RNAquarium Metadata Server
Institute Website Terms of Use Privacy Policy

run_metadata

693 rows where devstage_curation_coarse = "Embryo" and tissue_curation_coarse = "Cardiovascular System"

✎ View and edit SQL

This data as json, CSV (advanced)

technology 7

devstage_curation 6

experiment.library_selection 4

experiment.library_strategy 3

tissue_curation 2

experiment.library_source 2

experiment.library_layout 2

tissue_curation_coarse 1

  • Cardiovascular System · 693 ✖

experiment.platform 1

devstage_curation_coarse 1

  • Embryo · 693 ✖
Link rowid ▼ run.accession experiment.accession sample.accession study.accession bioproject study.title study.alias study.type study.abstract study.attributes study.PMIDs sample.description sample.title sample.alias sample.centername sample.attributes GEOsample.title GEOsample.dataprocessing GEOsample.source GEOsample.treatmentprotocol GEOsample.extractprotocol GEOsample.growthprotocol GEOsample.characteristics GEOsample.accession experiment.title experiment.alias experiment.library_name experiment.design_description experiment.library_construction_protocol experiment.attributes experiment.library_strategy experiment.library_source experiment.library_selection experiment.library_layout experiment.platform experiment.instrument_model experiment.spot_descriptor experiment.study_ref run.title run.attributes run.filename run.semantic_name run.total_bases run.total_spots run.alias run.read_lengths run.base_counts run.r1_length run.r2_length run.r3_length run.r4_length run.Acount run.Ccount run.Gcount run.Tcount run.Ncount run.experiment run.pool_member submission.accession submission.srasource submission.bioprojectsource seqdetective.n_mates seqdetective.mapping_rate.mate1 seqdetective.mapping_rate.mate2 seqdetective.nofeature_rate.mate1 seqdetective.nofeature_rate.mate2 seqdetective.sparsity.mate1 seqdetective.sparsity.mate2 seqdetective.pos_strand_rate.mate1 seqdetective.pos_strand_rate.mate2 seqdetective.readlen.mate1 seqdetective.readlen.mate2 seqdetective.judgement.mate1 seqdetective.judgement.mate2 seqdetective.judgement.reason platform_family instrument_generation read_bias selection_class prep_kit sc_or_bulk tech_class technology tech_variant submission.bioprojectsource.country earliest_date devstage_curation devstage_curation_coarse tissue_curation tissue_curation_coarse
25170 25170 SRR25661605 SRX21387413 SRS18627977 SRP455520 PRJNA1006302 The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes GSE241049 Transcriptome Analysis To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.   pubmed:39658721   hand2 FLD+/? 20 hpf CMs rep3 GSM7714404   source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 mutants|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing hand2 FLD+/? 20 hpf CMs rep3 Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts embryonic heart   miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 mutants|treatment:sorted cells by FACS GSM7714404 GSM7714404: hand2 FLD+/? 20 hpf CMs rep3; Danio rerio; RNA Seq GSM7714404 r1 GSM7714404 1 miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 2000   SRP455520   loader:fastq load.py E22_3458_Yanli_HT_Lib_WT_het_3_R1.fastq.gz fastq 2441736984.0 34141777.0 GSM7714404 r1 0:71.52 A:706186414;C:496261994;G:526176364;T:713112212;N:0 71       706186414 496261994 526176364 713112212 0 SRX21387413 SRS18627977 SRA1694205 MPI for heart and lung research MPI for heart and lung research 1 0.9026   0.15816   0.76278   0.44042   72   B   usable mapping rate illumina nextseq_v2 unknown cdna_unspecified unknown bulk unknown unknown   Germany 2023-08-17 Segmentation Embryo Heart Cardiovascular System
25171 25171 SRR25661606 SRX21387412 SRS18627976 SRP455520 PRJNA1006302 The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes GSE241049 Transcriptome Analysis To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.   pubmed:39658721   hand2 FLD+/? 20 hpf CMs rep2 GSM7714403   source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 mutants|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing hand2 FLD+/? 20 hpf CMs rep2 Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts embryonic heart   miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 mutants|treatment:sorted cells by FACS GSM7714403 GSM7714403: hand2 FLD+/? 20 hpf CMs rep2; Danio rerio; RNA Seq GSM7714403 r1 GSM7714403 1 miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 2000   SRP455520   loader:fastq load.py E22_3458_Yanli_HT_Lib_WT_het_2_R1.fastq.gz fastq 2185611269.0 30558084.0 GSM7714403 r1 0:71.52 A:612617675;C:458632518;G:474458738;T:639902338;N:0 71       612617675 458632518 474458738 639902338 0 SRX21387412 SRS18627976 SRA1694205 MPI for heart and lung research MPI for heart and lung research 1 0.90042   0.14005   0.75424   0.44277   72   B   usable mapping rate illumina nextseq_v2 unknown cdna_unspecified unknown bulk unknown unknown   Germany 2023-08-17 Segmentation Embryo Heart Cardiovascular System
25172 25172 SRR25661607 SRX21387411 SRS18627975 SRP455520 PRJNA1006302 The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes GSE241049 Transcriptome Analysis To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.   pubmed:39658721   hand2 FLD+/? 20 hpf CMs rep1 GSM7714402   source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 mutants|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing hand2 FLD+/? 20 hpf CMs rep1 Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts embryonic heart   miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 mutants|treatment:sorted cells by FACS GSM7714402 GSM7714402: hand2 FLD+/? 20 hpf CMs rep1; Danio rerio; RNA Seq GSM7714402 r1 GSM7714402 1 miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 2000   SRP455520   loader:fastq load.py E22_3458_Yanli_HT_Lib_WT_het_1_R1.fastq.gz fastq 2291884894.0 32043147.0 GSM7714402 r1 0:71.52 A:635094975;C:489594953;G:499909828;T:667285138;N:0 71       635094975 489594953 499909828 667285138 0 SRX21387411 SRS18627975 SRA1694205 MPI for heart and lung research MPI for heart and lung research 1 0.90883   0.14288   0.75331   0.44459   71   B   usable mapping rate illumina nextseq_v2 unknown cdna_unspecified unknown bulk unknown unknown   Germany 2023-08-17 Segmentation Embryo Heart Cardiovascular System
25173 25173 SRR25661608 SRX21387410 SRS18627974 SRP455520 PRJNA1006302 The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes GSE241049 Transcriptome Analysis To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.   pubmed:39658721   WT 20 hpf CMs rep3 GSM7714401   source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 OE|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing WT 20 hpf CMs rep3 Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts embryonic heart   miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 OE|treatment:sorted cells by FACS GSM7714401 GSM7714401: WT 20 hpf CMs rep3; Danio rerio; RNA Seq GSM7714401 r1 GSM7714401 1 miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 2000   SRP455520   loader:fastq load.py E22_3458_Yanli_HT_Lib_WT_CMs_3_R1.fastq.gz fastq 2268251602.0 31717610.0 GSM7714401 r1 0:71.51 A:637196241;C:477782543;G:497683941;T:655588877;N:0 71       637196241 477782543 497683941 655588877 0 SRX21387410 SRS18627974 SRA1694205 MPI for heart and lung research MPI for heart and lung research 1 0.90026   0.13291   0.78707   0.40811   71   B   usable mapping rate illumina nextseq_v2 unknown cdna_unspecified unknown bulk unknown unknown   Germany 2023-08-17 Segmentation Embryo Heart Cardiovascular System
25174 25174 SRR25661609 SRX21387409 SRS18627973 SRP455520 PRJNA1006302 The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes GSE241049 Transcriptome Analysis To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.   pubmed:39658721   WT 20 hpf CMs rep2 GSM7714400   source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 OE|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing WT 20 hpf CMs rep2 Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts embryonic heart   miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 OE|treatment:sorted cells by FACS GSM7714400 GSM7714400: WT 20 hpf CMs rep2; Danio rerio; RNA Seq GSM7714400 r1 GSM7714400 1 miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 2000   SRP455520   loader:fastq load.py E22_3458_Yanli_HT_Lib_WT_CMs_2_R1.fastq.gz fastq 2195524610.0 30700033.0 GSM7714400 r1 0:71.52 A:615401741;C:462686936;G:481135567;T:636300366;N:0 71       615401741 462686936 481135567 636300366 0 SRX21387409 SRS18627973 SRA1694205 MPI for heart and lung research MPI for heart and lung research 1 0.90323   0.1476   0.78744   0.41728   72   B   usable mapping rate illumina nextseq_v2 unknown cdna_unspecified unknown bulk unknown unknown   Germany 2023-08-17 Segmentation Embryo Heart Cardiovascular System
25175 25175 SRR25661610 SRX21387408 SRS18627972 SRP455520 PRJNA1006302 The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes GSE241049 Transcriptome Analysis To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.   pubmed:39658721   WT 20 hpf CMs rep1 GSM7714399   source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 OE|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing WT 20 hpf CMs rep1 Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts embryonic heart   miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 OE|treatment:sorted cells by FACS GSM7714399 GSM7714399: WT 20 hpf CMs rep1; Danio rerio; RNA Seq GSM7714399 r1 GSM7714399 1 miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 2000   SRP455520   loader:fastq load.py E22_3458_Yanli_HT_Lib_WT_CMs_1_R1.fastq.gz fastq 2258160684.0 31576661.0 GSM7714399 r1 0:71.51 A:641254288;C:471580136;G:491501482;T:653824778;N:0 71       641254288 471580136 491501482 653824778 0 SRX21387408 SRS18627972 SRA1694205 MPI for heart and lung research MPI for heart and lung research 1 0.9   0.13993   0.78445   0.40575   72   B   usable mapping rate illumina nextseq_v2 unknown cdna_unspecified unknown bulk unknown unknown   Germany 2023-08-17 Segmentation Embryo Heart Cardiovascular System
25176 25176 SRR25661611 SRX21387407 SRS18627971 SRP455520 PRJNA1006302 The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes GSE241049 Transcriptome Analysis To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.   pubmed:39658721   hand2 OE 20 hpf CMs rep3 GSM7714398   source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:overexpression hand2 in myocardium|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing hand2 OE 20 hpf CMs rep3 Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts embryonic heart   miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   tissue:embryonic heart|cell type:cardiomyocytes|genotype:overexpression hand2 in myocardium|treatment:sorted cells by FACS GSM7714398 GSM7714398: hand2 OE 20 hpf CMs rep3; Danio rerio; RNA Seq GSM7714398 r1 GSM7714398 1 miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 2000   SRP455520   loader:fastq load.py E22_3458_Yanli_HT_Lib_OE_CMs_3_R1.fastq.gz fastq 1886569909.0 26380170.0 GSM7714398 r1 0:71.51 A:534874421;C:392168718;G:411533838;T:547992932;N:0 71       534874421 392168718 411533838 547992932 0 SRX21387407 SRS18627971 SRA1694205 MPI for heart and lung research MPI for heart and lung research 1 0.89968   0.14763   0.77881   0.42601   72   B   usable mapping rate illumina nextseq_v2 unknown cdna_unspecified unknown bulk unknown unknown   Germany 2023-08-17 Segmentation Embryo Heart Cardiovascular System
25177 25177 SRR25661612 SRX21387406 SRS18627970 SRP455520 PRJNA1006302 The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes GSE241049 Transcriptome Analysis To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.   pubmed:39658721   hand2 OE 20 hpf CMs rep2 GSM7714397   source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:overexpression hand2 in myocardium|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing hand2 OE 20 hpf CMs rep2 Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts embryonic heart   miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   tissue:embryonic heart|cell type:cardiomyocytes|genotype:overexpression hand2 in myocardium|treatment:sorted cells by FACS GSM7714397 GSM7714397: hand2 OE 20 hpf CMs rep2; Danio rerio; RNA Seq GSM7714397 r1 GSM7714397 1 miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 2000   SRP455520   loader:fastq load.py E22_3458_Yanli_HT_Lib_OE_CMs_2_R1.fastq.gz fastq 2197151812.0 30722639.0 GSM7714397 r1 0:71.52 A:617116635;C:461951919;G:481371246;T:636712012;N:0 71       617116635 461951919 481371246 636712012 0 SRX21387406 SRS18627970 SRA1694205 MPI for heart and lung research MPI for heart and lung research 1 0.90877   0.14744   0.77191   0.42845   72   B   usable mapping rate illumina nextseq_v2 unknown cdna_unspecified unknown bulk unknown unknown   Germany 2023-08-17 Segmentation Embryo Heart Cardiovascular System
25178 25178 SRR25661613 SRX21387405 SRS18627969 SRP455520 PRJNA1006302 The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes GSE241049 Transcriptome Analysis To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.   pubmed:39658721   hand2 OE 20 hpf CMs rep1 GSM7714396   source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:overexpression hand2 in myocardium|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing hand2 OE 20 hpf CMs rep1 Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts embryonic heart   miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   tissue:embryonic heart|cell type:cardiomyocytes|genotype:overexpression hand2 in myocardium|treatment:sorted cells by FACS GSM7714396 GSM7714396: hand2 OE 20 hpf CMs rep1; Danio rerio; RNA Seq GSM7714396 r1 GSM7714396 1 miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 2000   SRP455520   loader:fastq load.py E22_3458_Yanli_HT_Lib_OE_CMs_1_R1.fastq.gz fastq 1773398936.0 24797998.0 GSM7714396 r1 0:71.51 A:495618212;C:375438077;G:390377060;T:511965587;N:0 71       495618212 375438077 390377060 511965587 0 SRX21387405 SRS18627969 SRA1694205 MPI for heart and lung research MPI for heart and lung research 1 0.90769   0.1387   0.7768   0.42096   72   B   usable mapping rate illumina nextseq_v2 unknown cdna_unspecified unknown bulk unknown unknown   Germany 2023-08-17 Segmentation Embryo Heart Cardiovascular System
25179 25179 SRR25661614 SRX21387404 SRS18627968 SRP455520 PRJNA1006302 The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes GSE241049 Transcriptome Analysis To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.   pubmed:39658721   hand2 FLD / 20 hpf CMs rep3 GSM7714395   source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:hand2 mutant|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing hand2 FLD / 20 hpf CMs rep3 Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts embryonic heart   miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   tissue:embryonic heart|cell type:cardiomyocytes|genotype:hand2 mutant|treatment:sorted cells by FACS GSM7714395 GSM7714395: hand2 FLD / 20 hpf CMs rep3; Danio rerio; RNA Seq GSM7714395 r1 GSM7714395 1 miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 2000   SRP455520   loader:fastq load.py E22_3458_Yanli_HT_Lib_Mut_3_R1.fastq.gz fastq 2179400259.0 30471965.0 GSM7714395 r1 0:71.52 A:600555691;C:468535203;G:483122661;T:627186704;N:0 71       600555691 468535203 483122661 627186704 0 SRX21387404 SRS18627968 SRA1694205 MPI for heart and lung research MPI for heart and lung research 1 0.91581   0.12256   0.75209   0.43413   71   B   usable mapping rate illumina nextseq_v2 unknown cdna_unspecified unknown bulk unknown unknown   Germany 2023-08-17 Segmentation Embryo Heart Cardiovascular System
25180 25180 SRR25661615 SRX21387403 SRS18627967 SRP455520 PRJNA1006302 The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes GSE241049 Transcriptome Analysis To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.   pubmed:39658721   hand2 FLD / 20 hpf CMs rep2 GSM7714394   source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:hand2 mutant|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing hand2 FLD / 20 hpf CMs rep2 Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts embryonic heart   miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   tissue:embryonic heart|cell type:cardiomyocytes|genotype:hand2 mutant|treatment:sorted cells by FACS GSM7714394 GSM7714394: hand2 FLD / 20 hpf CMs rep2; Danio rerio; RNA Seq GSM7714394 r1 GSM7714394 1 miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 2000   SRP455520   loader:fastq load.py E22_3458_Yanli_HT_Lib_Mut_2_R1.fastq.gz fastq 2340991168.0 32733068.0 GSM7714394 r1 0:71.52 A:647423337;C:500120073;G:514803152;T:678644606;N:0 71       647423337 500120073 514803152 678644606 0 SRX21387403 SRS18627967 SRA1694205 MPI for heart and lung research MPI for heart and lung research 1 0.91231   0.12561   0.75118   0.44445   71   B   usable mapping rate illumina nextseq_v2 unknown cdna_unspecified unknown bulk unknown unknown   Germany 2023-08-17 Segmentation Embryo Heart Cardiovascular System
25181 25181 SRR25661616 SRX21387402 SRS18627966 SRP455520 PRJNA1006302 The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes GSE241049 Transcriptome Analysis To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.   pubmed:39658721   hand2 FLD / 20 hpf CMs rep1 GSM7714393   source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:hand2 mutant|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing hand2 FLD / 20 hpf CMs rep1 Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts embryonic heart   miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   tissue:embryonic heart|cell type:cardiomyocytes|genotype:hand2 mutant|treatment:sorted cells by FACS GSM7714393 GSM7714393: hand2 FLD / 20 hpf CMs rep1; Danio rerio; RNA Seq GSM7714393 r1 GSM7714393 1 miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 2000   SRP455520   loader:fastq load.py E22_3458_Yanli_HT_Lib_Mut_1_R1.fastq.gz fastq 2727863036.0 38140997.0 GSM7714393 r1 0:71.52 A:760867462;C:577539041;G:596986102;T:792470431;N:0 71       760867462 577539041 596986102 792470431 0 SRX21387402 SRS18627966 SRA1694205 MPI for heart and lung research MPI for heart and lung research 1 0.91175   0.1342   0.75282   0.44063   72   B   usable mapping rate illumina nextseq_v2 unknown cdna_unspecified unknown bulk unknown unknown   Germany 2023-08-17 Segmentation Embryo Heart Cardiovascular System
26483 26483 SRR25930975 SRX21649988 SRS18818460 SRP458853 PRJNA1013567 scRNA seq of 50 hpf and 80 hpf isolated zebrafish hearts GSE242483 Transcriptome Analysis Seeking to identify additional transcription factors required for cardiac valve formation we determined and explored the transcriptional landscape of endocardial cells at the time when key morphogenetic events underlying valve development take place. Overall design: We isolated wild type zebrafish hearts at 50 hpf when valve identity has just been established and at 80 hpf when forming valves are first observed   pubmed:38748804   50hpf GSM7764481   source name:heart|tissue:heart|genotype:wild type|age:50hpf|geo loc name:missing|collection date:missing 50hpf Reads were aligned against the zebrafish genome and counted by StarSolo. Preprocessed counts were further analysed using Scanpy. Basic cell quality control was conducted by taking the number of detected genes and mitochondrial content into consideration. We removed cells that did not express more than 300 genes or had a mitochondrial content greater than 8%. Furthermore we filtered genes if they were detected in less than 30 cells. Raw counts per cell were normalised to the median count over all cells and transformed into log space to stabilise variance. We initially reduced dimensionality of the dataset using PCA retaining 50 principal components. Subsequent steps like low dimensional UMAP embedding and cell clustering were based on the initial PCA. Final data visualization was done by scanpy and cellxgene packages. Assembly: DanRer11 Supplementary files format and content: starsolo outputs heart   Whole hearts were isolated and cardiac cells were dissociated. Dead cells were removed from the final cell isolate by FACs sorting in PBS without xxx and Magnesium and with 0.04% BSA. Each sample was run separately on a lane in a Chromium controller with Chromium Next GEM Single Cell 3ʹ Reagent Kits v3 1 10xGenomics. scRNA seq library preparation was done using a standard protocol and sequencing was done on a Nextseq2000   tissue:heart|genotype:wild type|age:50hpf GSM7764481 GSM7764481: 50hpf; Danio rerio; RNA Seq GSM7764481 r1 GSM7764481 1 Whole hearts were isolated and cardiac cells were dissociated. Dead cells were removed from the final cell isolate by FACs sorting in PBS without xxx and Magnesium and with 0.04% BSA. Each sample was run separately on a lane in a Chromium controller with Chromium Next GEM Single Cell 3ʹ Reagent Kits v3 1 10xGenomics. scRNA seq library preparation was done using a standard protocol and sequencing was done on a Nextseq2000   RNA-Seq TRANSCRIPTOMIC SINGLE CELL cDNA PAIRED ILLUMINA NextSeq 2000   SRP458853     Giulia_50hpf_S1_R2_001.fastq.gz Giulia_50hpf_S1_R1_001.fastq.gz fastq fastq 19874763820.0 237988724.0 GSM7764481 r1 0:28 1:55.51 A:5320257914;C:4424267230;G:4320623789;T:5708249185;N:101365702 28 55     5320257914 4424267230 4320623789 5708249185 101365702 SRX21649988 SRS18818460 SRA1706674 Bioinformatics, Max-Planck-Institute for Heart and Lung Research Bioinformatics, Max-Planck-Institute for Heart and Lung Research 2 0.00185 0.94414 0.00087 0.13397 0.99675 0.80172 0.41142 0.51985 28 56 T B sc-like readlen illumina nextseq_v2 unknown cdna_unspecified unknown sc single_cell_droplet 10x   Germany 2023-09-06 Hatching Embryo Heart Cardiovascular System
29089 29089 SRR27015253 SRX22707797 SRS19700098 SRP475323 PRJNA1047551 Identification of genes important during atrial myocardial morphogenesis GSE249149 Transcriptome Analysis Atrial cardiomyocytes undergo complex cellular behaviours post 72 hpf to build muscle structures. We aimed to identify the genes involved during this process and therefore we seqeunced the RNA from 48 hpf and 72 hpf atrial cardiomyocytes to uncover changes in the transcirptome that might regulate or trigger atrial morphogenesis post 72 hpf. Overall design: Comparative gene expression profiling analysis of RNA seq data for 48 hpf and 72 hpf wild type zebrafish atrial cardiomyocytes.   pubmed:39289341   Wild type zebrafish atrial cardiomyocytes 48 hpf rep 3 GSM7927518   source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocyte|genotype:wild type|treatment:48 hpf loc name:missing|collection date:missing Wild type zebrafish atrial cardiomyocytes 48 hpf rep 3 Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Bolger et al. Trimmomatic: a flexible trimmer for Illumina sequence data. Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 3.0.0 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.4 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Assembly: danRer11 Supplementary files format and content: count matrix embryonic heart   miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   tissue:embryonic heart|cell type:cardiomyocyte|genotype:wild type|treatment:48 hpf GSM7927518 GSM7927518: Wild type zebrafish atrial cardiomyocytes 48 hpf rep 3; Danio rerio; RNA Seq GSM7927518 r1 GSM7927518 1 miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 2000   SRP475323   loader:fastq load.py dst226_zbrf_clt___ACrdmct-age___48h_b03_t01_m01_R1.fastq.gz fastq 2161847345.0 35921817.0 GSM7927518 r1 0:60.18 A:505467877;C:418329045;G:416403136;T:483063599;N:338583688 60       505467877 418329045 416403136 483063599 338583688 SRX22707797 SRS19700098 SRA1761360 MPI for heart and lung research MPI for heart and lung research 1 0.89532   0.08355   0.82012   0.68413   35   B   usable mapping rate illumina nextseq_v2 unknown cdna_unspecified unknown bulk unknown unknown   Germany 2023-12-01 Hatching Embryo Heart Cardiovascular System
29090 29090 SRR27015254 SRX22707796 SRS19700097 SRP475323 PRJNA1047551 Identification of genes important during atrial myocardial morphogenesis GSE249149 Transcriptome Analysis Atrial cardiomyocytes undergo complex cellular behaviours post 72 hpf to build muscle structures. We aimed to identify the genes involved during this process and therefore we seqeunced the RNA from 48 hpf and 72 hpf atrial cardiomyocytes to uncover changes in the transcirptome that might regulate or trigger atrial morphogenesis post 72 hpf. Overall design: Comparative gene expression profiling analysis of RNA seq data for 48 hpf and 72 hpf wild type zebrafish atrial cardiomyocytes.   pubmed:39289341   Wild type zebrafish atrial cardiomyocytes 48 hpf rep 2 GSM7927517   source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocyte|genotype:wild type|treatment:48 hpf loc name:missing|collection date:missing Wild type zebrafish atrial cardiomyocytes 48 hpf rep 2 Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Bolger et al. Trimmomatic: a flexible trimmer for Illumina sequence data. Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 3.0.0 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.4 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Assembly: danRer11 Supplementary files format and content: count matrix embryonic heart   miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   tissue:embryonic heart|cell type:cardiomyocyte|genotype:wild type|treatment:48 hpf GSM7927517 GSM7927517: Wild type zebrafish atrial cardiomyocytes 48 hpf rep 2; Danio rerio; RNA Seq GSM7927517 r1 GSM7927517 1 miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 2000   SRP475323   loader:fastq load.py dst226_zbrf_clt___ACrdmct-age___48h_b02_t01_m01_R1.fastq.gz fastq 2065547064.0 31863833.0 GSM7927517 r1 0:64.82 A:530497695;C:434164388;G:434118538;T:518043928;N:148722515 64       530497695 434164388 434118538 518043928 148722515 SRX22707796 SRS19700097 SRA1761360 MPI for heart and lung research MPI for heart and lung research 1 0.91772   0.17863   0.76828   0.49567   72   B   usable mapping rate illumina nextseq_v2 unknown cdna_unspecified unknown bulk unknown unknown   Germany 2023-12-01 Hatching Embryo Heart Cardiovascular System
29091 29091 SRR27015255 SRX22707795 SRS19700096 SRP475323 PRJNA1047551 Identification of genes important during atrial myocardial morphogenesis GSE249149 Transcriptome Analysis Atrial cardiomyocytes undergo complex cellular behaviours post 72 hpf to build muscle structures. We aimed to identify the genes involved during this process and therefore we seqeunced the RNA from 48 hpf and 72 hpf atrial cardiomyocytes to uncover changes in the transcirptome that might regulate or trigger atrial morphogenesis post 72 hpf. Overall design: Comparative gene expression profiling analysis of RNA seq data for 48 hpf and 72 hpf wild type zebrafish atrial cardiomyocytes.   pubmed:39289341   Wild type zebrafish atrial cardiomyocytes 48 hpf rep 1 GSM7927516   source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocyte|genotype:wild type|treatment:48 hpf loc name:missing|collection date:missing Wild type zebrafish atrial cardiomyocytes 48 hpf rep 1 Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Bolger et al. Trimmomatic: a flexible trimmer for Illumina sequence data. Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 3.0.0 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.4 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Assembly: danRer11 Supplementary files format and content: count matrix embryonic heart   miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   tissue:embryonic heart|cell type:cardiomyocyte|genotype:wild type|treatment:48 hpf GSM7927516 GSM7927516: Wild type zebrafish atrial cardiomyocytes 48 hpf rep 1; Danio rerio; RNA Seq GSM7927516 r1 GSM7927516 1 miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 2000   SRP475323   loader:fastq load.py dst226_zbrf_clt___ACrdmct-age___48h_b01_t01_m01_R1.fastq.gz fastq 1619268089.0 24941754.0 GSM7927516 r1 0:64.92 A:410578311;C:344485123;G:343852178;T:401558739;N:118793738 64       410578311 344485123 343852178 401558739 118793738 SRX22707795 SRS19700096 SRA1761360 MPI for heart and lung research MPI for heart and lung research 1 0.91693   0.13175   0.77082   0.47511   72   B   usable mapping rate illumina nextseq_v2 unknown cdna_unspecified unknown bulk unknown unknown   Germany 2023-12-01 Hatching Embryo Heart Cardiovascular System
31528 31528 SRR28423881 SRX24027916 SRS20821688 SRP497294 PRJNA1090898 The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst169 GSE262247 Transcriptome Analysis The innate immune system is triggered xxx post injury and its spatiotemporal dynamics are critical for successful regeneration. MyD88 is a key component of the innate immune response; however its role during regeneration remains unclear. Here we show that MyD88 controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. Our data reveal a significant reduction in pro inflammatory neutrophil and macrophage populations as well as the expansion of a collagen rich endocardial population in cryoinjured myd88 / ventricles. Consistent with these findings we observed increased myofibroblasts fibrin abundance and scarring in myd88 / ventricles. Transcriptomic analyses of endocardial cells and immunostaining experiments reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium. Moreover loss of MyD88 impairs cardiomyocyte proliferation and protrusive activity towards the injured area. Notably endothelial specific overexpression of myd88 reverses the neutrophil fibrotic and scarring phenotypes in cryoinjured myd88 / ventricles. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a transcriptional target of the MyD88 signaling axis and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis thereby emphasizing the strong impact of the innate immune response during tissue regeneration. Overall design: Live zebrafish ventricular cells were isolated at 24 hour post cryoinjury hpci from myd88+/+ and myd88 / ventricles by Fluorescence activated cell sorting FACS and analyzed using scRNAseq. parent bioproject:PRJNA1090894 pubmed:39271818   ventricular cells myd88 / 24 hpci GSM8161054   source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing ventricular cells myd88 / 24 hpci Raw reads were aligned against the zebrafish genome DanRer11 and counted by StarSolo Dobin et al. doi: 10.1093/bioinformatics/bts635 followed by secondary analysis in Annotated Data Format. Preprocessed counts were further analyzed using Scanpy Wolf et al. doi: 10.1186/s13059 017 1382 0. Basic cell quality control was conducted by taking the number of detected genes and mitochondrial content into consideration. We removed 32 cells in total that did not express more than 300 genes or had a mitochondrial content greater than 10%. Furthermore we filtered 7823 genes if they were detected in less than 30 cells <0.01%. Raw counts per cell were normalized to the median count over all cells and transformed into log space to stabilize variance We initially reduced dimensionality of the dataset using PCA retaining 50 principal components. Subsequent steps like low dimensional UMAP embedding McInnes & Healy https://arxiv.org/abs/1802.03426 and cell clustering via community detection Traag et al. https://arxiv.org/abs/1810.08473 were based on the initial PCA. Final data visualization was done by CellxGene package DOI 10.5281/zenodo.3235020. Assembly: DanRer11 Supplementary files format and content: starsolo outputs cardiac ventricles cardiac cryoinjury 24 hours prior to heart extraction Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer’s instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks’ balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell 3’ GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121.   tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury GSM8161054 GSM8161054: ventricular cells myd88 / 24 hpci; Danio rerio; RNA Seq GSM8161054 r1 GSM8161054 1 Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer's instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks' balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121.   RNA-Seq TRANSCRIPTOMIC SINGLE CELL cDNA PAIRED ILLUMINA NextSeq 2000   SRP497294     Pinelopi_10x_Zebrafish_Mut_Lib_R1.fastq.gz Pinelopi_10x_Zebrafish_Mut_Lib_R2.fastq.gz fastq fastq 31356990530.0 394538049.0 GSM8161054 r1 0:28 1:51.48 A:8573180857;C:6884590114;G:7520784498;T:8220228225;N:158206836 28 51     8573180857 6884590114 7520784498 8220228225 158206836 SRX24027916 SRS20821688 SRA1832827 MPI for heart and lung research MPI for heart and lung research                       T B sc-like readlen illumina nextseq_v2 unknown cdna_unspecified unknown sc single_cell_droplet 10x   Germany 2024-03-22 Cleavage Embryo Heart Cardiovascular System
31529 31529 SRR28423882 SRX24027915 SRS20821687 SRP497294 PRJNA1090898 The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst169 GSE262247 Transcriptome Analysis The innate immune system is triggered xxx post injury and its spatiotemporal dynamics are critical for successful regeneration. MyD88 is a key component of the innate immune response; however its role during regeneration remains unclear. Here we show that MyD88 controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. Our data reveal a significant reduction in pro inflammatory neutrophil and macrophage populations as well as the expansion of a collagen rich endocardial population in cryoinjured myd88 / ventricles. Consistent with these findings we observed increased myofibroblasts fibrin abundance and scarring in myd88 / ventricles. Transcriptomic analyses of endocardial cells and immunostaining experiments reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium. Moreover loss of MyD88 impairs cardiomyocyte proliferation and protrusive activity towards the injured area. Notably endothelial specific overexpression of myd88 reverses the neutrophil fibrotic and scarring phenotypes in cryoinjured myd88 / ventricles. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a transcriptional target of the MyD88 signaling axis and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis thereby emphasizing the strong impact of the innate immune response during tissue regeneration. Overall design: Live zebrafish ventricular cells were isolated at 24 hour post cryoinjury hpci from myd88+/+ and myd88 / ventricles by Fluorescence activated cell sorting FACS and analyzed using scRNAseq. parent bioproject:PRJNA1090894 pubmed:39271818   ventricular cells myd88+/+ 24 hpci GSM8161053   source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing ventricular cells myd88+/+ 24 hpci Raw reads were aligned against the zebrafish genome DanRer11 and counted by StarSolo Dobin et al. doi: 10.1093/bioinformatics/bts635 followed by secondary analysis in Annotated Data Format. Preprocessed counts were further analyzed using Scanpy Wolf et al. doi: 10.1186/s13059 017 1382 0. Basic cell quality control was conducted by taking the number of detected genes and mitochondrial content into consideration. We removed 32 cells in total that did not express more than 300 genes or had a mitochondrial content greater than 10%. Furthermore we filtered 7823 genes if they were detected in less than 30 cells <0.01%. Raw counts per cell were normalized to the median count over all cells and transformed into log space to stabilize variance We initially reduced dimensionality of the dataset using PCA retaining 50 principal components. Subsequent steps like low dimensional UMAP embedding McInnes & Healy https://arxiv.org/abs/1802.03426 and cell clustering via community detection Traag et al. https://arxiv.org/abs/1810.08473 were based on the initial PCA. Final data visualization was done by CellxGene package DOI 10.5281/zenodo.3235020. Assembly: DanRer11 Supplementary files format and content: starsolo outputs cardiac ventricles cardiac cryoinjury 24 hours prior to heart extraction Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer’s instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks’ balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell 3’ GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121.   tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury GSM8161053 GSM8161053: ventricular cells myd88+/+ 24 hpci; Danio rerio; RNA Seq GSM8161053 r1 GSM8161053 1 Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer's instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks' balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121.   RNA-Seq TRANSCRIPTOMIC SINGLE CELL cDNA PAIRED ILLUMINA NextSeq 2000   SRP497294     Pinelopi_10x_Zebrafish_WT_Lib_R1.fastq.gz Pinelopi_10x_Zebrafish_WT_Lib_R2.fastq.gz fastq fastq 40672259373.0 511650018.0 GSM8161053 r1 0:28 1:51.49 A:11079272327;C:8809520398;G:9307205642;T:11269370263;N:206890743 28 51     11079272327 8809520398 9307205642 11269370263 206890743 SRX24027915 SRS20821687 SRA1832827 MPI for heart and lung research MPI for heart and lung research                       T B sc-like readlen illumina nextseq_v2 unknown cdna_unspecified unknown sc single_cell_droplet 10x   Germany 2024-03-22 Cleavage Embryo Heart Cardiovascular System
32609 32609 SRR29325925 SRX24842084 SRS21553259 SRP512516 PRJNA1121299 Gene expression profile of single endocardial cells in 48 hpf and 72 hpf zebrafish embryos/larvae. In the study "The heart is a niche for hematopoietic stem and progenitor cells in zebrafish." GSE269378 Transcriptome Analysis We used single cell RNA expression to uncover the cellular and molecular heterogeneity of isolated endocardial cells in the heart. From this study we uncovered the presence of an endocardial hematopoietic cluster along with other significant clusters including valve endocardial and interstitial cells and non valve cells. Overall design: Endocardial cells were isolated using FACS from physically extracted Tgkdrl:nls mCherry and Tgcd41:GFP hearts according to presence of mCherry positive cells and further analyzed using scRNAseq.   pubmed:39217144   EC 2d GSM8314110   source name:Heart|tissue:Heart|cell type:Endocardial cells|genotype:Tgkdrl:nls mCherry; Tgcd41:GFP|developmental stage:48 hpf loc name:missing|collection date:missing EC 2d Sequencing was done on Nextseq2000 and raw reads were aligned against the zebrafish genome DanRer11 and counted by StarSolo Preprocessed counts were further analysed using Scanpy ollowed by secondary analysis in Annotated Data Format. Preprocessed counts were further analyzed using Scanpy. Basic cell quality control was conducted by taking the number of detected genes and mitochondrial content into consideration. We removed 5 cells in total that did not express more than 300 genes or had a mitochondrial content greater than 5%. Furthermore we filtered 24259 genes if they were detected in less than 30 cells <0.01%. Raw counts per cell were normalized to the median count over all cells and transformed into log space to stabilize variance. We initially reduced dimensionality of the dataset using PCA retaining 50 principal components. Subsequent steps like low dimensional UMAP embedding McInnes & Healy https://arxiv.org/abs/1802.03426 and cell clustering via community detection were based on the initial PCA. Final data visualization was done by scanpy and cellxgene packages. Assembly: danRer11 Supplementary files format and content: starsolo outputs Heart   Embryos were raised in a solution composed of 0.33 Danieau's medium containing the following concentrations: 17.4 mM NaCl 0.21 mM KCl 0.12 mM MgSO4·H2O and 0.18 mM CaNO32 while being maintained at a stable temperature of 28°C. To isolate EdCs for the single cell RNA sequencing experiment hearts from 48 and 72 hpf Tgkdrl:nls mCherry; Tgcd41:GFP larvae were manually dissected in DMEM + 10% FBS. Hearts were then centrifuged for 60 seconds at 3000 rpm washed with 1 mL Hanks’ Balanced Salt Solution and dissociated into single cells by incubating in 100 μl Enzyme 1 and 5 μl Enzyme 2 Pierce Cardiomyocyte Dissociation Kit Thermo Fisher Scientific Cat#88281 for 20 minutes at 300 rpm in a 30°C shaker 79. The samples were centrifuged for 5 minutes at 3000 rpm the supernatant was discarded and fresh medium was added to the dissociated cells and passed through 40 μM filter polystyrene 5ml tubes. Negative controls of non fluorescent hearts or single color fluorescent hearts were prepared to define the sorting gates. Cells were sorted using the BD FACSAria™ III BD Biosciences instrument. Live cells were selected by exclusion of DAPI using 30mW 405nm excitation paired with 450/50 nm band pass filter. The software used for sorting and analysis is BD FACSDiva v8.0.1. Single positive Tgkdrl:nls mCherry+ cells and double positive Tgkdrl:nls mCherry+; Tgcd41:GFP+ cells were sorted and collected into tubes with DMEM + 10% FBS. Cells from both collected samples were immediately combined and processed for the single cell RNA sequencing. mCherry fluorescence was measured with 50mW 561nm excitation paired with 610/20nm band pass filter. GFP fluorescence was measured with 50mW 488nm excitation paired with 530/30 band pass filter. The cell suspensions were counted with Moxi cell counter and diluted according to manufacturer’s protocol to obtain 4.000 2d HC and 8.000 3d 10.497 EC 1.569 HC single cell data points per sample respectively. Each sample was run separately on a lane in Chromium controller with Chromium Ne… Embryos/larvae were grown in 28 degree incubator until extraction at 48 or 72 hpf tissue:Heart|cell type:Endocardial cells|genotype:Tgkdrl:nls mCherry; Tgcd41:GFP|developmental stage:48 hpf GSM8314110 GSM8314110: EC 2d; Danio rerio; RNA Seq GSM8314110 r1 GSM8314110 1 Embryos were raised in a solution composed of 0.33 Danieau's medium containing the following concentrations: 17.4 mM NaCl 0.21 mM KCl 0.12 mM MgSO4·H2O and 0.18 mM CaNO32 while being maintained at a stable temperature of 28°C. To isolate EdCs for the single cell RNA sequencing experiment hearts from 48 and 72 hpf Tgkdrl:nls mCherry; Tgcd41:GFP larvae were manually dissected in DMEM + 10% FBS. Hearts were then centrifuged for 60 seconds at 3000 rpm washed with 1 mL Hanks' Balanced Salt Solution and dissociated into single cells by incubating in 100 μl Enzyme 1 and 5 μl Enzyme 2 Pierce Cardiomyocyte Dissociation Kit Thermo Fisher Scientific Cat#88281 for 20 minutes at 300 rpm in a 30°C shaker 79. The samples were centrifuged for 5 minutes at 3000 rpm the supernatant was discarded and fresh medium was added to the dissociated cells and passed through 40 μM filter polystyrene 5ml tubes. Negative controls of non fluorescent hearts or single color fluorescent hearts were prepared to define the sorting gates. Cells were sorted using the BD FACSAria™ III BD Biosciences instrument. Live cells were selected by exclusion of DAPI using 30mW 405nm excitation paired with 450/50 nm band pass filter. The software used for sorting and analysis is BD FACSDiva v8.0.1. Single positive Tgkdrl:nls mCherry+ cells and double positive Tgkdrl:nls mCherry+; Tgcd41:GFP+ cells were sorted and collected into tubes with DMEM + 10% FBS. Cells from both collected samples were immediately combined and processed for the single cell RNA sequencing. mCherry fluorescence was measured with 50mW 561nm excitation paired with 610/20nm band pass filter. GFP fluorescence was measured with 50mW 488nm excitation paired with 530/30 band pass filter. The cell suspensions were counted with Moxi cell counter and diluted according to manufacturer's protocol to obtain 4.000 2d HC and 8.000 3d 10.497 EC 1.569 HC single cell data points per sample respectively. Each sample was run separately on a lane in Chromium controller with Chromium Ne…   RNA-Seq TRANSCRIPTOMIC SINGLE CELL cDNA PAIRED ILLUMINA NextSeq 2000   SRP512516     Felix_10x_Lib_EC-2d_R1.fastq.gz Felix_10x_Lib_EC-2d_R2.fastq.gz fastq fastq 37849382027.0 476135961.0 GSM8314110 r1 0:28 1:51.49 A:10212120425;C:8162504214;G:8573129268;T:10704929378;N:196698742 28 51     10212120425 8162504214 8573129268 10704929378 196698742 SRX24842084 SRS21553259 SRA1892449 MPI for heart and lung research MPI for heart and lung research                       T B mate1 technical by mapping diff illumina nextseq_v2 unknown cdna_unspecified unknown sc single_cell_droplet 10x   Germany 2024-06-07 Hatching Embryo Heart Cardiovascular System
33805 33805 SRR30670312 SRX26088984 SRS22655387 SRP532815 PRJNA1161406 Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations GSE277234 Transcriptome Analysis Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit wi…   pubmed:39402138   DKOwBF 4 GSM8516797   source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62|geo loc name:missing|collection date:missing DKOwBF 4 base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample heart   RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol 2 dpf zebrafish embryo tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62 GSM8516797 GSM8516797: DKOwBF 4; Danio rerio; RNA Seq GSM8516797 r1 GSM8516797 1 RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 550   SRP532815     DKOwBF_4_R1_val_1.fq.gz DKOwBF_4_R2_val_2.fq.gz fastq fastq 2631656843.0 35135298.0 GSM8516797 r1 0:37.47 1:37.43 A:693207862;C:610024232;G:611701090;T:716593105;N:130554 37 37     693207862 610024232 611701090 716593105 130554 SRX26088984 SRS22655387 SRA1972600 University of Potsdam University of Potsdam                       B B biological fallback assumption illumina nextseq full_length random_priming nebnext bulk unknown unknown   Germany 2024-09-15 Hatching Embryo Heart Cardiovascular System
33806 33806 SRR30670313 SRX26088983 SRS22655386 SRP532815 PRJNA1161406 Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations GSE277234 Transcriptome Analysis Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit wi…   pubmed:39402138   DKOwBF 3 GSM8516796   source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62|geo loc name:missing|collection date:missing DKOwBF 3 base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample heart   RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol 2 dpf zebrafish embryo tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62 GSM8516796 GSM8516796: DKOwBF 3; Danio rerio; RNA Seq GSM8516796 r1 GSM8516796 1 RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 550   SRP532815     DKOwBF_3_R1_val_1.fq.gz DKOwBF_3_R2_val_2.fq.gz fastq fastq 2307127989.0 30809808.0 GSM8516796 r1 0:37.48 1:37.40 A:604817176;C:534788281;G:546273175;T:621136766;N:112591 37 37     604817176 534788281 546273175 621136766 112591 SRX26088983 SRS22655386 SRA1972600 University of Potsdam University of Potsdam                       B B biological fallback assumption illumina nextseq full_length random_priming nebnext bulk unknown unknown   Germany 2024-09-15 Hatching Embryo Heart Cardiovascular System
33807 33807 SRR30670314 SRX26088982 SRS22655385 SRP532815 PRJNA1161406 Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations GSE277234 Transcriptome Analysis Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit wi…   pubmed:39402138   DKOwBF 2 GSM8516795   source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62|geo loc name:missing|collection date:missing DKOwBF 2 base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample heart   RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol 2 dpf zebrafish embryo tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62 GSM8516795 GSM8516795: DKOwBF 2; Danio rerio; RNA Seq GSM8516795 r1 GSM8516795 1 RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 550   SRP532815     DKOwBF_2_R1_val_1.fq.gz DKOwBF_2_R2_val_2.fq.gz fastq fastq 2359951661.0 31500054.0 GSM8516795 r1 0:37.48 1:37.44 A:616053500;C:552042916;G:552098980;T:639639620;N:116645 37 37     616053500 552042916 552098980 639639620 116645 SRX26088982 SRS22655385 SRA1972600 University of Potsdam University of Potsdam                       B B biological fallback assumption illumina nextseq full_length random_priming nebnext bulk unknown unknown   Germany 2024-09-15 Hatching Embryo Heart Cardiovascular System
33808 33808 SRR30670315 SRX26088981 SRS22655384 SRP532815 PRJNA1161406 Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations GSE277234 Transcriptome Analysis Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit wi…   pubmed:39402138   DKOwBF 1 GSM8516794   source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62|geo loc name:missing|collection date:missing DKOwBF 1 base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample heart   RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol 2 dpf zebrafish embryo tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62 GSM8516794 GSM8516794: DKOwBF 1; Danio rerio; RNA Seq GSM8516794 r1 GSM8516794 1 RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 550   SRP532815     DKOwBF_1_R1_val_1.fq.gz DKOwBF_1_R2_val_2.fq.gz fastq fastq 2279765098.0 30432486.0 GSM8516794 r1 0:37.48 1:37.43 A:593961620;C:534035377;G:534433858;T:617220513;N:113730 37 37     593961620 534035377 534433858 617220513 113730 SRX26088981 SRS22655384 SRA1972600 University of Potsdam University of Potsdam                       B B biological fallback assumption illumina nextseq full_length random_priming nebnext bulk unknown unknown   Germany 2024-09-15 Hatching Embryo Heart Cardiovascular System
33809 33809 SRR30670316 SRX26088980 SRS22655383 SRP532815 PRJNA1161406 Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations GSE277234 Transcriptome Analysis Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit wi…   pubmed:39402138   ccm2 4 GSM8516793   source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201|geo loc name:missing|collection date:missing ccm2 4 base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample heart   RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol 2 dpf zebrafish embryo tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201 GSM8516793 GSM8516793: ccm2 4; Danio rerio; RNA Seq GSM8516793 r1 GSM8516793 1 RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 550   SRP532815     ccm2_4_R1_val_1.fq.gz ccm2_4_R2_val_2.fq.gz fastq fastq 1774723235.0 23698743.0 GSM8516793 r1 0:37.48 1:37.40 A:458133535;C:421770768;G:424339889;T:470391262;N:87781 37 37     458133535 421770768 424339889 470391262 87781 SRX26088980 SRS22655383 SRA1972600 University of Potsdam University of Potsdam                       B B biological fallback assumption illumina nextseq full_length random_priming nebnext bulk unknown unknown   Germany 2024-09-15 Hatching Embryo Heart Cardiovascular System
33810 33810 SRR30670317 SRX26088979 SRS22655382 SRP532815 PRJNA1161406 Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations GSE277234 Transcriptome Analysis Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit wi…   pubmed:39402138   ccm2 3 GSM8516792   source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201|geo loc name:missing|collection date:missing ccm2 3 base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample heart   RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol 2 dpf zebrafish embryo tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201 GSM8516792 GSM8516792: ccm2 3; Danio rerio; RNA Seq GSM8516792 r1 GSM8516792 1 RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 550   SRP532815     ccm2_3_R1_val_1.fq.gz ccm2_3_R2_val_2.fq.gz fastq fastq 2785670574.0 37207625.0 GSM8516792 r1 0:37.47 1:37.39 A:733595813;C:647190941;G:651896211;T:752851756;N:135853 37 37     733595813 647190941 651896211 752851756 135853 SRX26088979 SRS22655382 SRA1972600 University of Potsdam University of Potsdam                       B B biological fallback assumption illumina nextseq full_length random_priming nebnext bulk unknown unknown   Germany 2024-09-15 Hatching Embryo Heart Cardiovascular System
33811 33811 SRR30670318 SRX26088978 SRS22655381 SRP532815 PRJNA1161406 Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations GSE277234 Transcriptome Analysis Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit wi…   pubmed:39402138   ccm2 2 GSM8516791   source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201|geo loc name:missing|collection date:missing ccm2 2 base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample heart   RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol 2 dpf zebrafish embryo tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201 GSM8516791 GSM8516791: ccm2 2; Danio rerio; RNA Seq GSM8516791 r1 GSM8516791 1 RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 550   SRP532815     ccm2_2_R1_val_1.fq.gz ccm2_2_R2_val_2.fq.gz fastq fastq 1710862794.0 22847832.0 GSM8516791 r1 0:37.48 1:37.40 A:451866074;C:396308875;G:397143039;T:465461428;N:83378 37 37     451866074 396308875 397143039 465461428 83378 SRX26088978 SRS22655381 SRA1972600 University of Potsdam University of Potsdam                       B B biological fallback assumption illumina nextseq full_length random_priming nebnext bulk unknown unknown   Germany 2024-09-15 Hatching Embryo Heart Cardiovascular System
33812 33812 SRR30670319 SRX26088977 SRS22655380 SRP532815 PRJNA1161406 Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations GSE277234 Transcriptome Analysis Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit wi…   pubmed:39402138   ccm2 1 GSM8516790   source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201|geo loc name:missing|collection date:missing ccm2 1 base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample heart   RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol 2 dpf zebrafish embryo tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201 GSM8516790 GSM8516790: ccm2 1; Danio rerio; RNA Seq GSM8516790 r1 GSM8516790 1 RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 550   SRP532815     ccm2_1_R1_val_1.fq.gz ccm2_1_R2_val_2.fq.gz fastq fastq 2152186897.0 28739460.0 GSM8516790 r1 0:37.48 1:37.40 A:565328171;C:501524678;G:502042276;T:583186005;N:105767 37 37     565328171 501524678 502042276 583186005 105767 SRX26088977 SRS22655380 SRA1972600 University of Potsdam University of Potsdam                       B B biological fallback assumption illumina nextseq full_length random_priming nebnext bulk unknown unknown   Germany 2024-09-15 Hatching Embryo Heart Cardiovascular System
33813 33813 SRR30670320 SRX26088976 SRS22655379 SRP532815 PRJNA1161406 Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations GSE277234 Transcriptome Analysis Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit wi…   pubmed:39402138   wt 4 GSM8516789   source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:wild type|geo loc name:missing|collection date:missing wt 4 base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample heart   RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol 2 dpf zebrafish embryo tissue:heart|cell type:enriched endothelial cells|genotype:wild type GSM8516789 GSM8516789: wt 4; Danio rerio; RNA Seq GSM8516789 r1 GSM8516789 1 RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 550   SRP532815     wt_4_R1_val_1.fq.gz wt_4_R2_val_2.fq.gz fastq fastq 2115730283.0 28251845.0 GSM8516789 r1 0:37.48 1:37.40 A:554039480;C:497170515;G:497588268;T:566828365;N:103655 37 37     554039480 497170515 497588268 566828365 103655 SRX26088976 SRS22655379 SRA1972600 University of Potsdam University of Potsdam                       B B biological fallback assumption illumina nextseq full_length random_priming nebnext bulk unknown unknown   Germany 2024-09-15 Hatching Embryo Heart Cardiovascular System
33814 33814 SRR30670321 SRX26088975 SRS22655378 SRP532815 PRJNA1161406 Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations GSE277234 Transcriptome Analysis Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit wi…   pubmed:39402138   wt 3 GSM8516788   source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:wild type|geo loc name:missing|collection date:missing wt 3 base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample heart   RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol 2 dpf zebrafish embryo tissue:heart|cell type:enriched endothelial cells|genotype:wild type GSM8516788 GSM8516788: wt 3; Danio rerio; RNA Seq GSM8516788 r1 GSM8516788 1 RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 550   SRP532815     wt_3_R1_val_1.fq.gz wt_3_R2_val_2.fq.gz fastq fastq 1222858943.0 16325477.0 GSM8516788 r1 0:37.47 1:37.44 A:319777234;C:285362000;G:288524099;T:329135216;N:60394 37 37     319777234 285362000 288524099 329135216 60394 SRX26088975 SRS22655378 SRA1972600 University of Potsdam University of Potsdam                       B B biological fallback assumption illumina nextseq full_length random_priming nebnext bulk unknown unknown   Germany 2024-09-15 Hatching Embryo Heart Cardiovascular System
33815 33815 SRR30670322 SRX26088974 SRS22655377 SRP532815 PRJNA1161406 Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations GSE277234 Transcriptome Analysis Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit wi…   pubmed:39402138   wt 2 GSM8516787   source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:wild type|geo loc name:missing|collection date:missing wt 2 base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample heart   RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol 2 dpf zebrafish embryo tissue:heart|cell type:enriched endothelial cells|genotype:wild type GSM8516787 GSM8516787: wt 2; Danio rerio; RNA Seq GSM8516787 r1 GSM8516787 1 RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 550   SRP532815     wt_2_R1_val_1.fq.gz wt_2_R2_val_2.fq.gz fastq fastq 2264925518.0 30237170.0 GSM8516787 r1 0:37.48 1:37.43 A:593545435;C:529227225;G:529813966;T:612227538;N:111354 37 37     593545435 529227225 529813966 612227538 111354 SRX26088974 SRS22655377 SRA1972600 University of Potsdam University of Potsdam                       B B biological fallback assumption illumina nextseq full_length random_priming nebnext bulk unknown unknown   Germany 2024-09-15 Hatching Embryo Heart Cardiovascular System
33816 33816 SRR30670323 SRX26088973 SRS22655376 SRP532815 PRJNA1161406 Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations GSE277234 Transcriptome Analysis Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit wi…   pubmed:39402138   wt 1 GSM8516786   source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:wild type|geo loc name:missing|collection date:missing wt 1 base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample heart   RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol 2 dpf zebrafish embryo tissue:heart|cell type:enriched endothelial cells|genotype:wild type GSM8516786 GSM8516786: wt 1; Danio rerio; RNA Seq GSM8516786 r1 GSM8516786 1 RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 550   SRP532815     wt_1_R1_val_1.fq.gz wt_1_R2_val_2.fq.gz fastq fastq 2171991020.0 29008519.0 GSM8516786 r1 0:37.49 1:37.39 A:564449762;C:511917485;G:512535386;T:582980181;N:108206 37 37     564449762 511917485 512535386 582980181 108206 SRX26088973 SRS22655376 SRA1972600 University of Potsdam University of Potsdam                       B B biological fallback assumption illumina nextseq full_length random_priming nebnext bulk unknown unknown   Germany 2024-09-15 Hatching Embryo Heart Cardiovascular System
36641 36641 SRR700539 SRX233125 SRS393099 SRP018538 PRJNA189226 Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos GSE44233 Transcriptome Analysis The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed.   pubmed:23850773   Seq15 GSM1081113   tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant Seq15 Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel. sorted cardiomyocytes Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation. RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol. Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish. developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant GSM1081113 GSM1081113: Seq15; Danio rerio; RNA Seq GSM1081113 1   1   GEO Accession:GSM1081113 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP018538         1505008521.0 29509971.0 GSM1081113 r1 0:51 A:394410844;C:370013758;G:356489603;T:384055071;N:39245 51       394410844 370013758 356489603 384055071 39245 SRX233125 SRS393099 SRA066447 GEO Todd Evans Lab, Cell and Developmental Biology, Weill Cornell 1 0.9123   0.07373   0.71346   0.47555   51   B   usable mapping rate illumina hiseq_era full_length random_priming trueseq bulk bulk bulk   United States 2013-02-11 Pharyngula Embryo Heart Cardiovascular System
36642 36642 SRR700538 SRX233124 SRS393098 SRP018538 PRJNA189226 Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos GSE44233 Transcriptome Analysis The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed.   pubmed:23850773   Seq14 GSM1081112   tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant Seq14 Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel. sorted cardiomyocytes Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation. RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol. Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish. developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant GSM1081112 GSM1081112: Seq14; Danio rerio; RNA Seq GSM1081112 1   1   GEO Accession:GSM1081112 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP018538     seq14.txt.gz fastq 3144425502.0 61655402.0 GSM1081112 r1 0:51 A:825172912;C:756354008;G:742919584;T:819897573;N:81425 51       825172912 756354008 742919584 819897573 81425 SRX233124 SRS393098 SRA066447 GEO Todd Evans Lab, Cell and Developmental Biology, Weill Cornell 1 0.93659   0.0806   0.73716   0.47614   51   B   usable mapping rate illumina hiseq_era full_length random_priming trueseq bulk bulk bulk   United States 2013-02-11 Pharyngula Embryo Heart Cardiovascular System
36643 36643 SRR700537 SRX233123 SRS393097 SRP018538 PRJNA189226 Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos GSE44233 Transcriptome Analysis The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed.   pubmed:23850773   Seq11 GSM1081111   tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant Seq11 Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel. sorted cardiomyocytes Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation. RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol. Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish. developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant GSM1081111 GSM1081111: Seq11; Danio rerio; RNA Seq GSM1081111 1   1   GEO Accession:GSM1081111 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II   SRP018538         1364181264.0 37893924.0 GSM1081111 r1 0:36 A:362442341;C:297159061;G:406723961;T:297355968;N:499933 36       362442341 297159061 406723961 297355968 499933 SRX233123 SRS393097 SRA066447 GEO Todd Evans Lab, Cell and Developmental Biology, Weill Cornell 1 0.67174   0.07612   0.74416   0.48016   36   B   usable mapping rate illumina early_illumina full_length random_priming trueseq bulk bulk bulk   United States 2013-02-11 Pharyngula Embryo Heart Cardiovascular System
36644 36644 SRR700536 SRX233122 SRS393096 SRP018538 PRJNA189226 Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos GSE44233 Transcriptome Analysis The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed.   pubmed:23850773   Seq13 GSM1081110   tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype Seq13 Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel. sorted cardiomyocytes Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation. RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol. Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish. developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype GSM1081110 GSM1081110: Seq13; Danio rerio; RNA Seq GSM1081110 1   1   GEO Accession:GSM1081110 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP018538     seq13.txt.gz fastq 1693675269.0 33209319.0 GSM1081110 r1 0:51 A:443719209;C:411369010;G:404182982;T:434361031;N:43037 51       443719209 411369010 404182982 434361031 43037 SRX233122 SRS393096 SRA066447 GEO Todd Evans Lab, Cell and Developmental Biology, Weill Cornell 1 0.91781   0.08107   0.74976   0.46528   51   B   usable mapping rate illumina hiseq_era full_length random_priming trueseq bulk bulk bulk   United States 2013-02-11 Pharyngula Embryo Heart Cardiovascular System
36645 36645 SRR700535 SRX233121 SRS393095 SRP018538 PRJNA189226 Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos GSE44233 Transcriptome Analysis The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed.   pubmed:23850773   Seq5 GSM1081109   tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype Seq5 Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel. sorted cardiomyocytes Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation. RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol. Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish. developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype GSM1081109 GSM1081109: Seq5; Danio rerio; RNA Seq GSM1081109 1   1   GEO Accession:GSM1081109 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II   SRP018538     seq5.txt.gz fastq 1245644280.0 34601230.0 GSM1081109 r1 0:36 A:334131135;C:287707996;G:288492153;T:334895459;N:417537 36       334131135 287707996 288492153 334895459 417537 SRX233121 SRS393095 SRA066447 GEO Todd Evans Lab, Cell and Developmental Biology, Weill Cornell 1 0.89495   0.1058   0.74247   0.46422   36   B   usable mapping rate illumina early_illumina full_length random_priming trueseq bulk bulk bulk   United States 2013-02-11 Pharyngula Embryo Heart Cardiovascular System
36646 36646 SRR700534 SRX233120 SRS393094 SRP018538 PRJNA189226 Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos GSE44233 Transcriptome Analysis The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed.   pubmed:23850773   Seq1 GSM1081108   tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype Seq1 Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel. sorted cardiomyocytes Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation. RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol. Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish. developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype GSM1081108 GSM1081108: Seq1; Danio rerio; RNA Seq GSM1081108 1   1   GEO Accession:GSM1081108 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II   SRP018538     seq1.txt.gz fastq 929284704.0 25813464.0 GSM1081108 r1 0:36 A:244730361;C:220466820;G:213037296;T:250386569;N:663658 36       244730361 220466820 213037296 250386569 663658 SRX233120 SRS393094 SRA066447 GEO Todd Evans Lab, Cell and Developmental Biology, Weill Cornell 1 0.87436   0.11629   0.73302   0.46999   36   B   usable mapping rate illumina early_illumina full_length random_priming trueseq bulk bulk bulk   United States 2013-02-11 Pharyngula Embryo Heart Cardiovascular System
37255 37255 SRR1043688 SRX387598 SRS511498 SRP033532 PRJNA230686 Expression profiling in the heart of wild type and kctd10 mutant zebrafish larvae GSE53022 Transcriptome Analysis We sequenced mRNA of hearts from 50 wild type and 50 kctd10 mutant embryos at 48 hpf. Overall design: Examination of mRNA levels in the larvae hearts between the the wt and the kctd10 mutant.   pubmed:24430697   kctd10 mut zebrafish heart GSM1280516   source name:heart|strain background:AB|development stage:48 hpf|genotype/variation:kctd10 / kctd10 mutant|tissue:heart kctd10 mut zebrafish heart sequenced by the Illumina Hiseq 2000 platform Around 200 million 50 bp single end reads were obtained per sample. Reads were aligned to zebrafish genome Zv9 using tophat with up to 2 mismatches allowed. Differential expression analysis was performed using DESeq. Genome build: zebrafish genome Zv9 Supplementary files format and content: excel file of relative gene expression level between the wt and the kctd10 mutant. Supplementary files format and content: tab delimited txt files of gene raw counts and DESeq processed relative gene expression level between the wt and the kctd10 mutant. heart   Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol   strain background:AB|development stage:48 hpf|genotype/variation:kctd10 / kctd10 mutant|tissue:heart GSM1280516 GSM1280516: kctd10 mut zebrafish heart; Danio rerio; RNA Seq GSM1280516   1 Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol GEO Accession:GSM1280516 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP033532     s_8_1_1101_qseq.txt.gz Illumina native 159161750.0 3183235.0 GSM1280516 r1 0:50 A:40560849;C:38239286;G:38051715;T:41572492;N:737408 50       40560849 38239286 38051715 41572492 737408 SRX387598 SRS511498 SRA115339 GEO College of Life Sciences, Peking University 1 0.93678   0.06225   0.68834   0.44699   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   China 2013-12-05 Hatching Embryo Heart Cardiovascular System
37256 37256 SRR1104059 SRX387598 SRS511498 SRP033532 PRJNA230686 Expression profiling in the heart of wild type and kctd10 mutant zebrafish larvae GSE53022 Transcriptome Analysis We sequenced mRNA of hearts from 50 wild type and 50 kctd10 mutant embryos at 48 hpf. Overall design: Examination of mRNA levels in the larvae hearts between the the wt and the kctd10 mutant.   pubmed:24430697   kctd10 mut zebrafish heart GSM1280516   source name:heart|strain background:AB|development stage:48 hpf|genotype/variation:kctd10 / kctd10 mutant|tissue:heart kctd10 mut zebrafish heart sequenced by the Illumina Hiseq 2000 platform Around 200 million 50 bp single end reads were obtained per sample. Reads were aligned to zebrafish genome Zv9 using tophat with up to 2 mismatches allowed. Differential expression analysis was performed using DESeq. Genome build: zebrafish genome Zv9 Supplementary files format and content: excel file of relative gene expression level between the wt and the kctd10 mutant. Supplementary files format and content: tab delimited txt files of gene raw counts and DESeq processed relative gene expression level between the wt and the kctd10 mutant. heart   Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol   strain background:AB|development stage:48 hpf|genotype/variation:kctd10 / kctd10 mutant|tissue:heart GSM1280516 GSM1280516: kctd10 mut zebrafish heart; Danio rerio; RNA Seq GSM1280516   1 Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol GEO Accession:GSM1280516 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP033532         10053590150.0 201071803.0 GSM1280516 r2 0:50 A:2588651143;C:2370219438;G:2396055158;T:2650913003;N:47751408 50       2588651143 2370219438 2396055158 2650913003 47751408 SRX387598 SRS511498 SRA115339 GEO College of Life Sciences, Peking University 1 0.92227   0.06457   0.69367   0.45203   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   China 2013-12-05 Hatching Embryo Heart Cardiovascular System
37257 37257 SRR1043687 SRX387597 SRS511497 SRP033532 PRJNA230686 Expression profiling in the heart of wild type and kctd10 mutant zebrafish larvae GSE53022 Transcriptome Analysis We sequenced mRNA of hearts from 50 wild type and 50 kctd10 mutant embryos at 48 hpf. Overall design: Examination of mRNA levels in the larvae hearts between the the wt and the kctd10 mutant.   pubmed:24430697   wt zebrafish heart GSM1280515   source name:heart|strain background:AB|development stage:48 hpf|genotype/variation:wt wild type|tissue:heart wt zebrafish heart sequenced by the Illumina Hiseq 2000 platform Around 200 million 50 bp single end reads were obtained per sample. Reads were aligned to zebrafish genome Zv9 using tophat with up to 2 mismatches allowed. Differential expression analysis was performed using DESeq. Genome build: zebrafish genome Zv9 Supplementary files format and content: excel file of relative gene expression level between the wt and the kctd10 mutant. Supplementary files format and content: tab delimited txt files of gene raw counts and DESeq processed relative gene expression level between the wt and the kctd10 mutant. heart   Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol   strain background:AB|development stage:48 hpf|genotype/variation:wt wild type|tissue:heart GSM1280515 GSM1280515: wt zebrafish heart; Danio rerio; RNA Seq GSM1280515   1 Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol GEO Accession:GSM1280515 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP033532     s_6_1_1101_qseq.txt.gz Illumina native 155968450.0 3119369.0 GSM1280515 r1 0:50 A:40015379;C:37108086;G:37319547;T:41209982;N:315456 50       40015379 37108086 37319547 41209982 315456 SRX387597 SRS511497 SRA115339 GEO College of Life Sciences, Peking University 1 0.92288   0.06296   0.69209   0.4533   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   China 2013-12-05 Hatching Embryo Heart Cardiovascular System
37258 37258 SRR1104058 SRX387597 SRS511497 SRP033532 PRJNA230686 Expression profiling in the heart of wild type and kctd10 mutant zebrafish larvae GSE53022 Transcriptome Analysis We sequenced mRNA of hearts from 50 wild type and 50 kctd10 mutant embryos at 48 hpf. Overall design: Examination of mRNA levels in the larvae hearts between the the wt and the kctd10 mutant.   pubmed:24430697   wt zebrafish heart GSM1280515   source name:heart|strain background:AB|development stage:48 hpf|genotype/variation:wt wild type|tissue:heart wt zebrafish heart sequenced by the Illumina Hiseq 2000 platform Around 200 million 50 bp single end reads were obtained per sample. Reads were aligned to zebrafish genome Zv9 using tophat with up to 2 mismatches allowed. Differential expression analysis was performed using DESeq. Genome build: zebrafish genome Zv9 Supplementary files format and content: excel file of relative gene expression level between the wt and the kctd10 mutant. Supplementary files format and content: tab delimited txt files of gene raw counts and DESeq processed relative gene expression level between the wt and the kctd10 mutant. heart   Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol   strain background:AB|development stage:48 hpf|genotype/variation:wt wild type|tissue:heart GSM1280515 GSM1280515: wt zebrafish heart; Danio rerio; RNA Seq GSM1280515   1 Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol GEO Accession:GSM1280515 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP033532         10404769750.0 208095395.0 GSM1280515 r2 0:50 A:2661715782;C:2489013308;G:2484808257;T:2727159333;N:42073070 50       2661715782 2489013308 2484808257 2727159333 42073070 SRX387597 SRS511497 SRA115339 GEO College of Life Sciences, Peking University 1 0.93515   0.0656   0.68986   0.45312   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   China 2013-12-05 Hatching Embryo Heart Cardiovascular System
37991 37991 SRR1265766 SRX529160 SRS598857 SRP041544 PRJNA245824 Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish GSE57169 Transcriptome Analysis The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.   pubmed:26574018   Heart Replicate 3 sRNAseq GSM1376649   source name:Heart|tissue:Heart|genetic background:Wild type Singapore strain Heart Replicate 3 sRNAseq Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p <zebrafish precursor miRNA fasta file> m <zebrafish mature miRNA fasta file> r <unique reads fasta file> t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis. Heart N/A Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing. Fishes were purchased from a local supplier and acclimatized before tissue extraction. tissue:Heart|genetic background:Wild type Singapore strain GSM1376649 GSM1376649: Heart Replicate 3 sRNAseq; Danio rerio; miRNA Seq GSM1376649   1 Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing. GEO Accession:GSM1376649 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP041544     MZH008_GATCAG_L005_R1.fastq.gz fastq 4401229692.0 57910917.0 GSM1376649 r1 0:76 A:1009381958;C:1130057881;G:1173217392;T:1088123982;N:448479 76       1009381958 1130057881 1173217392 1088123982 448479 SRX529160 SRS598857 SRA160430 GEO Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore 1 0.00129   0.00046   0.99882   0.51351   76   T   under 1.2% mapping rate illumina hiseq_era unknown size_fractionation trueseq bulk unknown unknown   Singapore 2014-04-29 Undetermined Embryo Heart Cardiovascular System
37992 37992 SRR1265765 SRX529159 SRS598856 SRP041544 PRJNA245824 Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish GSE57169 Transcriptome Analysis The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.   pubmed:26574018   Heart Replicate 2 sRNAseq GSM1376648   source name:Heart|tissue:Heart|genetic background:Wild type Singapore strain Heart Replicate 2 sRNAseq Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p <zebrafish precursor miRNA fasta file> m <zebrafish mature miRNA fasta file> r <unique reads fasta file> t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis. Heart N/A Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing. Fishes were purchased from a local supplier and acclimatized before tissue extraction. tissue:Heart|genetic background:Wild type Singapore strain GSM1376648 GSM1376648: Heart Replicate 2 sRNAseq; Danio rerio; miRNA Seq GSM1376648   1 Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing. GEO Accession:GSM1376648 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP041544     MZH007_ACTTGA_L005_R1.fastq.gz fastq 3202357508.0 42136283.0 GSM1376648 r1 0:76 A:666309720;C:845347679;G:846066601;T:844306103;N:327405 76       666309720 845347679 846066601 844306103 327405 SRX529159 SRS598856 SRA160430 GEO Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore 1 0.00042   3e-05   0.99924   0.56521   76   T   under 1.2% mapping rate illumina hiseq_era unknown size_fractionation trueseq bulk unknown unknown   Singapore 2014-04-29 Undetermined Embryo Heart Cardiovascular System
37993 37993 SRR1265764 SRX529158 SRS598855 SRP041544 PRJNA245824 Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish GSE57169 Transcriptome Analysis The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.   pubmed:26574018   Heart Replicate 1 sRNAseq GSM1376647   source name:Heart|tissue:Heart|genetic background:Wild type Singapore strain Heart Replicate 1 sRNAseq Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p <zebrafish precursor miRNA fasta file> m <zebrafish mature miRNA fasta file> r <unique reads fasta file> t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis. Heart N/A Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing. Fishes were purchased from a local supplier and acclimatized before tissue extraction. tissue:Heart|genetic background:Wild type Singapore strain GSM1376647 GSM1376647: Heart Replicate 1 sRNAseq; Danio rerio; miRNA Seq GSM1376647   1 Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing. GEO Accession:GSM1376647 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP041544     MZH002_CAGATC_L005_R1.fastq.gz fastq 3777814232.0 49708082.0 GSM1376647 r1 0:76 A:791204432;C:1050679958;G:1001897360;T:933655799;N:376683 76       791204432 1050679958 1001897360 933655799 376683 SRX529158 SRS598855 SRA160430 GEO Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore 1 0.00034   4e-05   0.99943   0.62264   76   T   under 1.2% mapping rate illumina hiseq_era unknown size_fractionation trueseq bulk unknown unknown   Singapore 2014-04-29 Undetermined Embryo Heart Cardiovascular System
38364 38364 SRR1793802 SRX869237 SRS840014 SRP053359 PRJNA274951 Lymphatic vessels arise from a niche of multipotent angioblasts within the floor of the cardinal vein GSE65751 Transcriptome Analysis How cells acquire their fate is a fundamental question in both developmental and regenerative biology. Multipotent progenitors undergo gradual cell fate restriction in response to temporal and positional cues from the microenvironment the nature of which is far from being clear. In the case of the lymphatic system venous endothelial cells are thought to give rise to lymphatic vessels through a process of trans differentiation. Upon expression of a set of transcription factors venous cells acquire a lymphatic fate and bud out to generate the lymphatic vasculature. In this work we challenge this view and show that while lymphatic endothelial cells LECs do arise in the Cardinal Vein CV they do so from a previously uncharacterized pool of multipotent angioblasts. Using lymphatic specific transgenic zebrafish in combination with endothelial photoconvertible reporters and long term live imaging we demonstrate that these multipotent angioblasts can generate not only lymphatic but also arterious and venous fates. We further reveal that the underlying endoderm serves as a source of Wnt5b which acts as a lymphatic inductive signal promoting the angioblast to lymphatic transition. Moreover Wnt5b induced lymphatic specification in human embryonic stem cells derived vascular progenitors suggesting that this process is evolutionary conserved. Our results uncover a novel mechanism of lymphatic vessel formation whereby multipotent angioblasts and not venous endothelial cells give rise to the lymphatic endothelium and provide the first characterization of their inductive niche. More broadly our findings highlight the CV as a plastic and heterogeneous structure containing different cell populations analogous to the hematopoietic niche in the aortic floor. Overall design: Following Kaede photoconversion of dorsal or ventral halves of the PCV in Tgfli1:gal4;uasKaede embryos at 24 hpf 6 embryos per group were used for FACS isolation of Kaede photconverted red ECs.   pubmed:25992545   d red ZF sample 0012 GSM1604058   tissue:Dorsal endothelial cells|strain:Tgfli1:gal4; uasKaede|developmental stage:24hpf d red ZF sample 0012 Libraries were sequenced on the Illumina HiSeq2500 according to standard paired end sequencing protocols. Primary analysis done in RTA 1.17.20 1.13.48 Conversion from BCL to FASTQ and deumltiplexing using CASAVA 1.8 configureBclToFastq.pl fastq cluster count 1234567890 mismatches 0 use bases mask Y15n I6n Y35n Filter and read trimming barcode minimum quality of 20. trimming of read2 to 35 bases not required. CEL Seq Hashimshony et al. 2012 demultiplexing of second mate using first mate barcode allowing no mismatches in barcode. bowtie2 version 2.1.0 against Zv9 genome Read counting with htseq count version 0.5.4p3. Using on Ensemble Zv9 annotations. Reads with the same unique molecular identifiers UMIs were colapsed for transcript counting. Genome build: Zv9 Supplementary files format and content: Tabular expression matrix includes number of transcript molecules. Dorsal endothelial cells   RNA was isolated using TRIzol with addition of ERCC spike ins and GenElute LPA Sigma The CEL Seq protocol Hashimshony et al. 2012 was used to amplify and sequence. CEL Seq multiplexing barocdes with slite modification were used. Each CEL Seq primer cointained a barcode and a unique moleculare identifier Teemu et al. 2011 The vPCV vs dPCV endothelial cells were analyzed at 24hpf strain:Tgfli1:gal4;uasKaede|developmental stage:24hpf GSM1604058 GSM1604058: d red ZF sample 0012; Danio rerio; RNA Seq GSM1604058   1 RNA was isolated using TRIzol with addition of ERCC spike ins and GenElute LPA Sigma The CEL Seq protocol Hashimshony et al. 2012 was used to amplify and sequence. CEL Seq multiplexing barocdes with slite modification were used. Each CEL Seq primer cointained a barcode and a unique moleculare identifier Teemu et al. 2011 GEO Accession:GSM1604058 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP053359     d_red_ZF_sample_0012.fastq.gz fastq 136949295.0 3912837.0 GSM1604058 r1 0:35 A:38967686;C:29235653;G:29781723;T:38764742;N:199491 35       38967686 29235653 29781723 38764742 199491 SRX869237 SRS840014 SRA236924 GEO Itai Yanai, Biology, Technion - Israel Institute of Technology 1 0.50546   0.22201   0.91524   0.49457   35   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown sc single_cell_plate celseq   Israel 2015-02-09 Pharyngula Embryo Endothelium Cardiovascular System
38365 38365 SRR1793801 SRX869236 SRS840015 SRP053359 PRJNA274951 Lymphatic vessels arise from a niche of multipotent angioblasts within the floor of the cardinal vein GSE65751 Transcriptome Analysis How cells acquire their fate is a fundamental question in both developmental and regenerative biology. Multipotent progenitors undergo gradual cell fate restriction in response to temporal and positional cues from the microenvironment the nature of which is far from being clear. In the case of the lymphatic system venous endothelial cells are thought to give rise to lymphatic vessels through a process of trans differentiation. Upon expression of a set of transcription factors venous cells acquire a lymphatic fate and bud out to generate the lymphatic vasculature. In this work we challenge this view and show that while lymphatic endothelial cells LECs do arise in the Cardinal Vein CV they do so from a previously uncharacterized pool of multipotent angioblasts. Using lymphatic specific transgenic zebrafish in combination with endothelial photoconvertible reporters and long term live imaging we demonstrate that these multipotent angioblasts can generate not only lymphatic but also arterious and venous fates. We further reveal that the underlying endoderm serves as a source of Wnt5b which acts as a lymphatic inductive signal promoting the angioblast to lymphatic transition. Moreover Wnt5b induced lymphatic specification in human embryonic stem cells derived vascular progenitors suggesting that this process is evolutionary conserved. Our results uncover a novel mechanism of lymphatic vessel formation whereby multipotent angioblasts and not venous endothelial cells give rise to the lymphatic endothelium and provide the first characterization of their inductive niche. More broadly our findings highlight the CV as a plastic and heterogeneous structure containing different cell populations analogous to the hematopoietic niche in the aortic floor. Overall design: Following Kaede photoconversion of dorsal or ventral halves of the PCV in Tgfli1:gal4;uasKaede embryos at 24 hpf 6 embryos per group were used for FACS isolation of Kaede photconverted red ECs.   pubmed:25992545   d red ZF sample 0008 GSM1604057   tissue:Dorsal endothelial cells|strain:Tgfli1:gal4; uasKaede|developmental stage:24hpf d red ZF sample 0008 Libraries were sequenced on the Illumina HiSeq2500 according to standard paired end sequencing protocols. Primary analysis done in RTA 1.17.20 1.13.48 Conversion from BCL to FASTQ and deumltiplexing using CASAVA 1.8 configureBclToFastq.pl fastq cluster count 1234567890 mismatches 0 use bases mask Y15n I6n Y35n Filter and read trimming barcode minimum quality of 20. trimming of read2 to 35 bases not required. CEL Seq Hashimshony et al. 2012 demultiplexing of second mate using first mate barcode allowing no mismatches in barcode. bowtie2 version 2.1.0 against Zv9 genome Read counting with htseq count version 0.5.4p3. Using on Ensemble Zv9 annotations. Reads with the same unique molecular identifiers UMIs were colapsed for transcript counting. Genome build: Zv9 Supplementary files format and content: Tabular expression matrix includes number of transcript molecules. Dorsal endothelial cells   RNA was isolated using TRIzol with addition of ERCC spike ins and GenElute LPA Sigma The CEL Seq protocol Hashimshony et al. 2012 was used to amplify and sequence. CEL Seq multiplexing barocdes with slite modification were used. Each CEL Seq primer cointained a barcode and a unique moleculare identifier Teemu et al. 2011 The vPCV vs dPCV endothelial cells were analyzed at 24hpf strain:Tgfli1:gal4;uasKaede|developmental stage:24hpf GSM1604057 GSM1604057: d red ZF sample 0008; Danio rerio; RNA Seq GSM1604057   1 RNA was isolated using TRIzol with addition of ERCC spike ins and GenElute LPA Sigma The CEL Seq protocol Hashimshony et al. 2012 was used to amplify and sequence. CEL Seq multiplexing barocdes with slite modification were used. Each CEL Seq primer cointained a barcode and a unique moleculare identifier Teemu et al. 2011 GEO Accession:GSM1604057 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP053359     d_red_ZF_sample_0008.fastq.gz fastq 230204380.0 6577268.0 GSM1604057 r1 0:35 A:63286154;C:49924891;G:50948035;T:65703538;N:341762 35       63286154 49924891 50948035 65703538 341762 SRX869236 SRS840015 SRA236924 GEO Itai Yanai, Biology, Technion - Israel Institute of Technology 1 0.59898   0.14092   0.89073   0.49292   35   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown sc single_cell_plate celseq   Israel 2015-02-09 Pharyngula Embryo Endothelium Cardiovascular System
38366 38366 SRR1793800 SRX869235 SRS840013 SRP053359 PRJNA274951 Lymphatic vessels arise from a niche of multipotent angioblasts within the floor of the cardinal vein GSE65751 Transcriptome Analysis How cells acquire their fate is a fundamental question in both developmental and regenerative biology. Multipotent progenitors undergo gradual cell fate restriction in response to temporal and positional cues from the microenvironment the nature of which is far from being clear. In the case of the lymphatic system venous endothelial cells are thought to give rise to lymphatic vessels through a process of trans differentiation. Upon expression of a set of transcription factors venous cells acquire a lymphatic fate and bud out to generate the lymphatic vasculature. In this work we challenge this view and show that while lymphatic endothelial cells LECs do arise in the Cardinal Vein CV they do so from a previously uncharacterized pool of multipotent angioblasts. Using lymphatic specific transgenic zebrafish in combination with endothelial photoconvertible reporters and long term live imaging we demonstrate that these multipotent angioblasts can generate not only lymphatic but also arterious and venous fates. We further reveal that the underlying endoderm serves as a source of Wnt5b which acts as a lymphatic inductive signal promoting the angioblast to lymphatic transition. Moreover Wnt5b induced lymphatic specification in human embryonic stem cells derived vascular progenitors suggesting that this process is evolutionary conserved. Our results uncover a novel mechanism of lymphatic vessel formation whereby multipotent angioblasts and not venous endothelial cells give rise to the lymphatic endothelium and provide the first characterization of their inductive niche. More broadly our findings highlight the CV as a plastic and heterogeneous structure containing different cell populations analogous to the hematopoietic niche in the aortic floor. Overall design: Following Kaede photoconversion of dorsal or ventral halves of the PCV in Tgfli1:gal4;uasKaede embryos at 24 hpf 6 embryos per group were used for FACS isolation of Kaede photconverted red ECs.   pubmed:25992545   V red ZF sample 0011 GSM1604056   tissue:Ventral endothelial cells|strain:Tgfli1:gal4; uasKaede|developmental stage:24hpf V red ZF sample 0011 Libraries were sequenced on the Illumina HiSeq2500 according to standard paired end sequencing protocols. Primary analysis done in RTA 1.17.20 1.13.48 Conversion from BCL to FASTQ and deumltiplexing using CASAVA 1.8 configureBclToFastq.pl fastq cluster count 1234567890 mismatches 0 use bases mask Y15n I6n Y35n Filter and read trimming barcode minimum quality of 20. trimming of read2 to 35 bases not required. CEL Seq Hashimshony et al. 2012 demultiplexing of second mate using first mate barcode allowing no mismatches in barcode. bowtie2 version 2.1.0 against Zv9 genome Read counting with htseq count version 0.5.4p3. Using on Ensemble Zv9 annotations. Reads with the same unique molecular identifiers UMIs were colapsed for transcript counting. Genome build: Zv9 Supplementary files format and content: Tabular expression matrix includes number of transcript molecules. Ventral endothelial cells   RNA was isolated using TRIzol with addition of ERCC spike ins and GenElute LPA Sigma The CEL Seq protocol Hashimshony et al. 2012 was used to amplify and sequence. CEL Seq multiplexing barocdes with slite modification were used. Each CEL Seq primer cointained a barcode and a unique moleculare identifier Teemu et al. 2011 The vPCV vs dPCV endothelial cells were analyzed at 24hpf strain:Tgfli1:gal4;uasKaede|developmental stage:24hpf GSM1604056 GSM1604056: V red ZF sample 0011; Danio rerio; RNA Seq GSM1604056   1 RNA was isolated using TRIzol with addition of ERCC spike ins and GenElute LPA Sigma The CEL Seq protocol Hashimshony et al. 2012 was used to amplify and sequence. CEL Seq multiplexing barocdes with slite modification were used. Each CEL Seq primer cointained a barcode and a unique moleculare identifier Teemu et al. 2011 GEO Accession:GSM1604056 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP053359     V_red_ZF_sample_0011.fastq.gz fastq 146319705.0 4180563.0 GSM1604056 r1 0:35 A:40991954;C:30892087;G:32112709;T:42103782;N:219173 35       40991954 30892087 32112709 42103782 219173 SRX869235 SRS840013 SRA236924 GEO Itai Yanai, Biology, Technion - Israel Institute of Technology 1 0.57038   0.16086   0.89014   0.53016   35   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown sc single_cell_plate celseq   Israel 2015-02-09 Pharyngula Embryo Endothelium Cardiovascular System
38367 38367 SRR1793799 SRX869234 SRS840016 SRP053359 PRJNA274951 Lymphatic vessels arise from a niche of multipotent angioblasts within the floor of the cardinal vein GSE65751 Transcriptome Analysis How cells acquire their fate is a fundamental question in both developmental and regenerative biology. Multipotent progenitors undergo gradual cell fate restriction in response to temporal and positional cues from the microenvironment the nature of which is far from being clear. In the case of the lymphatic system venous endothelial cells are thought to give rise to lymphatic vessels through a process of trans differentiation. Upon expression of a set of transcription factors venous cells acquire a lymphatic fate and bud out to generate the lymphatic vasculature. In this work we challenge this view and show that while lymphatic endothelial cells LECs do arise in the Cardinal Vein CV they do so from a previously uncharacterized pool of multipotent angioblasts. Using lymphatic specific transgenic zebrafish in combination with endothelial photoconvertible reporters and long term live imaging we demonstrate that these multipotent angioblasts can generate not only lymphatic but also arterious and venous fates. We further reveal that the underlying endoderm serves as a source of Wnt5b which acts as a lymphatic inductive signal promoting the angioblast to lymphatic transition. Moreover Wnt5b induced lymphatic specification in human embryonic stem cells derived vascular progenitors suggesting that this process is evolutionary conserved. Our results uncover a novel mechanism of lymphatic vessel formation whereby multipotent angioblasts and not venous endothelial cells give rise to the lymphatic endothelium and provide the first characterization of their inductive niche. More broadly our findings highlight the CV as a plastic and heterogeneous structure containing different cell populations analogous to the hematopoietic niche in the aortic floor. Overall design: Following Kaede photoconversion of dorsal or ventral halves of the PCV in Tgfli1:gal4;uasKaede embryos at 24 hpf 6 embryos per group were used for FACS isolation of Kaede photconverted red ECs.   pubmed:25992545   V red ZF sample 0007 GSM1604055   tissue:Ventral endothelial cells|strain:Tgfli1:gal4; uasKaede|developmental stage:24hpf V red ZF sample 0007 Libraries were sequenced on the Illumina HiSeq2500 according to standard paired end sequencing protocols. Primary analysis done in RTA 1.17.20 1.13.48 Conversion from BCL to FASTQ and deumltiplexing using CASAVA 1.8 configureBclToFastq.pl fastq cluster count 1234567890 mismatches 0 use bases mask Y15n I6n Y35n Filter and read trimming barcode minimum quality of 20. trimming of read2 to 35 bases not required. CEL Seq Hashimshony et al. 2012 demultiplexing of second mate using first mate barcode allowing no mismatches in barcode. bowtie2 version 2.1.0 against Zv9 genome Read counting with htseq count version 0.5.4p3. Using on Ensemble Zv9 annotations. Reads with the same unique molecular identifiers UMIs were colapsed for transcript counting. Genome build: Zv9 Supplementary files format and content: Tabular expression matrix includes number of transcript molecules. Ventral endothelial cells   RNA was isolated using TRIzol with addition of ERCC spike ins and GenElute LPA Sigma The CEL Seq protocol Hashimshony et al. 2012 was used to amplify and sequence. CEL Seq multiplexing barocdes with slite modification were used. Each CEL Seq primer cointained a barcode and a unique moleculare identifier Teemu et al. 2011 The vPCV vs dPCV endothelial cells were analyzed at 24hpf strain:Tgfli1:gal4;uasKaede|developmental stage:24hpf GSM1604055 GSM1604055: V red ZF sample 0007; Danio rerio; RNA Seq GSM1604055   1 RNA was isolated using TRIzol with addition of ERCC spike ins and GenElute LPA Sigma The CEL Seq protocol Hashimshony et al. 2012 was used to amplify and sequence. CEL Seq multiplexing barocdes with slite modification were used. Each CEL Seq primer cointained a barcode and a unique moleculare identifier Teemu et al. 2011 GEO Accession:GSM1604055 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP053359     V_red_ZF_sample_0007.fastq.gz fastq 219537045.0 6272487.0 GSM1604055 r1 0:35 A:61562432;C:46586451;G:48274564;T:62792331;N:321267 35       61562432 46586451 48274564 62792331 321267 SRX869234 SRS840016 SRA236924 GEO Itai Yanai, Biology, Technion - Israel Institute of Technology 1 0.57949   0.1659   0.88187   0.51446   35   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown sc single_cell_plate celseq   Israel 2015-02-09 Pharyngula Embryo Endothelium Cardiovascular System
40737 40737 SRR3290613 SRX1660379 SRS1360338 SRP072298 PRJNA316318 Analysis of gene expression during the early stages of zebrafish heart valve development GSE79585 Transcriptome Analysis We report changes in the levels of gene expression between 48hpf hearts and 56hpf hearts the initial stages of valvulogenesis Overall design: 48hpf and 56hpf hearts were dissected and RNA was extracted. RNA profiles were then generated at each stage using Illumina deep sequencing   pubmed:27221222   56hpf con3 ESD 21 N1 GSM2098629   source name:heart|line:AB|tissue:heart|developmental stage:56hpf 56hpf con3 ESD 21 N1 Image analysis and base calling were performed using RTA 1.17.21.3 and CASAVA 1.8.2. Reads were mapped onto the zv9 assembly of Danio rerio genome using Tophat2.0.10 and bowtie 2 2.1.0. Quantification of gene expression has been performed using HTSeq 0.5.4p3. Normalization was performed using DESeq 1.10.1. Genome build: zv9 Supplementary files format and content: tabulated text file containing normalized read counts. heart   Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions. Embryos were collected staged and grown under standard conditions line:AB|tissue:heart|developmental stage:56hpf GSM2098629 GSM2098629: 56hpf con3 ESD 21 N1; Danio rerio; RNA Seq GSM2098629   1 Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions. GEO Accession:GSM2098629 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP072298     ESD-21_N1.fastq.gz fastq 2561571150.0 51231423.0 GSM2098629 r1 0:50 A:738531563;C:525473156;G:523941846;T:773278863;N:345722 50       738531563 525473156 523941846 773278863 345722 SRX1660379 SRS1360338 SRA395278 GEO IGBMC 1 0.90421   0.28766   0.74312   0.52751   50   B   usable mapping rate illumina hiseq_era unknown random_priming unknown bulk unknown unknown   France 2016-03-24 Hatching Embryo Heart Cardiovascular System
40738 40738 SRR3290612 SRX1660378 SRS1360339 SRP072298 PRJNA316318 Analysis of gene expression during the early stages of zebrafish heart valve development GSE79585 Transcriptome Analysis We report changes in the levels of gene expression between 48hpf hearts and 56hpf hearts the initial stages of valvulogenesis Overall design: 48hpf and 56hpf hearts were dissected and RNA was extracted. RNA profiles were then generated at each stage using Illumina deep sequencing   pubmed:27221222   56hpf con2 ESD 20 N8 GSM2098628   source name:heart|line:AB|tissue:heart|developmental stage:56hpf 56hpf con2 ESD 20 N8 Image analysis and base calling were performed using RTA 1.17.21.3 and CASAVA 1.8.2. Reads were mapped onto the zv9 assembly of Danio rerio genome using Tophat2.0.10 and bowtie 2 2.1.0. Quantification of gene expression has been performed using HTSeq 0.5.4p3. Normalization was performed using DESeq 1.10.1. Genome build: zv9 Supplementary files format and content: tabulated text file containing normalized read counts. heart   Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions. Embryos were collected staged and grown under standard conditions line:AB|tissue:heart|developmental stage:56hpf GSM2098628 GSM2098628: 56hpf con2 ESD 20 N8; Danio rerio; RNA Seq GSM2098628   1 Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions. GEO Accession:GSM2098628 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP072298     ESD-20_N8.fastq.gz fastq 2243358450.0 44867169.0 GSM2098628 r1 0:50 A:653175386;C:451218310;G:450082444;T:688620234;N:262076 50       653175386 451218310 450082444 688620234 262076 SRX1660378 SRS1360339 SRA395278 GEO IGBMC 1 0.90525   0.27718   0.74915   0.53438   50   B   usable mapping rate illumina hiseq_era unknown random_priming unknown bulk unknown unknown   France 2016-03-24 Hatching Embryo Heart Cardiovascular System
40739 40739 SRR3290611 SRX1660377 SRS1360340 SRP072298 PRJNA316318 Analysis of gene expression during the early stages of zebrafish heart valve development GSE79585 Transcriptome Analysis We report changes in the levels of gene expression between 48hpf hearts and 56hpf hearts the initial stages of valvulogenesis Overall design: 48hpf and 56hpf hearts were dissected and RNA was extracted. RNA profiles were then generated at each stage using Illumina deep sequencing   pubmed:27221222   56hpf con1 ESD 19 N6 GSM2098627   source name:heart|line:AB|tissue:heart|developmental stage:56hpf 56hpf con1 ESD 19 N6 Image analysis and base calling were performed using RTA 1.17.21.3 and CASAVA 1.8.2. Reads were mapped onto the zv9 assembly of Danio rerio genome using Tophat2.0.10 and bowtie 2 2.1.0. Quantification of gene expression has been performed using HTSeq 0.5.4p3. Normalization was performed using DESeq 1.10.1. Genome build: zv9 Supplementary files format and content: tabulated text file containing normalized read counts. heart   Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions. Embryos were collected staged and grown under standard conditions line:AB|tissue:heart|developmental stage:56hpf GSM2098627 GSM2098627: 56hpf con1 ESD 19 N6; Danio rerio; RNA Seq GSM2098627   1 Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions. GEO Accession:GSM2098627 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP072298     ESD-19_N6.fastq.gz fastq 2100229600.0 42004592.0 GSM2098627 r1 0:50 A:601981170;C:436442080;G:439494399;T:622070663;N:241288 50       601981170 436442080 439494399 622070663 241288 SRX1660377 SRS1360340 SRA395278 GEO IGBMC 1 0.87598   0.32196   0.74146   0.58008   50   B   usable mapping rate illumina hiseq_era unknown random_priming unknown bulk unknown unknown   France 2016-03-24 Hatching Embryo Heart Cardiovascular System
40740 40740 SRR3290610 SRX1660376 SRS1360341 SRP072298 PRJNA316318 Analysis of gene expression during the early stages of zebrafish heart valve development GSE79585 Transcriptome Analysis We report changes in the levels of gene expression between 48hpf hearts and 56hpf hearts the initial stages of valvulogenesis Overall design: 48hpf and 56hpf hearts were dissected and RNA was extracted. RNA profiles were then generated at each stage using Illumina deep sequencing   pubmed:27221222   48hpf con3 ESD 15 N5 GSM2098626   source name:heart|line:AB|tissue:heart|developmental stage:48hpf 48hpf con3 ESD 15 N5 Image analysis and base calling were performed using RTA 1.17.21.3 and CASAVA 1.8.2. Reads were mapped onto the zv9 assembly of Danio rerio genome using Tophat2.0.10 and bowtie 2 2.1.0. Quantification of gene expression has been performed using HTSeq 0.5.4p3. Normalization was performed using DESeq 1.10.1. Genome build: zv9 Supplementary files format and content: tabulated text file containing normalized read counts. heart   Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions. Embryos were collected staged and grown under standard conditions line:AB|tissue:heart|developmental stage:48hpf GSM2098626 GSM2098626: 48hpf con3 ESD 15 N5; Danio rerio; RNA Seq GSM2098626   1 Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions. GEO Accession:GSM2098626 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP072298     ESD-15_N5.fastq.gz fastq 1677511000.0 33550220.0 GSM2098626 r1 0:50 A:515769850;C:312578723;G:314926898;T:534106645;N:128884 50       515769850 312578723 314926898 534106645 128884 SRX1660376 SRS1360341 SRA395278 GEO IGBMC 1 0.88227   0.34705   0.74905   0.40306   50   B   usable mapping rate illumina hiseq_era unknown random_priming unknown bulk unknown unknown   France 2016-03-24 Hatching Embryo Heart Cardiovascular System
40741 40741 SRR3290609 SRX1660375 SRS1360342 SRP072298 PRJNA316318 Analysis of gene expression during the early stages of zebrafish heart valve development GSE79585 Transcriptome Analysis We report changes in the levels of gene expression between 48hpf hearts and 56hpf hearts the initial stages of valvulogenesis Overall design: 48hpf and 56hpf hearts were dissected and RNA was extracted. RNA profiles were then generated at each stage using Illumina deep sequencing   pubmed:27221222   48hpf con2 ESD 14 N3 GSM2098625   source name:heart|line:AB|tissue:heart|developmental stage:48hpf 48hpf con2 ESD 14 N3 Image analysis and base calling were performed using RTA 1.17.21.3 and CASAVA 1.8.2. Reads were mapped onto the zv9 assembly of Danio rerio genome using Tophat2.0.10 and bowtie 2 2.1.0. Quantification of gene expression has been performed using HTSeq 0.5.4p3. Normalization was performed using DESeq 1.10.1. Genome build: zv9 Supplementary files format and content: tabulated text file containing normalized read counts. heart   Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions. Embryos were collected staged and grown under standard conditions line:AB|tissue:heart|developmental stage:48hpf GSM2098625 GSM2098625: 48hpf con2 ESD 14 N3; Danio rerio; RNA Seq GSM2098625   1 Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions. GEO Accession:GSM2098625 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP072298     ESD-14_N3.fastq.gz fastq 3262822450.0 65256449.0 GSM2098625 r1 0:50 A:1003248923;C:599408057;G:606959271;T:1052958480;N:247719 50       1003248923 599408057 606959271 1052958480 247719 SRX1660375 SRS1360342 SRA395278 GEO IGBMC 1 0.8699   0.34134   0.75848   0.48365   50   B   usable mapping rate illumina hiseq_era unknown random_priming unknown bulk unknown unknown   France 2016-03-24 Hatching Embryo Heart Cardiovascular System
40742 40742 SRR3290608 SRX1660374 SRS1360343 SRP072298 PRJNA316318 Analysis of gene expression during the early stages of zebrafish heart valve development GSE79585 Transcriptome Analysis We report changes in the levels of gene expression between 48hpf hearts and 56hpf hearts the initial stages of valvulogenesis Overall design: 48hpf and 56hpf hearts were dissected and RNA was extracted. RNA profiles were then generated at each stage using Illumina deep sequencing   pubmed:27221222   48hpf con1 ESD 13 N1 GSM2098624   source name:heart|line:AB|tissue:heart|developmental stage:48hpf 48hpf con1 ESD 13 N1 Image analysis and base calling were performed using RTA 1.17.21.3 and CASAVA 1.8.2. Reads were mapped onto the zv9 assembly of Danio rerio genome using Tophat2.0.10 and bowtie 2 2.1.0. Quantification of gene expression has been performed using HTSeq 0.5.4p3. Normalization was performed using DESeq 1.10.1. Genome build: zv9 Supplementary files format and content: tabulated text file containing normalized read counts. heart   Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions. Embryos were collected staged and grown under standard conditions line:AB|tissue:heart|developmental stage:48hpf GSM2098624 GSM2098624: 48hpf con1 ESD 13 N1; Danio rerio; RNA Seq GSM2098624   1 Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions. GEO Accession:GSM2098624 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP072298     ESD-13_N1.fastq.gz fastq 1560642600.0 31212852.0 GSM2098624 r1 0:50 A:451261879;C:320132595;G:321545848;T:467582692;N:119586 50       451261879 320132595 321545848 467582692 119586 SRX1660374 SRS1360343 SRA395278 GEO IGBMC 1 0.8654   0.30695   0.74286   0.54249   50   B   usable mapping rate illumina hiseq_era unknown random_priming unknown bulk unknown unknown   France 2016-03-24 Hatching Embryo Heart Cardiovascular System
40970 40970 SRR3498280 SRX1756826 SRS1433357 SRP074847 PRJNA321312 mRNAs Establish and Maintain Uniform Cellular Phenotypes during the Architecture of Complex Tissues GSE81335 Transcriptome Analysis Proper functioning of tissues requires cells to behave in uniform well organized ways. Conversely many diseases involve increased cellular heterogeneity due to genetic and epigenetic alterations. Defining the mechanisms that counteract phenotypic variability is therefore critical to understand how tissues sustain homeostasis. Here we carried out a single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single microRNA miRNA genes and multi gene miRNA families. We found that miRNA mutants exhibit a profound increase in cellular phenotypic variability of specific vascular traits. Genome wide analysis of endothelial miRNA target genes identified antagonistic regulatory nodes of vascular growth and morphogenesis signaling that allow variable cell behaviors when derepressed. Remarkably lack of such miRNA activity greatly sensitized the vascular system to microenvironmental changes induced by pharmacological stress. We uncover a previously unrecognized role of miRNAs as a widespread protective mechanism that limits variability in cellular phenotypes. This discovery marks an important advance in our comprehension of how miRNAs function in the physiology of higher organisms. Overall design: Analysis of differential genes expression in Zebrafish endothelial cells for 4 different developmental stages parent bioproject:PRJNA321317 pubmed:28350988;pubmed:33273096   48hpf E1 GSM2150744   source name:Endothelial cell|developmental stage:48 hpf|tissue:Endothelial|stain:GFP 48hpf E1 Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to Zv9 whole genome using STAR v2.3.0 Fragments Per Kilobase Of Exon Per Million Fragments Mapped FPKM were calculated using Cufflink software Annotation gtf for Zv9 Genome build: Zv9 Supplementary files format and content: tab delimited text files include FPKM values for each Sample . Endothelial cell   Transgenic fish were treated with Liberase to dissociate the cells. post FACS sorting the GFP positive RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols Zebrafish embryos were raised according standard protocols at 28˚C and according to protocols approved by Yale University Institutional Animal Care and Use Committee # 2015 11473. developmental stage:48 hpf|tissue:Endothelial|stain:GFP GSM2150744 GSM2150744: 48hpf E1; Danio rerio; RNA Seq GSM2150744   1 Transgenic fish were treated with Liberase to dissociate the cells. post FACS sorting the GFP positive RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM2150744 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer   SRP074847     EF_034_002_CGATGT_L002_R1.fastq.gz fastq 485202316.0 6384241.0 GSM2150744 r1 0:76 A:128473144;C:107489507;G:107138177;T:135707012;N:6394476 76       128473144 107489507 107138177 135707012 6394476 SRX1756826 SRS1433357 SRA424807 GEO Internal Medicine, Yale University 1 0.89084   0.1385   0.71985   0.4908   76   B   usable mapping rate illumina early_illumina unknown small_rna trueseq bulk unknown unknown   United States 2016-05-11 Hatching Embryo Endothelium Cardiovascular System
40971 40971 SRR3498279 SRX1756825 SRS1433356 SRP074847 PRJNA321312 mRNAs Establish and Maintain Uniform Cellular Phenotypes during the Architecture of Complex Tissues GSE81335 Transcriptome Analysis Proper functioning of tissues requires cells to behave in uniform well organized ways. Conversely many diseases involve increased cellular heterogeneity due to genetic and epigenetic alterations. Defining the mechanisms that counteract phenotypic variability is therefore critical to understand how tissues sustain homeostasis. Here we carried out a single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single microRNA miRNA genes and multi gene miRNA families. We found that miRNA mutants exhibit a profound increase in cellular phenotypic variability of specific vascular traits. Genome wide analysis of endothelial miRNA target genes identified antagonistic regulatory nodes of vascular growth and morphogenesis signaling that allow variable cell behaviors when derepressed. Remarkably lack of such miRNA activity greatly sensitized the vascular system to microenvironmental changes induced by pharmacological stress. We uncover a previously unrecognized role of miRNAs as a widespread protective mechanism that limits variability in cellular phenotypes. This discovery marks an important advance in our comprehension of how miRNAs function in the physiology of higher organisms. Overall design: Analysis of differential genes expression in Zebrafish endothelial cells for 4 different developmental stages parent bioproject:PRJNA321317 pubmed:28350988;pubmed:33273096   24hpf E1 GSM2150743   source name:Endothelial cell|developmental stage:24 hpf|tissue:Endothelial|stain:GFP 24hpf E1 Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to Zv9 whole genome using STAR v2.3.0 Fragments Per Kilobase Of Exon Per Million Fragments Mapped FPKM were calculated using Cufflink software Annotation gtf for Zv9 Genome build: Zv9 Supplementary files format and content: tab delimited text files include FPKM values for each Sample . Endothelial cell   Transgenic fish were treated with Liberase to dissociate the cells. post FACS sorting the GFP positive RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols Zebrafish embryos were raised according standard protocols at 28˚C and according to protocols approved by Yale University Institutional Animal Care and Use Committee # 2015 11473. developmental stage:24 hpf|tissue:Endothelial|stain:GFP GSM2150743 GSM2150743: 24hpf E1; Danio rerio; RNA Seq GSM2150743   1 Transgenic fish were treated with Liberase to dissociate the cells. post FACS sorting the GFP positive RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM2150743 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer   SRP074847     EF_033_001_ATCACG_L002_R1.fastq.gz fastq 426238476.0 5608401.0 GSM2150743 r1 0:76 A:113332066;C:95045840;G:93307502;T:118935708;N:5617360 76       113332066 95045840 93307502 118935708 5617360 SRX1756825 SRS1433356 SRA424807 GEO Internal Medicine, Yale University 1 0.88651   0.15752   0.72805   0.48414   76   B   usable mapping rate illumina early_illumina unknown small_rna trueseq bulk unknown unknown   United States 2016-05-11 Pharyngula Embryo Endothelium Cardiovascular System
40975 40975 SRR3498291 SRX1756837 SRS1433368 SRP074848 PRJNA321321 microRNAs Establish and Maintain Uniform Cellular Phenotypes during the Architecture of Complex Tissues GSE81340 Transcriptome Analysis Proper functioning of tissues requires cells to behave in uniform well organized ways. Conversely many diseases involve increased cellular heterogeneity due to genetic and epigenetic alterations. Defining the mechanisms that counteract phenotypic variability is therefore critical to understand how tissues sustain homeostasis. Here we carried out a single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single microRNA miRNA genes and multi gene miRNA families. We found that miRNA mutants exhibit a profound increase in cellular phenotypic variability of specific vascular traits. Genome wide analysis of endothelial miRNA target genes identified antagonistic regulatory nodes of vascular growth and morphogenesis signaling that allow variable cell behaviors when derepressed. Remarkably lack of such miRNA activity greatly sensitized the vascular system to microenvironmental changes induced by pharmacological stress. We uncover a previously unrecognized role of miRNAs as a widespread protective mechanism that limits variability in cellular phenotypes. This discovery marks an important advance in our comprehension of how miRNAs function in the physiology of higher organisms. Overall design: Analysis of differential genes expression in Zebrafish endothelial cells for 4 different developmental stages in duplicate parent bioproject:PRJNA321317 pubmed:28350988;pubmed:33273096   NoEndo 48hpf E2 GSM2150816   source name:Endothelial cell|developmental stage:48hpf|tissue:Endothelial|stain:GFP NoEndo 48hpf E2 Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to Zv9 whole genome using STAR v2.3.0 Fragments Per Kilobase Of Exon Per Million Fragments Mapped FPKM were calculated using Cufflink software Annotation gtf for Zv9 Genome build: Zv9 Supplementary files format and content: tab delimited text files include RPKM values for each Sample ... Endothelial cell   Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols Zebrafish embryos were raised according standard protocols at 28˚C and according to protocols approved by Yale University Institutional Animal Care and Use Committee # 2015 11473. developmental stage:48hpf|tissue:Endothelial|stain:GFP GSM2150816 GSM2150816: NoEndo 48hpf E2; Danio rerio; miRNA Seq GSM2150816   1 Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM2150816 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer   SRP074848     NoEndo_48hpf_E2.fastq.gz fastq 553364740.0 7281115.0 GSM2150816 r1 0:76 A:129173344;C:134804122;G:141026546;T:148331467;N:29261 76       129173344 134804122 141026546 148331467 29261 SRX1756837 SRS1433368 SRA424808 GEO Internal Medicine, Yale University 1 1e-05   0.0   0.99997   0.0   76   T   under 1.2% mapping rate illumina early_illumina unknown size_fractionation trueseq bulk unknown unknown   United States 2016-05-11 Hatching Embryo Endothelium Cardiovascular System
40976 40976 SRR3498290 SRX1756836 SRS1433367 SRP074848 PRJNA321321 microRNAs Establish and Maintain Uniform Cellular Phenotypes during the Architecture of Complex Tissues GSE81340 Transcriptome Analysis Proper functioning of tissues requires cells to behave in uniform well organized ways. Conversely many diseases involve increased cellular heterogeneity due to genetic and epigenetic alterations. Defining the mechanisms that counteract phenotypic variability is therefore critical to understand how tissues sustain homeostasis. Here we carried out a single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single microRNA miRNA genes and multi gene miRNA families. We found that miRNA mutants exhibit a profound increase in cellular phenotypic variability of specific vascular traits. Genome wide analysis of endothelial miRNA target genes identified antagonistic regulatory nodes of vascular growth and morphogenesis signaling that allow variable cell behaviors when derepressed. Remarkably lack of such miRNA activity greatly sensitized the vascular system to microenvironmental changes induced by pharmacological stress. We uncover a previously unrecognized role of miRNAs as a widespread protective mechanism that limits variability in cellular phenotypes. This discovery marks an important advance in our comprehension of how miRNAs function in the physiology of higher organisms. Overall design: Analysis of differential genes expression in Zebrafish endothelial cells for 4 different developmental stages in duplicate parent bioproject:PRJNA321317 pubmed:28350988;pubmed:33273096   NoEndo 48hpf E1 GSM2150815   source name:Endothelial cell|developmental stage:48hpf|tissue:Endothelial|stain:GFP NoEndo 48hpf E1 Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to Zv9 whole genome using STAR v2.3.0 Fragments Per Kilobase Of Exon Per Million Fragments Mapped FPKM were calculated using Cufflink software Annotation gtf for Zv9 Genome build: Zv9 Supplementary files format and content: tab delimited text files include RPKM values for each Sample ... Endothelial cell   Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols Zebrafish embryos were raised according standard protocols at 28˚C and according to protocols approved by Yale University Institutional Animal Care and Use Committee # 2015 11473. developmental stage:48hpf|tissue:Endothelial|stain:GFP GSM2150815 GSM2150815: NoEndo 48hpf E1; Danio rerio; miRNA Seq GSM2150815   1 Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM2150815 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer   SRP074848     NoEndo_48hpf_E1.fastq.gz fastq 1204752152.0 15852002.0 GSM2150815 r1 0:76 A:297517299;C:293969730;G:317491224;T:295696492;N:77407 76       297517299 293969730 317491224 295696492 77407 SRX1756836 SRS1433367 SRA424808 GEO Internal Medicine, Yale University 1 0.0   0.0   1.0       76   T   under 1.2% mapping rate illumina early_illumina unknown size_fractionation trueseq bulk unknown unknown   United States 2016-05-11 Hatching Embryo Endothelium Cardiovascular System
40977 40977 SRR3498289 SRX1756835 SRS1433366 SRP074848 PRJNA321321 microRNAs Establish and Maintain Uniform Cellular Phenotypes during the Architecture of Complex Tissues GSE81340 Transcriptome Analysis Proper functioning of tissues requires cells to behave in uniform well organized ways. Conversely many diseases involve increased cellular heterogeneity due to genetic and epigenetic alterations. Defining the mechanisms that counteract phenotypic variability is therefore critical to understand how tissues sustain homeostasis. Here we carried out a single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single microRNA miRNA genes and multi gene miRNA families. We found that miRNA mutants exhibit a profound increase in cellular phenotypic variability of specific vascular traits. Genome wide analysis of endothelial miRNA target genes identified antagonistic regulatory nodes of vascular growth and morphogenesis signaling that allow variable cell behaviors when derepressed. Remarkably lack of such miRNA activity greatly sensitized the vascular system to microenvironmental changes induced by pharmacological stress. We uncover a previously unrecognized role of miRNAs as a widespread protective mechanism that limits variability in cellular phenotypes. This discovery marks an important advance in our comprehension of how miRNAs function in the physiology of higher organisms. Overall design: Analysis of differential genes expression in Zebrafish endothelial cells for 4 different developmental stages in duplicate parent bioproject:PRJNA321317 pubmed:28350988;pubmed:33273096   NoEndo 24hpf E1 GSM2150814   source name:Endothelial cell|developmental stage:24hpf|tissue:Endothelial|stain:GFP NoEndo 24hpf E1 Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to Zv9 whole genome using STAR v2.3.0 Fragments Per Kilobase Of Exon Per Million Fragments Mapped FPKM were calculated using Cufflink software Annotation gtf for Zv9 Genome build: Zv9 Supplementary files format and content: tab delimited text files include RPKM values for each Sample ... Endothelial cell   Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols Zebrafish embryos were raised according standard protocols at 28˚C and according to protocols approved by Yale University Institutional Animal Care and Use Committee # 2015 11473. developmental stage:24hpf|tissue:Endothelial|stain:GFP GSM2150814 GSM2150814: NoEndo 24hpf E1; Danio rerio; miRNA Seq GSM2150814   1 Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM2150814 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer   SRP074848     NoEndo_24hpf_E1.fastq.gz fastq 1422085704.0 18711654.0 GSM2150814 r1 0:76 A:347700492;C:356065333;G:376424133;T:341806001;N:89745 76       347700492 356065333 376424133 341806001 89745 SRX1756835 SRS1433366 SRA424808 GEO Internal Medicine, Yale University 1 0.0   0.0   1.0       76   T   under 1.2% mapping rate illumina early_illumina unknown size_fractionation trueseq bulk unknown unknown   United States 2016-05-11 Pharyngula Embryo Endothelium Cardiovascular System
40981 40981 SRR3498285 SRX1756831 SRS1433362 SRP074848 PRJNA321321 microRNAs Establish and Maintain Uniform Cellular Phenotypes during the Architecture of Complex Tissues GSE81340 Transcriptome Analysis Proper functioning of tissues requires cells to behave in uniform well organized ways. Conversely many diseases involve increased cellular heterogeneity due to genetic and epigenetic alterations. Defining the mechanisms that counteract phenotypic variability is therefore critical to understand how tissues sustain homeostasis. Here we carried out a single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single microRNA miRNA genes and multi gene miRNA families. We found that miRNA mutants exhibit a profound increase in cellular phenotypic variability of specific vascular traits. Genome wide analysis of endothelial miRNA target genes identified antagonistic regulatory nodes of vascular growth and morphogenesis signaling that allow variable cell behaviors when derepressed. Remarkably lack of such miRNA activity greatly sensitized the vascular system to microenvironmental changes induced by pharmacological stress. We uncover a previously unrecognized role of miRNAs as a widespread protective mechanism that limits variability in cellular phenotypes. This discovery marks an important advance in our comprehension of how miRNAs function in the physiology of higher organisms. Overall design: Analysis of differential genes expression in Zebrafish endothelial cells for 4 different developmental stages in duplicate parent bioproject:PRJNA321317 pubmed:28350988;pubmed:33273096   Endo 48hpf E2 GSM2150810   source name:Endothelial cell|developmental stage:48hpf|tissue:Endothelial|stain:GFP Endo 48hpf E2 Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to Zv9 whole genome using STAR v2.3.0 Fragments Per Kilobase Of Exon Per Million Fragments Mapped FPKM were calculated using Cufflink software Annotation gtf for Zv9 Genome build: Zv9 Supplementary files format and content: tab delimited text files include RPKM values for each Sample ... Endothelial cell   Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols Zebrafish embryos were raised according standard protocols at 28˚C and according to protocols approved by Yale University Institutional Animal Care and Use Committee # 2015 11473. developmental stage:48hpf|tissue:Endothelial|stain:GFP GSM2150810 GSM2150810: Endo 48hpf E2; Danio rerio; miRNA Seq GSM2150810   1 Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM2150810 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer   SRP074848     Endo_48hpf_E2.fastq.gz fastq 1254556624.0 16507324.0 GSM2150810 r1 0:76 A:316229540;C:323340793;G:307552357;T:307354555;N:79379 76       316229540 323340793 307552357 307354555 79379 SRX1756831 SRS1433362 SRA424808 GEO Internal Medicine, Yale University 1 0.0   0.0   1.0       76   T   under 1.2% mapping rate illumina early_illumina unknown size_fractionation trueseq bulk unknown unknown   United States 2016-05-11 Hatching Embryo Endothelium Cardiovascular System
40982 40982 SRR3498284 SRX1756830 SRS1433361 SRP074848 PRJNA321321 microRNAs Establish and Maintain Uniform Cellular Phenotypes during the Architecture of Complex Tissues GSE81340 Transcriptome Analysis Proper functioning of tissues requires cells to behave in uniform well organized ways. Conversely many diseases involve increased cellular heterogeneity due to genetic and epigenetic alterations. Defining the mechanisms that counteract phenotypic variability is therefore critical to understand how tissues sustain homeostasis. Here we carried out a single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single microRNA miRNA genes and multi gene miRNA families. We found that miRNA mutants exhibit a profound increase in cellular phenotypic variability of specific vascular traits. Genome wide analysis of endothelial miRNA target genes identified antagonistic regulatory nodes of vascular growth and morphogenesis signaling that allow variable cell behaviors when derepressed. Remarkably lack of such miRNA activity greatly sensitized the vascular system to microenvironmental changes induced by pharmacological stress. We uncover a previously unrecognized role of miRNAs as a widespread protective mechanism that limits variability in cellular phenotypes. This discovery marks an important advance in our comprehension of how miRNAs function in the physiology of higher organisms. Overall design: Analysis of differential genes expression in Zebrafish endothelial cells for 4 different developmental stages in duplicate parent bioproject:PRJNA321317 pubmed:28350988;pubmed:33273096   Endo 48hpf E1 GSM2150809   source name:Endothelial cell|developmental stage:48hpf|tissue:Endothelial|stain:GFP Endo 48hpf E1 Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to Zv9 whole genome using STAR v2.3.0 Fragments Per Kilobase Of Exon Per Million Fragments Mapped FPKM were calculated using Cufflink software Annotation gtf for Zv9 Genome build: Zv9 Supplementary files format and content: tab delimited text files include RPKM values for each Sample ... Endothelial cell   Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols Zebrafish embryos were raised according standard protocols at 28˚C and according to protocols approved by Yale University Institutional Animal Care and Use Committee # 2015 11473. developmental stage:48hpf|tissue:Endothelial|stain:GFP GSM2150809 GSM2150809: Endo 48hpf E1; Danio rerio; miRNA Seq GSM2150809   1 Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM2150809 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer   SRP074848     Endo_48hpf_E1.fastq.gz fastq 1449497080.0 19072330.0 GSM2150809 r1 0:76 A:362564557;C:370330864;G:364749441;T:351760774;N:91444 76       362564557 370330864 364749441 351760774 91444 SRX1756830 SRS1433361 SRA424808 GEO Internal Medicine, Yale University 1 0.0   0.0   1.0       76   T   under 1.2% mapping rate illumina early_illumina unknown size_fractionation trueseq bulk unknown unknown   United States 2016-05-11 Hatching Embryo Endothelium Cardiovascular System
40983 40983 SRR3498283 SRX1756829 SRS1433360 SRP074848 PRJNA321321 microRNAs Establish and Maintain Uniform Cellular Phenotypes during the Architecture of Complex Tissues GSE81340 Transcriptome Analysis Proper functioning of tissues requires cells to behave in uniform well organized ways. Conversely many diseases involve increased cellular heterogeneity due to genetic and epigenetic alterations. Defining the mechanisms that counteract phenotypic variability is therefore critical to understand how tissues sustain homeostasis. Here we carried out a single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single microRNA miRNA genes and multi gene miRNA families. We found that miRNA mutants exhibit a profound increase in cellular phenotypic variability of specific vascular traits. Genome wide analysis of endothelial miRNA target genes identified antagonistic regulatory nodes of vascular growth and morphogenesis signaling that allow variable cell behaviors when derepressed. Remarkably lack of such miRNA activity greatly sensitized the vascular system to microenvironmental changes induced by pharmacological stress. We uncover a previously unrecognized role of miRNAs as a widespread protective mechanism that limits variability in cellular phenotypes. This discovery marks an important advance in our comprehension of how miRNAs function in the physiology of higher organisms. Overall design: Analysis of differential genes expression in Zebrafish endothelial cells for 4 different developmental stages in duplicate parent bioproject:PRJNA321317 pubmed:28350988;pubmed:33273096   Endo 24hpf E1 GSM2150808   source name:Endothelial cell|developmental stage:24hpf|tissue:Endothelial|stain:GFP Endo 24hpf E1 Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to Zv9 whole genome using STAR v2.3.0 Fragments Per Kilobase Of Exon Per Million Fragments Mapped FPKM were calculated using Cufflink software Annotation gtf for Zv9 Genome build: Zv9 Supplementary files format and content: tab delimited text files include RPKM values for each Sample ... Endothelial cell   Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols Zebrafish embryos were raised according standard protocols at 28˚C and according to protocols approved by Yale University Institutional Animal Care and Use Committee # 2015 11473. developmental stage:24hpf|tissue:Endothelial|stain:GFP GSM2150808 GSM2150808: Endo 24hpf E1; Danio rerio; miRNA Seq GSM2150808   1 Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM2150808 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer   SRP074848     Endo_24hpf_E1.fastq.gz fastq 1527500440.0 20098690.0 GSM2150808 r1 0:76 A:356712587;C:354608109;G:432977038;T:383106520;N:96186 76       356712587 354608109 432977038 383106520 96186 SRX1756829 SRS1433360 SRA424808 GEO Internal Medicine, Yale University 1 0.0   0.0   1.0       76   T   under 1.2% mapping rate illumina early_illumina unknown size_fractionation trueseq bulk unknown unknown   United States 2016-05-11 Pharyngula Embryo Endothelium Cardiovascular System
41146 41146 SRR3742564 SRX1896783 SRS1539775 SRP077871 PRJNA327749 Gene expression profiles of endothelial cells from mutants and siblings of tsu3994 GSE83987 Transcriptome Analysis Through RNA seq we report endothelial cells from mutants had 1063 up regulated and 132 down regulated genes >2.0 fold with false discovery rate <0.001 when compared to siblings. Overall design: Examination of gene exprssion profiles of endothelial cells from siblings and mutants of tsu3994   pubmed:28003365   Mt GSM2224910   tissue:kdrl:GFP+ Endothelial cells|genetic background:tsu3994;Tgkdrl;GFP cross|genotype/variation:Morphologically mutant embryo|Stage:44 hpf type:Endothelial cells Mt HCS3.3.20 RTA 2.5.2 and bcl2fastq2 v2.16 were used for basecalling. Sequenced reads were remove reads with adaptors and remove reads in which unknown bases are more than 10% remove reads in which unknown bases are more than 10%.We use Bowtie2 with parameters q phred64 sensitive dpad 0 gbar 99999999 mp 1 1 np 1 score min L 0 0.1 p 16 k 200 to map clean reads to reference gene and use BWA with parameters o 1 e 50 i 50 L k 2 l 31 t 4 q 10 to reference genome Danio rerio.GRCz10.dna.toplevel.fa . RSEM is a quantification tool that computed Maximum likelihood abundance estimates using the Expectation Maximization EM algorithm for its statistical model . FPKM fragment Per Kilobase of gene per Megabase of library size method is used in calculated expression level. Genome build: Zv10 Supplementary files format and content: tab delimited text files include FPKM values for each Sample kdrl:GFP+ Endothelial cells   Morphologically normal siblings and mutant embryos from crosses of Tgkdrl:GFP; gbf1tsu3994/+ at 44 hpf were dechorionated and disintegrated completely to prepare single cell suspension. Then kdrl:GFP+ ECs were sorted by flow cytomer FACSAria BD and MoFlo XDP BeckMan and positive cells were confirmed by microscopy. Total mRNAs were extracted with RNeasy Mini Kit QIAGEN. The total RNA samples are first treated with DNase I to degrade any possible DNA contamination. Then the mRNA is enriched by using the oligo dT magnetic beads. Mixed with the fragmentation buffer the mRNA is fragmented into short fragments. Then the first strand of cDNA is synthesized by using random hexamer primer. Buffer dNTPs RNase H and DNA polymerase I are added to synthesize the second strand. The double strand cDNA is purified with magnetic beads. End reparation and 3’ end single nucleotide A adenine addition is then performed. Finally sequencing adaptors are ligated to the fragments. The fragments are enriched by PCR amplification.During the QC step Agilent 2100 Bioanaylzer and ABI StepOnePlus Real Time PCR System are used to qualify and quantify of the sample library. The library products are ready for sequencing via Illumina HiSeqTM 2000 or other sequencer when necessary.   genetic background:tsu3994;Tgkdrl;GFP cross|genotype/variation:Morphologically mutant embryo|Stage:44 hpf type:Endothelial cells GSM2224910 GSM2224910: Mt; Danio rerio; RNA Seq GSM2224910   1 Morphologically normal siblings and mutant embryos from crosses of Tgkdrl:GFP; gbf1tsu3994/+ at 44 hpf were dechorionated and disintegrated completely to prepare single cell suspension. Then kdrl:GFP+ ECs were sorted by flow cytomer FACSAria BD and MoFlo XDP BeckMan and positive cells were confirmed by microscopy. Total mRNAs were extracted with RNeasy Mini Kit QIAGEN. The total RNA samples are first treated with DNase I to degrade any possible DNA contamination. Then the mRNA is enriched by using the oligo dT magnetic beads. Mixed with the fragmentation buffer the mRNA is fragmented into short fragments. Then the first strand of cDNA is synthesized by using random hexamer primer. Buffer dNTPs RNase H and DNA polymerase I are added to synthesize the second strand. The double strand cDNA is purified with magnetic beads. End reparation and 3’ end single nucleotide A adenine addition is then performed. Finally sequencing adaptors are ligated to the fragments. The fragments are enriched by PCR amplification.During the QC step Agilent 2100 Bioanaylzer and ABI StepOnePlus Real Time PCR System are used to qualify and quantify of the sample library. The library products are ready for sequencing via Illumina HiSeqTM 2000 or other sequencer when necessary. GEO Accession:GSM2224910 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 4000   SRP077871     160123_I114_FCH52M2BBXX_L2_WHFISoiqRAABRAAPEI-144_1.fq.gz fastq 262444686.0 5356014.0 GSM2224910 r1 0:49 A:66548564;C:63544339;G:66582385;T:65755749;N:13649 49       66548564 63544339 66582385 65755749 13649 SRX1896783 SRS1539775 SRA437681 GEO Anming Meng, School of Lifesciences, Tsinghua University 1 0.92714   0.05568   0.73423   0.48371   49   B   usable mapping rate illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2016-07-04 Pharyngula Embryo Endothelium Cardiovascular System
41147 41147 SRR3742565 SRX1896783 SRS1539775 SRP077871 PRJNA327749 Gene expression profiles of endothelial cells from mutants and siblings of tsu3994 GSE83987 Transcriptome Analysis Through RNA seq we report endothelial cells from mutants had 1063 up regulated and 132 down regulated genes >2.0 fold with false discovery rate <0.001 when compared to siblings. Overall design: Examination of gene exprssion profiles of endothelial cells from siblings and mutants of tsu3994   pubmed:28003365   Mt GSM2224910   tissue:kdrl:GFP+ Endothelial cells|genetic background:tsu3994;Tgkdrl;GFP cross|genotype/variation:Morphologically mutant embryo|Stage:44 hpf type:Endothelial cells Mt HCS3.3.20 RTA 2.5.2 and bcl2fastq2 v2.16 were used for basecalling. Sequenced reads were remove reads with adaptors and remove reads in which unknown bases are more than 10% remove reads in which unknown bases are more than 10%.We use Bowtie2 with parameters q phred64 sensitive dpad 0 gbar 99999999 mp 1 1 np 1 score min L 0 0.1 p 16 k 200 to map clean reads to reference gene and use BWA with parameters o 1 e 50 i 50 L k 2 l 31 t 4 q 10 to reference genome Danio rerio.GRCz10.dna.toplevel.fa . RSEM is a quantification tool that computed Maximum likelihood abundance estimates using the Expectation Maximization EM algorithm for its statistical model . FPKM fragment Per Kilobase of gene per Megabase of library size method is used in calculated expression level. Genome build: Zv10 Supplementary files format and content: tab delimited text files include FPKM values for each Sample kdrl:GFP+ Endothelial cells   Morphologically normal siblings and mutant embryos from crosses of Tgkdrl:GFP; gbf1tsu3994/+ at 44 hpf were dechorionated and disintegrated completely to prepare single cell suspension. Then kdrl:GFP+ ECs were sorted by flow cytomer FACSAria BD and MoFlo XDP BeckMan and positive cells were confirmed by microscopy. Total mRNAs were extracted with RNeasy Mini Kit QIAGEN. The total RNA samples are first treated with DNase I to degrade any possible DNA contamination. Then the mRNA is enriched by using the oligo dT magnetic beads. Mixed with the fragmentation buffer the mRNA is fragmented into short fragments. Then the first strand of cDNA is synthesized by using random hexamer primer. Buffer dNTPs RNase H and DNA polymerase I are added to synthesize the second strand. The double strand cDNA is purified with magnetic beads. End reparation and 3’ end single nucleotide A adenine addition is then performed. Finally sequencing adaptors are ligated to the fragments. The fragments are enriched by PCR amplification.During the QC step Agilent 2100 Bioanaylzer and ABI StepOnePlus Real Time PCR System are used to qualify and quantify of the sample library. The library products are ready for sequencing via Illumina HiSeqTM 2000 or other sequencer when necessary.   genetic background:tsu3994;Tgkdrl;GFP cross|genotype/variation:Morphologically mutant embryo|Stage:44 hpf type:Endothelial cells GSM2224910 GSM2224910: Mt; Danio rerio; RNA Seq GSM2224910   1 Morphologically normal siblings and mutant embryos from crosses of Tgkdrl:GFP; gbf1tsu3994/+ at 44 hpf were dechorionated and disintegrated completely to prepare single cell suspension. Then kdrl:GFP+ ECs were sorted by flow cytomer FACSAria BD and MoFlo XDP BeckMan and positive cells were confirmed by microscopy. Total mRNAs were extracted with RNeasy Mini Kit QIAGEN. The total RNA samples are first treated with DNase I to degrade any possible DNA contamination. Then the mRNA is enriched by using the oligo dT magnetic beads. Mixed with the fragmentation buffer the mRNA is fragmented into short fragments. Then the first strand of cDNA is synthesized by using random hexamer primer. Buffer dNTPs RNase H and DNA polymerase I are added to synthesize the second strand. The double strand cDNA is purified with magnetic beads. End reparation and 3’ end single nucleotide A adenine addition is then performed. Finally sequencing adaptors are ligated to the fragments. The fragments are enriched by PCR amplification.During the QC step Agilent 2100 Bioanaylzer and ABI StepOnePlus Real Time PCR System are used to qualify and quantify of the sample library. The library products are ready for sequencing via Illumina HiSeqTM 2000 or other sequencer when necessary. GEO Accession:GSM2224910 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 4000   SRP077871     160204_I136_FCH55MNBBXX_L6_WHFISoiqRAABRAAPEI-144_1.fq.gz fastq 448147973.0 9145877.0 GSM2224910 r2 0:49 A:113623842;C:108767789;G:113689061;T:112055179;N:12102 49       113623842 108767789 113689061 112055179 12102 SRX1896783 SRS1539775 SRA437681 GEO Anming Meng, School of Lifesciences, Tsinghua University 1 0.91636   0.05377   0.73545   0.48441   49   B   usable mapping rate illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2016-07-04 Pharyngula Embryo Endothelium Cardiovascular System
41148 41148 SRR3742562 SRX1896782 SRS1539774 SRP077871 PRJNA327749 Gene expression profiles of endothelial cells from mutants and siblings of tsu3994 GSE83987 Transcriptome Analysis Through RNA seq we report endothelial cells from mutants had 1063 up regulated and 132 down regulated genes >2.0 fold with false discovery rate <0.001 when compared to siblings. Overall design: Examination of gene exprssion profiles of endothelial cells from siblings and mutants of tsu3994   pubmed:28003365   Sib GSM2224909   tissue:kdrl:GFP+ Endothelial cells|genetic background:tsu3994;Tgkdrl;GFP cross|genotype/variation:Morphologically normal siblings embryo|Stage:44 hpf type:Endothelial cells Sib HCS3.3.20 RTA 2.5.2 and bcl2fastq2 v2.16 were used for basecalling. Sequenced reads were remove reads with adaptors and remove reads in which unknown bases are more than 10% remove reads in which unknown bases are more than 10%.We use Bowtie2 with parameters q phred64 sensitive dpad 0 gbar 99999999 mp 1 1 np 1 score min L 0 0.1 p 16 k 200 to map clean reads to reference gene and use BWA with parameters o 1 e 50 i 50 L k 2 l 31 t 4 q 10 to reference genome Danio rerio.GRCz10.dna.toplevel.fa . RSEM is a quantification tool that computed Maximum likelihood abundance estimates using the Expectation Maximization EM algorithm for its statistical model . FPKM fragment Per Kilobase of gene per Megabase of library size method is used in calculated expression level. Genome build: Zv10 Supplementary files format and content: tab delimited text files include FPKM values for each Sample kdrl:GFP+ Endothelial cells   Morphologically normal siblings and mutant embryos from crosses of Tgkdrl:GFP; gbf1tsu3994/+ at 44 hpf were dechorionated and disintegrated completely to prepare single cell suspension. Then kdrl:GFP+ ECs were sorted by flow cytomer FACSAria BD and MoFlo XDP BeckMan and positive cells were confirmed by microscopy. Total mRNAs were extracted with RNeasy Mini Kit QIAGEN. The total RNA samples are first treated with DNase I to degrade any possible DNA contamination. Then the mRNA is enriched by using the oligo dT magnetic beads. Mixed with the fragmentation buffer the mRNA is fragmented into short fragments. Then the first strand of cDNA is synthesized by using random hexamer primer. Buffer dNTPs RNase H and DNA polymerase I are added to synthesize the second strand. The double strand cDNA is purified with magnetic beads. End reparation and 3’ end single nucleotide A adenine addition is then performed. Finally sequencing adaptors are ligated to the fragments. The fragments are enriched by PCR amplification.During the QC step Agilent 2100 Bioanaylzer and ABI StepOnePlus Real Time PCR System are used to qualify and quantify of the sample library. The library products are ready for sequencing via Illumina HiSeqTM 2000 or other sequencer when necessary.   genetic background:tsu3994;Tgkdrl;GFP cross|genotype/variation:Morphologically normal siblings embryo|Stage:44 hpf type:Endothelial cells GSM2224909 GSM2224909: Sib; Danio rerio; RNA Seq GSM2224909   1 Morphologically normal siblings and mutant embryos from crosses of Tgkdrl:GFP; gbf1tsu3994/+ at 44 hpf were dechorionated and disintegrated completely to prepare single cell suspension. Then kdrl:GFP+ ECs were sorted by flow cytomer FACSAria BD and MoFlo XDP BeckMan and positive cells were confirmed by microscopy. Total mRNAs were extracted with RNeasy Mini Kit QIAGEN. The total RNA samples are first treated with DNase I to degrade any possible DNA contamination. Then the mRNA is enriched by using the oligo dT magnetic beads. Mixed with the fragmentation buffer the mRNA is fragmented into short fragments. Then the first strand of cDNA is synthesized by using random hexamer primer. Buffer dNTPs RNase H and DNA polymerase I are added to synthesize the second strand. The double strand cDNA is purified with magnetic beads. End reparation and 3’ end single nucleotide A adenine addition is then performed. Finally sequencing adaptors are ligated to the fragments. The fragments are enriched by PCR amplification.During the QC step Agilent 2100 Bioanaylzer and ABI StepOnePlus Real Time PCR System are used to qualify and quantify of the sample library. The library products are ready for sequencing via Illumina HiSeqTM 2000 or other sequencer when necessary. GEO Accession:GSM2224909 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 4000   SRP077871     160123_I114_FCH52M2BBXX_L2_WHFISoiqRAAARAAPEI-100_1.fq.gz fastq 180708423.0 3687927.0 GSM2224909 r1 0:49 A:45675389;C:44261209;G:46002295;T:44768361;N:1169 49       45675389 44261209 46002295 44768361 1169 SRX1896782 SRS1539774 SRA437681 GEO Anming Meng, School of Lifesciences, Tsinghua University 1 0.93956   0.0479   0.75276   0.47889   49   B   usable mapping rate illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2016-07-04 Pharyngula Embryo Endothelium Cardiovascular System
41149 41149 SRR3742563 SRX1896782 SRS1539774 SRP077871 PRJNA327749 Gene expression profiles of endothelial cells from mutants and siblings of tsu3994 GSE83987 Transcriptome Analysis Through RNA seq we report endothelial cells from mutants had 1063 up regulated and 132 down regulated genes >2.0 fold with false discovery rate <0.001 when compared to siblings. Overall design: Examination of gene exprssion profiles of endothelial cells from siblings and mutants of tsu3994   pubmed:28003365   Sib GSM2224909   tissue:kdrl:GFP+ Endothelial cells|genetic background:tsu3994;Tgkdrl;GFP cross|genotype/variation:Morphologically normal siblings embryo|Stage:44 hpf type:Endothelial cells Sib HCS3.3.20 RTA 2.5.2 and bcl2fastq2 v2.16 were used for basecalling. Sequenced reads were remove reads with adaptors and remove reads in which unknown bases are more than 10% remove reads in which unknown bases are more than 10%.We use Bowtie2 with parameters q phred64 sensitive dpad 0 gbar 99999999 mp 1 1 np 1 score min L 0 0.1 p 16 k 200 to map clean reads to reference gene and use BWA with parameters o 1 e 50 i 50 L k 2 l 31 t 4 q 10 to reference genome Danio rerio.GRCz10.dna.toplevel.fa . RSEM is a quantification tool that computed Maximum likelihood abundance estimates using the Expectation Maximization EM algorithm for its statistical model . FPKM fragment Per Kilobase of gene per Megabase of library size method is used in calculated expression level. Genome build: Zv10 Supplementary files format and content: tab delimited text files include FPKM values for each Sample kdrl:GFP+ Endothelial cells   Morphologically normal siblings and mutant embryos from crosses of Tgkdrl:GFP; gbf1tsu3994/+ at 44 hpf were dechorionated and disintegrated completely to prepare single cell suspension. Then kdrl:GFP+ ECs were sorted by flow cytomer FACSAria BD and MoFlo XDP BeckMan and positive cells were confirmed by microscopy. Total mRNAs were extracted with RNeasy Mini Kit QIAGEN. The total RNA samples are first treated with DNase I to degrade any possible DNA contamination. Then the mRNA is enriched by using the oligo dT magnetic beads. Mixed with the fragmentation buffer the mRNA is fragmented into short fragments. Then the first strand of cDNA is synthesized by using random hexamer primer. Buffer dNTPs RNase H and DNA polymerase I are added to synthesize the second strand. The double strand cDNA is purified with magnetic beads. End reparation and 3’ end single nucleotide A adenine addition is then performed. Finally sequencing adaptors are ligated to the fragments. The fragments are enriched by PCR amplification.During the QC step Agilent 2100 Bioanaylzer and ABI StepOnePlus Real Time PCR System are used to qualify and quantify of the sample library. The library products are ready for sequencing via Illumina HiSeqTM 2000 or other sequencer when necessary.   genetic background:tsu3994;Tgkdrl;GFP cross|genotype/variation:Morphologically normal siblings embryo|Stage:44 hpf type:Endothelial cells GSM2224909 GSM2224909: Sib; Danio rerio; RNA Seq GSM2224909   1 Morphologically normal siblings and mutant embryos from crosses of Tgkdrl:GFP; gbf1tsu3994/+ at 44 hpf were dechorionated and disintegrated completely to prepare single cell suspension. Then kdrl:GFP+ ECs were sorted by flow cytomer FACSAria BD and MoFlo XDP BeckMan and positive cells were confirmed by microscopy. Total mRNAs were extracted with RNeasy Mini Kit QIAGEN. The total RNA samples are first treated with DNase I to degrade any possible DNA contamination. Then the mRNA is enriched by using the oligo dT magnetic beads. Mixed with the fragmentation buffer the mRNA is fragmented into short fragments. Then the first strand of cDNA is synthesized by using random hexamer primer. Buffer dNTPs RNase H and DNA polymerase I are added to synthesize the second strand. The double strand cDNA is purified with magnetic beads. End reparation and 3’ end single nucleotide A adenine addition is then performed. Finally sequencing adaptors are ligated to the fragments. The fragments are enriched by PCR amplification.During the QC step Agilent 2100 Bioanaylzer and ABI StepOnePlus Real Time PCR System are used to qualify and quantify of the sample library. The library products are ready for sequencing via Illumina HiSeqTM 2000 or other sequencer when necessary. GEO Accession:GSM2224909 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 4000   SRP077871     160204_I136_FCH55MNBBXX_L6_WHFISoiqRAAARAAPEI-100_1.fq.gz fastq 454459418.0 9274682.0 GSM2224909 r2 0:49 A:114982478;C:111450118;G:115561207;T:112452344;N:13271 49       114982478 111450118 115561207 112452344 13271 SRX1896782 SRS1539774 SRA437681 GEO Anming Meng, School of Lifesciences, Tsinghua University 1 0.92536   0.04644   0.75103   0.47559   49   B   usable mapping rate illumina hiseq_era unknown random_priming unknown bulk unknown unknown   China 2016-07-04 Pharyngula Embryo Endothelium Cardiovascular System
41532 41532 SRR5006039 SRX2337867 SRS1791085 SRP092952 PRJNA352869 The Biotagging toolkit for analysis of specific cell populations in zebrafish reveals gene regulatory logic encoded in the nuclear transcriptome GSE89670 Other Interrogation of gene regulatory circuits in complex organisms requires precise tools for the selection of individual cell types as well as robust methods for tissue specific labeling and biochemical profiling of target proteins. By exploiting multiple transgenesis strategies we have developed a tissue specific binary in vivo biotinylation system in zebrafish termed "biotagging" a versatile methodology that uses genetically encoded components to biotinylate target proteins enabling in depth genome wide analyses of their molecular interactions. Using tissue specific transgenic drivers and individual cell compartment effector lines from our "biotagging" toolkit we demonstrate the specificity of our approach at the biochemical cellular and transcriptional levels. By characterizing the in vivo transcriptional landscape of migratory neural crest and myocardial cells in two different cellular compartments ribosomes and nucleus we identify a comprehensive network of protein coding and non coding RNAs and uncover cis regulatory modules and regulatory logic conferring cell specific identity embedded in the complexity of the non coding nuclear transcriptomes. Our study demonstrates that "biotagging" eliminates background inherent to complex embryonic environments and allows analyses of molecular interactions in any cellular context at highest resolution. Overall design: Examination of RNA seq and ATAC seq using in vivo biotinylated nuclei and polysomes.   pubmed:28402863   Myl7 RNASeq Nuclear 26hpf 2 GSM2386502   source name:Myl7 RNASeq Nuclear 26hpf|strain/background:AB/TU|tissue:myocardium|developmental stage:26hpf|assay:RNA seq stranded|cellular comp1nt:nuclear|ribodepleted:ribodepleted|isolation method:InVivoBiotinylatedNuclei|strand:reverse Myl7 RNASeq Nuclear 26hpf 2 ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using an enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a. BAM files incorporating reads belonging to either DNA strand were generated using custom python script. Genome build: danRer7 Zv9 Supplementary files format and content: bigWig files Myl7 RNASeq Nuclear 26hpf   Nuclei isolation using biotin tagged outer nuclear envelope adapted from INTACT procedure. Polyribosome isolation using biotin tagged Rpl10 protein adapted from TRAP procedure. FACS procedure using cell specific fluorescent marker following gentle dissociation of embryonic tissue. ATAC procedure adapted from Buenostro et al. 2013 adapted for FACS sorted embryonic cells. RNA pools extracted using RNAqueous Micro Scale Total RNA Isolation Kit. Non directional sequencing libraries post polyA selection of RNA transcripts NEBNext® PolyA mRNA Magnetic Isolation Module NEB were built using NEBnext Ultra RNA library kit for Illumina NEB. Following ribodepletion using Ribo ZeroTM Magnetic Kit Epicentre directional RNA seq libraries were constructed using Stranded RNA Seq Library Preparation Kit KAPABiosystems.   strain/background:AB/TU|tissue:myocardium|developmental stage:26hpf|assay:RNA seq stranded|cellular comp1nt:nuclear|ribodepleted:ribodepleted|isolation method:InVivoBiotinylatedNuclei|strand:reverse GSM2386502 GSM2386502: Myl7 RNASeq Nuclear 26hpf 2; Danio rerio; RNA Seq GSM2386502   1 Nuclei isolation using biotin tagged outer nuclear envelope adapted from INTACT procedure. Polyribosome isolation using biotin tagged Rpl10 protein adapted from TRAP procedure. FACS procedure using cell specific fluorescent marker following gentle dissociation of embryonic tissue. ATAC procedure adapted from Buenostro et al. 2013 adapted for FACS sorted embryonic cells. RNA pools extracted using RNAqueous Micro Scale Total RNA Isolation Kit. Non directional sequencing libraries post polyA selection of RNA transcripts NEBNext® PolyA mRNA Magnetic Isolation Module NEB were built using NEBnext Ultra RNA library kit for Illumina NEB. Following ribodepletion using Ribo ZeroTM Magnetic Kit Epicentre directional RNA seq libraries were constructed using Stranded RNA Seq Library Preparation Kit KAPABiosystems. GEO Accession:GSM2386502 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP092952     Myl7_RNASeq_Nuclear_26hpf_2_R1.fastq.gz Myl7_RNASeq_Nuclear_26hpf_2_R2.fastq.gz fastq fastq 5163276312.0 50620356.0 GSM2386502 r1 0:51 1:51 A:1144341926;C:1402381884;G:1460666304;T:1155627236;N:258962 51 51     1144341926 1402381884 1460666304 1155627236 258962 SRX2337867 SRS1791085 SRA491940 GEO Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine 2 0.79148 0.79923 0.1676 0.16851 0.74501 0.74395 0.44104 0.45239 51 51 B B biological fallback assumption illumina hiseq_era unknown poly_a nebnext bulk unknown unknown   United Kingdom 2016-11-08 Pharyngula Embryo Heart Cardiovascular System
41533 41533 SRR5006038 SRX2337866 SRS1791086 SRP092952 PRJNA352869 The Biotagging toolkit for analysis of specific cell populations in zebrafish reveals gene regulatory logic encoded in the nuclear transcriptome GSE89670 Other Interrogation of gene regulatory circuits in complex organisms requires precise tools for the selection of individual cell types as well as robust methods for tissue specific labeling and biochemical profiling of target proteins. By exploiting multiple transgenesis strategies we have developed a tissue specific binary in vivo biotinylation system in zebrafish termed "biotagging" a versatile methodology that uses genetically encoded components to biotinylate target proteins enabling in depth genome wide analyses of their molecular interactions. Using tissue specific transgenic drivers and individual cell compartment effector lines from our "biotagging" toolkit we demonstrate the specificity of our approach at the biochemical cellular and transcriptional levels. By characterizing the in vivo transcriptional landscape of migratory neural crest and myocardial cells in two different cellular compartments ribosomes and nucleus we identify a comprehensive network of protein coding and non coding RNAs and uncover cis regulatory modules and regulatory logic conferring cell specific identity embedded in the complexity of the non coding nuclear transcriptomes. Our study demonstrates that "biotagging" eliminates background inherent to complex embryonic environments and allows analyses of molecular interactions in any cellular context at highest resolution. Overall design: Examination of RNA seq and ATAC seq using in vivo biotinylated nuclei and polysomes.   pubmed:28402863   Myl7 RNASeq Nuclear 26hpf 1 GSM2386501   source name:Myl7 RNASeq Nuclear 26hpf|strain/background:AB/TU|tissue:myocardium|developmental stage:26hpf|assay:RNA seq stranded|cellular comp1nt:nuclear|ribodepleted:ribodepleted|isolation method:InVivoBiotinylatedNuclei|strand:reverse Myl7 RNASeq Nuclear 26hpf 1 ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using an enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a. BAM files incorporating reads belonging to either DNA strand were generated using custom python script. Genome build: danRer7 Zv9 Supplementary files format and content: bigWig files Myl7 RNASeq Nuclear 26hpf   Nuclei isolation using biotin tagged outer nuclear envelope adapted from INTACT procedure. Polyribosome isolation using biotin tagged Rpl10 protein adapted from TRAP procedure. FACS procedure using cell specific fluorescent marker following gentle dissociation of embryonic tissue. ATAC procedure adapted from Buenostro et al. 2013 adapted for FACS sorted embryonic cells. RNA pools extracted using RNAqueous Micro Scale Total RNA Isolation Kit. Non directional sequencing libraries post polyA selection of RNA transcripts NEBNext® PolyA mRNA Magnetic Isolation Module NEB were built using NEBnext Ultra RNA library kit for Illumina NEB. Following ribodepletion using Ribo ZeroTM Magnetic Kit Epicentre directional RNA seq libraries were constructed using Stranded RNA Seq Library Preparation Kit KAPABiosystems.   strain/background:AB/TU|tissue:myocardium|developmental stage:26hpf|assay:RNA seq stranded|cellular comp1nt:nuclear|ribodepleted:ribodepleted|isolation method:InVivoBiotinylatedNuclei|strand:reverse GSM2386501 GSM2386501: Myl7 RNASeq Nuclear 26hpf 1; Danio rerio; RNA Seq GSM2386501   1 Nuclei isolation using biotin tagged outer nuclear envelope adapted from INTACT procedure. Polyribosome isolation using biotin tagged Rpl10 protein adapted from TRAP procedure. FACS procedure using cell specific fluorescent marker following gentle dissociation of embryonic tissue. ATAC procedure adapted from Buenostro et al. 2013 adapted for FACS sorted embryonic cells. RNA pools extracted using RNAqueous Micro Scale Total RNA Isolation Kit. Non directional sequencing libraries post polyA selection of RNA transcripts NEBNext® PolyA mRNA Magnetic Isolation Module NEB were built using NEBnext Ultra RNA library kit for Illumina NEB. Following ribodepletion using Ribo ZeroTM Magnetic Kit Epicentre directional RNA seq libraries were constructed using Stranded RNA Seq Library Preparation Kit KAPABiosystems. GEO Accession:GSM2386501 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP092952     Myl7_RNASeq_Nuclear_26hpf_1_R1.fastq.gz Myl7_RNASeq_Nuclear_26hpf_1_R2.fastq.gz fastq fastq 4985333334.0 48875817.0 GSM2386501 r1 0:51 1:51 A:1030896260;C:1411954598;G:1508330460;T:1033900255;N:251761 51 51     1030896260 1411954598 1508330460 1033900255 251761 SRX2337866 SRS1791086 SRA491940 GEO Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine 2 0.7362 0.7434 0.12786 0.12837 0.75952 0.76065 0.47917 0.48384 51 51 B B biological fallback assumption illumina hiseq_era unknown poly_a nebnext bulk unknown unknown   United Kingdom 2016-11-08 Pharyngula Embryo Heart Cardiovascular System
41681 41681 SRR5119926 SRX2435201 SRS1870197 SRP095331 PRJNA358009 CXCL8 and CXCR1 Remodel the Vascular Niche to Promote Hematopoietic Stem and Progenitor Cell Colonization and Engraftment [wt vs kdrl:cxcr1] GSE92542 Transcriptome Analysis The microenvironment is an important regulator of hematopoietic stem and progenitor cell HSPC biology. Interactions between the niche and stem cells have been difficult to track but recent advances marking fluorescent HSPCs have allowed exquisite visualization in the caudal hematopoietic tissue CHT of the developing zebrafish. Sinusoidal endothelial cells interact closely with HSPCs as they colonize this niche. Here we show that the chemokine cxcl8 and its receptor cxcr1 are abundantly expressed by zebrafish endothelial cells and we identify cxcl8/cxcr1 signaling as a positive regulator of HSPC colonization using genetic gain and loss of function techniques. Single cell tracking experiments demonstrated that this effect is due to an increase in HSPC “cuddling” by endothelial cells thereby increasing CHT residency time and allowing more HSPC cell divisions to occur. Enhanced cxcl8/cxcr1 signaling was associated with an increase in the volume of the CHT and induction of cxcl12a expression favoring HSPC colonization. Finally using parabiotic zebrafish we show that cxcr1 acts stem cell non autonomously to improve the efficiency of donor HSPC engraftment. This work identifies a mechanism by which the hematopoietic niche remodels to promote HSPC engraftment and suggests that cxcl8/cxcr1 signaling is a potential therapeutic target in patients undergoing hematopoietic stem cell transplantation. Overall design: Kdrl:mcherry and kdrl:mcherry;kdrl:cxcr1 zebrafish were dissociated and endothelial cells purified by FACS. RNA seq libraries were prepared from endothelial cells purified from two independent clutches of fish four libraries total. parent bioproject:PRJNA358001 pubmed:28351983   wt clutch2 GSM2432105   tissue:endothelial cells|cell type:endothelial cells wt clutch2 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using cutadapt then mapped to Ensembl GRCz10 whole genome using Tophat 2.0.11 without xxx splicing form calls Transcript abundance and differential expression were calculated with Cufflinks 2.2.1. FPKM values were used to normalize and quantify each transcripts Genome build: GRCz10 Supplementary files format and content: excel files include RPKM values for each Sample endothelial cells   Freshly sorted cells were lysed in Trizol LS and total RNA was extracted by isopropanol precipitation. Libraries were prepared using the SMARTer Universal Low Input RNA kit followed by the Low Input Library Prep Kit for Illumina Clontech Laboratories. Zebrafish embryos were grown under standard conditions in a 28 degree incubator. cell type:endothelial cells GSM2432105 GSM2432105: wt clutch2; Danio rerio; RNA Seq GSM2432105   1 Freshly sorted cells were lysed in Trizol LS and total RNA was extracted by isopropanol precipitation. Libraries were prepared using the SMARTer Universal Low Input RNA kit followed by the Low Input Library Prep Kit for Illumina Clontech Laboratories. GEO Accession:GSM2432105 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP095331     BB-IL8-7_GATCAG_R2.fastq.gz BB-IL8-7_GATCAG_R1.fastq.gz fastq fastq 6054362200.0 30271811.0 GSM2432105 r1 0:100 1:100 A:1586036726;C:1442511502;G:1449390272;T:1575855416;N:568284 100 100     1586036726 1442511502 1449390272 1575855416 568284 SRX2435201 SRS1870197 SRA505250 GEO Oncology/Hematology, Boston Children's Hospital 2 0.68659 0.68507 0.22283 0.22137 0.76067 0.76343 0.57225 0.58743 100 100 B B biological fallback assumption illumina hiseq_era full_length random_priming smarter bulk unknown unknown   United States 2016-12-19 Undetermined Embryo Endothelium Cardiovascular System
41682 41682 SRR5119925 SRX2435200 SRS1870195 SRP095331 PRJNA358009 CXCL8 and CXCR1 Remodel the Vascular Niche to Promote Hematopoietic Stem and Progenitor Cell Colonization and Engraftment [wt vs kdrl:cxcr1] GSE92542 Transcriptome Analysis The microenvironment is an important regulator of hematopoietic stem and progenitor cell HSPC biology. Interactions between the niche and stem cells have been difficult to track but recent advances marking fluorescent HSPCs have allowed exquisite visualization in the caudal hematopoietic tissue CHT of the developing zebrafish. Sinusoidal endothelial cells interact closely with HSPCs as they colonize this niche. Here we show that the chemokine cxcl8 and its receptor cxcr1 are abundantly expressed by zebrafish endothelial cells and we identify cxcl8/cxcr1 signaling as a positive regulator of HSPC colonization using genetic gain and loss of function techniques. Single cell tracking experiments demonstrated that this effect is due to an increase in HSPC “cuddling” by endothelial cells thereby increasing CHT residency time and allowing more HSPC cell divisions to occur. Enhanced cxcl8/cxcr1 signaling was associated with an increase in the volume of the CHT and induction of cxcl12a expression favoring HSPC colonization. Finally using parabiotic zebrafish we show that cxcr1 acts stem cell non autonomously to improve the efficiency of donor HSPC engraftment. This work identifies a mechanism by which the hematopoietic niche remodels to promote HSPC engraftment and suggests that cxcl8/cxcr1 signaling is a potential therapeutic target in patients undergoing hematopoietic stem cell transplantation. Overall design: Kdrl:mcherry and kdrl:mcherry;kdrl:cxcr1 zebrafish were dissociated and endothelial cells purified by FACS. RNA seq libraries were prepared from endothelial cells purified from two independent clutches of fish four libraries total. parent bioproject:PRJNA358001 pubmed:28351983   wt clutch1 GSM2432104   tissue:endothelial cells|cell type:endothelial cells wt clutch1 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using cutadapt then mapped to Ensembl GRCz10 whole genome using Tophat 2.0.11 without xxx splicing form calls Transcript abundance and differential expression were calculated with Cufflinks 2.2.1. FPKM values were used to normalize and quantify each transcripts Genome build: GRCz10 Supplementary files format and content: excel files include RPKM values for each Sample endothelial cells   Freshly sorted cells were lysed in Trizol LS and total RNA was extracted by isopropanol precipitation. Libraries were prepared using the SMARTer Universal Low Input RNA kit followed by the Low Input Library Prep Kit for Illumina Clontech Laboratories. Zebrafish embryos were grown under standard conditions in a 28 degree incubator. cell type:endothelial cells GSM2432104 GSM2432104: wt clutch1; Danio rerio; RNA Seq GSM2432104   1 Freshly sorted cells were lysed in Trizol LS and total RNA was extracted by isopropanol precipitation. Libraries were prepared using the SMARTer Universal Low Input RNA kit followed by the Low Input Library Prep Kit for Illumina Clontech Laboratories. GEO Accession:GSM2432104 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP095331     BB-IL8-3_TGACCA_R1.fastq.gz BB-IL8-3_TGACCA_R2.fastq.gz fastq fastq 4718160000.0 23590800.0 GSM2432104 r1 0:100 1:100 A:1285175152;C:1075055485;G:1078285328;T:1279202852;N:441183 100 100     1285175152 1075055485 1078285328 1279202852 441183 SRX2435200 SRS1870195 SRA505250 GEO Oncology/Hematology, Boston Children's Hospital 2 0.79676 0.7947 0.26445 0.26272 0.71652 0.71924 0.55157 0.55957 100 100 B B biological fallback assumption illumina hiseq_era full_length random_priming smarter bulk unknown unknown   United States 2016-12-19 Undetermined Embryo Endothelium Cardiovascular System
41683 41683 SRR5119924 SRX2435199 SRS1870196 SRP095331 PRJNA358009 CXCL8 and CXCR1 Remodel the Vascular Niche to Promote Hematopoietic Stem and Progenitor Cell Colonization and Engraftment [wt vs kdrl:cxcr1] GSE92542 Transcriptome Analysis The microenvironment is an important regulator of hematopoietic stem and progenitor cell HSPC biology. Interactions between the niche and stem cells have been difficult to track but recent advances marking fluorescent HSPCs have allowed exquisite visualization in the caudal hematopoietic tissue CHT of the developing zebrafish. Sinusoidal endothelial cells interact closely with HSPCs as they colonize this niche. Here we show that the chemokine cxcl8 and its receptor cxcr1 are abundantly expressed by zebrafish endothelial cells and we identify cxcl8/cxcr1 signaling as a positive regulator of HSPC colonization using genetic gain and loss of function techniques. Single cell tracking experiments demonstrated that this effect is due to an increase in HSPC “cuddling” by endothelial cells thereby increasing CHT residency time and allowing more HSPC cell divisions to occur. Enhanced cxcl8/cxcr1 signaling was associated with an increase in the volume of the CHT and induction of cxcl12a expression favoring HSPC colonization. Finally using parabiotic zebrafish we show that cxcr1 acts stem cell non autonomously to improve the efficiency of donor HSPC engraftment. This work identifies a mechanism by which the hematopoietic niche remodels to promote HSPC engraftment and suggests that cxcl8/cxcr1 signaling is a potential therapeutic target in patients undergoing hematopoietic stem cell transplantation. Overall design: Kdrl:mcherry and kdrl:mcherry;kdrl:cxcr1 zebrafish were dissociated and endothelial cells purified by FACS. RNA seq libraries were prepared from endothelial cells purified from two independent clutches of fish four libraries total. parent bioproject:PRJNA358001 pubmed:28351983   kdrl:cxcr1 clutch2 GSM2432103   tissue:endothelial cells|cell type:endothelial cells kdrl:cxcr1 clutch2 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using cutadapt then mapped to Ensembl GRCz10 whole genome using Tophat 2.0.11 without xxx splicing form calls Transcript abundance and differential expression were calculated with Cufflinks 2.2.1. FPKM values were used to normalize and quantify each transcripts Genome build: GRCz10 Supplementary files format and content: excel files include RPKM values for each Sample endothelial cells   Freshly sorted cells were lysed in Trizol LS and total RNA was extracted by isopropanol precipitation. Libraries were prepared using the SMARTer Universal Low Input RNA kit followed by the Low Input Library Prep Kit for Illumina Clontech Laboratories. Zebrafish embryos were grown under standard conditions in a 28 degree incubator. cell type:endothelial cells GSM2432103 GSM2432103: kdrl:cxcr1 clutch2; Danio rerio; RNA Seq GSM2432103   1 Freshly sorted cells were lysed in Trizol LS and total RNA was extracted by isopropanol precipitation. Libraries were prepared using the SMARTer Universal Low Input RNA kit followed by the Low Input Library Prep Kit for Illumina Clontech Laboratories. GEO Accession:GSM2432103 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP095331     BB-IL8-5_GCCAAT_R1.fastq.gz BB-IL8-5_GCCAAT_R2.fastq.gz fastq fastq 4575871400.0 22879357.0 GSM2432103 r1 0:100 1:100 A:1212272291;C:1077863805;G:1079802103;T:1205507838;N:425363 100 100     1212272291 1077863805 1079802103 1205507838 425363 SRX2435199 SRS1870196 SRA505250 GEO Oncology/Hematology, Boston Children's Hospital 2 0.79788 0.79581 0.25639 0.25339 0.74888 0.75195 0.55512 0.56401 100 100 B B biological fallback assumption illumina hiseq_era full_length random_priming smarter bulk unknown unknown   United States 2016-12-19 Undetermined Embryo Endothelium Cardiovascular System
41684 41684 SRR5119923 SRX2435198 SRS1870193 SRP095331 PRJNA358009 CXCL8 and CXCR1 Remodel the Vascular Niche to Promote Hematopoietic Stem and Progenitor Cell Colonization and Engraftment [wt vs kdrl:cxcr1] GSE92542 Transcriptome Analysis The microenvironment is an important regulator of hematopoietic stem and progenitor cell HSPC biology. Interactions between the niche and stem cells have been difficult to track but recent advances marking fluorescent HSPCs have allowed exquisite visualization in the caudal hematopoietic tissue CHT of the developing zebrafish. Sinusoidal endothelial cells interact closely with HSPCs as they colonize this niche. Here we show that the chemokine cxcl8 and its receptor cxcr1 are abundantly expressed by zebrafish endothelial cells and we identify cxcl8/cxcr1 signaling as a positive regulator of HSPC colonization using genetic gain and loss of function techniques. Single cell tracking experiments demonstrated that this effect is due to an increase in HSPC “cuddling” by endothelial cells thereby increasing CHT residency time and allowing more HSPC cell divisions to occur. Enhanced cxcl8/cxcr1 signaling was associated with an increase in the volume of the CHT and induction of cxcl12a expression favoring HSPC colonization. Finally using parabiotic zebrafish we show that cxcr1 acts stem cell non autonomously to improve the efficiency of donor HSPC engraftment. This work identifies a mechanism by which the hematopoietic niche remodels to promote HSPC engraftment and suggests that cxcl8/cxcr1 signaling is a potential therapeutic target in patients undergoing hematopoietic stem cell transplantation. Overall design: Kdrl:mcherry and kdrl:mcherry;kdrl:cxcr1 zebrafish were dissociated and endothelial cells purified by FACS. RNA seq libraries were prepared from endothelial cells purified from two independent clutches of fish four libraries total. parent bioproject:PRJNA358001 pubmed:28351983   kdrl:cxcr1 clutch1 GSM2432102   tissue:endothelial cells|cell type:endothelial cells kdrl:cxcr1 clutch1 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using cutadapt then mapped to Ensembl GRCz10 whole genome using Tophat 2.0.11 without xxx splicing form calls Transcript abundance and differential expression were calculated with Cufflinks 2.2.1. FPKM values were used to normalize and quantify each transcripts Genome build: GRCz10 Supplementary files format and content: excel files include RPKM values for each Sample endothelial cells   Freshly sorted cells were lysed in Trizol LS and total RNA was extracted by isopropanol precipitation. Libraries were prepared using the SMARTer Universal Low Input RNA kit followed by the Low Input Library Prep Kit for Illumina Clontech Laboratories. Zebrafish embryos were grown under standard conditions in a 28 degree incubator. cell type:endothelial cells GSM2432102 GSM2432102: kdrl:cxcr1 clutch1; Danio rerio; RNA Seq GSM2432102   1 Freshly sorted cells were lysed in Trizol LS and total RNA was extracted by isopropanol precipitation. Libraries were prepared using the SMARTer Universal Low Input RNA kit followed by the Low Input Library Prep Kit for Illumina Clontech Laboratories. GEO Accession:GSM2432102 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP095331     BB-IL8-1_ATCACG_R1.fastq.gz BB-IL8-1_ATCACG_R2.fastq.gz fastq fastq 5384509000.0 26922545.0 GSM2432102 r1 0:100 1:100 A:1457197772;C:1237507818;G:1239484699;T:1449819489;N:499222 100 100     1457197772 1237507818 1239484699 1449819489 499222 SRX2435198 SRS1870193 SRA505250 GEO Oncology/Hematology, Boston Children's Hospital 2 0.80446 0.79238 0.24797 0.24691 0.72423 0.72681 0.57301 0.46021 100 100 B B biological fallback assumption illumina hiseq_era full_length random_priming smarter bulk unknown unknown   United States 2016-12-19 Undetermined Embryo Endothelium Cardiovascular System
41827 41827 SRR5251446 SRX2557171 SRS1974564 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs WT miR139 B1 nicoli mutmir AG01645   strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 139|replicate:1|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs WT miR139 B1 AG01645.1 AG01645.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01645.1_R1.fastq.gz fastq 1574284140.0 20714265.0 AG01645.1 R1.fastq.gz 0:76 A:485471345;C:270854124;G:374164721;T:443766613;N:27337 76       485471345 270854124 374164721 443766613 27337 SRX2557171 SRS1974564 SRA537606 Yale University|Genetics Yale University 1 0.82142   0.14068   0.8002   0.5444   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-27 Undetermined Embryo Endothelium Cardiovascular System
41828 41828 SRR5251445 SRX2557170 SRS1974563 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs WT miR139 B2 nicoli mutmir AG01646   strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 139|replicate:2|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs WT miR139 B2 AG01646.1 AG01646.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01646.1_R1.fastq.gz fastq 1484740104.0 19536054.0 AG01646.1 R1.fastq.gz 0:76 A:453388316;C:246477203;G:365031959;T:419816346;N:26280 76       453388316 246477203 365031959 419816346 26280 SRX2557170 SRS1974563 SRA537606 Yale University|Genetics Yale University 1 0.82649   0.1897   0.79862   0.52759   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-28 Undetermined Embryo Endothelium Cardiovascular System
41829 41829 SRR5251444 SRX2557169 SRS1974562 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs WT miR139 B3 nicoli mutmir AG01647   strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 139|replicate:3|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs WT miR139 B3 AG01647.1 AG01647.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01647.1_R1.fastq.gz fastq 881298660.0 11596035.0 AG01647.1 R1.fastq.gz 0:76 A:270675838;C:160127586;G:228157662;T:222301246;N:36328 76       270675838 160127586 228157662 222301246 36328 SRX2557169 SRS1974562 SRA537606 Yale University|Genetics Yale University 1 0.76133   0.15034   0.83341   0.56596   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-28 Undetermined Embryo Endothelium Cardiovascular System
41830 41830 SRR5251443 SRX2557168 SRS1974561 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs Mut miR139 B1 nicoli mutmir AG01648   strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 139 ya302/ya302|molecule:mRNA|condition:miR 139|replicate:1|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs Mut miR139 B1 AG01648.1 AG01648.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01648.1_R1.fastq.gz fastq 637896880.0 8393380.0 AG01648.1 R1.fastq.gz 0:76 A:192829278;C:112701153;G:153321271;T:179019095;N:26083 76       192829278 112701153 153321271 179019095 26083 SRX2557168 SRS1974561 SRA537606 Yale University|Genetics Yale University 1 0.75971   0.1181   0.82171   0.56797   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-28 Undetermined Embryo Endothelium Cardiovascular System
41831 41831 SRR5251442 SRX2557167 SRS1974560 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs Mut miR139 B2 nicoli mutmir AG01649   strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 139 ya302/ya302|molecule:mRNA|condition:miR 139|replicate:2|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs Mut miR139 B2 AG01649.1 AG01649.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01649.1_R1.fastq.gz fastq 849868328.0 11182478.0 AG01649.1 R1.fastq.gz 0:76 A:258225905;C:148467172;G:205165181;T:237974100;N:35970 76       258225905 148467172 205165181 237974100 35970 SRX2557167 SRS1974560 SRA537606 Yale University|Genetics Yale University 1 0.75096   0.14506   0.81507   0.5545   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-28 Undetermined Embryo Endothelium Cardiovascular System
41832 41832 SRR5251441 SRX2557166 SRS1974559 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs Mut miR139 B3 nicoli mutmir AG01650   strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 139 ya302/ya302|molecule:mRNA|condition:miR 139|replicate:3|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs Mut miR139 B3 AG01650.1 AG01650.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01650.1_R1.fastq.gz fastq 998464668.0 13137693.0 AG01650.1 R1.fastq.gz 0:76 A:311526420;C:176545041;G:251852786;T:258497630;N:42791 76       311526420 176545041 251852786 258497630 42791 SRX2557166 SRS1974559 SRA537606 Yale University|Genetics Yale University 1 0.76479   0.11192   0.82674   0.54621   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-28 Undetermined Embryo Endothelium Cardiovascular System
41833 41833 SRR5251440 SRX2557165 SRS1974558 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs WT miR24 B1 nicoli mutmir AG01651   strain:TU/AB|age:51.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 24|replicate:1|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs WT miR24 B1 AG01651.1 AG01651.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01651.1_R1.fastq.gz fastq 570492252.0 7506477.0 AG01651.1 R1.fastq.gz 0:76 A:162512811;C:104071716;G:135730697;T:168149427;N:27601 76       162512811 104071716 135730697 168149427 27601 SRX2557165 SRS1974558 SRA537606 Yale University|Genetics Yale University 1 0.73988   0.10157   0.86647   0.54252   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-28 Undetermined Embryo Endothelium Cardiovascular System
41834 41834 SRR5251439 SRX2557164 SRS1974557 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs WT miR24 B2 nicoli mutmir AG01652   strain:TU/AB|age:51.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 24|replicate:2|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs WT miR24 B2 AG01652.1 AG01652.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01652.1_R1.fastq.gz fastq 1072886148.0 14116923.0 AG01652.1 R1.fastq.gz 0:76 A:338399596;C:192703439;G:242960887;T:298769761;N:52465 76       338399596 192703439 242960887 298769761 52465 SRX2557164 SRS1974557 SRA537606 Yale University|Genetics Yale University 1 0.76456   0.11024   0.89197   0.59214   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-28 Undetermined Embryo Endothelium Cardiovascular System
41835 41835 SRR5251438 SRX2557163 SRS1974556 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs WT miR24 B3 nicoli mutmir AG01653   strain:TU/AB|age:51.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 24|replicate:3|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs WT miR24 B3 AG01653.1 AG01653.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01653.1_R1.fastq.gz fastq 1016374144.0 13373344.0 AG01653.1 R1.fastq.gz 0:76 A:310958343;C:168702106;G:223420046;T:313241363;N:52286 76       310958343 168702106 223420046 313241363 52286 SRX2557163 SRS1974556 SRA537606 Yale University|Genetics Yale University 1 0.75735   0.12224   0.79756   0.55136   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-02-13 Undetermined Embryo Endothelium Cardiovascular System
41836 41836 SRR5251437 SRX2557162 SRS1974555 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs Mut miR24 B1 nicoli mutmir AG01654   strain:TU/AB|age:51.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 24 ya324/? ya325/? ya326/? ya327/?|molecule:mRNA|condition:miR 24|replicate:1|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs Mut miR24 B1 AG01654.1 AG01654.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01654.1_R1.fastq.gz fastq 782170112.0 10291712.0 AG01654.1 R1.fastq.gz 0:76 A:238316720;C:132163709;G:179301544;T:232350598;N:37541 76       238316720 132163709 179301544 232350598 37541 SRX2557162 SRS1974555 SRA537606 Yale University|Genetics Yale University 1 0.7683   0.10712   0.80034   0.55804   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-28 Undetermined Embryo Endothelium Cardiovascular System
41837 41837 SRR5251436 SRX2557161 SRS1974554 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs Mut miR24 B2 nicoli mutmir AG01655   strain:TU/AB|age:51.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 24 ya324/? ya325/? ya326/? ya327/?|molecule:mRNA|condition:miR 24|replicate:2|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs Mut miR24 B2 AG01655.1 AG01655.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01655.1_R1.fastq.gz fastq 1053946340.0 13867715.0 AG01655.1 R1.fastq.gz 0:76 A:318351311;C:191163031;G:240348413;T:304030367;N:53218 76       318351311 191163031 240348413 304030367 53218 SRX2557161 SRS1974554 SRA537606 Yale University|Genetics Yale University 1 0.77588   0.07983   0.83934   0.56228   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-28 Undetermined Embryo Endothelium Cardiovascular System
41838 41838 SRR5251435 SRX2557160 SRS1974553 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs Mut miR24 B3 nicoli mutmir AG01656   strain:TU/AB|age:51.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 24 ya324/? ya325/? ya326/? ya327/?|molecule:mRNA|condition:miR 24|replicate:3|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs Mut miR24 B3 AG01656.1 AG01656.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01656.1_R1.fastq.gz fastq 1182467736.0 15558786.0 AG01656.1 R1.fastq.gz 0:76 A:344465226;C:204677242;G:269228338;T:364036735;N:60195 76       344465226 204677242 269228338 364036735 60195 SRX2557160 SRS1974553 SRA537606 Yale University|Genetics Yale University 1 0.78956   0.13495   0.81517   0.56342   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-02-13 Undetermined Embryo Endothelium Cardiovascular System
41839 41839 SRR5251434 SRX2557159 SRS1974552 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs WT miR223 B1 nicoli mutmir AG01657   strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 223|replicate:1|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs WT miR223 B1 AG01657.1 AG01657.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01657.1_R1.fastq.gz fastq 536336712.0 7057062.0 AG01657.1 R1.fastq.gz 0:76 A:158301607;C:93070120;G:121382262;T:163555487;N:27236 76       158301607 93070120 121382262 163555487 27236 SRX2557159 SRS1974552 SRA537606 Yale University|Genetics Yale University 1 0.76425   0.1278   0.84222   0.55305   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-02-13 Undetermined Embryo Endothelium Cardiovascular System
41840 41840 SRR5251433 SRX2557158 SRS1974551 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs WT miR223 B2 nicoli mutmir AG01658   strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 223|replicate:2|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs WT miR223 B2 AG01658.1 AG01658.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01658.1_R1.fastq.gz fastq 798581856.0 10507656.0 AG01658.1 R1.fastq.gz 0:76 A:241352089;C:134327379;G:183394123;T:239469845;N:38420 76       241352089 134327379 183394123 239469845 38420 SRX2557158 SRS1974551 SRA537606 Yale University|Genetics Yale University 1 0.76221   0.13398   0.82459   0.55228   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-28 Undetermined Embryo Endothelium Cardiovascular System
41841 41841 SRR5251432 SRX2557157 SRS1974550 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs WT miR223 B3 nicoli mutmir AG01659   strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 223|replicate:3|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs WT miR223 B3 AG01659.1 AG01659.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01659.1_R1.fastq.gz fastq 1093998948.0 14394723.0 AG01659.1 R1.fastq.gz 0:76 A:330741822;C:186325335;G:249557623;T:327320449;N:53719 76       330741822 186325335 249557623 327320449 53719 SRX2557157 SRS1974550 SRA537606 Yale University|Genetics Yale University 1 0.77108   0.14674   0.80955   0.55819   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-28 Undetermined Embryo Endothelium Cardiovascular System
41842 41842 SRR5251431 SRX2557156 SRS1974549 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs Mut miR223 B1 nicoli mutmir AG01660   strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 223 ya304/ya304|molecule:mRNA|condition:miR 223|replicate:1|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs Mut miR223 B1 AG01660.1 AG01660.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01660.1_R1.fastq.gz fastq 849905492.0 11182967.0 AG01660.1 R1.fastq.gz 0:76 A:250953875;C:146191904;G:190040699;T:262674911;N:44103 76       250953875 146191904 190040699 262674911 44103 SRX2557156 SRS1974549 SRA537606 Yale University|Genetics Yale University 1 0.7687   0.14192   0.82842   0.5344   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-02-13 Undetermined Embryo Endothelium Cardiovascular System
41843 41843 SRR5251430 SRX2557155 SRS1974548 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs Mut miR223 B2 nicoli mutmir AG01661   strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 223 ya304/ya304|molecule:mRNA|condition:miR 223|replicate:2|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs Mut miR223 B2 AG01661.1 AG01661.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01661.1_R1.fastq.gz fastq 840115400.0 11054150.0 AG01661.1 R1.fastq.gz 0:76 A:257057495;C:141775085;G:188281166;T:252960590;N:41064 76       257057495 141775085 188281166 252960590 41064 SRX2557155 SRS1974548 SRA537606 Yale University|Genetics Yale University 1 0.74292   0.10759   0.83615   0.55136   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-28 Undetermined Embryo Endothelium Cardiovascular System
42141 42141 SRR5443688 SRX2733020 SRS2120917 SRP103805 PRJNA382558 mafba is a downstream transcriptional effector of Vegfc signaling essential for embryonic lymphangiogenesis in zebrafish. GSE97649 Transcriptome Analysis 48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate with 6 brains used per samples. Overall design: wild type vs mutant   pubmed:26253536   48hpf zebrafish FAC sorted endothelial cell mutant 3 GSM2574373   tissue:purified endothelial cell|transgene:kdrl eGFP|genotype:mafba uq4bh mutant 48hpf zebrafish FAC sorted endothelial cell mutant 3 adaptor trimming done by bcl2fastq2 Reads were mapped against the reference genome danRer7/Zv9 using STAR Dobin et al. 2013 and read counts for each gene in the Ensembl annotation were generated using htseq count in the HTSeq python package Anders et al. 2015. Genome build: danRer7/Zv9 Supplementary files format and content: Tab delimited text files include yugene normalised data for each sample purified endothelial cell   48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols   transgene:kdrl eGFP|genotype:mafba uq4bh mutant GSM2574373 GSM2574373: 48hpf zebrafish FAC sorted endothelial cell mutant 3; Danio rerio; RNA Seq GSM2574373   1 48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM2574373 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP103805     M3_S6_L001_R1_001.fastq.gz fastq 1290470348.0 17096427.0 GSM2574373 r1 0:75.48 1:0 A:320847705;C:319435806;G:300073193;T:350044923;N:68721 75 0     320847705 319435806 300073193 350044923 68721 SRX2733020 SRS2120917 SRA553927 GEO Australian Institute for Bioengineering and Nanotechnology 1 0.94339   0.05762   0.72232   0.50799   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified unknown bulk unknown unknown   Australia 2017-04-11 Hatching Embryo Endothelium Cardiovascular System
42142 42142 SRR5443689 SRX2733020 SRS2120917 SRP103805 PRJNA382558 mafba is a downstream transcriptional effector of Vegfc signaling essential for embryonic lymphangiogenesis in zebrafish. GSE97649 Transcriptome Analysis 48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate with 6 brains used per samples. Overall design: wild type vs mutant   pubmed:26253536   48hpf zebrafish FAC sorted endothelial cell mutant 3 GSM2574373   tissue:purified endothelial cell|transgene:kdrl eGFP|genotype:mafba uq4bh mutant 48hpf zebrafish FAC sorted endothelial cell mutant 3 adaptor trimming done by bcl2fastq2 Reads were mapped against the reference genome danRer7/Zv9 using STAR Dobin et al. 2013 and read counts for each gene in the Ensembl annotation were generated using htseq count in the HTSeq python package Anders et al. 2015. Genome build: danRer7/Zv9 Supplementary files format and content: Tab delimited text files include yugene normalised data for each sample purified endothelial cell   48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols   transgene:kdrl eGFP|genotype:mafba uq4bh mutant GSM2574373 GSM2574373: 48hpf zebrafish FAC sorted endothelial cell mutant 3; Danio rerio; RNA Seq GSM2574373   1 48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM2574373 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP103805     M3_S6_L002_R1_001.fastq.gz fastq 1274417413.0 16883601.0 GSM2574373 r2 0:75.48 1:0 A:316659737;C:315517172;G:296527344;T:345645123;N:68037 75 0     316659737 315517172 296527344 345645123 68037 SRX2733020 SRS2120917 SRA553927 GEO Australian Institute for Bioengineering and Nanotechnology 1 0.94193   0.05753   0.7236   0.50991   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified unknown bulk unknown unknown   Australia 2017-04-11 Hatching Embryo Endothelium Cardiovascular System
42143 42143 SRR5443690 SRX2733020 SRS2120917 SRP103805 PRJNA382558 mafba is a downstream transcriptional effector of Vegfc signaling essential for embryonic lymphangiogenesis in zebrafish. GSE97649 Transcriptome Analysis 48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate with 6 brains used per samples. Overall design: wild type vs mutant   pubmed:26253536   48hpf zebrafish FAC sorted endothelial cell mutant 3 GSM2574373   tissue:purified endothelial cell|transgene:kdrl eGFP|genotype:mafba uq4bh mutant 48hpf zebrafish FAC sorted endothelial cell mutant 3 adaptor trimming done by bcl2fastq2 Reads were mapped against the reference genome danRer7/Zv9 using STAR Dobin et al. 2013 and read counts for each gene in the Ensembl annotation were generated using htseq count in the HTSeq python package Anders et al. 2015. Genome build: danRer7/Zv9 Supplementary files format and content: Tab delimited text files include yugene normalised data for each sample purified endothelial cell   48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols   transgene:kdrl eGFP|genotype:mafba uq4bh mutant GSM2574373 GSM2574373: 48hpf zebrafish FAC sorted endothelial cell mutant 3; Danio rerio; RNA Seq GSM2574373   1 48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM2574373 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP103805     M3_S6_L003_R1_001.fastq.gz fastq 1267650302.0 16794051.0 GSM2574373 r3 0:75.48 1:0 A:316851687;C:313922763;G:294562163;T:342271337;N:42352 75 0     316851687 313922763 294562163 342271337 42352 SRX2733020 SRS2120917 SRA553927 GEO Australian Institute for Bioengineering and Nanotechnology 1 0.93935   0.05711   0.72421   0.51344   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified unknown bulk unknown unknown   Australia 2017-04-11 Hatching Embryo Endothelium Cardiovascular System
42144 42144 SRR5443691 SRX2733020 SRS2120917 SRP103805 PRJNA382558 mafba is a downstream transcriptional effector of Vegfc signaling essential for embryonic lymphangiogenesis in zebrafish. GSE97649 Transcriptome Analysis 48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate with 6 brains used per samples. Overall design: wild type vs mutant   pubmed:26253536   48hpf zebrafish FAC sorted endothelial cell mutant 3 GSM2574373   tissue:purified endothelial cell|transgene:kdrl eGFP|genotype:mafba uq4bh mutant 48hpf zebrafish FAC sorted endothelial cell mutant 3 adaptor trimming done by bcl2fastq2 Reads were mapped against the reference genome danRer7/Zv9 using STAR Dobin et al. 2013 and read counts for each gene in the Ensembl annotation were generated using htseq count in the HTSeq python package Anders et al. 2015. Genome build: danRer7/Zv9 Supplementary files format and content: Tab delimited text files include yugene normalised data for each sample purified endothelial cell   48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols   transgene:kdrl eGFP|genotype:mafba uq4bh mutant GSM2574373 GSM2574373: 48hpf zebrafish FAC sorted endothelial cell mutant 3; Danio rerio; RNA Seq GSM2574373   1 48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM2574373 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP103805     M3_S6_L004_R1_001.fastq.gz fastq 1272371755.0 16856553.0 GSM2574373 r4 0:75.48 1:0 A:317627046;C:315030569;G:295859300;T:343808592;N:46248 75 0     317627046 315030569 295859300 343808592 46248 SRX2733020 SRS2120917 SRA553927 GEO Australian Institute for Bioengineering and Nanotechnology 1 0.94038   0.05657   0.72391   0.5115   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified unknown bulk unknown unknown   Australia 2017-04-11 Hatching Embryo Endothelium Cardiovascular System
42145 42145 SRR5443684 SRX2733019 SRS2120916 SRP103805 PRJNA382558 mafba is a downstream transcriptional effector of Vegfc signaling essential for embryonic lymphangiogenesis in zebrafish. GSE97649 Transcriptome Analysis 48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate with 6 brains used per samples. Overall design: wild type vs mutant   pubmed:26253536   48hpf zebrafish FAC sorted endothelial cell mutant 2 GSM2574372   tissue:purified endothelial cell|transgene:kdrl eGFP|genotype:mafba uq4bh mutant 48hpf zebrafish FAC sorted endothelial cell mutant 2 adaptor trimming done by bcl2fastq2 Reads were mapped against the reference genome danRer7/Zv9 using STAR Dobin et al. 2013 and read counts for each gene in the Ensembl annotation were generated using htseq count in the HTSeq python package Anders et al. 2015. Genome build: danRer7/Zv9 Supplementary files format and content: Tab delimited text files include yugene normalised data for each sample purified endothelial cell   48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols   transgene:kdrl eGFP|genotype:mafba uq4bh mutant GSM2574372 GSM2574372: 48hpf zebrafish FAC sorted endothelial cell mutant 2; Danio rerio; RNA Seq GSM2574372   1 48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM2574372 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP103805     M2_S4_L001_R1_001.fastq.gz fastq 1110761224.0 14715439.0 GSM2574372 r1 0:75.48 1:0 A:275638341;C:274879264;G:260426963;T:299738013;N:78643 75 0     275638341 274879264 260426963 299738013 78643 SRX2733019 SRS2120916 SRA553927 GEO Australian Institute for Bioengineering and Nanotechnology 1 0.93377   0.0583   0.73697   0.503   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified unknown bulk unknown unknown   Australia 2017-04-11 Hatching Embryo Endothelium Cardiovascular System
42146 42146 SRR5443685 SRX2733019 SRS2120916 SRP103805 PRJNA382558 mafba is a downstream transcriptional effector of Vegfc signaling essential for embryonic lymphangiogenesis in zebrafish. GSE97649 Transcriptome Analysis 48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate with 6 brains used per samples. Overall design: wild type vs mutant   pubmed:26253536   48hpf zebrafish FAC sorted endothelial cell mutant 2 GSM2574372   tissue:purified endothelial cell|transgene:kdrl eGFP|genotype:mafba uq4bh mutant 48hpf zebrafish FAC sorted endothelial cell mutant 2 adaptor trimming done by bcl2fastq2 Reads were mapped against the reference genome danRer7/Zv9 using STAR Dobin et al. 2013 and read counts for each gene in the Ensembl annotation were generated using htseq count in the HTSeq python package Anders et al. 2015. Genome build: danRer7/Zv9 Supplementary files format and content: Tab delimited text files include yugene normalised data for each sample purified endothelial cell   48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols   transgene:kdrl eGFP|genotype:mafba uq4bh mutant GSM2574372 GSM2574372: 48hpf zebrafish FAC sorted endothelial cell mutant 2; Danio rerio; RNA Seq GSM2574372   1 48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM2574372 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP103805     M2_S4_L002_R1_001.fastq.gz fastq 1096460187.0 14525794.0 GSM2574372 r2 0:75.48 1:0 A:271912949;C:271463678;G:257186071;T:295823949;N:73540 75 0     271912949 271463678 257186071 295823949 73540 SRX2733019 SRS2120916 SRA553927 GEO Australian Institute for Bioengineering and Nanotechnology 1 0.9322   0.05825   0.74054   0.50344   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified unknown bulk unknown unknown   Australia 2017-04-11 Hatching Embryo Endothelium Cardiovascular System
42147 42147 SRR5443686 SRX2733019 SRS2120916 SRP103805 PRJNA382558 mafba is a downstream transcriptional effector of Vegfc signaling essential for embryonic lymphangiogenesis in zebrafish. GSE97649 Transcriptome Analysis 48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate with 6 brains used per samples. Overall design: wild type vs mutant   pubmed:26253536   48hpf zebrafish FAC sorted endothelial cell mutant 2 GSM2574372   tissue:purified endothelial cell|transgene:kdrl eGFP|genotype:mafba uq4bh mutant 48hpf zebrafish FAC sorted endothelial cell mutant 2 adaptor trimming done by bcl2fastq2 Reads were mapped against the reference genome danRer7/Zv9 using STAR Dobin et al. 2013 and read counts for each gene in the Ensembl annotation were generated using htseq count in the HTSeq python package Anders et al. 2015. Genome build: danRer7/Zv9 Supplementary files format and content: Tab delimited text files include yugene normalised data for each sample purified endothelial cell   48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols   transgene:kdrl eGFP|genotype:mafba uq4bh mutant GSM2574372 GSM2574372: 48hpf zebrafish FAC sorted endothelial cell mutant 2; Danio rerio; RNA Seq GSM2574372   1 48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM2574372 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP103805     M2_S4_L003_R1_001.fastq.gz fastq 1091010366.0 14453885.0 GSM2574372 r3 0:75.48 1:0 A:272182496;C:270174883;G:255585422;T:293013773;N:53792 75 0     272182496 270174883 255585422 293013773 53792 SRX2733019 SRS2120916 SRA553927 GEO Australian Institute for Bioengineering and Nanotechnology 1 0.93152   0.05837   0.74168   0.50083   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified unknown bulk unknown unknown   Australia 2017-04-11 Hatching Embryo Endothelium Cardiovascular System
42148 42148 SRR5443687 SRX2733019 SRS2120916 SRP103805 PRJNA382558 mafba is a downstream transcriptional effector of Vegfc signaling essential for embryonic lymphangiogenesis in zebrafish. GSE97649 Transcriptome Analysis 48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate with 6 brains used per samples. Overall design: wild type vs mutant   pubmed:26253536   48hpf zebrafish FAC sorted endothelial cell mutant 2 GSM2574372   tissue:purified endothelial cell|transgene:kdrl eGFP|genotype:mafba uq4bh mutant 48hpf zebrafish FAC sorted endothelial cell mutant 2 adaptor trimming done by bcl2fastq2 Reads were mapped against the reference genome danRer7/Zv9 using STAR Dobin et al. 2013 and read counts for each gene in the Ensembl annotation were generated using htseq count in the HTSeq python package Anders et al. 2015. Genome build: danRer7/Zv9 Supplementary files format and content: Tab delimited text files include yugene normalised data for each sample purified endothelial cell   48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols   transgene:kdrl eGFP|genotype:mafba uq4bh mutant GSM2574372 GSM2574372: 48hpf zebrafish FAC sorted endothelial cell mutant 2; Danio rerio; RNA Seq GSM2574372   1 48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM2574372 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP103805     M2_S4_L004_R1_001.fastq.gz fastq 1094982987.0 14506489.0 GSM2574372 r4 0:75.48 1:0 A:272880331;C:271041484;G:256630523;T:294374054;N:56595 75 0     272880331 271041484 256630523 294374054 56595 SRX2733019 SRS2120916 SRA553927 GEO Australian Institute for Bioengineering and Nanotechnology 1 0.93087   0.05679   0.73791   0.51669   74   B   usable mapping rate illumina nextseq unknown cdna_unspecified unknown bulk unknown unknown   Australia 2017-04-11 Hatching Embryo Endothelium Cardiovascular System
42149 42149 SRR5443680 SRX2733018 SRS2120918 SRP103805 PRJNA382558 mafba is a downstream transcriptional effector of Vegfc signaling essential for embryonic lymphangiogenesis in zebrafish. GSE97649 Transcriptome Analysis 48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate with 6 brains used per samples. Overall design: wild type vs mutant   pubmed:26253536   48hpf zebrafish FAC sorted endothelial cell mutant 1 GSM2574371   tissue:purified endothelial cell|transgene:kdrl eGFP|genotype:mafba uq4bh mutant 48hpf zebrafish FAC sorted endothelial cell mutant 1 adaptor trimming done by bcl2fastq2 Reads were mapped against the reference genome danRer7/Zv9 using STAR Dobin et al. 2013 and read counts for each gene in the Ensembl annotation were generated using htseq count in the HTSeq python package Anders et al. 2015. Genome build: danRer7/Zv9 Supplementary files format and content: Tab delimited text files include yugene normalised data for each sample purified endothelial cell   48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols   transgene:kdrl eGFP|genotype:mafba uq4bh mutant GSM2574371 GSM2574371: 48hpf zebrafish FAC sorted endothelial cell mutant 1; Danio rerio; RNA Seq GSM2574371   1 48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM2574371 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP103805     M1_S2_L001_R1_001.fastq.gz fastq 1191104867.0 15788220.0 GSM2574371 r1 0:75.44 1:0 A:291253611;C:297887900;G:280714676;T:321180057;N:68623 75 0     291253611 297887900 280714676 321180057 68623 SRX2733018 SRS2120918 SRA553927 GEO Australian Institute for Bioengineering and Nanotechnology 1 0.93937   0.05486   0.73841   0.50505   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified unknown bulk unknown unknown   Australia 2017-04-11 Hatching Embryo Endothelium Cardiovascular System
42150 42150 SRR5443681 SRX2733018 SRS2120918 SRP103805 PRJNA382558 mafba is a downstream transcriptional effector of Vegfc signaling essential for embryonic lymphangiogenesis in zebrafish. GSE97649 Transcriptome Analysis 48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate with 6 brains used per samples. Overall design: wild type vs mutant   pubmed:26253536   48hpf zebrafish FAC sorted endothelial cell mutant 1 GSM2574371   tissue:purified endothelial cell|transgene:kdrl eGFP|genotype:mafba uq4bh mutant 48hpf zebrafish FAC sorted endothelial cell mutant 1 adaptor trimming done by bcl2fastq2 Reads were mapped against the reference genome danRer7/Zv9 using STAR Dobin et al. 2013 and read counts for each gene in the Ensembl annotation were generated using htseq count in the HTSeq python package Anders et al. 2015. Genome build: danRer7/Zv9 Supplementary files format and content: Tab delimited text files include yugene normalised data for each sample purified endothelial cell   48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols   transgene:kdrl eGFP|genotype:mafba uq4bh mutant GSM2574371 GSM2574371: 48hpf zebrafish FAC sorted endothelial cell mutant 1; Danio rerio; RNA Seq GSM2574371   1 48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM2574371 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP103805     M1_S2_L002_R1_001.fastq.gz fastq 1175231750.0 15577911.0 GSM2574371 r2 0:75.44 1:0 A:287141469;C:293942288;G:277159611;T:316919071;N:69311 75 0     287141469 293942288 277159611 316919071 69311 SRX2733018 SRS2120918 SRA553927 GEO Australian Institute for Bioengineering and Nanotechnology 1 0.93883   0.05461   0.73841   0.50615   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified unknown bulk unknown unknown   Australia 2017-04-11 Hatching Embryo Endothelium Cardiovascular System
42151 42151 SRR5443682 SRX2733018 SRS2120918 SRP103805 PRJNA382558 mafba is a downstream transcriptional effector of Vegfc signaling essential for embryonic lymphangiogenesis in zebrafish. GSE97649 Transcriptome Analysis 48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate with 6 brains used per samples. Overall design: wild type vs mutant   pubmed:26253536   48hpf zebrafish FAC sorted endothelial cell mutant 1 GSM2574371   tissue:purified endothelial cell|transgene:kdrl eGFP|genotype:mafba uq4bh mutant 48hpf zebrafish FAC sorted endothelial cell mutant 1 adaptor trimming done by bcl2fastq2 Reads were mapped against the reference genome danRer7/Zv9 using STAR Dobin et al. 2013 and read counts for each gene in the Ensembl annotation were generated using htseq count in the HTSeq python package Anders et al. 2015. Genome build: danRer7/Zv9 Supplementary files format and content: Tab delimited text files include yugene normalised data for each sample purified endothelial cell   48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols   transgene:kdrl eGFP|genotype:mafba uq4bh mutant GSM2574371 GSM2574371: 48hpf zebrafish FAC sorted endothelial cell mutant 1; Danio rerio; RNA Seq GSM2574371   1 48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM2574371 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP103805     M1_S2_L003_R1_001.fastq.gz fastq 1170671016.0 15517791.0 GSM2574371 r3 0:75.44 1:0 A:287726896;C:292922993;G:275775803;T:314197498;N:47826 75 0     287726896 292922993 275775803 314197498 47826 SRX2733018 SRS2120918 SRA553927 GEO Australian Institute for Bioengineering and Nanotechnology 1 0.93571   0.05459   0.74168   0.50894   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified unknown bulk unknown unknown   Australia 2017-04-11 Hatching Embryo Endothelium Cardiovascular System

Next page

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;