BI and DNAseI Roche the cell suspension was strained through a 70µm filter and stained with SYTOXTM blue ThermoFisher for live/dead discrimination. 5000 live scarb2a+ single cells were sorted into 40 µl of lysis/binding buffer solution ThermoFisher containing RNase inhibitor RNasinTM Promega. FACS analysis and sorting were performed on a BD FACS Aria III using a 70µm nozzle. RNA was captured using Dynabeads™ mRNA DIRECT™ Purification Kit ThermoFisher prior to library preparation. A bulk adaptation of the MARS seq protocol was used to generate RNA libraries for the expression profile of scarb2+ mutant and wt cells. The RNA was further fragmented and transformed into a sequencing ready library by tagging the samples with Illumina sequences during ligation RT and PCR. The final library concentration was measured by Qubit TapeStation and qPCR for zebrafish actin as previously described. Sequencing was performed on a Nextseq500/550 High Output Kit v2.5 75 cycles Illumina; paired end sequencing and each sample was sequenced for 6M reads. | tissue:head|cell type:scarb2a+ cells|genotype:wt | GSM8339364 | GSM8339364: head wt rep 1; Danio rerio; RNA Seq | GSM8339364 r1 | GSM8339364 | 1 | For each experimental condition a pool of 50 heads 3 biological replicates was dissected from euthanized 48 hpf scarb2a mutants and wt siblings and dissociated into a single cell suspension. post a brief enzymatic treatment with a cocktail of Liberase Blendzyme 3 Roche trypsin B BI and DNAseI Roche the cell suspension was strained through a 70µm filter and stained with SYTOXTM blue ThermoFisher for live/dead discrimination. 5000 live scarb2a+ single cells were sorted into 40 µl of lysis/binding buffer solution ThermoFisher containing RNase inhibitor RNasinTM Promega. FACS analysis and sorting were performed on a BD FACS Aria III using a 70µm nozzle. RNA was captured using Dynabeads™ mRNA DIRECT™ Purification Kit ThermoFisher prior to library preparation. A bulk adaptation of the MARS seq protocol was used to generate RNA libraries for the expression profile of scarb2+ mutant and wt cells. The RNA was further fragmented and transformed into a sequencing ready library by tagging the samples with Illumina sequences during ligation RT and PCR. The final library concentration was measured by Qubit TapeStation and qPCR for zebrafish actin as previously described. Sequencing was performed on a Nextseq500/550 High Output Kit v2.5 75 cycles Illumina; paired end sequencing and each sample was sequenced for 6M reads. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP515053 | scarb2_wt1_R1.fastq.gz scarb2_wt1_R2.fastq.gz | fastq fastq | 539653799.0 | 6501853.0 | GSM8339364 r1 | 0:75 1:8 | A:153571518;C:110489477;G:128477853;T:147108152;N:6799 | 75 | 8 | 153571518 | 110489477 | 128477853 | 147108152 | 6799 | SRX24989900 | SRS21691703 | SRA1904886 | Karina Yaniv lab, Immunology and Regenerative Biology, Weizmann Institute of Science | Karina Yaniv lab, Immunology and Regenerative Biology, Weizmann Institute of Science | 2 | 0.87359 | 0.0 | 0.07353 | 0.0 | 0.80184 | 1.0 | 0.47111 | 75 | 8 | B | T | sc-like readlen | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_plate | marsseq | Israel | 2024-06-20 | Hatching | Embryo | Head | Nervous System | |||||||||||||
| 32863 | 32863 | SRR30114185 | SRX25586802 | SRS22237546 | SRP523914 | PRJNA1126282 | Danio rerio Single cell Transcriptome | PRJNA1126282 | Transcriptome Analysis | Single cell sequencing of Zebrafish model with RFC1 mutation for loss of function study. Samples from zebrafishes at 2 or 4 dpf isolated from the whole head or whole brain respectively. Libraries prepared and sequenced with 10X Genomics three prime Chromium kits. | WT sc 2dpf | WT sc 2dpf S1 L003 | strain:Tgrfc1+/+|age:2dpf|collection date:2024 02 19|geo loc name:Canada: Montreal|sex:N/A|tissue:Head|genotype:Wild Type|BioSampleModel:Model organism or animal | scRNA Seq of danio rerio: 2dpf head | WT sc 2dpf | WT sc 2dpf | Four brains or three heads per condition from 4dpf or 2dpf larvae respectively were transferred into 1.5ml tubes containing 250 l of papain solution 100l papain 100l DNase I and 200l L cysteine per 5 mL of DMEM/F12. The tissue was digested 20min at 37C with pipetting every 10min. Enzymatic digestion was stopped with washing solution 65l glucose 45 % 50L HEPES 1M and 0.5ml FBS qsp 10ml DPBS 1X and centrifuged at 800g for 5min at 4C. Supernatant was removed and pellet was resuspended in 50l of washing solution. The cell suspension was filtered with a cell strainer to remove aggregates. Libraries were prepared with a three prime Chromium kit and sent for 10X Genomics sequencing at a depth of 250 million reads 100bp ea from Illumina NovaSeq6000. | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP523914 | WT_sc_2dpf_S1_L003_R2.fastq.gz WT_sc_2dpf_S1_L003_R1.fastq.gz | fastq fastq | 56807165786.0 | 281223593.0 | WT sc 2dpf S1 L003 R1.fastq.gz | 0:101 1:101 | A:15279867415;C:9333139424;G:10011041111;T:22182483036;N:634800 | 101 | 101 | 15279867415 | 9333139424 | 10011041111 | 22182483036 | 634800 | SRX25586802 | SRS22237546 | SRA1936077 | CHUM Research Center|Neurosciences | CHUM Research Center | 2 | 0.07599 | 0.93395 | 0.0191 | 0.17781 | 0.97636 | 0.81215 | 0.61682 | 0.56234 | 101 | 101 | T | B | mate1 technical by mapping diff | illumina | novaseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | Canada | 2024-08-02 | Hatching | Embryo | Head | Nervous System | ||||||||||||||||||||
| 32864 | 32864 | SRR30114186 | SRX25586801 | SRS22237545 | SRP523914 | PRJNA1126282 | Danio rerio Single cell Transcriptome | PRJNA1126282 | Transcriptome Analysis | Single cell sequencing of Zebrafish model with RFC1 mutation for loss of function study. Samples from zebrafishes at 2 or 4 dpf isolated from the whole head or whole brain respectively. Libraries prepared and sequenced with 10X Genomics three prime Chromium kits. | RFC1 KO sc 2dpf | RFC1 KO sc 2dpf S2 L003 | strain:Tgrfc1 / |age:2dpf|collection date:2024 02 19|geo loc name:Canada: Montreal|sex:N/A|tissue:Head|genotype:RFC1 KO|BioSampleModel:Model organism or animal | scRNA Seq of danio rerio: 2dpf head | RFC1 KO sc 2dpf | RFC1 KO sc 2dpf | Four brains or three heads per condition from 4dpf or 2dpf larvae respectively were transferred into 1.5ml tubes containing 250 l of papain solution 100l papain 100l DNase I and 200l L cysteine per 5 mL of DMEM/F12. The tissue was digested 20min at 37C with pipetting every 10min. Enzymatic digestion was stopped with washing solution 65l glucose 45 % 50L HEPES 1M and 0.5ml FBS qsp 10ml DPBS 1X and centrifuged at 800g for 5min at 4C. Supernatant was removed and pellet was resuspended in 50l of washing solution. The cell suspension was filtered with a cell strainer to remove aggregates. Libraries were prepared with a three prime Chromium kit and sent for 10X Genomics sequencing at a depth of 250 million reads 100bp ea from Illumina NovaSeq6000. | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP523914 | RFC1-KO_sc_2dpf_S2_L003_R1.fastq.gz RFC1-KO_sc_2dpf_S2_L003_R2.fastq.gz | fastq fastq | 45448109280.0 | 224990640.0 | RFC1 KO sc 2dpf S2 L003 R1.fastq.gz | 0:101 1:101 | A:12090767157;C:7635667126;G:8209912637;T:17511260653;N:501707 | 101 | 101 | 12090767157 | 7635667126 | 8209912637 | 17511260653 | 501707 | SRX25586801 | SRS22237545 | SRA1936077 | CHUM Research Center|Neurosciences | CHUM Research Center | 2 | 0.09244 | 0.93268 | 0.02271 | 0.19887 | 0.97544 | 0.80955 | 0.6375 | 0.56143 | 101 | 101 | T | B | mate1 technical by mapping diff | illumina | novaseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | Canada | 2024-08-02 | Hatching | Embryo | Head | Nervous System | ||||||||||||||||||||
| 34088 | 34088 | SRR31047783 | SRX26432306 | SRS22949546 | SRP539617 | PRJNA1175041 | 6PPD induces cerebrovascular defects by triggering oxidative stress and ferroptosis in zebrafish | GSE279887 | Transcriptome Analysis | N 1 3 dimethylbutyl N' phenyl p phenylenediamine 6PPD which is widely used as an antiozonant in rubber tires has recently got much attention for its acute aquatic toxicity. However the developmental toxicity of 6PPD in cerebrovascular network remains unknown. Here we investigated the effects of 6PPD exposure in cerebral vascular using the larvae of zebrafish. 6PPD would not affect the body length and shape of zebrafish larvae at the concentrations ranging from 20 µg/L to 1000 µg/L. 6PPD induced developmental defects in the brain in a concentration dependent manner. The trunk vascular development would not be affected while the cerebrovascular network was disrupted upon 6PPD exposure. 6PPD would trigger excessive Reactive Oxygen Species ROS in the brain indicating abnormal oxidative stress. Mechanistically brain specific transcriptome analysis showed that 6PPD could potentially cause the blockage of arachidonic acid AA metabolism related genes and the upregulation of ferroptosis related genes. Besides treatment with ferroptosis inhibitor N Acetyl L cysteine NAC attenuated oxidative damage and improved the construction of cerebrovascular network upon 6PPD exposure. Moreover using a human vascular endothelial cell line we further confirmed that 6PPD could trigger abnormal oxidative stress and defective expansion capacity implying the conserved toxicity cross species. These findings are useful for the elucidation of toxicity underlying 6PPD in cerebrovascular systems of both zebrafish and humans. Overall design: To investigate the effects of 6PPD on zebrafish development embryos were treated with 500 µg/L 6PPD from 10 hpf until 2 dpf dpf. For transcriptomic analysis three biological replicates were prepared for both the 6PPD treatment group and the DMSO control group. For each replicate the heads of 150 embryos at 2 dpf were dissected flash frozen in liquid nitrogen and sent for transcriptomic sequencing. The raw data analysis was performed to identify differentially expressed genes between the 6PPD tr… | 6PPD 3 | GSM8582553 | source name:Brain|tissue:Brain|treatment:6PPD|geo loc name:missing|collection date:missing | 6PPD 3 | Self house pipeline Sequence reads were trimmed for adaptor sequence/low quality seguence using fastp parameter Quality limit: 20 Trimmed sequence reads were mapped to GRCz11.109 use HISAT2 Read count extraction and normalization were performed using featureCounts and StringTie Assembly: GRCz11.109 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text files include FPKM values for each Sample | Brain | For transcriptomic analysis three biological replicates were prepared for both the 500 μg/L 6PPD treatment group and the DMSO control group. The embryos were treated from 10 hpf to 2dpf.For each replicate the heads of 150 embryos at 2 dpf were dissected flash frozen in liquid nitrogen. | Total RNA was isolated and purified using TRIzol reagent Invitrogen Carlsbad CA USA following the manufacturer's procedure. The RNA amount and purity of each sample was quantified using NanoDrop ND 1000 NanoDrop Wilmington DE USA. The RNA integrity was assessed by Bioanalyzer 2100 Agilent CA USA with RIN number >7.0 and confirmed by electrophoresis with denaturing agarose gel. Poly A RNA is purified from 1μg total RNA using Dynabeads Oligo dT25 61005 Thermo Fisher CA USA using two rounds of purification. Then the polyA RNA was fragmented into small pieces using Magnesium RNA Fragmentation Module NEB cat.e6150 USA under 94℃ 5 7min. Then the cleaved RNA fragments were reverse transcribed to create the cDNA by SuperScript™ II Reverse Transcriptase Invitrogen cat. 1896649 USA which were next used to synthesise U labeled second stranded DNAs with E. coli DNA polymerase I NEB cat.m0209 USA RNase H NEB cat.m0297 USA and dUTP Solution Thermo Fisher cat.R0133 USA). An A base is then added to the blunt ends of each strand preparing them for ligation to the indexed adapters. Each adapter contains a T base overhang for ligating the adapter to the A tailed fragmented DNA. Single or dual index adapters are ligated to the fragments and size selection was performed with AMPureXP beads. post the heat labile UDG enzyme NEB cat.m0280 USA treatment of the U labeled second stranded DNAs the ligated products are amplified with PCR by the following conditions: initial denaturation at 95℃ for 3 min; 8 cycles of denaturation at 98℃ for 15 sec annealing at 60℃ for 15 sec and extension at 72℃ for 30 sec; and then final extension at 72℃ for 5 min. The average insert size for the final cDNA library was 300±50 bp. At last we performed the 2×150bp paired end sequencing PE150 on an illumina Novaseq™ 6000 LC Bio Technology CO. Ltd. Hangzhou China following the vendor's recommended protocol. | Embryos were collected and cultured in egg water 0.06 mg/mL sea salt 0.5 mg/L methylene blue and incubated before 24 hpf at 28°C. To inhibit pigmentation embryos were treated with 0.003% 1 phenyl 2 thiourea PTU Aladdin starting at 24 hpf. | tissue:Brain|treatment:6PPD | GSM8582553 | GSM8582553: 6PPD 3; Danio rerio; RNA Seq | GSM8582553 r1 | GSM8582553 | 1 | Total RNA was isolated and purified using TRIzol reagent Invitrogen Carlsbad CA USA following the manufacturer's procedure. The RNA amount and purity of each sample was quantified using NanoDrop ND 1000 NanoDrop Wilmington DE USA. The RNA integrity was assessed by Bioanalyzer 2100 Agilent CA USA with RIN number >7.0 and confirmed by electrophoresis with denaturing agarose gel. Poly A RNA is purified from 1μg total RNA using Dynabeads Oligo dT25 61005 Thermo Fisher CA USA using two rounds of purification. Then the polyA RNA was fragmented into small pieces using Magnesium RNA Fragmentation Module NEB cat.e6150 USA under 94℃ 5 7min. Then the cleaved RNA fragments were reverse transcribed to create the cDNA by SuperScript™ II Reverse Transcriptase Invitrogen cat. 1896649 USA which were next used to synthesise U labeled second stranded DNAs with E. coli DNA polymerase I NEB cat.m0209 USA RNase H NEB cat.m0297 USA and dUTP Solution Thermo Fisher cat.R0133 USA). An A base is then added to the blunt ends of each strand preparing them for ligation to the indexed adapters. Each adapter contains a T base overhang for ligating the adapter to the A tailed fragmented DNA. Single or dual index adapters are ligated to the fragments and size selection was performed with AMPureXP beads. post the heat labile UDG enzyme NEB cat.m0280 USA treatment of the U labeled second stranded DNAs the ligated products are amplified with PCR by the following conditions: initial denaturation at 95℃ for 3 min; 8 cycles of denaturation at 98℃ for 15 sec annealing at 60℃ for 15 sec and extension at 72℃ for 30 sec; and then final extension at 72℃ for 5 min. The average insert size for the final cDNA library was 300±50 bp. At last we performed the 2×150bp paired end sequencing PE150 on an illumina Novaseq™ 6000 LC Bio Technology CO. Ltd. Hangzhou China following the vendor's recommended protocol. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539617 | 6PPD3head_Clean_Data1.fq.gz 6PPD3head_Clean_Data2.fq.gz | fastq fastq | 5643201065.0 | 19058349.0 | GSM8582553 r1 | SRX26432306 | SRS22949546 | SRA1994053 | Guizhou Medical University | Guizhou Medical University | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | China | 2024-10-19 | Multi-stage | Embryo | Brain | Nervous System | |||||||||||||||||||||||||||||||
| 34089 | 34089 | SRR31047784 | SRX26432305 | SRS22949545 | SRP539617 | PRJNA1175041 | 6PPD induces cerebrovascular defects by triggering oxidative stress and ferroptosis in zebrafish | GSE279887 | Transcriptome Analysis | N 1 3 dimethylbutyl N' phenyl p phenylenediamine 6PPD which is widely used as an antiozonant in rubber tires has recently got much attention for its acute aquatic toxicity. However the developmental toxicity of 6PPD in cerebrovascular network remains unknown. Here we investigated the effects of 6PPD exposure in cerebral vascular using the larvae of zebrafish. 6PPD would not affect the body length and shape of zebrafish larvae at the concentrations ranging from 20 µg/L to 1000 µg/L. 6PPD induced developmental defects in the brain in a concentration dependent manner. The trunk vascular development would not be affected while the cerebrovascular network was disrupted upon 6PPD exposure. 6PPD would trigger excessive Reactive Oxygen Species ROS in the brain indicating abnormal oxidative stress. Mechanistically brain specific transcriptome analysis showed that 6PPD could potentially cause the blockage of arachidonic acid AA metabolism related genes and the upregulation of ferroptosis related genes. Besides treatment with ferroptosis inhibitor N Acetyl L cysteine NAC attenuated oxidative damage and improved the construction of cerebrovascular network upon 6PPD exposure. Moreover using a human vascular endothelial cell line we further confirmed that 6PPD could trigger abnormal oxidative stress and defective expansion capacity implying the conserved toxicity cross species. These findings are useful for the elucidation of toxicity underlying 6PPD in cerebrovascular systems of both zebrafish and humans. Overall design: To investigate the effects of 6PPD on zebrafish development embryos were treated with 500 µg/L 6PPD from 10 hpf until 2 dpf dpf. For transcriptomic analysis three biological replicates were prepared for both the 6PPD treatment group and the DMSO control group. For each replicate the heads of 150 embryos at 2 dpf were dissected flash frozen in liquid nitrogen and sent for transcriptomic sequencing. The raw data analysis was performed to identify differentially expressed genes between the 6PPD tr… | 6PPD 2 | GSM8582552 | source name:Brain|tissue:Brain|treatment:6PPD|geo loc name:missing|collection date:missing | 6PPD 2 | Self house pipeline Sequence reads were trimmed for adaptor sequence/low quality seguence using fastp parameter Quality limit: 20 Trimmed sequence reads were mapped to GRCz11.109 use HISAT2 Read count extraction and normalization were performed using featureCounts and StringTie Assembly: GRCz11.109 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text files include FPKM values for each Sample | Brain | For transcriptomic analysis three biological replicates were prepared for both the 500 μg/L 6PPD treatment group and the DMSO control group. The embryos were treated from 10 hpf to 2dpf.For each replicate the heads of 150 embryos at 2 dpf were dissected flash frozen in liquid nitrogen. | Total RNA was isolated and purified using TRIzol reagent Invitrogen Carlsbad CA USA following the manufacturer's procedure. The RNA amount and purity of each sample was quantified using NanoDrop ND 1000 NanoDrop Wilmington DE USA. The RNA integrity was assessed by Bioanalyzer 2100 Agilent CA USA with RIN number >7.0 and confirmed by electrophoresis with denaturing agarose gel. Poly A RNA is purified from 1μg total RNA using Dynabeads Oligo dT25 61005 Thermo Fisher CA USA using two rounds of purification. Then the polyA RNA was fragmented into small pieces using Magnesium RNA Fragmentation Module NEB cat.e6150 USA under 94℃ 5 7min. Then the cleaved RNA fragments were reverse transcribed to create the cDNA by SuperScript™ II Reverse Transcriptase Invitrogen cat. 1896649 USA which were next used to synthesise U labeled second stranded DNAs with E. coli DNA polymerase I NEB cat.m0209 USA RNase H NEB cat.m0297 USA and dUTP Solution Thermo Fisher cat.R0133 USA). An A base is then added to the blunt ends of each strand preparing them for ligation to the indexed adapters. Each adapter contains a T base overhang for ligating the adapter to the A tailed fragmented DNA. Single or dual index adapters are ligated to the fragments and size selection was performed with AMPureXP beads. post the heat labile UDG enzyme NEB cat.m0280 USA treatment of the U labeled second stranded DNAs the ligated products are amplified with PCR by the following conditions: initial denaturation at 95℃ for 3 min; 8 cycles of denaturation at 98℃ for 15 sec annealing at 60℃ for 15 sec and extension at 72℃ for 30 sec; and then final extension at 72℃ for 5 min. The average insert size for the final cDNA library was 300±50 bp. At last we performed the 2×150bp paired end sequencing PE150 on an illumina Novaseq™ 6000 LC Bio Technology CO. Ltd. Hangzhou China following the vendor's recommended protocol. | Embryos were collected and cultured in egg water 0.06 mg/mL sea salt 0.5 mg/L methylene blue and incubated before 24 hpf at 28°C. To inhibit pigmentation embryos were treated with 0.003% 1 phenyl 2 thiourea PTU Aladdin starting at 24 hpf. | tissue:Brain|treatment:6PPD | GSM8582552 | GSM8582552: 6PPD 2; Danio rerio; RNA Seq | GSM8582552 r1 | GSM8582552 | 1 | Total RNA was isolated and purified using TRIzol reagent Invitrogen Carlsbad CA USA following the manufacturer's procedure. The RNA amount and purity of each sample was quantified using NanoDrop ND 1000 NanoDrop Wilmington DE USA. The RNA integrity was assessed by Bioanalyzer 2100 Agilent CA USA with RIN number >7.0 and confirmed by electrophoresis with denaturing agarose gel. Poly A RNA is purified from 1μg total RNA using Dynabeads Oligo dT25 61005 Thermo Fisher CA USA using two rounds of purification. Then the polyA RNA was fragmented into small pieces using Magnesium RNA Fragmentation Module NEB cat.e6150 USA under 94℃ 5 7min. Then the cleaved RNA fragments were reverse transcribed to create the cDNA by SuperScript™ II Reverse Transcriptase Invitrogen cat. 1896649 USA which were next used to synthesise U labeled second stranded DNAs with E. coli DNA polymerase I NEB cat.m0209 USA RNase H NEB cat.m0297 USA and dUTP Solution Thermo Fisher cat.R0133 USA). An A base is then added to the blunt ends of each strand preparing them for ligation to the indexed adapters. Each adapter contains a T base overhang for ligating the adapter to the A tailed fragmented DNA. Single or dual index adapters are ligated to the fragments and size selection was performed with AMPureXP beads. post the heat labile UDG enzyme NEB cat.m0280 USA treatment of the U labeled second stranded DNAs the ligated products are amplified with PCR by the following conditions: initial denaturation at 95℃ for 3 min; 8 cycles of denaturation at 98℃ for 15 sec annealing at 60℃ for 15 sec and extension at 72℃ for 30 sec; and then final extension at 72℃ for 5 min. The average insert size for the final cDNA library was 300±50 bp. At last we performed the 2×150bp paired end sequencing PE150 on an illumina Novaseq™ 6000 LC Bio Technology CO. Ltd. Hangzhou China following the vendor's recommended protocol. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539617 | 6PPD2head_Clean_Data1.fq.gz 6PPD2head_Clean_Data2.fq.gz | fastq fastq | 6184525960.0 | 20877930.0 | GSM8582552 r1 | SRX26432305 | SRS22949545 | SRA1994053 | Guizhou Medical University | Guizhou Medical University | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | China | 2024-10-19 | Multi-stage | Embryo | Brain | Nervous System | |||||||||||||||||||||||||||||||
| 34090 | 34090 | SRR31047785 | SRX26432304 | SRS22949544 | SRP539617 | PRJNA1175041 | 6PPD induces cerebrovascular defects by triggering oxidative stress and ferroptosis in zebrafish | GSE279887 | Transcriptome Analysis | N 1 3 dimethylbutyl N' phenyl p phenylenediamine 6PPD which is widely used as an antiozonant in rubber tires has recently got much attention for its acute aquatic toxicity. However the developmental toxicity of 6PPD in cerebrovascular network remains unknown. Here we investigated the effects of 6PPD exposure in cerebral vascular using the larvae of zebrafish. 6PPD would not affect the body length and shape of zebrafish larvae at the concentrations ranging from 20 µg/L to 1000 µg/L. 6PPD induced developmental defects in the brain in a concentration dependent manner. The trunk vascular development would not be affected while the cerebrovascular network was disrupted upon 6PPD exposure. 6PPD would trigger excessive Reactive Oxygen Species ROS in the brain indicating abnormal oxidative stress. Mechanistically brain specific transcriptome analysis showed that 6PPD could potentially cause the blockage of arachidonic acid AA metabolism related genes and the upregulation of ferroptosis related genes. Besides treatment with ferroptosis inhibitor N Acetyl L cysteine NAC attenuated oxidative damage and improved the construction of cerebrovascular network upon 6PPD exposure. Moreover using a human vascular endothelial cell line we further confirmed that 6PPD could trigger abnormal oxidative stress and defective expansion capacity implying the conserved toxicity cross species. These findings are useful for the elucidation of toxicity underlying 6PPD in cerebrovascular systems of both zebrafish and humans. Overall design: To investigate the effects of 6PPD on zebrafish development embryos were treated with 500 µg/L 6PPD from 10 hpf until 2 dpf dpf. For transcriptomic analysis three biological replicates were prepared for both the 6PPD treatment group and the DMSO control group. For each replicate the heads of 150 embryos at 2 dpf were dissected flash frozen in liquid nitrogen and sent for transcriptomic sequencing. The raw data analysis was performed to identify differentially expressed genes between the 6PPD tr… | 6PPD 1 | GSM8582551 | source name:Brain|tissue:Brain|treatment:6PPD|geo loc name:missing|collection date:missing | 6PPD 1 | Self house pipeline Sequence reads were trimmed for adaptor sequence/low quality seguence using fastp parameter Quality limit: 20 Trimmed sequence reads were mapped to GRCz11.109 use HISAT2 Read count extraction and normalization were performed using featureCounts and StringTie Assembly: GRCz11.109 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text files include FPKM values for each Sample | Brain | For transcriptomic analysis three biological replicates were prepared for both the 500 μg/L 6PPD treatment group and the DMSO control group. The embryos were treated from 10 hpf to 2dpf.For each replicate the heads of 150 embryos at 2 dpf were dissected flash frozen in liquid nitrogen. | Total RNA was isolated and purified using TRIzol reagent Invitrogen Carlsbad CA USA following the manufacturer's procedure. The RNA amount and purity of each sample was quantified using NanoDrop ND 1000 NanoDrop Wilmington DE USA. The RNA integrity was assessed by Bioanalyzer 2100 Agilent CA USA with RIN number >7.0 and confirmed by electrophoresis with denaturing agarose gel. Poly A RNA is purified from 1μg total RNA using Dynabeads Oligo dT25 61005 Thermo Fisher CA USA using two rounds of purification. Then the polyA RNA was fragmented into small pieces using Magnesium RNA Fragmentation Module NEB cat.e6150 USA under 94℃ 5 7min. Then the cleaved RNA fragments were reverse transcribed to create the cDNA by SuperScript™ II Reverse Transcriptase Invitrogen cat. 1896649 USA which were next used to synthesise U labeled second stranded DNAs with E. coli DNA polymerase I NEB cat.m0209 USA RNase H NEB cat.m0297 USA and dUTP Solution Thermo Fisher cat.R0133 USA). An A base is then added to the blunt ends of each strand preparing them for ligation to the indexed adapters. Each adapter contains a T base overhang for ligating the adapter to the A tailed fragmented DNA. Single or dual index adapters are ligated to the fragments and size selection was performed with AMPureXP beads. post the heat labile UDG enzyme NEB cat.m0280 USA treatment of the U labeled second stranded DNAs the ligated products are amplified with PCR by the following conditions: initial denaturation at 95℃ for 3 min; 8 cycles of denaturation at 98℃ for 15 sec annealing at 60℃ for 15 sec and extension at 72℃ for 30 sec; and then final extension at 72℃ for 5 min. The average insert size for the final cDNA library was 300±50 bp. At last we performed the 2×150bp paired end sequencing PE150 on an illumina Novaseq™ 6000 LC Bio Technology CO. Ltd. Hangzhou China following the vendor's recommended protocol. | Embryos were collected and cultured in egg water 0.06 mg/mL sea salt 0.5 mg/L methylene blue and incubated before 24 hpf at 28°C. To inhibit pigmentation embryos were treated with 0.003% 1 phenyl 2 thiourea PTU Aladdin starting at 24 hpf. | tissue:Brain|treatment:6PPD | GSM8582551 | GSM8582551: 6PPD 1; Danio rerio; RNA Seq | GSM8582551 r1 | GSM8582551 | 1 | Total RNA was isolated and purified using TRIzol reagent Invitrogen Carlsbad CA USA following the manufacturer's procedure. The RNA amount and purity of each sample was quantified using NanoDrop ND 1000 NanoDrop Wilmington DE USA. The RNA integrity was assessed by Bioanalyzer 2100 Agilent CA USA with RIN number >7.0 and confirmed by electrophoresis with denaturing agarose gel. Poly A RNA is purified from 1μg total RNA using Dynabeads Oligo dT25 61005 Thermo Fisher CA USA using two rounds of purification. Then the polyA RNA was fragmented into small pieces using Magnesium RNA Fragmentation Module NEB cat.e6150 USA under 94℃ 5 7min. Then the cleaved RNA fragments were reverse transcribed to create the cDNA by SuperScript™ II Reverse Transcriptase Invitrogen cat. 1896649 USA which were next used to synthesise U labeled second stranded DNAs with E. coli DNA polymerase I NEB cat.m0209 USA RNase H NEB cat.m0297 USA and dUTP Solution Thermo Fisher cat.R0133 USA). An A base is then added to the blunt ends of each strand preparing them for ligation to the indexed adapters. Each adapter contains a T base overhang for ligating the adapter to the A tailed fragmented DNA. Single or dual index adapters are ligated to the fragments and size selection was performed with AMPureXP beads. post the heat labile UDG enzyme NEB cat.m0280 USA treatment of the U labeled second stranded DNAs the ligated products are amplified with PCR by the following conditions: initial denaturation at 95℃ for 3 min; 8 cycles of denaturation at 98℃ for 15 sec annealing at 60℃ for 15 sec and extension at 72℃ for 30 sec; and then final extension at 72℃ for 5 min. The average insert size for the final cDNA library was 300±50 bp. At last we performed the 2×150bp paired end sequencing PE150 on an illumina Novaseq™ 6000 LC Bio Technology CO. Ltd. Hangzhou China following the vendor's recommended protocol. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539617 | 6PPD1head_Clean_Data1.fq.gz 6PPD1head_Clean_Data2.fq.gz | fastq fastq | 5412472152.0 | 18274114.0 | GSM8582551 r1 | SRX26432304 | SRS22949544 | SRA1994053 | Guizhou Medical University | Guizhou Medical University | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | China | 2024-10-19 | Multi-stage | Embryo | Brain | Nervous System | |||||||||||||||||||||||||||||||
| 34091 | 34091 | SRR31047786 | SRX26432303 | SRS22949543 | SRP539617 | PRJNA1175041 | 6PPD induces cerebrovascular defects by triggering oxidative stress and ferroptosis in zebrafish | GSE279887 | Transcriptome Analysis | N 1 3 dimethylbutyl N' phenyl p phenylenediamine 6PPD which is widely used as an antiozonant in rubber tires has recently got much attention for its acute aquatic toxicity. However the developmental toxicity of 6PPD in cerebrovascular network remains unknown. Here we investigated the effects of 6PPD exposure in cerebral vascular using the larvae of zebrafish. 6PPD would not affect the body length and shape of zebrafish larvae at the concentrations ranging from 20 µg/L to 1000 µg/L. 6PPD induced developmental defects in the brain in a concentration dependent manner. The trunk vascular development would not be affected while the cerebrovascular network was disrupted upon 6PPD exposure. 6PPD would trigger excessive Reactive Oxygen Species ROS in the brain indicating abnormal oxidative stress. Mechanistically brain specific transcriptome analysis showed that 6PPD could potentially cause the blockage of arachidonic acid AA metabolism related genes and the upregulation of ferroptosis related genes. Besides treatment with ferroptosis inhibitor N Acetyl L cysteine NAC attenuated oxidative damage and improved the construction of cerebrovascular network upon 6PPD exposure. Moreover using a human vascular endothelial cell line we further confirmed that 6PPD could trigger abnormal oxidative stress and defective expansion capacity implying the conserved toxicity cross species. These findings are useful for the elucidation of toxicity underlying 6PPD in cerebrovascular systems of both zebrafish and humans. Overall design: To investigate the effects of 6PPD on zebrafish development embryos were treated with 500 µg/L 6PPD from 10 hpf until 2 dpf dpf. For transcriptomic analysis three biological replicates were prepared for both the 6PPD treatment group and the DMSO control group. For each replicate the heads of 150 embryos at 2 dpf were dissected flash frozen in liquid nitrogen and sent for transcriptomic sequencing. The raw data analysis was performed to identify differentially expressed genes between the 6PPD tr… | Con 3 | GSM8582550 | source name:Brain|tissue:Brain|treatment:DMSO|geo loc name:missing|collection date:missing | Con 3 | Self house pipeline Sequence reads were trimmed for adaptor sequence/low quality seguence using fastp parameter Quality limit: 20 Trimmed sequence reads were mapped to GRCz11.109 use HISAT2 Read count extraction and normalization were performed using featureCounts and StringTie Assembly: GRCz11.109 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text files include FPKM values for each Sample | Brain | For transcriptomic analysis three biological replicates were prepared for both the 500 μg/L 6PPD treatment group and the DMSO control group. The embryos were treated from 10 hpf to 2dpf.For each replicate the heads of 150 embryos at 2 dpf were dissected flash frozen in liquid nitrogen. | Total RNA was isolated and purified using TRIzol reagent Invitrogen Carlsbad CA USA following the manufacturer's procedure. The RNA amount and purity of each sample was quantified using NanoDrop ND 1000 NanoDrop Wilmington DE USA. The RNA integrity was assessed by Bioanalyzer 2100 Agilent CA USA with RIN number >7.0 and confirmed by electrophoresis with denaturing agarose gel. Poly A RNA is purified from 1μg total RNA using Dynabeads Oligo dT25 61005 Thermo Fisher CA USA using two rounds of purification. Then the polyA RNA was fragmented into small pieces using Magnesium RNA Fragmentation Module NEB cat.e6150 USA under 94℃ 5 7min. Then the cleaved RNA fragments were reverse transcribed to create the cDNA by SuperScript™ II Reverse Transcriptase Invitrogen cat. 1896649 USA which were next used to synthesise U labeled second stranded DNAs with E. coli DNA polymerase I NEB cat.m0209 USA RNase H NEB cat.m0297 USA and dUTP Solution Thermo Fisher cat.R0133 USA). An A base is then added to the blunt ends of each strand preparing them for ligation to the indexed adapters. Each adapter contains a T base overhang for ligating the adapter to the A tailed fragmented DNA. Single or dual index adapters are ligated to the fragments and size selection was performed with AMPureXP beads. post the heat labile UDG enzyme NEB cat.m0280 USA treatment of the U labeled second stranded DNAs the ligated products are amplified with PCR by the following conditions: initial denaturation at 95℃ for 3 min; 8 cycles of denaturation at 98℃ for 15 sec annealing at 60℃ for 15 sec and extension at 72℃ for 30 sec; and then final extension at 72℃ for 5 min. The average insert size for the final cDNA library was 300±50 bp. At last we performed the 2×150bp paired end sequencing PE150 on an illumina Novaseq™ 6000 LC Bio Technology CO. Ltd. Hangzhou China following the vendor's recommended protocol. | Embryos were collected and cultured in egg water 0.06 mg/mL sea salt 0.5 mg/L methylene blue and incubated before 24 hpf at 28°C. To inhibit pigmentation embryos were treated with 0.003% 1 phenyl 2 thiourea PTU Aladdin starting at 24 hpf. | tissue:Brain|treatment:DMSO | GSM8582550 | GSM8582550: Con 3; Danio rerio; RNA Seq | GSM8582550 r1 | GSM8582550 | 1 | Total RNA was isolated and purified using TRIzol reagent Invitrogen Carlsbad CA USA following the manufacturer's procedure. The RNA amount and purity of each sample was quantified using NanoDrop ND 1000 NanoDrop Wilmington DE USA. The RNA integrity was assessed by Bioanalyzer 2100 Agilent CA USA with RIN number >7.0 and confirmed by electrophoresis with denaturing agarose gel. Poly A RNA is purified from 1μg total RNA using Dynabeads Oligo dT25 61005 Thermo Fisher CA USA using two rounds of purification. Then the polyA RNA was fragmented into small pieces using Magnesium RNA Fragmentation Module NEB cat.e6150 USA under 94℃ 5 7min. Then the cleaved RNA fragments were reverse transcribed to create the cDNA by SuperScript™ II Reverse Transcriptase Invitrogen cat. 1896649 USA which were next used to synthesise U labeled second stranded DNAs with E. coli DNA polymerase I NEB cat.m0209 USA RNase H NEB cat.m0297 USA and dUTP Solution Thermo Fisher cat.R0133 USA). An A base is then added to the blunt ends of each strand preparing them for ligation to the indexed adapters. Each adapter contains a T base overhang for ligating the adapter to the A tailed fragmented DNA. Single or dual index adapters are ligated to the fragments and size selection was performed with AMPureXP beads. post the heat labile UDG enzyme NEB cat.m0280 USA treatment of the U labeled second stranded DNAs the ligated products are amplified with PCR by the following conditions: initial denaturation at 95℃ for 3 min; 8 cycles of denaturation at 98℃ for 15 sec annealing at 60℃ for 15 sec and extension at 72℃ for 30 sec; and then final extension at 72℃ for 5 min. The average insert size for the final cDNA library was 300±50 bp. At last we performed the 2×150bp paired end sequencing PE150 on an illumina Novaseq™ 6000 LC Bio Technology CO. Ltd. Hangzhou China following the vendor's recommended protocol. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539617 | Con3head_Clean_Data1.fq.gz Con3head_Clean_Data2.fq.gz | fastq fastq | 6118959402.0 | 20641047.0 | GSM8582550 r1 | SRX26432303 | SRS22949543 | SRA1994053 | Guizhou Medical University | Guizhou Medical University | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | China | 2024-10-19 | Multi-stage | Embryo | Brain | Nervous System | |||||||||||||||||||||||||||||||
| 34092 | 34092 | SRR31047787 | SRX26432302 | SRS22949542 | SRP539617 | PRJNA1175041 | 6PPD induces cerebrovascular defects by triggering oxidative stress and ferroptosis in zebrafish | GSE279887 | Transcriptome Analysis | N 1 3 dimethylbutyl N' phenyl p phenylenediamine 6PPD which is widely used as an antiozonant in rubber tires has recently got much attention for its acute aquatic toxicity. However the developmental toxicity of 6PPD in cerebrovascular network remains unknown. Here we investigated the effects of 6PPD exposure in cerebral vascular using the larvae of zebrafish. 6PPD would not affect the body length and shape of zebrafish larvae at the concentrations ranging from 20 µg/L to 1000 µg/L. 6PPD induced developmental defects in the brain in a concentration dependent manner. The trunk vascular development would not be affected while the cerebrovascular network was disrupted upon 6PPD exposure. 6PPD would trigger excessive Reactive Oxygen Species ROS in the brain indicating abnormal oxidative stress. Mechanistically brain specific transcriptome analysis showed that 6PPD could potentially cause the blockage of arachidonic acid AA metabolism related genes and the upregulation of ferroptosis related genes. Besides treatment with ferroptosis inhibitor N Acetyl L cysteine NAC attenuated oxidative damage and improved the construction of cerebrovascular network upon 6PPD exposure. Moreover using a human vascular endothelial cell line we further confirmed that 6PPD could trigger abnormal oxidative stress and defective expansion capacity implying the conserved toxicity cross species. These findings are useful for the elucidation of toxicity underlying 6PPD in cerebrovascular systems of both zebrafish and humans. Overall design: To investigate the effects of 6PPD on zebrafish development embryos were treated with 500 µg/L 6PPD from 10 hpf until 2 dpf dpf. For transcriptomic analysis three biological replicates were prepared for both the 6PPD treatment group and the DMSO control group. For each replicate the heads of 150 embryos at 2 dpf were dissected flash frozen in liquid nitrogen and sent for transcriptomic sequencing. The raw data analysis was performed to identify differentially expressed genes between the 6PPD tr… | Con 2 | GSM8582549 | source name:Brain|tissue:Brain|treatment:DMSO|geo loc name:missing|collection date:missing | Con 2 | Self house pipeline Sequence reads were trimmed for adaptor sequence/low quality seguence using fastp parameter Quality limit: 20 Trimmed sequence reads were mapped to GRCz11.109 use HISAT2 Read count extraction and normalization were performed using featureCounts and StringTie Assembly: GRCz11.109 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text files include FPKM values for each Sample | Brain | For transcriptomic analysis three biological replicates were prepared for both the 500 μg/L 6PPD treatment group and the DMSO control group. The embryos were treated from 10 hpf to 2dpf.For each replicate the heads of 150 embryos at 2 dpf were dissected flash frozen in liquid nitrogen. | Total RNA was isolated and purified using TRIzol reagent Invitrogen Carlsbad CA USA following the manufacturer's procedure. The RNA amount and purity of each sample was quantified using NanoDrop ND 1000 NanoDrop Wilmington DE USA. The RNA integrity was assessed by Bioanalyzer 2100 Agilent CA USA with RIN number >7.0 and confirmed by electrophoresis with denaturing agarose gel. Poly A RNA is purified from 1μg total RNA using Dynabeads Oligo dT25 61005 Thermo Fisher CA USA using two rounds of purification. Then the polyA RNA was fragmented into small pieces using Magnesium RNA Fragmentation Module NEB cat.e6150 USA under 94℃ 5 7min. Then the cleaved RNA fragments were reverse transcribed to create the cDNA by SuperScript™ II Reverse Transcriptase Invitrogen cat. 1896649 USA which were next used to synthesise U labeled second stranded DNAs with E. coli DNA polymerase I NEB cat.m0209 USA RNase H NEB cat.m0297 USA and dUTP Solution Thermo Fisher cat.R0133 USA). An A base is then added to the blunt ends of each strand preparing them for ligation to the indexed adapters. Each adapter contains a T base overhang for ligating the adapter to the A tailed fragmented DNA. Single or dual index adapters are ligated to the fragments and size selection was performed with AMPureXP beads. post the heat labile UDG enzyme NEB cat.m0280 USA treatment of the U labeled second stranded DNAs the ligated products are amplified with PCR by the following conditions: initial denaturation at 95℃ for 3 min; 8 cycles of denaturation at 98℃ for 15 sec annealing at 60℃ for 15 sec and extension at 72℃ for 30 sec; and then final extension at 72℃ for 5 min. The average insert size for the final cDNA library was 300±50 bp. At last we performed the 2×150bp paired end sequencing PE150 on an illumina Novaseq™ 6000 LC Bio Technology CO. Ltd. Hangzhou China following the vendor's recommended protocol. | Embryos were collected and cultured in egg water 0.06 mg/mL sea salt 0.5 mg/L methylene blue and incubated before 24 hpf at 28°C. To inhibit pigmentation embryos were treated with 0.003% 1 phenyl 2 thiourea PTU Aladdin starting at 24 hpf. | tissue:Brain|treatment:DMSO | GSM8582549 | GSM8582549: Con 2; Danio rerio; RNA Seq | GSM8582549 r1 | GSM8582549 | 1 | Total RNA was isolated and purified using TRIzol reagent Invitrogen Carlsbad CA USA following the manufacturer's procedure. The RNA amount and purity of each sample was quantified using NanoDrop ND 1000 NanoDrop Wilmington DE USA. The RNA integrity was assessed by Bioanalyzer 2100 Agilent CA USA with RIN number >7.0 and confirmed by electrophoresis with denaturing agarose gel. Poly A RNA is purified from 1μg total RNA using Dynabeads Oligo dT25 61005 Thermo Fisher CA USA using two rounds of purification. Then the polyA RNA was fragmented into small pieces using Magnesium RNA Fragmentation Module NEB cat.e6150 USA under 94℃ 5 7min. Then the cleaved RNA fragments were reverse transcribed to create the cDNA by SuperScript™ II Reverse Transcriptase Invitrogen cat. 1896649 USA which were next used to synthesise U labeled second stranded DNAs with E. coli DNA polymerase I NEB cat.m0209 USA RNase H NEB cat.m0297 USA and dUTP Solution Thermo Fisher cat.R0133 USA). An A base is then added to the blunt ends of each strand preparing them for ligation to the indexed adapters. Each adapter contains a T base overhang for ligating the adapter to the A tailed fragmented DNA. Single or dual index adapters are ligated to the fragments and size selection was performed with AMPureXP beads. post the heat labile UDG enzyme NEB cat.m0280 USA treatment of the U labeled second stranded DNAs the ligated products are amplified with PCR by the following conditions: initial denaturation at 95℃ for 3 min; 8 cycles of denaturation at 98℃ for 15 sec annealing at 60℃ for 15 sec and extension at 72℃ for 30 sec; and then final extension at 72℃ for 5 min. The average insert size for the final cDNA library was 300±50 bp. At last we performed the 2×150bp paired end sequencing PE150 on an illumina Novaseq™ 6000 LC Bio Technology CO. Ltd. Hangzhou China following the vendor's recommended protocol. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539617 | Con2head_Clean_Data1.fq.gz Con2head_Clean_Data2.fq.gz | fastq fastq | 5778620515.0 | 19519984.0 | GSM8582549 r1 | SRX26432302 | SRS22949542 | SRA1994053 | Guizhou Medical University | Guizhou Medical University | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | China | 2024-10-19 | Multi-stage | Embryo | Brain | Nervous System | |||||||||||||||||||||||||||||||
| 34093 | 34093 | SRR31047788 | SRX26432301 | SRS22949541 | SRP539617 | PRJNA1175041 | 6PPD induces cerebrovascular defects by triggering oxidative stress and ferroptosis in zebrafish | GSE279887 | Transcriptome Analysis | N 1 3 dimethylbutyl N' phenyl p phenylenediamine 6PPD which is widely used as an antiozonant in rubber tires has recently got much attention for its acute aquatic toxicity. However the developmental toxicity of 6PPD in cerebrovascular network remains unknown. Here we investigated the effects of 6PPD exposure in cerebral vascular using the larvae of zebrafish. 6PPD would not affect the body length and shape of zebrafish larvae at the concentrations ranging from 20 µg/L to 1000 µg/L. 6PPD induced developmental defects in the brain in a concentration dependent manner. The trunk vascular development would not be affected while the cerebrovascular network was disrupted upon 6PPD exposure. 6PPD would trigger excessive Reactive Oxygen Species ROS in the brain indicating abnormal oxidative stress. Mechanistically brain specific transcriptome analysis showed that 6PPD could potentially cause the blockage of arachidonic acid AA metabolism related genes and the upregulation of ferroptosis related genes. Besides treatment with ferroptosis inhibitor N Acetyl L cysteine NAC attenuated oxidative damage and improved the construction of cerebrovascular network upon 6PPD exposure. Moreover using a human vascular endothelial cell line we further confirmed that 6PPD could trigger abnormal oxidative stress and defective expansion capacity implying the conserved toxicity cross species. These findings are useful for the elucidation of toxicity underlying 6PPD in cerebrovascular systems of both zebrafish and humans. Overall design: To investigate the effects of 6PPD on zebrafish development embryos were treated with 500 µg/L 6PPD from 10 hpf until 2 dpf dpf. For transcriptomic analysis three biological replicates were prepared for both the 6PPD treatment group and the DMSO control group. For each replicate the heads of 150 embryos at 2 dpf were dissected flash frozen in liquid nitrogen and sent for transcriptomic sequencing. The raw data analysis was performed to identify differentially expressed genes between the 6PPD tr… | Con 1 | GSM8582548 | source name:Brain|tissue:Brain|treatment:DMSO|geo loc name:missing|collection date:missing | Con 1 | Self house pipeline Sequence reads were trimmed for adaptor sequence/low quality seguence using fastp parameter Quality limit: 20 Trimmed sequence reads were mapped to GRCz11.109 use HISAT2 Read count extraction and normalization were performed using featureCounts and StringTie Assembly: GRCz11.109 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text files include FPKM values for each Sample | Brain | For transcriptomic analysis three biological replicates were prepared for both the 500 μg/L 6PPD treatment group and the DMSO control group. The embryos were treated from 10 hpf to 2dpf.For each replicate the heads of 150 embryos at 2 dpf were dissected flash frozen in liquid nitrogen. | Total RNA was isolated and purified using TRIzol reagent Invitrogen Carlsbad CA USA following the manufacturer's procedure. The RNA amount and purity of each sample was quantified using NanoDrop ND 1000 NanoDrop Wilmington DE USA. The RNA integrity was assessed by Bioanalyzer 2100 Agilent CA USA with RIN number >7.0 and confirmed by electrophoresis with denaturing agarose gel. Poly A RNA is purified from 1μg total RNA using Dynabeads Oligo dT25 61005 Thermo Fisher CA USA using two rounds of purification. Then the polyA RNA was fragmented into small pieces using Magnesium RNA Fragmentation Module NEB cat.e6150 USA under 94℃ 5 7min. Then the cleaved RNA fragments were reverse transcribed to create the cDNA by SuperScript™ II Reverse Transcriptase Invitrogen cat. 1896649 USA which were next used to synthesise U labeled second stranded DNAs with E. coli DNA polymerase I NEB cat.m0209 USA RNase H NEB cat.m0297 USA and dUTP Solution Thermo Fisher cat.R0133 USA). An A base is then added to the blunt ends of each strand preparing them for ligation to the indexed adapters. Each adapter contains a T base overhang for ligating the adapter to the A tailed fragmented DNA. Single or dual index adapters are ligated to the fragments and size selection was performed with AMPureXP beads. post the heat labile UDG enzyme NEB cat.m0280 USA treatment of the U labeled second stranded DNAs the ligated products are amplified with PCR by the following conditions: initial denaturation at 95℃ for 3 min; 8 cycles of denaturation at 98℃ for 15 sec annealing at 60℃ for 15 sec and extension at 72℃ for 30 sec; and then final extension at 72℃ for 5 min. The average insert size for the final cDNA library was 300±50 bp. At last we performed the 2×150bp paired end sequencing PE150 on an illumina Novaseq™ 6000 LC Bio Technology CO. Ltd. Hangzhou China following the vendor's recommended protocol. | Embryos were collected and cultured in egg water 0.06 mg/mL sea salt 0.5 mg/L methylene blue and incubated before 24 hpf at 28°C. To inhibit pigmentation embryos were treated with 0.003% 1 phenyl 2 thiourea PTU Aladdin starting at 24 hpf. | tissue:Brain|treatment:DMSO | GSM8582548 | GSM8582548: Con 1; Danio rerio; RNA Seq | GSM8582548 r1 | GSM8582548 | 1 | Total RNA was isolated and purified using TRIzol reagent Invitrogen Carlsbad CA USA following the manufacturer's procedure. The RNA amount and purity of each sample was quantified using NanoDrop ND 1000 NanoDrop Wilmington DE USA. The RNA integrity was assessed by Bioanalyzer 2100 Agilent CA USA with RIN number >7.0 and confirmed by electrophoresis with denaturing agarose gel. Poly A RNA is purified from 1μg total RNA using Dynabeads Oligo dT25 61005 Thermo Fisher CA USA using two rounds of purification. Then the polyA RNA was fragmented into small pieces using Magnesium RNA Fragmentation Module NEB cat.e6150 USA under 94℃ 5 7min. Then the cleaved RNA fragments were reverse transcribed to create the cDNA by SuperScript™ II Reverse Transcriptase Invitrogen cat. 1896649 USA which were next used to synthesise U labeled second stranded DNAs with E. coli DNA polymerase I NEB cat.m0209 USA RNase H NEB cat.m0297 USA and dUTP Solution Thermo Fisher cat.R0133 USA). An A base is then added to the blunt ends of each strand preparing them for ligation to the indexed adapters. Each adapter contains a T base overhang for ligating the adapter to the A tailed fragmented DNA. Single or dual index adapters are ligated to the fragments and size selection was performed with AMPureXP beads. post the heat labile UDG enzyme NEB cat.m0280 USA treatment of the U labeled second stranded DNAs the ligated products are amplified with PCR by the following conditions: initial denaturation at 95℃ for 3 min; 8 cycles of denaturation at 98℃ for 15 sec annealing at 60℃ for 15 sec and extension at 72℃ for 30 sec; and then final extension at 72℃ for 5 min. The average insert size for the final cDNA library was 300±50 bp. At last we performed the 2×150bp paired end sequencing PE150 on an illumina Novaseq™ 6000 LC Bio Technology CO. Ltd. Hangzhou China following the vendor's recommended protocol. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539617 | Con1head_Clean_Data1.fq.gz Con1head_Clean_Data2.fq.gz | fastq fastq | 5538973366.0 | 18707123.0 | GSM8582548 r1 | SRX26432301 | SRS22949541 | SRA1994053 | Guizhou Medical University | Guizhou Medical University | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | China | 2024-10-19 | Multi-stage | Embryo | Brain | Nervous System |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;