run_metadata
85 rows where devstage_curation_coarse = "Embryo" and tissue_curation_coarse = "Cancer or Tumor"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 40456 | 40456 | SRR3169301 | SRX1584902 | SRS1302559 | SRP070127 | PRJNA312107 | SATB2 induces transcriptional programs in melanoma that lead to metastatic behavior [RNA Seq] | GSE77922 | Transcriptome Analysis | We report gene expression data for zebrafish melanomas overexpressing human SATB2 and EGFP. Overall design: RNA seq was performed on three biological replicates of primary zebrafish melanoma tumors that were excized from MCR:EGFP control and MCR:SATB2 overexpressing TgBRAF V600E;p53 / ; mitf / zebrafish. | parent bioproject:PRJNA312106 | MCR:SATB2 tumor 3 | GSM2061399 | source name:SATB2 3|tissue:primary melanoma tumor|genotype:Tgmitfa:BRAFV600E; p53 / ; mitfa / | MCR:SATB2 tumor 3 | Quality control of RNA Seq datasets was performed by FastQC18 and Cutadapt19 to remove adaptor sequences and low quality regions. The high quality reads were aligned to UCSC build danRer7 of zebrafish genome using Tophat20 2.0.11 without xxx splicing form calls. Transcript abundance and differential expression were calculated with Cufflinks21 2.2.1. FPKM values were used to normalize and quantify each transcript. Genome build: Danio rerio UCSC danRer7 Supplementary files format and content: tab delimited text file containg the FPKM value of each gene | SATB2 3 | Zebrafish Tgmitfa:BRAFV600E; p53 / ; mitfa / one cell stage embryos were injected with a MiniCoopR expression vector to induce melanocyte specific overexpression of either EGFP control or human SATB2 raised to maturity and monitored for melanoma formation. | Zebrafish melanomas were isolated and mechanically homogenized in RTL buffer Qiagen containing β mercaptoethanol. Tumor lysates were transferred onto a QiaShredder column Qiagen and RNA isolation was performed using the RNA Micro Plus kit Qiagen according to the manufacturers instruction. Total RNA was depleted of ribosomal RNA with the Ribo Zero Gold kit Epicentre. Ribosome depleted RNA was used to create multiplexed RNA seq libraries NEBNext Ultra according to manufacturer's protocol | tissue:primary melanoma tumor|genotype:Tgmitfa:BRAFV600E; p53 / ; mitfa / | GSM2061399 | GSM2061399: MCR:SATB2 tumor 3; Danio rerio; RNA Seq | GSM2061399 | 1 | Zebrafish melanomas were isolated and mechanically homogenized in RTL buffer Qiagen containing β mercaptoethanol. Tumor lysates were transferred onto a QiaShredder column Qiagen and RNA isolation was performed using the RNA Micro Plus kit Qiagen according to the manufacturers instruction. Total RNA was depleted of ribosomal RNA with the Ribo Zero Gold kit Epicentre. Ribosome depleted RNA was used to create multiplexed RNA seq libraries NEBNext Ultra according to manufacturer's protocol | GEO Accession:GSM2061399 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP070127 | EvR-7_R2.fastq.gz EvR-7_R1.fastq.gz | fastq fastq | 9597529848.0 | 47512524.0 | GSM2061399 r1 | 0:101 1:101 | A:2382410076;C:2407580203;G:2401045751;T:2403277437;N:3216381 | 101 | 101 | 2382410076 | 2407580203 | 2401045751 | 2403277437 | 3216381 | SRX1584902 | SRS1302559 | SRA353730 | GEO | Oncology/Hematology, Boston Children's Hospital | 2 | 0.91036 | 0.90143 | 0.35231 | 0.35333 | 0.73701 | 0.74464 | 0.54407 | 0.55412 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2016-02-15 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 40457 | 40457 | SRR3169300 | SRX1584901 | SRS1302560 | SRP070127 | PRJNA312107 | SATB2 induces transcriptional programs in melanoma that lead to metastatic behavior [RNA Seq] | GSE77922 | Transcriptome Analysis | We report gene expression data for zebrafish melanomas overexpressing human SATB2 and EGFP. Overall design: RNA seq was performed on three biological replicates of primary zebrafish melanoma tumors that were excized from MCR:EGFP control and MCR:SATB2 overexpressing TgBRAF V600E;p53 / ; mitf / zebrafish. | parent bioproject:PRJNA312106 | MCR:SATB2 tumor 2 | GSM2061398 | source name:SATB2 2|tissue:primary melanoma tumor|genotype:Tgmitfa:BRAFV600E; p53 / ; mitfa / | MCR:SATB2 tumor 2 | Quality control of RNA Seq datasets was performed by FastQC18 and Cutadapt19 to remove adaptor sequences and low quality regions. The high quality reads were aligned to UCSC build danRer7 of zebrafish genome using Tophat20 2.0.11 without xxx splicing form calls. Transcript abundance and differential expression were calculated with Cufflinks21 2.2.1. FPKM values were used to normalize and quantify each transcript. Genome build: Danio rerio UCSC danRer7 Supplementary files format and content: tab delimited text file containg the FPKM value of each gene | SATB2 2 | Zebrafish Tgmitfa:BRAFV600E; p53 / ; mitfa / one cell stage embryos were injected with a MiniCoopR expression vector to induce melanocyte specific overexpression of either EGFP control or human SATB2 raised to maturity and monitored for melanoma formation. | Zebrafish melanomas were isolated and mechanically homogenized in RTL buffer Qiagen containing β mercaptoethanol. Tumor lysates were transferred onto a QiaShredder column Qiagen and RNA isolation was performed using the RNA Micro Plus kit Qiagen according to the manufacturers instruction. Total RNA was depleted of ribosomal RNA with the Ribo Zero Gold kit Epicentre. Ribosome depleted RNA was used to create multiplexed RNA seq libraries NEBNext Ultra according to manufacturer's protocol | tissue:primary melanoma tumor|genotype:Tgmitfa:BRAFV600E; p53 / ; mitfa / | GSM2061398 | GSM2061398: MCR:SATB2 tumor 2; Danio rerio; RNA Seq | GSM2061398 | 1 | Zebrafish melanomas were isolated and mechanically homogenized in RTL buffer Qiagen containing β mercaptoethanol. Tumor lysates were transferred onto a QiaShredder column Qiagen and RNA isolation was performed using the RNA Micro Plus kit Qiagen according to the manufacturers instruction. Total RNA was depleted of ribosomal RNA with the Ribo Zero Gold kit Epicentre. Ribosome depleted RNA was used to create multiplexed RNA seq libraries NEBNext Ultra according to manufacturer's protocol | GEO Accession:GSM2061398 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP070127 | EvR-6_R1.fastq.gz EvR-6_R2.fastq.gz | fastq fastq | 8239248720.0 | 40788360.0 | GSM2061398 r1 | 0:101 1:101 | A:2050158124;C:2039805258;G:2055117618;T:2091456014;N:2711706 | 101 | 101 | 2050158124 | 2039805258 | 2055117618 | 2091456014 | 2711706 | SRX1584901 | SRS1302560 | SRA353730 | GEO | Oncology/Hematology, Boston Children's Hospital | 2 | 0.89794 | 0.89327 | 0.4125 | 0.40937 | 0.74 | 0.74598 | 0.49301 | 0.51668 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2016-02-15 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 40458 | 40458 | SRR3169299 | SRX1584900 | SRS1302561 | SRP070127 | PRJNA312107 | SATB2 induces transcriptional programs in melanoma that lead to metastatic behavior [RNA Seq] | GSE77922 | Transcriptome Analysis | We report gene expression data for zebrafish melanomas overexpressing human SATB2 and EGFP. Overall design: RNA seq was performed on three biological replicates of primary zebrafish melanoma tumors that were excized from MCR:EGFP control and MCR:SATB2 overexpressing TgBRAF V600E;p53 / ; mitf / zebrafish. | parent bioproject:PRJNA312106 | MCR:SATB2 tumor 1 | GSM2061397 | source name:SATB2 1|tissue:primary melanoma tumor|genotype:Tgmitfa:BRAFV600E; p53 / ; mitfa / | MCR:SATB2 tumor 1 | Quality control of RNA Seq datasets was performed by FastQC18 and Cutadapt19 to remove adaptor sequences and low quality regions. The high quality reads were aligned to UCSC build danRer7 of zebrafish genome using Tophat20 2.0.11 without xxx splicing form calls. Transcript abundance and differential expression were calculated with Cufflinks21 2.2.1. FPKM values were used to normalize and quantify each transcript. Genome build: Danio rerio UCSC danRer7 Supplementary files format and content: tab delimited text file containg the FPKM value of each gene | SATB2 1 | Zebrafish Tgmitfa:BRAFV600E; p53 / ; mitfa / one cell stage embryos were injected with a MiniCoopR expression vector to induce melanocyte specific overexpression of either EGFP control or human SATB2 raised to maturity and monitored for melanoma formation. | Zebrafish melanomas were isolated and mechanically homogenized in RTL buffer Qiagen containing β mercaptoethanol. Tumor lysates were transferred onto a QiaShredder column Qiagen and RNA isolation was performed using the RNA Micro Plus kit Qiagen according to the manufacturers instruction. Total RNA was depleted of ribosomal RNA with the Ribo Zero Gold kit Epicentre. Ribosome depleted RNA was used to create multiplexed RNA seq libraries NEBNext Ultra according to manufacturer's protocol | tissue:primary melanoma tumor|genotype:Tgmitfa:BRAFV600E; p53 / ; mitfa / | GSM2061397 | GSM2061397: MCR:SATB2 tumor 1; Danio rerio; RNA Seq | GSM2061397 | 1 | Zebrafish melanomas were isolated and mechanically homogenized in RTL buffer Qiagen containing β mercaptoethanol. Tumor lysates were transferred onto a QiaShredder column Qiagen and RNA isolation was performed using the RNA Micro Plus kit Qiagen according to the manufacturers instruction. Total RNA was depleted of ribosomal RNA with the Ribo Zero Gold kit Epicentre. Ribosome depleted RNA was used to create multiplexed RNA seq libraries NEBNext Ultra according to manufacturer's protocol | GEO Accession:GSM2061397 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP070127 | EvR-5_R1.fastq.gz EvR-5_R2.fastq.gz | fastq fastq | 9154990470.0 | 45321735.0 | GSM2061397 r1 | 0:101 1:101 | A:2196552266;C:2343147947;G:2363804516;T:2248519959;N:2965782 | 101 | 101 | 2196552266 | 2343147947 | 2363804516 | 2248519959 | 2965782 | SRX1584900 | SRS1302561 | SRA353730 | GEO | Oncology/Hematology, Boston Children's Hospital | 2 | 0.93607 | 0.93161 | 0.24224 | 0.23511 | 0.75343 | 0.7587 | 0.50166 | 0.50302 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2016-02-15 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 40459 | 40459 | SRR3169298 | SRX1584899 | SRS1302562 | SRP070127 | PRJNA312107 | SATB2 induces transcriptional programs in melanoma that lead to metastatic behavior [RNA Seq] | GSE77922 | Transcriptome Analysis | We report gene expression data for zebrafish melanomas overexpressing human SATB2 and EGFP. Overall design: RNA seq was performed on three biological replicates of primary zebrafish melanoma tumors that were excized from MCR:EGFP control and MCR:SATB2 overexpressing TgBRAF V600E;p53 / ; mitf / zebrafish. | parent bioproject:PRJNA312106 | MCR:EGFP tumor 3 | GSM2061396 | source name:EGFP 3|tissue:primary melanoma tumor|genotype:Tgmitfa:BRAFV600E; p53 / ; mitfa / | MCR:EGFP tumor 3 | Quality control of RNA Seq datasets was performed by FastQC18 and Cutadapt19 to remove adaptor sequences and low quality regions. The high quality reads were aligned to UCSC build danRer7 of zebrafish genome using Tophat20 2.0.11 without xxx splicing form calls. Transcript abundance and differential expression were calculated with Cufflinks21 2.2.1. FPKM values were used to normalize and quantify each transcript. Genome build: Danio rerio UCSC danRer7 Supplementary files format and content: tab delimited text file containg the FPKM value of each gene | EGFP 3 | Zebrafish Tgmitfa:BRAFV600E; p53 / ; mitfa / one cell stage embryos were injected with a MiniCoopR expression vector to induce melanocyte specific overexpression of either EGFP control or human SATB2 raised to maturity and monitored for melanoma formation. | Zebrafish melanomas were isolated and mechanically homogenized in RTL buffer Qiagen containing β mercaptoethanol. Tumor lysates were transferred onto a QiaShredder column Qiagen and RNA isolation was performed using the RNA Micro Plus kit Qiagen according to the manufacturers instruction. Total RNA was depleted of ribosomal RNA with the Ribo Zero Gold kit Epicentre. Ribosome depleted RNA was used to create multiplexed RNA seq libraries NEBNext Ultra according to manufacturer's protocol | tissue:primary melanoma tumor|genotype:Tgmitfa:BRAFV600E; p53 / ; mitfa / | GSM2061396 | GSM2061396: MCR:EGFP tumor 3; Danio rerio; RNA Seq | GSM2061396 | 1 | Zebrafish melanomas were isolated and mechanically homogenized in RTL buffer Qiagen containing β mercaptoethanol. Tumor lysates were transferred onto a QiaShredder column Qiagen and RNA isolation was performed using the RNA Micro Plus kit Qiagen according to the manufacturers instruction. Total RNA was depleted of ribosomal RNA with the Ribo Zero Gold kit Epicentre. Ribosome depleted RNA was used to create multiplexed RNA seq libraries NEBNext Ultra according to manufacturer's protocol | GEO Accession:GSM2061396 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP070127 | EvR-3_R2.fastq.gz EvR-3_R1.fastq.gz | fastq fastq | 8307858828.0 | 41128014.0 | GSM2061396 r1 | 0:101 1:101 | A:2148512897;C:1987958154;G:2004557741;T:2164084488;N:2745548 | 101 | 101 | 2148512897 | 1987958154 | 2004557741 | 2164084488 | 2745548 | SRX1584899 | SRS1302562 | SRA353730 | GEO | Oncology/Hematology, Boston Children's Hospital | 2 | 0.89808 | 0.88969 | 0.36112 | 0.35518 | 0.719 | 0.72711 | 0.50262 | 0.49961 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2016-02-15 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 40460 | 40460 | SRR3169297 | SRX1584898 | SRS1302563 | SRP070127 | PRJNA312107 | SATB2 induces transcriptional programs in melanoma that lead to metastatic behavior [RNA Seq] | GSE77922 | Transcriptome Analysis | We report gene expression data for zebrafish melanomas overexpressing human SATB2 and EGFP. Overall design: RNA seq was performed on three biological replicates of primary zebrafish melanoma tumors that were excized from MCR:EGFP control and MCR:SATB2 overexpressing TgBRAF V600E;p53 / ; mitf / zebrafish. | parent bioproject:PRJNA312106 | MCR:EGFP tumor 2 | GSM2061395 | source name:EGFP 2|tissue:primary melanoma tumor|genotype:Tgmitfa:BRAFV600E; p53 / ; mitfa / | MCR:EGFP tumor 2 | Quality control of RNA Seq datasets was performed by FastQC18 and Cutadapt19 to remove adaptor sequences and low quality regions. The high quality reads were aligned to UCSC build danRer7 of zebrafish genome using Tophat20 2.0.11 without xxx splicing form calls. Transcript abundance and differential expression were calculated with Cufflinks21 2.2.1. FPKM values were used to normalize and quantify each transcript. Genome build: Danio rerio UCSC danRer7 Supplementary files format and content: tab delimited text file containg the FPKM value of each gene | EGFP 2 | Zebrafish Tgmitfa:BRAFV600E; p53 / ; mitfa / one cell stage embryos were injected with a MiniCoopR expression vector to induce melanocyte specific overexpression of either EGFP control or human SATB2 raised to maturity and monitored for melanoma formation. | Zebrafish melanomas were isolated and mechanically homogenized in RTL buffer Qiagen containing β mercaptoethanol. Tumor lysates were transferred onto a QiaShredder column Qiagen and RNA isolation was performed using the RNA Micro Plus kit Qiagen according to the manufacturers instruction. Total RNA was depleted of ribosomal RNA with the Ribo Zero Gold kit Epicentre. Ribosome depleted RNA was used to create multiplexed RNA seq libraries NEBNext Ultra according to manufacturer's protocol | tissue:primary melanoma tumor|genotype:Tgmitfa:BRAFV600E; p53 / ; mitfa / | GSM2061395 | GSM2061395: MCR:EGFP tumor 2; Danio rerio; RNA Seq | GSM2061395 | 1 | Zebrafish melanomas were isolated and mechanically homogenized in RTL buffer Qiagen containing β mercaptoethanol. Tumor lysates were transferred onto a QiaShredder column Qiagen and RNA isolation was performed using the RNA Micro Plus kit Qiagen according to the manufacturers instruction. Total RNA was depleted of ribosomal RNA with the Ribo Zero Gold kit Epicentre. Ribosome depleted RNA was used to create multiplexed RNA seq libraries NEBNext Ultra according to manufacturer's protocol | GEO Accession:GSM2061395 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP070127 | EvR-2_R2.fastq.gz EvR-2_R1.fastq.gz | fastq fastq | 7890162016.0 | 39060208.0 | GSM2061395 r1 | 0:101 1:101 | A:2172564285;C:1760424902;G:1758426718;T:2196099270;N:2646841 | 101 | 101 | 2172564285 | 1760424902 | 1758426718 | 2196099270 | 2646841 | SRX1584898 | SRS1302563 | SRA353730 | GEO | Oncology/Hematology, Boston Children's Hospital | 2 | 0.89676 | 0.89022 | 0.35914 | 0.35869 | 0.72748 | 0.73328 | 0.50126 | 0.48386 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2016-02-15 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 40461 | 40461 | SRR3169296 | SRX1584897 | SRS1302564 | SRP070127 | PRJNA312107 | SATB2 induces transcriptional programs in melanoma that lead to metastatic behavior [RNA Seq] | GSE77922 | Transcriptome Analysis | We report gene expression data for zebrafish melanomas overexpressing human SATB2 and EGFP. Overall design: RNA seq was performed on three biological replicates of primary zebrafish melanoma tumors that were excized from MCR:EGFP control and MCR:SATB2 overexpressing TgBRAF V600E;p53 / ; mitf / zebrafish. | parent bioproject:PRJNA312106 | MCR:EGFP tumor 1 | GSM2061394 | source name:EGFP 1|tissue:primary melanoma tumor|genotype:Tgmitfa:BRAFV600E; p53 / ; mitfa / | MCR:EGFP tumor 1 | Quality control of RNA Seq datasets was performed by FastQC18 and Cutadapt19 to remove adaptor sequences and low quality regions. The high quality reads were aligned to UCSC build danRer7 of zebrafish genome using Tophat20 2.0.11 without xxx splicing form calls. Transcript abundance and differential expression were calculated with Cufflinks21 2.2.1. FPKM values were used to normalize and quantify each transcript. Genome build: Danio rerio UCSC danRer7 Supplementary files format and content: tab delimited text file containg the FPKM value of each gene | EGFP 1 | Zebrafish Tgmitfa:BRAFV600E; p53 / ; mitfa / one cell stage embryos were injected with a MiniCoopR expression vector to induce melanocyte specific overexpression of either EGFP control or human SATB2 raised to maturity and monitored for melanoma formation. | Zebrafish melanomas were isolated and mechanically homogenized in RTL buffer Qiagen containing β mercaptoethanol. Tumor lysates were transferred onto a QiaShredder column Qiagen and RNA isolation was performed using the RNA Micro Plus kit Qiagen according to the manufacturers instruction. Total RNA was depleted of ribosomal RNA with the Ribo Zero Gold kit Epicentre. Ribosome depleted RNA was used to create multiplexed RNA seq libraries NEBNext Ultra according to manufacturer's protocol | tissue:primary melanoma tumor|genotype:Tgmitfa:BRAFV600E; p53 / ; mitfa / | GSM2061394 | GSM2061394: MCR:EGFP tumor 1; Danio rerio; RNA Seq | GSM2061394 | 1 | Zebrafish melanomas were isolated and mechanically homogenized in RTL buffer Qiagen containing β mercaptoethanol. Tumor lysates were transferred onto a QiaShredder column Qiagen and RNA isolation was performed using the RNA Micro Plus kit Qiagen according to the manufacturers instruction. Total RNA was depleted of ribosomal RNA with the Ribo Zero Gold kit Epicentre. Ribosome depleted RNA was used to create multiplexed RNA seq libraries NEBNext Ultra according to manufacturer's protocol | GEO Accession:GSM2061394 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP070127 | EvR-1_R2.fastq.gz EvR-1_R1.fastq.gz | fastq fastq | 8226747950.0 | 40726475.0 | GSM2061394 r1 | 0:101 1:101 | A:1937216496;C:2135232355;G:2150394263;T:2001262497;N:2642339 | 101 | 101 | 1937216496 | 2135232355 | 2150394263 | 2001262497 | 2642339 | SRX1584897 | SRS1302564 | SRA353730 | GEO | Oncology/Hematology, Boston Children's Hospital | 2 | 0.94058 | 0.93759 | 0.26678 | 0.26414 | 0.77277 | 0.77648 | 0.4952 | 0.49739 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2016-02-15 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 46223 | 46223 | SRR6507310 | SRX3595752 | SRS2864724 | SRP131267 | PRJNA431425 | tp53 deficiency causes a wide tumor spectrum and elevates embryonal rhabdomyosarcoma metastasis in zebrafish | GSE109581 | Transcriptome Analysis | We generated tp53 deletion mutant zebrafish that spontaneously develop malignant peripheral nerve sheath tumors angiosarcomas germ cell tumors and an aggressive Natural Killer cell leukemia not previously reported in zebrafish. Each tumor type efficiently engrafted into syngeneic recipient zebrafish and shared gene expression signatures with predicted cells of origin. Overall design: We generated a complete null tp53 deletion allele in syngeneic CG1 strain zebrafish using TALEN endonucleases. The list of tumors spontaneously developed in these tp53del/del animals included malignant peripheral nerve sheath tumors MPNSTs angiosarcomas germ cell tumors and Natural Killer cell leukemia. We obtained 3 MPNSTs samples MPNST 1 MPNST 2 and MPNST 3 2 angiosarcoma samples Angiosarcoma 1 and Angiosarcoma 2 3 leukemia samples Leukemia 1 Leukemia 2 and Leukemia 3 and 1 sample of germ cell tumor GermCell 1. We also assessed the role of tp53 in kRASG12D induced human embryonal rhabdomyosarcoma ERMS using large scale cell transplantation assays and live fluorescent imaging over time. We obtained 3 ERMS samples ERMS 1 ERMS 2 and ERMS 3. All these tumor samples were compared to 3 background CG1 samples samples WholeFish 1 WholeFish 2 and WholeFish 3. | pubmed:30192230 | MPNST 3 | GSM2946791 | tissue:malignant peripheral nerve sheath tumor|genotype:CG1 tp53 homozygous mutant|tumor type:spontaneous|procedure:primary transplant dissection | MPNST 3 | Reads were aligned with STAR v2.4.0; PCR duplicates were removed with Picard v1.95 and reads aligning to ribosomal RNA were removed with RSeQC; gene counts were obtained from reads with an alignment quality of at least 10 using featureCounts and transformed to transcript per million TPM units. Genome build: GRCz10 Supplementary files format and content: Counts matrix provided as supplementary file. | malignant peripheral nerve sheath tumor | Tissue was harvested using 90% PBS + 5% FBS. FACS sorting was performed to obtain tumor cell fraction with 85% purity and 90% viability. | Total RNA was extracted using RLT buffer Qiagen and purified using RNeasy kit Qiagen as per manufacturer instructions Libraries were prepared according to Illumina's instructions accompanying the RNA Sample Kit | Animals were raised at 28 degrees celcius | genotype:CG1 tp53 homozygous mutant|tumor type:spontaneous|procedure:primary transplant dissection | GSM2946791 | GSM2946791: MPNST 3; Danio rerio; RNA Seq | GSM2946791 | 1 | Total RNA was extracted using RLT buffer Qiagen and purified using RNeasy kit Qiagen as per manufacturer instructions Libraries were prepared according to Illumina's instructions accompanying the RNA Sample Kit | GEO Accession:GSM2946791 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP131267 | MPNST_3.bam | bam | 11383285396.0 | 56352898.0 | GSM2946791 r1 | 0:101 1:101 | A:3079386367;C:2613075331;G:2617162315;T:3072644029;N:1017354 | 101 | 101 | 3079386367 | 2613075331 | 2617162315 | 3072644029 | 1017354 | SRX3595752 | SRS2864724 | SRA652013 | GEO | Pathology, Massachusetts General Hospital | 2 | 0.92421 | 0.92754 | 0.11361 | 0.112 | 0.69203 | 0.69365 | 0.47226 | 0.47658 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2018-01-24 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||
| 46224 | 46224 | SRR6507309 | SRX3595751 | SRS2864311 | SRP131267 | PRJNA431425 | tp53 deficiency causes a wide tumor spectrum and elevates embryonal rhabdomyosarcoma metastasis in zebrafish | GSE109581 | Transcriptome Analysis | We generated tp53 deletion mutant zebrafish that spontaneously develop malignant peripheral nerve sheath tumors angiosarcomas germ cell tumors and an aggressive Natural Killer cell leukemia not previously reported in zebrafish. Each tumor type efficiently engrafted into syngeneic recipient zebrafish and shared gene expression signatures with predicted cells of origin. Overall design: We generated a complete null tp53 deletion allele in syngeneic CG1 strain zebrafish using TALEN endonucleases. The list of tumors spontaneously developed in these tp53del/del animals included malignant peripheral nerve sheath tumors MPNSTs angiosarcomas germ cell tumors and Natural Killer cell leukemia. We obtained 3 MPNSTs samples MPNST 1 MPNST 2 and MPNST 3 2 angiosarcoma samples Angiosarcoma 1 and Angiosarcoma 2 3 leukemia samples Leukemia 1 Leukemia 2 and Leukemia 3 and 1 sample of germ cell tumor GermCell 1. We also assessed the role of tp53 in kRASG12D induced human embryonal rhabdomyosarcoma ERMS using large scale cell transplantation assays and live fluorescent imaging over time. We obtained 3 ERMS samples ERMS 1 ERMS 2 and ERMS 3. All these tumor samples were compared to 3 background CG1 samples samples WholeFish 1 WholeFish 2 and WholeFish 3. | pubmed:30192230 | MPNST 2 | GSM2946790 | tissue:malignant peripheral nerve sheath tumor|genotype:CG1 tp53 homozygous mutant|tumor type:spontaneous|procedure:primary transplant dissection | MPNST 2 | Reads were aligned with STAR v2.4.0; PCR duplicates were removed with Picard v1.95 and reads aligning to ribosomal RNA were removed with RSeQC; gene counts were obtained from reads with an alignment quality of at least 10 using featureCounts and transformed to transcript per million TPM units. Genome build: GRCz10 Supplementary files format and content: Counts matrix provided as supplementary file. | malignant peripheral nerve sheath tumor | Tissue was harvested using 90% PBS + 5% FBS. FACS sorting was performed to obtain tumor cell fraction with 85% purity and 90% viability. | Total RNA was extracted using RLT buffer Qiagen and purified using RNeasy kit Qiagen as per manufacturer instructions Libraries were prepared according to Illumina's instructions accompanying the RNA Sample Kit | Animals were raised at 28 degrees celcius | genotype:CG1 tp53 homozygous mutant|tumor type:spontaneous|procedure:primary transplant dissection | GSM2946790 | GSM2946790: MPNST 2; Danio rerio; RNA Seq | GSM2946790 | 1 | Total RNA was extracted using RLT buffer Qiagen and purified using RNeasy kit Qiagen as per manufacturer instructions Libraries were prepared according to Illumina's instructions accompanying the RNA Sample Kit | GEO Accession:GSM2946790 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP131267 | MPNST_2.bam | bam | 4475755208.0 | 22157204.0 | GSM2946790 r1 | 0:101 1:101 | A:1173881184;C:1063354569;G:1068337599;T:1169755139;N:426717 | 101 | 101 | 1173881184 | 1063354569 | 1068337599 | 1169755139 | 426717 | SRX3595751 | SRS2864311 | SRA652013 | GEO | Pathology, Massachusetts General Hospital | 2 | 0.94771 | 0.95125 | 0.06684 | 0.06559 | 0.72427 | 0.72634 | 0.48094 | 0.48917 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2018-01-24 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||
| 46225 | 46225 | SRR6507308 | SRX3595750 | SRS2864123 | SRP131267 | PRJNA431425 | tp53 deficiency causes a wide tumor spectrum and elevates embryonal rhabdomyosarcoma metastasis in zebrafish | GSE109581 | Transcriptome Analysis | We generated tp53 deletion mutant zebrafish that spontaneously develop malignant peripheral nerve sheath tumors angiosarcomas germ cell tumors and an aggressive Natural Killer cell leukemia not previously reported in zebrafish. Each tumor type efficiently engrafted into syngeneic recipient zebrafish and shared gene expression signatures with predicted cells of origin. Overall design: We generated a complete null tp53 deletion allele in syngeneic CG1 strain zebrafish using TALEN endonucleases. The list of tumors spontaneously developed in these tp53del/del animals included malignant peripheral nerve sheath tumors MPNSTs angiosarcomas germ cell tumors and Natural Killer cell leukemia. We obtained 3 MPNSTs samples MPNST 1 MPNST 2 and MPNST 3 2 angiosarcoma samples Angiosarcoma 1 and Angiosarcoma 2 3 leukemia samples Leukemia 1 Leukemia 2 and Leukemia 3 and 1 sample of germ cell tumor GermCell 1. We also assessed the role of tp53 in kRASG12D induced human embryonal rhabdomyosarcoma ERMS using large scale cell transplantation assays and live fluorescent imaging over time. We obtained 3 ERMS samples ERMS 1 ERMS 2 and ERMS 3. All these tumor samples were compared to 3 background CG1 samples samples WholeFish 1 WholeFish 2 and WholeFish 3. | pubmed:30192230 | MPNST 1 | GSM2946789 | tissue:malignant peripheral nerve sheath tumor|genotype:CG1 tp53 homozygous mutant|tumor type:spontaneous|procedure:primary transplant dissection | MPNST 1 | Reads were aligned with STAR v2.4.0; PCR duplicates were removed with Picard v1.95 and reads aligning to ribosomal RNA were removed with RSeQC; gene counts were obtained from reads with an alignment quality of at least 10 using featureCounts and transformed to transcript per million TPM units. Genome build: GRCz10 Supplementary files format and content: Counts matrix provided as supplementary file. | malignant peripheral nerve sheath tumor | Tissue was harvested using 90% PBS + 5% FBS. FACS sorting was performed to obtain tumor cell fraction with 85% purity and 90% viability. | Total RNA was extracted using RLT buffer Qiagen and purified using RNeasy kit Qiagen as per manufacturer instructions Libraries were prepared according to Illumina's instructions accompanying the RNA Sample Kit | Animals were raised at 28 degrees celcius | genotype:CG1 tp53 homozygous mutant|tumor type:spontaneous|procedure:primary transplant dissection | GSM2946789 | GSM2946789: MPNST 1; Danio rerio; RNA Seq | GSM2946789 | 1 | Total RNA was extracted using RLT buffer Qiagen and purified using RNeasy kit Qiagen as per manufacturer instructions Libraries were prepared according to Illumina's instructions accompanying the RNA Sample Kit | GEO Accession:GSM2946789 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP131267 | MPNST_1.bam | bam | 4758494608.0 | 23556904.0 | GSM2946789 r1 | 0:101 1:101 | A:1256101624;C:1121363306;G:1131796356;T:1248769939;N:463383 | 101 | 101 | 1256101624 | 1121363306 | 1131796356 | 1248769939 | 463383 | SRX3595750 | SRS2864123 | SRA652013 | GEO | Pathology, Massachusetts General Hospital | 2 | 0.94674 | 0.9501 | 0.07974 | 0.07759 | 0.70761 | 0.71155 | 0.48864 | 0.49029 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2018-01-24 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||
| 46226 | 46226 | SRR6507307 | SRX3595749 | SRS2864137 | SRP131267 | PRJNA431425 | tp53 deficiency causes a wide tumor spectrum and elevates embryonal rhabdomyosarcoma metastasis in zebrafish | GSE109581 | Transcriptome Analysis | We generated tp53 deletion mutant zebrafish that spontaneously develop malignant peripheral nerve sheath tumors angiosarcomas germ cell tumors and an aggressive Natural Killer cell leukemia not previously reported in zebrafish. Each tumor type efficiently engrafted into syngeneic recipient zebrafish and shared gene expression signatures with predicted cells of origin. Overall design: We generated a complete null tp53 deletion allele in syngeneic CG1 strain zebrafish using TALEN endonucleases. The list of tumors spontaneously developed in these tp53del/del animals included malignant peripheral nerve sheath tumors MPNSTs angiosarcomas germ cell tumors and Natural Killer cell leukemia. We obtained 3 MPNSTs samples MPNST 1 MPNST 2 and MPNST 3 2 angiosarcoma samples Angiosarcoma 1 and Angiosarcoma 2 3 leukemia samples Leukemia 1 Leukemia 2 and Leukemia 3 and 1 sample of germ cell tumor GermCell 1. We also assessed the role of tp53 in kRASG12D induced human embryonal rhabdomyosarcoma ERMS using large scale cell transplantation assays and live fluorescent imaging over time. We obtained 3 ERMS samples ERMS 1 ERMS 2 and ERMS 3. All these tumor samples were compared to 3 background CG1 samples samples WholeFish 1 WholeFish 2 and WholeFish 3. | pubmed:30192230 | Leukemia 3 | GSM2946788 | tissue:Natural Killer cell leukemia|genotype:CG1 tp53 homozygous mutant|tumor type:spontaneous|procedure:primary transplant GFP FACS sorted | Leukemia 3 | Reads were aligned with STAR v2.4.0; PCR duplicates were removed with Picard v1.95 and reads aligning to ribosomal RNA were removed with RSeQC; gene counts were obtained from reads with an alignment quality of at least 10 using featureCounts and transformed to transcript per million TPM units. Genome build: GRCz10 Supplementary files format and content: Counts matrix provided as supplementary file. | Natural Killer cell leukemia | Tissue was harvested using 90% PBS + 5% FBS. FACS sorting was performed to obtain tumor cell fraction with 85% purity and 90% viability. | Total RNA was extracted using RLT buffer Qiagen and purified using RNeasy kit Qiagen as per manufacturer instructions Libraries were prepared according to Illumina's instructions accompanying the RNA Sample Kit | Animals were raised at 28 degrees celcius | genotype:CG1 tp53 homozygous mutant|tumor type:spontaneous|procedure:primary transplant GFP FACS sorted | GSM2946788 | GSM2946788: Leukemia 3; Danio rerio; RNA Seq | GSM2946788 | 1 | Total RNA was extracted using RLT buffer Qiagen and purified using RNeasy kit Qiagen as per manufacturer instructions Libraries were prepared according to Illumina's instructions accompanying the RNA Sample Kit | GEO Accession:GSM2946788 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP131267 | Leukemia_3.bam | bam | 4769595114.0 | 23611857.0 | GSM2946788 r1 | 0:101 1:101 | A:1234057643;C:1141479035;G:1156554815;T:1237033403;N:470218 | 101 | 101 | 1234057643 | 1141479035 | 1156554815 | 1237033403 | 470218 | SRX3595749 | SRS2864137 | SRA652013 | GEO | Pathology, Massachusetts General Hospital | 2 | 0.94945 | 0.95271 | 0.09019 | 0.0888 | 0.74777 | 0.74963 | 0.47913 | 0.47856 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2018-01-24 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||
| 46227 | 46227 | SRR6507306 | SRX3595748 | SRS2864295 | SRP131267 | PRJNA431425 | tp53 deficiency causes a wide tumor spectrum and elevates embryonal rhabdomyosarcoma metastasis in zebrafish | GSE109581 | Transcriptome Analysis | We generated tp53 deletion mutant zebrafish that spontaneously develop malignant peripheral nerve sheath tumors angiosarcomas germ cell tumors and an aggressive Natural Killer cell leukemia not previously reported in zebrafish. Each tumor type efficiently engrafted into syngeneic recipient zebrafish and shared gene expression signatures with predicted cells of origin. Overall design: We generated a complete null tp53 deletion allele in syngeneic CG1 strain zebrafish using TALEN endonucleases. The list of tumors spontaneously developed in these tp53del/del animals included malignant peripheral nerve sheath tumors MPNSTs angiosarcomas germ cell tumors and Natural Killer cell leukemia. We obtained 3 MPNSTs samples MPNST 1 MPNST 2 and MPNST 3 2 angiosarcoma samples Angiosarcoma 1 and Angiosarcoma 2 3 leukemia samples Leukemia 1 Leukemia 2 and Leukemia 3 and 1 sample of germ cell tumor GermCell 1. We also assessed the role of tp53 in kRASG12D induced human embryonal rhabdomyosarcoma ERMS using large scale cell transplantation assays and live fluorescent imaging over time. We obtained 3 ERMS samples ERMS 1 ERMS 2 and ERMS 3. All these tumor samples were compared to 3 background CG1 samples samples WholeFish 1 WholeFish 2 and WholeFish 3. | pubmed:30192230 | Leukemia 2 | GSM2946787 | tissue:Natural Killer cell leukemia|genotype:CG1 tp53 homozygous mutant|tumor type:spontaneous|procedure:primary transplant GFP FACS sorted | Leukemia 2 | Reads were aligned with STAR v2.4.0; PCR duplicates were removed with Picard v1.95 and reads aligning to ribosomal RNA were removed with RSeQC; gene counts were obtained from reads with an alignment quality of at least 10 using featureCounts and transformed to transcript per million TPM units. Genome build: GRCz10 Supplementary files format and content: Counts matrix provided as supplementary file. | Natural Killer cell leukemia | Tissue was harvested using 90% PBS + 5% FBS. FACS sorting was performed to obtain tumor cell fraction with 85% purity and 90% viability. | Total RNA was extracted using RLT buffer Qiagen and purified using RNeasy kit Qiagen as per manufacturer instructions Libraries were prepared according to Illumina's instructions accompanying the RNA Sample Kit | Animals were raised at 28 degrees celcius | genotype:CG1 tp53 homozygous mutant|tumor type:spontaneous|procedure:primary transplant GFP FACS sorted | GSM2946787 | GSM2946787: Leukemia 2; Danio rerio; RNA Seq | GSM2946787 | 1 | Total RNA was extracted using RLT buffer Qiagen and purified using RNeasy kit Qiagen as per manufacturer instructions Libraries were prepared according to Illumina's instructions accompanying the RNA Sample Kit | GEO Accession:GSM2946787 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP131267 | Leukemia_2.bam | bam | 3932585692.0 | 19468246.0 | GSM2946787 r1 | 0:101 1:101 | A:1026642167;C:937784785;G:940180391;T:1027590540;N:387809 | 101 | 101 | 1026642167 | 937784785 | 940180391 | 1027590540 | 387809 | SRX3595748 | SRS2864295 | SRA652013 | GEO | Pathology, Massachusetts General Hospital | 2 | 0.93844 | 0.93922 | 0.13853 | 0.13474 | 0.75765 | 0.76023 | 0.48216 | 0.49502 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2018-01-24 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||
| 46228 | 46228 | SRR6507305 | SRX3595747 | SRS2864135 | SRP131267 | PRJNA431425 | tp53 deficiency causes a wide tumor spectrum and elevates embryonal rhabdomyosarcoma metastasis in zebrafish | GSE109581 | Transcriptome Analysis | We generated tp53 deletion mutant zebrafish that spontaneously develop malignant peripheral nerve sheath tumors angiosarcomas germ cell tumors and an aggressive Natural Killer cell leukemia not previously reported in zebrafish. Each tumor type efficiently engrafted into syngeneic recipient zebrafish and shared gene expression signatures with predicted cells of origin. Overall design: We generated a complete null tp53 deletion allele in syngeneic CG1 strain zebrafish using TALEN endonucleases. The list of tumors spontaneously developed in these tp53del/del animals included malignant peripheral nerve sheath tumors MPNSTs angiosarcomas germ cell tumors and Natural Killer cell leukemia. We obtained 3 MPNSTs samples MPNST 1 MPNST 2 and MPNST 3 2 angiosarcoma samples Angiosarcoma 1 and Angiosarcoma 2 3 leukemia samples Leukemia 1 Leukemia 2 and Leukemia 3 and 1 sample of germ cell tumor GermCell 1. We also assessed the role of tp53 in kRASG12D induced human embryonal rhabdomyosarcoma ERMS using large scale cell transplantation assays and live fluorescent imaging over time. We obtained 3 ERMS samples ERMS 1 ERMS 2 and ERMS 3. All these tumor samples were compared to 3 background CG1 samples samples WholeFish 1 WholeFish 2 and WholeFish 3. | pubmed:30192230 | Leukemia 1 | GSM2946786 | tissue:Natural Killer cell leukemia|genotype:CG1 tp53 homozygous mutant|tumor type:spontaneous|procedure:primary transplant GFP FACS sorted | Leukemia 1 | Reads were aligned with STAR v2.4.0; PCR duplicates were removed with Picard v1.95 and reads aligning to ribosomal RNA were removed with RSeQC; gene counts were obtained from reads with an alignment quality of at least 10 using featureCounts and transformed to transcript per million TPM units. Genome build: GRCz10 Supplementary files format and content: Counts matrix provided as supplementary file. | Natural Killer cell leukemia | Tissue was harvested using 90% PBS + 5% FBS. FACS sorting was performed to obtain tumor cell fraction with 85% purity and 90% viability. | Total RNA was extracted using RLT buffer Qiagen and purified using RNeasy kit Qiagen as per manufacturer instructions Libraries were prepared according to Illumina's instructions accompanying the RNA Sample Kit | Animals were raised at 28 degrees celcius | genotype:CG1 tp53 homozygous mutant|tumor type:spontaneous|procedure:primary transplant GFP FACS sorted | GSM2946786 | GSM2946786: Leukemia 1; Danio rerio; RNA Seq | GSM2946786 | 1 | Total RNA was extracted using RLT buffer Qiagen and purified using RNeasy kit Qiagen as per manufacturer instructions Libraries were prepared according to Illumina's instructions accompanying the RNA Sample Kit | GEO Accession:GSM2946786 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP131267 | Leukemia_1.bam | bam | 5514990264.0 | 27301932.0 | GSM2946786 r1 | 0:101 1:101 | A:1473054210;C:1283289156;G:1289375636;T:1468738366;N:532896 | 101 | 101 | 1473054210 | 1283289156 | 1289375636 | 1468738366 | 532896 | SRX3595747 | SRS2864135 | SRA652013 | GEO | Pathology, Massachusetts General Hospital | 2 | 0.93575 | 0.93936 | 0.12916 | 0.12725 | 0.74097 | 0.74312 | 0.47845 | 0.48929 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2018-01-24 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||
| 46229 | 46229 | SRR6507304 | SRX3595746 | SRS2864134 | SRP131267 | PRJNA431425 | tp53 deficiency causes a wide tumor spectrum and elevates embryonal rhabdomyosarcoma metastasis in zebrafish | GSE109581 | Transcriptome Analysis | We generated tp53 deletion mutant zebrafish that spontaneously develop malignant peripheral nerve sheath tumors angiosarcomas germ cell tumors and an aggressive Natural Killer cell leukemia not previously reported in zebrafish. Each tumor type efficiently engrafted into syngeneic recipient zebrafish and shared gene expression signatures with predicted cells of origin. Overall design: We generated a complete null tp53 deletion allele in syngeneic CG1 strain zebrafish using TALEN endonucleases. The list of tumors spontaneously developed in these tp53del/del animals included malignant peripheral nerve sheath tumors MPNSTs angiosarcomas germ cell tumors and Natural Killer cell leukemia. We obtained 3 MPNSTs samples MPNST 1 MPNST 2 and MPNST 3 2 angiosarcoma samples Angiosarcoma 1 and Angiosarcoma 2 3 leukemia samples Leukemia 1 Leukemia 2 and Leukemia 3 and 1 sample of germ cell tumor GermCell 1. We also assessed the role of tp53 in kRASG12D induced human embryonal rhabdomyosarcoma ERMS using large scale cell transplantation assays and live fluorescent imaging over time. We obtained 3 ERMS samples ERMS 1 ERMS 2 and ERMS 3. All these tumor samples were compared to 3 background CG1 samples samples WholeFish 1 WholeFish 2 and WholeFish 3. | pubmed:30192230 | Angiosarcoma 2 | GSM2946785 | tissue:angiosarcoma|genotype:CG1 tp53 homozygous mutant|tumor type:spontaneous|procedure:primary transplant GFP FACS sorted | Angiosarcoma 2 | Reads were aligned with STAR v2.4.0; PCR duplicates were removed with Picard v1.95 and reads aligning to ribosomal RNA were removed with RSeQC; gene counts were obtained from reads with an alignment quality of at least 10 using featureCounts and transformed to transcript per million TPM units. Genome build: GRCz10 Supplementary files format and content: Counts matrix provided as supplementary file. | angiosarcoma | Tissue was harvested using 90% PBS + 5% FBS. FACS sorting was performed to obtain tumor cell fraction with 85% purity and 90% viability. | Total RNA was extracted using RLT buffer Qiagen and purified using RNeasy kit Qiagen as per manufacturer instructions Libraries were prepared according to Illumina's instructions accompanying the RNA Sample Kit | Animals were raised at 28 degrees celcius | genotype:CG1 tp53 homozygous mutant|tumor type:spontaneous|procedure:primary transplant GFP FACS sorted | GSM2946785 | GSM2946785: Angiosarcoma 2; Danio rerio; RNA Seq | GSM2946785 | 1 | Total RNA was extracted using RLT buffer Qiagen and purified using RNeasy kit Qiagen as per manufacturer instructions Libraries were prepared according to Illumina's instructions accompanying the RNA Sample Kit | GEO Accession:GSM2946785 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP131267 | Angiosarcoma_2.bam | bam | 5653646094.0 | 27988347.0 | GSM2946785 r1 | 0:101 1:101 | A:1527009041;C:1301975169;G:1301292898;T:1522816041;N:552945 | 101 | 101 | 1527009041 | 1301975169 | 1301292898 | 1522816041 | 552945 | SRX3595746 | SRS2864134 | SRA652013 | GEO | Pathology, Massachusetts General Hospital | 2 | 0.93396 | 0.93929 | 0.10315 | 0.1009 | 0.67065 | 0.67322 | 0.4792 | 0.47967 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2018-01-24 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||
| 46230 | 46230 | SRR6507303 | SRX3595745 | SRS2864133 | SRP131267 | PRJNA431425 | tp53 deficiency causes a wide tumor spectrum and elevates embryonal rhabdomyosarcoma metastasis in zebrafish | GSE109581 | Transcriptome Analysis | We generated tp53 deletion mutant zebrafish that spontaneously develop malignant peripheral nerve sheath tumors angiosarcomas germ cell tumors and an aggressive Natural Killer cell leukemia not previously reported in zebrafish. Each tumor type efficiently engrafted into syngeneic recipient zebrafish and shared gene expression signatures with predicted cells of origin. Overall design: We generated a complete null tp53 deletion allele in syngeneic CG1 strain zebrafish using TALEN endonucleases. The list of tumors spontaneously developed in these tp53del/del animals included malignant peripheral nerve sheath tumors MPNSTs angiosarcomas germ cell tumors and Natural Killer cell leukemia. We obtained 3 MPNSTs samples MPNST 1 MPNST 2 and MPNST 3 2 angiosarcoma samples Angiosarcoma 1 and Angiosarcoma 2 3 leukemia samples Leukemia 1 Leukemia 2 and Leukemia 3 and 1 sample of germ cell tumor GermCell 1. We also assessed the role of tp53 in kRASG12D induced human embryonal rhabdomyosarcoma ERMS using large scale cell transplantation assays and live fluorescent imaging over time. We obtained 3 ERMS samples ERMS 1 ERMS 2 and ERMS 3. All these tumor samples were compared to 3 background CG1 samples samples WholeFish 1 WholeFish 2 and WholeFish 3. | pubmed:30192230 | Angiosarcoma 1 | GSM2946784 | tissue:angiosarcoma|genotype:CG1 tp53 homozygous mutant|tumor type:spontaneous|procedure:primary transplant GFP FACS sorted | Angiosarcoma 1 | Reads were aligned with STAR v2.4.0; PCR duplicates were removed with Picard v1.95 and reads aligning to ribosomal RNA were removed with RSeQC; gene counts were obtained from reads with an alignment quality of at least 10 using featureCounts and transformed to transcript per million TPM units. Genome build: GRCz10 Supplementary files format and content: Counts matrix provided as supplementary file. | angiosarcoma | Tissue was harvested using 90% PBS + 5% FBS. FACS sorting was performed to obtain tumor cell fraction with 85% purity and 90% viability. | Total RNA was extracted using RLT buffer Qiagen and purified using RNeasy kit Qiagen as per manufacturer instructions Libraries were prepared according to Illumina's instructions accompanying the RNA Sample Kit | Animals were raised at 28 degrees celcius | genotype:CG1 tp53 homozygous mutant|tumor type:spontaneous|procedure:primary transplant GFP FACS sorted | GSM2946784 | GSM2946784: Angiosarcoma 1; Danio rerio; RNA Seq | GSM2946784 | 1 | Total RNA was extracted using RLT buffer Qiagen and purified using RNeasy kit Qiagen as per manufacturer instructions Libraries were prepared according to Illumina's instructions accompanying the RNA Sample Kit | GEO Accession:GSM2946784 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP131267 | Angiosarcoma_1.bam | bam | 5694971052.0 | 28192926.0 | GSM2946784 r1 | SRX3595745 | SRS2864133 | SRA652013 | GEO | Pathology, Massachusetts General Hospital | 2 | 0.95498 | 0.93958 | 0.06596 | 0.06254 | 0.68594 | 0.68647 | 0.47578 | 0.47052 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2018-01-24 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||||||||||
| 51023 | 51023 | SRR12429756 | SRX8925578 | SRS7181813 | SRP180876 | PRJNA515051 | Zebrafish Samples for Loss of ATRX cooperates with p53 Deficiency to promote the Development of Sarcomas and other Malignancies | GSE125040 | Transcriptome Analysis | The SWI/SNF family chromatin remodeling protein ATRX is a tumor suppressor in sarcomas gliomas and other malignancies. Its loss of function facilitates the alternative lengthening of telomeres ALT pathway in tumor cells while it also affects Polycomb repressive complex 2 PRC2 silencing of its target genes. To further define the role of inactivating ATRX mutations in carcinogenesis we knocked out atrx in our previously published p53/nf1 deficient zebrafish line that develops malignant peripheral nerve sheath tumors and gliomas. Complete inactivation of atrx using CRISPR cas9 was lethal in developing fish and resulted in an alpha thalassemia like phenotype including reduced alpha globin expression. In p53/nf1 deficient zebrafish neither peripheral nerve sheath tumors nor gliomas showed accelerated onset in atrx+/ fish but these fish developed various tumors that were not observed in their atrx+/+ siblings including epithelioid sarcoma angiosarcoma undifferentiated pleomorphic sarcoma and rare types of carcinoma. Most of these cancer types are included in the AACR Genie database of human tumors associated with mutant ATRX indicating that our zebrafish model reliably reflects a role for ATRX loss in the early pathogenesis of these types of human cancers. RNA seq of p53/nf1 and p53/nf1/atrx deficient tumors revealed that down regulation of telomerase accompanied ALT mediated lengthening of the telomeres in atrx mutant samples. Moreover inactivating mutations in atrx disturbed PRC2 target gene silencing indicating a connection between ATRX loss and PRC2 dysfunction in cancer development. Overall design: Gene expression values were derived from paired end RNA Seq data that compared zebrafish samples from p53/nf1/atrx deficient tumors to samples from atrx wildtype controls 3 vs. 3 samples. | pubmed:30970016;pubmed:32651197 | MPNST suz12 mut Z5 | GSM4720870 | tissue:Zebrafish malignant peripheral nerve sheath tumors MPNSTs|tp53: / |nf1b: / |nf1a:+/ |atrx:wt|suz12a:+/ |suz12b:+/ | MPNST suz12 mut Z5 | FastQC was used to evaluate read quality on raw RNA Seq reads and trimmed reads. Trimming of low quality reads and clipping of sequencing adapters was done using the program Trimmomatic version 0.36 and all reads shorter than 36bp post trimming were dropped Trimmomatic was run with settings of ILLUMINACLIP:adapters/TruSeq3 PE 2.fa: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 AVGQUAL:10. Reads were aligned to the zebrafish Danio rerio reference genome with TopHat version 2.1.0 using UCSC danRer10 and settings of x 1 g 1 r 44 mate std dev 223 with values for the flags r and mate std dev coming from the mean fragment size. Bam sorting and indexing was done with SamTools and duplicate reads were removed using Picard tools http://picard.sourceforge.net. Aligned reads processed to Fragments Per Kilobase of exon per Million fragments mapped FPKM using cufflinks version 2.2.1 http://cufflinks.cbcb.umd.edu/index.html with the G flag to use the danRer10 reference annotation to estimate isoform expression and not assemble novel transcripts and the flags max bundle frags 4000000 N compatible hits norm. Gene level counts were obtained with htseq count version 0.9.1. Differential gene expression was evaluated with the R Bioconductor package DESeq2 and normalized expression values for individual samples were obtained from DESeq2 using the variance stabilizing transform on the raw counts. The variance stabilizing transformed data were used for GSEA. Genome build: GRCz10 Supplementary files format and content: genes.fpkm tracking files are tab delimited text files output by cufflinks in a generic FPKM tracking format with estimated gene level expression values in the form of FPKM values and raw count.txt files are tab delimited text files output by htseq count with gene level counts | Zebrafish malignant peripheral nerve sheath tumors MPNSTs | The zebrafish atrx mutant lines were generated by the CRISPR Cas9 genome editing system using the previous described protocol Hwang et al. Nature Biotechnology 2013. The plasmid constructs pDR274 #42250 and pMLM3613 #42251 were purchased from Addgene. Oligonucleotides 5’ TAG GTC CTG AGT TCC GTA ACA A 3’ and 5’ AAA CTT GTT ACG GAA CTC AGG A 3’ were annealed and cloned into the pDR274 vector to generate single guide RNAs gRNAs targeting atrx exon 4. Each embryo was injected with 1 nl of solution containing 25 ng/μl gRNA and 600 ng/μl Cas9 mRNA at the 1 cell stage. Mosaic F0 fish with germline mutation were identified and stable mutant lines were established by outcrossing. | RNA was isolated from one half of p53/nf1/atrx deficient MPNSTs and p53/nf1 deficient control MPNSTs using the AllPrep DNA/RNA Mini Kit from Qiagen Hilden Germany and the other half was set asside for analysis by histopathology. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | Zebrafish were raised and maintained according to standard procedures. They were derived from the p53/nf1 deficient background Shin et al. Disease Models & Mechanisms 2012. All zebrafish studies and maintenance were done in accord with Dana Farber Cancer Institute IACUC approved protocol #02 107. | tp53: / |nf1b: / |nf1a:+/ |atrx:wt|suz12a:+/ |suz12b:+/ | GSM4720870 | GSM4720870: MPNST suz12 mut Z5; Danio rerio; RNA Seq | GSM4720870 | 1 | RNA was isolated from one half of p53/nf1/atrx deficient MPNSTs and p53/nf1 deficient control MPNSTs using the AllPrep DNA/RNA Mini Kit from Qiagen Hilden Germany and the other half was set asside for analysis by histopathology. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | GEO Accession:GSM4720870 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP180876 | 20170730_Z5_MWZ4474_S7_R1_001.fastq.gz 20170730_Z5_MWZ4474_S7_R2_001.fastq.gz | fastq fastq | 7968086400.0 | 53120576.0 | GSM4720870 r1 | 0:75 1:75 | A:2175597026;C:1816735807;G:1842562950;T:2131670896;N:1519721 | 75 | 75 | 2175597026 | 1816735807 | 1842562950 | 2131670896 | 1519721 | SRX8925578 | SRS7181813 | SRA834478 | GEO | Pediatric Oncology, Dana-Farber Cancer Institute | 2 | 0.92871 | 0.92975 | 0.08295 | 0.08243 | 0.78263 | 0.79868 | 0.52067 | 0.52262 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2020-08-11 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||
| 51024 | 51024 | SRR12429755 | SRX8925577 | SRS7181811 | SRP180876 | PRJNA515051 | Zebrafish Samples for Loss of ATRX cooperates with p53 Deficiency to promote the Development of Sarcomas and other Malignancies | GSE125040 | Transcriptome Analysis | The SWI/SNF family chromatin remodeling protein ATRX is a tumor suppressor in sarcomas gliomas and other malignancies. Its loss of function facilitates the alternative lengthening of telomeres ALT pathway in tumor cells while it also affects Polycomb repressive complex 2 PRC2 silencing of its target genes. To further define the role of inactivating ATRX mutations in carcinogenesis we knocked out atrx in our previously published p53/nf1 deficient zebrafish line that develops malignant peripheral nerve sheath tumors and gliomas. Complete inactivation of atrx using CRISPR cas9 was lethal in developing fish and resulted in an alpha thalassemia like phenotype including reduced alpha globin expression. In p53/nf1 deficient zebrafish neither peripheral nerve sheath tumors nor gliomas showed accelerated onset in atrx+/ fish but these fish developed various tumors that were not observed in their atrx+/+ siblings including epithelioid sarcoma angiosarcoma undifferentiated pleomorphic sarcoma and rare types of carcinoma. Most of these cancer types are included in the AACR Genie database of human tumors associated with mutant ATRX indicating that our zebrafish model reliably reflects a role for ATRX loss in the early pathogenesis of these types of human cancers. RNA seq of p53/nf1 and p53/nf1/atrx deficient tumors revealed that down regulation of telomerase accompanied ALT mediated lengthening of the telomeres in atrx mutant samples. Moreover inactivating mutations in atrx disturbed PRC2 target gene silencing indicating a connection between ATRX loss and PRC2 dysfunction in cancer development. Overall design: Gene expression values were derived from paired end RNA Seq data that compared zebrafish samples from p53/nf1/atrx deficient tumors to samples from atrx wildtype controls 3 vs. 3 samples. | pubmed:30970016;pubmed:32651197 | MPNST suz12 mut Z3 | GSM4720869 | tissue:Zebrafish malignant peripheral nerve sheath tumors MPNSTs|tp53: / |nf1b: / |nf1a:+/ |atrx:wt|suz12a:+/ |suz12b:+/ | MPNST suz12 mut Z3 | FastQC was used to evaluate read quality on raw RNA Seq reads and trimmed reads. Trimming of low quality reads and clipping of sequencing adapters was done using the program Trimmomatic version 0.36 and all reads shorter than 36bp post trimming were dropped Trimmomatic was run with settings of ILLUMINACLIP:adapters/TruSeq3 PE 2.fa: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 AVGQUAL:10. Reads were aligned to the zebrafish Danio rerio reference genome with TopHat version 2.1.0 using UCSC danRer10 and settings of x 1 g 1 r 44 mate std dev 223 with values for the flags r and mate std dev coming from the mean fragment size. Bam sorting and indexing was done with SamTools and duplicate reads were removed using Picard tools http://picard.sourceforge.net. Aligned reads processed to Fragments Per Kilobase of exon per Million fragments mapped FPKM using cufflinks version 2.2.1 http://cufflinks.cbcb.umd.edu/index.html with the G flag to use the danRer10 reference annotation to estimate isoform expression and not assemble novel transcripts and the flags max bundle frags 4000000 N compatible hits norm. Gene level counts were obtained with htseq count version 0.9.1. Differential gene expression was evaluated with the R Bioconductor package DESeq2 and normalized expression values for individual samples were obtained from DESeq2 using the variance stabilizing transform on the raw counts. The variance stabilizing transformed data were used for GSEA. Genome build: GRCz10 Supplementary files format and content: genes.fpkm tracking files are tab delimited text files output by cufflinks in a generic FPKM tracking format with estimated gene level expression values in the form of FPKM values and raw count.txt files are tab delimited text files output by htseq count with gene level counts | Zebrafish malignant peripheral nerve sheath tumors MPNSTs | The zebrafish atrx mutant lines were generated by the CRISPR Cas9 genome editing system using the previous described protocol Hwang et al. Nature Biotechnology 2013. The plasmid constructs pDR274 #42250 and pMLM3613 #42251 were purchased from Addgene. Oligonucleotides 5’ TAG GTC CTG AGT TCC GTA ACA A 3’ and 5’ AAA CTT GTT ACG GAA CTC AGG A 3’ were annealed and cloned into the pDR274 vector to generate single guide RNAs gRNAs targeting atrx exon 4. Each embryo was injected with 1 nl of solution containing 25 ng/μl gRNA and 600 ng/μl Cas9 mRNA at the 1 cell stage. Mosaic F0 fish with germline mutation were identified and stable mutant lines were established by outcrossing. | RNA was isolated from one half of p53/nf1/atrx deficient MPNSTs and p53/nf1 deficient control MPNSTs using the AllPrep DNA/RNA Mini Kit from Qiagen Hilden Germany and the other half was set asside for analysis by histopathology. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | Zebrafish were raised and maintained according to standard procedures. They were derived from the p53/nf1 deficient background Shin et al. Disease Models & Mechanisms 2012. All zebrafish studies and maintenance were done in accord with Dana Farber Cancer Institute IACUC approved protocol #02 107. | tp53: / |nf1b: / |nf1a:+/ |atrx:wt|suz12a:+/ |suz12b:+/ | GSM4720869 | GSM4720869: MPNST suz12 mut Z3; Danio rerio; RNA Seq | GSM4720869 | 1 | RNA was isolated from one half of p53/nf1/atrx deficient MPNSTs and p53/nf1 deficient control MPNSTs using the AllPrep DNA/RNA Mini Kit from Qiagen Hilden Germany and the other half was set asside for analysis by histopathology. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | GEO Accession:GSM4720869 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP180876 | 20170730_Z3_MWZ4474_S6_R1_001.fastq.gz 20170730_Z3_MWZ4474_S6_R2_001.fastq.gz | fastq fastq | 7640907450.0 | 50939383.0 | GSM4720869 r1 | 0:75 1:75 | A:2079034539;C:1748735317;G:1754586436;T:2057075691;N:1475467 | 75 | 75 | 2079034539 | 1748735317 | 1754586436 | 2057075691 | 1475467 | SRX8925577 | SRS7181811 | SRA834478 | GEO | Pediatric Oncology, Dana-Farber Cancer Institute | 2 | 0.93466 | 0.93441 | 0.0777 | 0.07678 | 0.7766 | 0.79368 | 0.53878 | 0.53762 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2020-08-11 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||
| 51025 | 51025 | SRR12429754 | SRX8925576 | SRS7181810 | SRP180876 | PRJNA515051 | Zebrafish Samples for Loss of ATRX cooperates with p53 Deficiency to promote the Development of Sarcomas and other Malignancies | GSE125040 | Transcriptome Analysis | The SWI/SNF family chromatin remodeling protein ATRX is a tumor suppressor in sarcomas gliomas and other malignancies. Its loss of function facilitates the alternative lengthening of telomeres ALT pathway in tumor cells while it also affects Polycomb repressive complex 2 PRC2 silencing of its target genes. To further define the role of inactivating ATRX mutations in carcinogenesis we knocked out atrx in our previously published p53/nf1 deficient zebrafish line that develops malignant peripheral nerve sheath tumors and gliomas. Complete inactivation of atrx using CRISPR cas9 was lethal in developing fish and resulted in an alpha thalassemia like phenotype including reduced alpha globin expression. In p53/nf1 deficient zebrafish neither peripheral nerve sheath tumors nor gliomas showed accelerated onset in atrx+/ fish but these fish developed various tumors that were not observed in their atrx+/+ siblings including epithelioid sarcoma angiosarcoma undifferentiated pleomorphic sarcoma and rare types of carcinoma. Most of these cancer types are included in the AACR Genie database of human tumors associated with mutant ATRX indicating that our zebrafish model reliably reflects a role for ATRX loss in the early pathogenesis of these types of human cancers. RNA seq of p53/nf1 and p53/nf1/atrx deficient tumors revealed that down regulation of telomerase accompanied ALT mediated lengthening of the telomeres in atrx mutant samples. Moreover inactivating mutations in atrx disturbed PRC2 target gene silencing indicating a connection between ATRX loss and PRC2 dysfunction in cancer development. Overall design: Gene expression values were derived from paired end RNA Seq data that compared zebrafish samples from p53/nf1/atrx deficient tumors to samples from atrx wildtype controls 3 vs. 3 samples. | pubmed:30970016;pubmed:32651197 | MPNST suz12 mut Z2 | GSM4720868 | tissue:Zebrafish malignant peripheral nerve sheath tumors MPNSTs|tp53: / |nf1b: / |nf1a:+/ |atrx:wt|suz12a:+/ |suz12b: / | MPNST suz12 mut Z2 | FastQC was used to evaluate read quality on raw RNA Seq reads and trimmed reads. Trimming of low quality reads and clipping of sequencing adapters was done using the program Trimmomatic version 0.36 and all reads shorter than 36bp post trimming were dropped Trimmomatic was run with settings of ILLUMINACLIP:adapters/TruSeq3 PE 2.fa: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 AVGQUAL:10. Reads were aligned to the zebrafish Danio rerio reference genome with TopHat version 2.1.0 using UCSC danRer10 and settings of x 1 g 1 r 44 mate std dev 223 with values for the flags r and mate std dev coming from the mean fragment size. Bam sorting and indexing was done with SamTools and duplicate reads were removed using Picard tools http://picard.sourceforge.net. Aligned reads processed to Fragments Per Kilobase of exon per Million fragments mapped FPKM using cufflinks version 2.2.1 http://cufflinks.cbcb.umd.edu/index.html with the G flag to use the danRer10 reference annotation to estimate isoform expression and not assemble novel transcripts and the flags max bundle frags 4000000 N compatible hits norm. Gene level counts were obtained with htseq count version 0.9.1. Differential gene expression was evaluated with the R Bioconductor package DESeq2 and normalized expression values for individual samples were obtained from DESeq2 using the variance stabilizing transform on the raw counts. The variance stabilizing transformed data were used for GSEA. Genome build: GRCz10 Supplementary files format and content: genes.fpkm tracking files are tab delimited text files output by cufflinks in a generic FPKM tracking format with estimated gene level expression values in the form of FPKM values and raw count.txt files are tab delimited text files output by htseq count with gene level counts | Zebrafish malignant peripheral nerve sheath tumors MPNSTs | The zebrafish atrx mutant lines were generated by the CRISPR Cas9 genome editing system using the previous described protocol Hwang et al. Nature Biotechnology 2013. The plasmid constructs pDR274 #42250 and pMLM3613 #42251 were purchased from Addgene. Oligonucleotides 5’ TAG GTC CTG AGT TCC GTA ACA A 3’ and 5’ AAA CTT GTT ACG GAA CTC AGG A 3’ were annealed and cloned into the pDR274 vector to generate single guide RNAs gRNAs targeting atrx exon 4. Each embryo was injected with 1 nl of solution containing 25 ng/μl gRNA and 600 ng/μl Cas9 mRNA at the 1 cell stage. Mosaic F0 fish with germline mutation were identified and stable mutant lines were established by outcrossing. | RNA was isolated from one half of p53/nf1/atrx deficient MPNSTs and p53/nf1 deficient control MPNSTs using the AllPrep DNA/RNA Mini Kit from Qiagen Hilden Germany and the other half was set asside for analysis by histopathology. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | Zebrafish were raised and maintained according to standard procedures. They were derived from the p53/nf1 deficient background Shin et al. Disease Models & Mechanisms 2012. All zebrafish studies and maintenance were done in accord with Dana Farber Cancer Institute IACUC approved protocol #02 107. | tp53: / |nf1b: / |nf1a:+/ |atrx:wt|suz12a:+/ |suz12b: / | GSM4720868 | GSM4720868: MPNST suz12 mut Z2; Danio rerio; RNA Seq | GSM4720868 | 1 | RNA was isolated from one half of p53/nf1/atrx deficient MPNSTs and p53/nf1 deficient control MPNSTs using the AllPrep DNA/RNA Mini Kit from Qiagen Hilden Germany and the other half was set asside for analysis by histopathology. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | GEO Accession:GSM4720868 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP180876 | 20170730_Z2_MWZ4474_S5_R1_001.fastq.gz 20170730_Z2_MWZ4474_S5_R2_001.fastq.gz | fastq fastq | 7725082350.0 | 51500549.0 | GSM4720868 r1 | 0:75 1:75 | A:2140078104;C:1732679948;G:1742195011;T:2108639649;N:1489638 | 75 | 75 | 2140078104 | 1732679948 | 1742195011 | 2108639649 | 1489638 | SRX8925576 | SRS7181810 | SRA834478 | GEO | Pediatric Oncology, Dana-Farber Cancer Institute | 2 | 0.92806 | 0.92776 | 0.08381 | 0.0825 | 0.76019 | 0.77699 | 0.51452 | 0.53018 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2020-08-11 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||
| 51026 | 51026 | SRR12429753 | SRX8925575 | SRS7181809 | SRP180876 | PRJNA515051 | Zebrafish Samples for Loss of ATRX cooperates with p53 Deficiency to promote the Development of Sarcomas and other Malignancies | GSE125040 | Transcriptome Analysis | The SWI/SNF family chromatin remodeling protein ATRX is a tumor suppressor in sarcomas gliomas and other malignancies. Its loss of function facilitates the alternative lengthening of telomeres ALT pathway in tumor cells while it also affects Polycomb repressive complex 2 PRC2 silencing of its target genes. To further define the role of inactivating ATRX mutations in carcinogenesis we knocked out atrx in our previously published p53/nf1 deficient zebrafish line that develops malignant peripheral nerve sheath tumors and gliomas. Complete inactivation of atrx using CRISPR cas9 was lethal in developing fish and resulted in an alpha thalassemia like phenotype including reduced alpha globin expression. In p53/nf1 deficient zebrafish neither peripheral nerve sheath tumors nor gliomas showed accelerated onset in atrx+/ fish but these fish developed various tumors that were not observed in their atrx+/+ siblings including epithelioid sarcoma angiosarcoma undifferentiated pleomorphic sarcoma and rare types of carcinoma. Most of these cancer types are included in the AACR Genie database of human tumors associated with mutant ATRX indicating that our zebrafish model reliably reflects a role for ATRX loss in the early pathogenesis of these types of human cancers. RNA seq of p53/nf1 and p53/nf1/atrx deficient tumors revealed that down regulation of telomerase accompanied ALT mediated lengthening of the telomeres in atrx mutant samples. Moreover inactivating mutations in atrx disturbed PRC2 target gene silencing indicating a connection between ATRX loss and PRC2 dysfunction in cancer development. Overall design: Gene expression values were derived from paired end RNA Seq data that compared zebrafish samples from p53/nf1/atrx deficient tumors to samples from atrx wildtype controls 3 vs. 3 samples. | pubmed:30970016;pubmed:32651197 | MPNST suz12 mut Z1 | GSM4720867 | tissue:Zebrafish malignant peripheral nerve sheath tumors MPNSTs|tp53: / |nf1b: / |nf1a:+/ |atrx:wt|suz12a:+/ |suz12b: / | MPNST suz12 mut Z1 | FastQC was used to evaluate read quality on raw RNA Seq reads and trimmed reads. Trimming of low quality reads and clipping of sequencing adapters was done using the program Trimmomatic version 0.36 and all reads shorter than 36bp post trimming were dropped Trimmomatic was run with settings of ILLUMINACLIP:adapters/TruSeq3 PE 2.fa: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 AVGQUAL:10. Reads were aligned to the zebrafish Danio rerio reference genome with TopHat version 2.1.0 using UCSC danRer10 and settings of x 1 g 1 r 44 mate std dev 223 with values for the flags r and mate std dev coming from the mean fragment size. Bam sorting and indexing was done with SamTools and duplicate reads were removed using Picard tools http://picard.sourceforge.net. Aligned reads processed to Fragments Per Kilobase of exon per Million fragments mapped FPKM using cufflinks version 2.2.1 http://cufflinks.cbcb.umd.edu/index.html with the G flag to use the danRer10 reference annotation to estimate isoform expression and not assemble novel transcripts and the flags max bundle frags 4000000 N compatible hits norm. Gene level counts were obtained with htseq count version 0.9.1. Differential gene expression was evaluated with the R Bioconductor package DESeq2 and normalized expression values for individual samples were obtained from DESeq2 using the variance stabilizing transform on the raw counts. The variance stabilizing transformed data were used for GSEA. Genome build: GRCz10 Supplementary files format and content: genes.fpkm tracking files are tab delimited text files output by cufflinks in a generic FPKM tracking format with estimated gene level expression values in the form of FPKM values and raw count.txt files are tab delimited text files output by htseq count with gene level counts | Zebrafish malignant peripheral nerve sheath tumors MPNSTs | The zebrafish atrx mutant lines were generated by the CRISPR Cas9 genome editing system using the previous described protocol Hwang et al. Nature Biotechnology 2013. The plasmid constructs pDR274 #42250 and pMLM3613 #42251 were purchased from Addgene. Oligonucleotides 5’ TAG GTC CTG AGT TCC GTA ACA A 3’ and 5’ AAA CTT GTT ACG GAA CTC AGG A 3’ were annealed and cloned into the pDR274 vector to generate single guide RNAs gRNAs targeting atrx exon 4. Each embryo was injected with 1 nl of solution containing 25 ng/μl gRNA and 600 ng/μl Cas9 mRNA at the 1 cell stage. Mosaic F0 fish with germline mutation were identified and stable mutant lines were established by outcrossing. | RNA was isolated from one half of p53/nf1/atrx deficient MPNSTs and p53/nf1 deficient control MPNSTs using the AllPrep DNA/RNA Mini Kit from Qiagen Hilden Germany and the other half was set asside for analysis by histopathology. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | Zebrafish were raised and maintained according to standard procedures. They were derived from the p53/nf1 deficient background Shin et al. Disease Models & Mechanisms 2012. All zebrafish studies and maintenance were done in accord with Dana Farber Cancer Institute IACUC approved protocol #02 107. | tp53: / |nf1b: / |nf1a:+/ |atrx:wt|suz12a:+/ |suz12b: / | GSM4720867 | GSM4720867: MPNST suz12 mut Z1; Danio rerio; RNA Seq | GSM4720867 | 1 | RNA was isolated from one half of p53/nf1/atrx deficient MPNSTs and p53/nf1 deficient control MPNSTs using the AllPrep DNA/RNA Mini Kit from Qiagen Hilden Germany and the other half was set asside for analysis by histopathology. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | GEO Accession:GSM4720867 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP180876 | 20170730_Z1_MWZ4474_S4_R2_001.fastq.gz 20170730_Z1_MWZ4474_S4_R1_001.fastq.gz | fastq fastq | 5642950050.0 | 37619667.0 | GSM4720867 r1 | 0:75 1:75 | A:1537175203;C:1290621752;G:1298132389;T:1515946875;N:1073831 | 75 | 75 | 1537175203 | 1290621752 | 1298132389 | 1515946875 | 1073831 | SRX8925575 | SRS7181809 | SRA834478 | GEO | Pediatric Oncology, Dana-Farber Cancer Institute | 2 | 0.92722 | 0.92948 | 0.08526 | 0.08492 | 0.74771 | 0.76656 | 0.50026 | 0.51083 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2020-08-11 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||
| 51027 | 51027 | SRR8439649 | SRX5247079 | SRS4273268 | SRP180876 | PRJNA515051 | Zebrafish Samples for Loss of ATRX cooperates with p53 Deficiency to promote the Development of Sarcomas and other Malignancies | GSE125040 | Transcriptome Analysis | The SWI/SNF family chromatin remodeling protein ATRX is a tumor suppressor in sarcomas gliomas and other malignancies. Its loss of function facilitates the alternative lengthening of telomeres ALT pathway in tumor cells while it also affects Polycomb repressive complex 2 PRC2 silencing of its target genes. To further define the role of inactivating ATRX mutations in carcinogenesis we knocked out atrx in our previously published p53/nf1 deficient zebrafish line that develops malignant peripheral nerve sheath tumors and gliomas. Complete inactivation of atrx using CRISPR cas9 was lethal in developing fish and resulted in an alpha thalassemia like phenotype including reduced alpha globin expression. In p53/nf1 deficient zebrafish neither peripheral nerve sheath tumors nor gliomas showed accelerated onset in atrx+/ fish but these fish developed various tumors that were not observed in their atrx+/+ siblings including epithelioid sarcoma angiosarcoma undifferentiated pleomorphic sarcoma and rare types of carcinoma. Most of these cancer types are included in the AACR Genie database of human tumors associated with mutant ATRX indicating that our zebrafish model reliably reflects a role for ATRX loss in the early pathogenesis of these types of human cancers. RNA seq of p53/nf1 and p53/nf1/atrx deficient tumors revealed that down regulation of telomerase accompanied ALT mediated lengthening of the telomeres in atrx mutant samples. Moreover inactivating mutations in atrx disturbed PRC2 target gene silencing indicating a connection between ATRX loss and PRC2 dysfunction in cancer development. Overall design: Gene expression values were derived from paired end RNA Seq data that compared zebrafish samples from p53/nf1/atrx deficient tumors to samples from atrx wildtype controls 3 vs. 3 samples. | pubmed:30970016;pubmed:32651197 | MPNST atrx mut A16 | GSM3561588 | tissue:Zebrafish malignant peripheral nerve sheath tumors MPNSTs|tp53: / |nf1b: / |nf1a:+/ |atrx:+/ | MPNST atrx mut A16 | FastQC was used to evaluate read quality on raw RNA Seq reads and trimmed reads. Trimming of low quality reads and clipping of sequencing adapters was done using the program Trimmomatic version 0.36 and all reads shorter than 36bp post trimming were dropped Trimmomatic was run with settings of ILLUMINACLIP:adapters/TruSeq3 PE 2.fa: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 AVGQUAL:10. Reads were aligned to the zebrafish Danio rerio reference genome with TopHat version 2.1.0 using UCSC danRer10 and settings of x 1 g 1 r 44 mate std dev 223 with values for the flags r and mate std dev coming from the mean fragment size. Bam sorting and indexing was done with SamTools and duplicate reads were removed using Picard tools http://picard.sourceforge.net. Aligned reads processed to Fragments Per Kilobase of exon per Million fragments mapped FPKM using cufflinks version 2.2.1 http://cufflinks.cbcb.umd.edu/index.html with the G flag to use the danRer10 reference annotation to estimate isoform expression and not assemble novel transcripts and the flags max bundle frags 4000000 N compatible hits norm. Gene level counts were obtained with htseq count version 0.9.1. Differential gene expression was evaluated with the R Bioconductor package DESeq2 and normalized expression values for individual samples were obtained from DESeq2 using the variance stabilizing transform on the raw counts. The variance stabilizing transformed data were used for GSEA. Genome build: GRCz10 Supplementary files format and content: genes.fpkm tracking files are tab delimited text files output by cufflinks in a generic FPKM tracking format with estimated gene level expression values in the form of FPKM values and raw count.txt files are tab delimited text files output by htseq count with gene level counts | Zebrafish malignant peripheral nerve sheath tumors MPNSTs | The zebrafish atrx mutant lines were generated by the CRISPR Cas9 genome editing system using the previous described protocol Hwang et al. Nature Biotechnology 2013. The plasmid constructs pDR274 #42250 and pMLM3613 #42251 were purchased from Addgene. Oligonucleotides 5’ TAG GTC CTG AGT TCC GTA ACA A 3’ and 5’ AAA CTT GTT ACG GAA CTC AGG A 3’ were annealed and cloned into the pDR274 vector to generate single guide RNAs gRNAs targeting atrx exon 4. Each embryo was injected with 1 nl of solution containing 25 ng/μl gRNA and 600 ng/μl Cas9 mRNA at the 1 cell stage. Mosaic F0 fish with germline mutation were identified and stable mutant lines were established by outcrossing. | RNA was isolated from one half of p53/nf1/atrx deficient MPNSTs and p53/nf1 deficient control MPNSTs using the AllPrep DNA/RNA Mini Kit from Qiagen Hilden Germany and the other half was set asside for analysis by histopathology. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | Zebrafish were raised and maintained according to standard procedures. They were derived from the p53/nf1 deficient background Shin et al. Disease Models & Mechanisms 2012. All zebrafish studies and maintenance were done in accord with Dana Farber Cancer Institute IACUC approved protocol #02 107. | tp53: / |nf1b: / |nf1a:+/ |atrx:+/ | GSM3561588 | GSM3561588: MPNST atrx mut A16; Danio rerio; RNA Seq | GSM3561588 | 1 | RNA was isolated from one half of p53/nf1/atrx deficient MPNSTs and p53/nf1 deficient control MPNSTs using the AllPrep DNA/RNA Mini Kit from Qiagen Hilden Germany and the other half was set asside for analysis by histopathology. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | GEO Accession:GSM3561588 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP180876 | 20170730_A16_MWZ4474_S10_R1_001.fastq.gz 20170730_A16_MWZ4474_S10_R2_001.fastq.gz | fastq fastq | 8340354300.0 | 55602362.0 | GSM3561588 r1 | 0:75 1:75 | A:2263688783;C:1911816082;G:1926080483;T:2237169236;N:1599716 | 75 | 75 | 2263688783 | 1911816082 | 1926080483 | 2237169236 | 1599716 | SRX5247079 | SRS4273268 | SRA834478 | GEO | Pediatric Oncology, Dana-Farber Cancer Institute | 2 | 0.92645 | 0.92604 | 0.08416 | 0.08296 | 0.75607 | 0.7753 | 0.5085 | 0.5092 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2019-01-14 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||
| 51028 | 51028 | SRR8439648 | SRX5247078 | SRS4273267 | SRP180876 | PRJNA515051 | Zebrafish Samples for Loss of ATRX cooperates with p53 Deficiency to promote the Development of Sarcomas and other Malignancies | GSE125040 | Transcriptome Analysis | The SWI/SNF family chromatin remodeling protein ATRX is a tumor suppressor in sarcomas gliomas and other malignancies. Its loss of function facilitates the alternative lengthening of telomeres ALT pathway in tumor cells while it also affects Polycomb repressive complex 2 PRC2 silencing of its target genes. To further define the role of inactivating ATRX mutations in carcinogenesis we knocked out atrx in our previously published p53/nf1 deficient zebrafish line that develops malignant peripheral nerve sheath tumors and gliomas. Complete inactivation of atrx using CRISPR cas9 was lethal in developing fish and resulted in an alpha thalassemia like phenotype including reduced alpha globin expression. In p53/nf1 deficient zebrafish neither peripheral nerve sheath tumors nor gliomas showed accelerated onset in atrx+/ fish but these fish developed various tumors that were not observed in their atrx+/+ siblings including epithelioid sarcoma angiosarcoma undifferentiated pleomorphic sarcoma and rare types of carcinoma. Most of these cancer types are included in the AACR Genie database of human tumors associated with mutant ATRX indicating that our zebrafish model reliably reflects a role for ATRX loss in the early pathogenesis of these types of human cancers. RNA seq of p53/nf1 and p53/nf1/atrx deficient tumors revealed that down regulation of telomerase accompanied ALT mediated lengthening of the telomeres in atrx mutant samples. Moreover inactivating mutations in atrx disturbed PRC2 target gene silencing indicating a connection between ATRX loss and PRC2 dysfunction in cancer development. Overall design: Gene expression values were derived from paired end RNA Seq data that compared zebrafish samples from p53/nf1/atrx deficient tumors to samples from atrx wildtype controls 3 vs. 3 samples. | pubmed:30970016;pubmed:32651197 | MPNST atrx mut A15 | GSM3561587 | tissue:Zebrafish malignant peripheral nerve sheath tumors MPNSTs|tp53: / |nf1b: / |nf1a:+/ |atrx:+/ | MPNST atrx mut A15 | FastQC was used to evaluate read quality on raw RNA Seq reads and trimmed reads. Trimming of low quality reads and clipping of sequencing adapters was done using the program Trimmomatic version 0.36 and all reads shorter than 36bp post trimming were dropped Trimmomatic was run with settings of ILLUMINACLIP:adapters/TruSeq3 PE 2.fa: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 AVGQUAL:10. Reads were aligned to the zebrafish Danio rerio reference genome with TopHat version 2.1.0 using UCSC danRer10 and settings of x 1 g 1 r 44 mate std dev 223 with values for the flags r and mate std dev coming from the mean fragment size. Bam sorting and indexing was done with SamTools and duplicate reads were removed using Picard tools http://picard.sourceforge.net. Aligned reads processed to Fragments Per Kilobase of exon per Million fragments mapped FPKM using cufflinks version 2.2.1 http://cufflinks.cbcb.umd.edu/index.html with the G flag to use the danRer10 reference annotation to estimate isoform expression and not assemble novel transcripts and the flags max bundle frags 4000000 N compatible hits norm. Gene level counts were obtained with htseq count version 0.9.1. Differential gene expression was evaluated with the R Bioconductor package DESeq2 and normalized expression values for individual samples were obtained from DESeq2 using the variance stabilizing transform on the raw counts. The variance stabilizing transformed data were used for GSEA. Genome build: GRCz10 Supplementary files format and content: genes.fpkm tracking files are tab delimited text files output by cufflinks in a generic FPKM tracking format with estimated gene level expression values in the form of FPKM values and raw count.txt files are tab delimited text files output by htseq count with gene level counts | Zebrafish malignant peripheral nerve sheath tumors MPNSTs | The zebrafish atrx mutant lines were generated by the CRISPR Cas9 genome editing system using the previous described protocol Hwang et al. Nature Biotechnology 2013. The plasmid constructs pDR274 #42250 and pMLM3613 #42251 were purchased from Addgene. Oligonucleotides 5’ TAG GTC CTG AGT TCC GTA ACA A 3’ and 5’ AAA CTT GTT ACG GAA CTC AGG A 3’ were annealed and cloned into the pDR274 vector to generate single guide RNAs gRNAs targeting atrx exon 4. Each embryo was injected with 1 nl of solution containing 25 ng/μl gRNA and 600 ng/μl Cas9 mRNA at the 1 cell stage. Mosaic F0 fish with germline mutation were identified and stable mutant lines were established by outcrossing. | RNA was isolated from one half of p53/nf1/atrx deficient MPNSTs and p53/nf1 deficient control MPNSTs using the AllPrep DNA/RNA Mini Kit from Qiagen Hilden Germany and the other half was set asside for analysis by histopathology. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | Zebrafish were raised and maintained according to standard procedures. They were derived from the p53/nf1 deficient background Shin et al. Disease Models & Mechanisms 2012. All zebrafish studies and maintenance were done in accord with Dana Farber Cancer Institute IACUC approved protocol #02 107. | tp53: / |nf1b: / |nf1a:+/ |atrx:+/ | GSM3561587 | GSM3561587: MPNST atrx mut A15; Danio rerio; RNA Seq | GSM3561587 | 1 | RNA was isolated from one half of p53/nf1/atrx deficient MPNSTs and p53/nf1 deficient control MPNSTs using the AllPrep DNA/RNA Mini Kit from Qiagen Hilden Germany and the other half was set asside for analysis by histopathology. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | GEO Accession:GSM3561587 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP180876 | 20170730_A15_MWZ4474_S9_R1_001.fastq.gz 20170730_A15_MWZ4474_S9_R2_001.fastq.gz | fastq fastq | 8241576300.0 | 54943842.0 | GSM3561587 r1 | 0:75 1:75 | A:2288402334;C:1835846255;G:1874705276;T:2241015118;N:1607317 | 75 | 75 | 2288402334 | 1835846255 | 1874705276 | 2241015118 | 1607317 | SRX5247078 | SRS4273267 | SRA834478 | GEO | Pediatric Oncology, Dana-Farber Cancer Institute | 2 | 0.93509 | 0.93468 | 0.08306 | 0.08245 | 0.77506 | 0.79458 | 0.56347 | 0.58112 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2019-01-14 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||
| 51029 | 51029 | SRR8439647 | SRX5247077 | SRS4273266 | SRP180876 | PRJNA515051 | Zebrafish Samples for Loss of ATRX cooperates with p53 Deficiency to promote the Development of Sarcomas and other Malignancies | GSE125040 | Transcriptome Analysis | The SWI/SNF family chromatin remodeling protein ATRX is a tumor suppressor in sarcomas gliomas and other malignancies. Its loss of function facilitates the alternative lengthening of telomeres ALT pathway in tumor cells while it also affects Polycomb repressive complex 2 PRC2 silencing of its target genes. To further define the role of inactivating ATRX mutations in carcinogenesis we knocked out atrx in our previously published p53/nf1 deficient zebrafish line that develops malignant peripheral nerve sheath tumors and gliomas. Complete inactivation of atrx using CRISPR cas9 was lethal in developing fish and resulted in an alpha thalassemia like phenotype including reduced alpha globin expression. In p53/nf1 deficient zebrafish neither peripheral nerve sheath tumors nor gliomas showed accelerated onset in atrx+/ fish but these fish developed various tumors that were not observed in their atrx+/+ siblings including epithelioid sarcoma angiosarcoma undifferentiated pleomorphic sarcoma and rare types of carcinoma. Most of these cancer types are included in the AACR Genie database of human tumors associated with mutant ATRX indicating that our zebrafish model reliably reflects a role for ATRX loss in the early pathogenesis of these types of human cancers. RNA seq of p53/nf1 and p53/nf1/atrx deficient tumors revealed that down regulation of telomerase accompanied ALT mediated lengthening of the telomeres in atrx mutant samples. Moreover inactivating mutations in atrx disturbed PRC2 target gene silencing indicating a connection between ATRX loss and PRC2 dysfunction in cancer development. Overall design: Gene expression values were derived from paired end RNA Seq data that compared zebrafish samples from p53/nf1/atrx deficient tumors to samples from atrx wildtype controls 3 vs. 3 samples. | pubmed:30970016;pubmed:32651197 | MPNST atrx mut A1 | GSM3561586 | tissue:Zebrafish malignant peripheral nerve sheath tumors MPNSTs|tp53: / |nf1b: / |nf1a:+/ |atrx:+/ | MPNST atrx mut A1 | FastQC was used to evaluate read quality on raw RNA Seq reads and trimmed reads. Trimming of low quality reads and clipping of sequencing adapters was done using the program Trimmomatic version 0.36 and all reads shorter than 36bp post trimming were dropped Trimmomatic was run with settings of ILLUMINACLIP:adapters/TruSeq3 PE 2.fa: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 AVGQUAL:10. Reads were aligned to the zebrafish Danio rerio reference genome with TopHat version 2.1.0 using UCSC danRer10 and settings of x 1 g 1 r 44 mate std dev 223 with values for the flags r and mate std dev coming from the mean fragment size. Bam sorting and indexing was done with SamTools and duplicate reads were removed using Picard tools http://picard.sourceforge.net. Aligned reads processed to Fragments Per Kilobase of exon per Million fragments mapped FPKM using cufflinks version 2.2.1 http://cufflinks.cbcb.umd.edu/index.html with the G flag to use the danRer10 reference annotation to estimate isoform expression and not assemble novel transcripts and the flags max bundle frags 4000000 N compatible hits norm. Gene level counts were obtained with htseq count version 0.9.1. Differential gene expression was evaluated with the R Bioconductor package DESeq2 and normalized expression values for individual samples were obtained from DESeq2 using the variance stabilizing transform on the raw counts. The variance stabilizing transformed data were used for GSEA. Genome build: GRCz10 Supplementary files format and content: genes.fpkm tracking files are tab delimited text files output by cufflinks in a generic FPKM tracking format with estimated gene level expression values in the form of FPKM values and raw count.txt files are tab delimited text files output by htseq count with gene level counts | Zebrafish malignant peripheral nerve sheath tumors MPNSTs | The zebrafish atrx mutant lines were generated by the CRISPR Cas9 genome editing system using the previous described protocol Hwang et al. Nature Biotechnology 2013. The plasmid constructs pDR274 #42250 and pMLM3613 #42251 were purchased from Addgene. Oligonucleotides 5’ TAG GTC CTG AGT TCC GTA ACA A 3’ and 5’ AAA CTT GTT ACG GAA CTC AGG A 3’ were annealed and cloned into the pDR274 vector to generate single guide RNAs gRNAs targeting atrx exon 4. Each embryo was injected with 1 nl of solution containing 25 ng/μl gRNA and 600 ng/μl Cas9 mRNA at the 1 cell stage. Mosaic F0 fish with germline mutation were identified and stable mutant lines were established by outcrossing. | RNA was isolated from one half of p53/nf1/atrx deficient MPNSTs and p53/nf1 deficient control MPNSTs using the AllPrep DNA/RNA Mini Kit from Qiagen Hilden Germany and the other half was set asside for analysis by histopathology. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | Zebrafish were raised and maintained according to standard procedures. They were derived from the p53/nf1 deficient background Shin et al. Disease Models & Mechanisms 2012. All zebrafish studies and maintenance were done in accord with Dana Farber Cancer Institute IACUC approved protocol #02 107. | tp53: / |nf1b: / |nf1a:+/ |atrx:+/ | GSM3561586 | GSM3561586: MPNST atrx mut A1; Danio rerio; RNA Seq | GSM3561586 | 1 | RNA was isolated from one half of p53/nf1/atrx deficient MPNSTs and p53/nf1 deficient control MPNSTs using the AllPrep DNA/RNA Mini Kit from Qiagen Hilden Germany and the other half was set asside for analysis by histopathology. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | GEO Accession:GSM3561586 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP180876 | 20170730_A1_MWZ4474_S3_R2_001.fastq.gz 20170730_A1_MWZ4474_S3_R1_001.fastq.gz | fastq fastq | 7091090550.0 | 47273937.0 | GSM3561586 r1 | 0:75 1:75 | A:1979016948;C:1575512434;G:1582806544;T:1952381152;N:1373472 | 75 | 75 | 1979016948 | 1575512434 | 1582806544 | 1952381152 | 1373472 | SRX5247077 | SRS4273266 | SRA834478 | GEO | Pediatric Oncology, Dana-Farber Cancer Institute | 2 | 0.91956 | 0.91956 | 0.08912 | 0.0878 | 0.74848 | 0.76627 | 0.52338 | 0.51896 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2019-01-14 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||
| 51030 | 51030 | SRR8439646 | SRX5247076 | SRS4273265 | SRP180876 | PRJNA515051 | Zebrafish Samples for Loss of ATRX cooperates with p53 Deficiency to promote the Development of Sarcomas and other Malignancies | GSE125040 | Transcriptome Analysis | The SWI/SNF family chromatin remodeling protein ATRX is a tumor suppressor in sarcomas gliomas and other malignancies. Its loss of function facilitates the alternative lengthening of telomeres ALT pathway in tumor cells while it also affects Polycomb repressive complex 2 PRC2 silencing of its target genes. To further define the role of inactivating ATRX mutations in carcinogenesis we knocked out atrx in our previously published p53/nf1 deficient zebrafish line that develops malignant peripheral nerve sheath tumors and gliomas. Complete inactivation of atrx using CRISPR cas9 was lethal in developing fish and resulted in an alpha thalassemia like phenotype including reduced alpha globin expression. In p53/nf1 deficient zebrafish neither peripheral nerve sheath tumors nor gliomas showed accelerated onset in atrx+/ fish but these fish developed various tumors that were not observed in their atrx+/+ siblings including epithelioid sarcoma angiosarcoma undifferentiated pleomorphic sarcoma and rare types of carcinoma. Most of these cancer types are included in the AACR Genie database of human tumors associated with mutant ATRX indicating that our zebrafish model reliably reflects a role for ATRX loss in the early pathogenesis of these types of human cancers. RNA seq of p53/nf1 and p53/nf1/atrx deficient tumors revealed that down regulation of telomerase accompanied ALT mediated lengthening of the telomeres in atrx mutant samples. Moreover inactivating mutations in atrx disturbed PRC2 target gene silencing indicating a connection between ATRX loss and PRC2 dysfunction in cancer development. Overall design: Gene expression values were derived from paired end RNA Seq data that compared zebrafish samples from p53/nf1/atrx deficient tumors to samples from atrx wildtype controls 3 vs. 3 samples. | pubmed:30970016;pubmed:32651197 | MPNST atrx WT A14 | GSM3561585 | tissue:Zebrafish malignant peripheral nerve sheath tumors MPNSTs|tp53: / |nf1b: / |nf1a:+/ |atrx:wt | MPNST atrx WT A14 | FastQC was used to evaluate read quality on raw RNA Seq reads and trimmed reads. Trimming of low quality reads and clipping of sequencing adapters was done using the program Trimmomatic version 0.36 and all reads shorter than 36bp post trimming were dropped Trimmomatic was run with settings of ILLUMINACLIP:adapters/TruSeq3 PE 2.fa: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 AVGQUAL:10. Reads were aligned to the zebrafish Danio rerio reference genome with TopHat version 2.1.0 using UCSC danRer10 and settings of x 1 g 1 r 44 mate std dev 223 with values for the flags r and mate std dev coming from the mean fragment size. Bam sorting and indexing was done with SamTools and duplicate reads were removed using Picard tools http://picard.sourceforge.net. Aligned reads processed to Fragments Per Kilobase of exon per Million fragments mapped FPKM using cufflinks version 2.2.1 http://cufflinks.cbcb.umd.edu/index.html with the G flag to use the danRer10 reference annotation to estimate isoform expression and not assemble novel transcripts and the flags max bundle frags 4000000 N compatible hits norm. Gene level counts were obtained with htseq count version 0.9.1. Differential gene expression was evaluated with the R Bioconductor package DESeq2 and normalized expression values for individual samples were obtained from DESeq2 using the variance stabilizing transform on the raw counts. The variance stabilizing transformed data were used for GSEA. Genome build: GRCz10 Supplementary files format and content: genes.fpkm tracking files are tab delimited text files output by cufflinks in a generic FPKM tracking format with estimated gene level expression values in the form of FPKM values and raw count.txt files are tab delimited text files output by htseq count with gene level counts | Zebrafish malignant peripheral nerve sheath tumors MPNSTs | The zebrafish atrx mutant lines were generated by the CRISPR Cas9 genome editing system using the previous described protocol Hwang et al. Nature Biotechnology 2013. The plasmid constructs pDR274 #42250 and pMLM3613 #42251 were purchased from Addgene. Oligonucleotides 5’ TAG GTC CTG AGT TCC GTA ACA A 3’ and 5’ AAA CTT GTT ACG GAA CTC AGG A 3’ were annealed and cloned into the pDR274 vector to generate single guide RNAs gRNAs targeting atrx exon 4. Each embryo was injected with 1 nl of solution containing 25 ng/μl gRNA and 600 ng/μl Cas9 mRNA at the 1 cell stage. Mosaic F0 fish with germline mutation were identified and stable mutant lines were established by outcrossing. | RNA was isolated from one half of p53/nf1/atrx deficient MPNSTs and p53/nf1 deficient control MPNSTs using the AllPrep DNA/RNA Mini Kit from Qiagen Hilden Germany and the other half was set asside for analysis by histopathology. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | Zebrafish were raised and maintained according to standard procedures. They were derived from the p53/nf1 deficient background Shin et al. Disease Models & Mechanisms 2012. All zebrafish studies and maintenance were done in accord with Dana Farber Cancer Institute IACUC approved protocol #02 107. | tp53: / |nf1b: / |nf1a:+/ |atrx:wt | GSM3561585 | GSM3561585: MPNST atrx WT A14; Danio rerio; RNA Seq | GSM3561585 | 1 | RNA was isolated from one half of p53/nf1/atrx deficient MPNSTs and p53/nf1 deficient control MPNSTs using the AllPrep DNA/RNA Mini Kit from Qiagen Hilden Germany and the other half was set asside for analysis by histopathology. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | GEO Accession:GSM3561585 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP180876 | 20170730_A14_MWZ4474_S8_R1_001.fastq.gz 20170730_A14_MWZ4474_S8_R2_001.fastq.gz | fastq fastq | 6664823700.0 | 44432158.0 | GSM3561585 r1 | 0:75 1:75 | A:1818800880;C:1519582626;G:1528375916;T:1796781856;N:1282422 | 75 | 75 | 1818800880 | 1519582626 | 1528375916 | 1796781856 | 1282422 | SRX5247076 | SRS4273265 | SRA834478 | GEO | Pediatric Oncology, Dana-Farber Cancer Institute | 2 | 0.92705 | 0.92717 | 0.08967 | 0.0892 | 0.75209 | 0.7709 | 0.50996 | 0.49376 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2019-01-14 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||
| 51031 | 51031 | SRR8439645 | SRX5247075 | SRS4273263 | SRP180876 | PRJNA515051 | Zebrafish Samples for Loss of ATRX cooperates with p53 Deficiency to promote the Development of Sarcomas and other Malignancies | GSE125040 | Transcriptome Analysis | The SWI/SNF family chromatin remodeling protein ATRX is a tumor suppressor in sarcomas gliomas and other malignancies. Its loss of function facilitates the alternative lengthening of telomeres ALT pathway in tumor cells while it also affects Polycomb repressive complex 2 PRC2 silencing of its target genes. To further define the role of inactivating ATRX mutations in carcinogenesis we knocked out atrx in our previously published p53/nf1 deficient zebrafish line that develops malignant peripheral nerve sheath tumors and gliomas. Complete inactivation of atrx using CRISPR cas9 was lethal in developing fish and resulted in an alpha thalassemia like phenotype including reduced alpha globin expression. In p53/nf1 deficient zebrafish neither peripheral nerve sheath tumors nor gliomas showed accelerated onset in atrx+/ fish but these fish developed various tumors that were not observed in their atrx+/+ siblings including epithelioid sarcoma angiosarcoma undifferentiated pleomorphic sarcoma and rare types of carcinoma. Most of these cancer types are included in the AACR Genie database of human tumors associated with mutant ATRX indicating that our zebrafish model reliably reflects a role for ATRX loss in the early pathogenesis of these types of human cancers. RNA seq of p53/nf1 and p53/nf1/atrx deficient tumors revealed that down regulation of telomerase accompanied ALT mediated lengthening of the telomeres in atrx mutant samples. Moreover inactivating mutations in atrx disturbed PRC2 target gene silencing indicating a connection between ATRX loss and PRC2 dysfunction in cancer development. Overall design: Gene expression values were derived from paired end RNA Seq data that compared zebrafish samples from p53/nf1/atrx deficient tumors to samples from atrx wildtype controls 3 vs. 3 samples. | pubmed:30970016;pubmed:32651197 | MPNST atrx WT A11 | GSM3561584 | tissue:Zebrafish malignant peripheral nerve sheath tumors MPNSTs|tp53: / |nf1b: / |nf1a:+/ |atrx:wt | MPNST atrx WT A11 | FastQC was used to evaluate read quality on raw RNA Seq reads and trimmed reads. Trimming of low quality reads and clipping of sequencing adapters was done using the program Trimmomatic version 0.36 and all reads shorter than 36bp post trimming were dropped Trimmomatic was run with settings of ILLUMINACLIP:adapters/TruSeq3 PE 2.fa: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 AVGQUAL:10. Reads were aligned to the zebrafish Danio rerio reference genome with TopHat version 2.1.0 using UCSC danRer10 and settings of x 1 g 1 r 44 mate std dev 223 with values for the flags r and mate std dev coming from the mean fragment size. Bam sorting and indexing was done with SamTools and duplicate reads were removed using Picard tools http://picard.sourceforge.net. Aligned reads processed to Fragments Per Kilobase of exon per Million fragments mapped FPKM using cufflinks version 2.2.1 http://cufflinks.cbcb.umd.edu/index.html with the G flag to use the danRer10 reference annotation to estimate isoform expression and not assemble novel transcripts and the flags max bundle frags 4000000 N compatible hits norm. Gene level counts were obtained with htseq count version 0.9.1. Differential gene expression was evaluated with the R Bioconductor package DESeq2 and normalized expression values for individual samples were obtained from DESeq2 using the variance stabilizing transform on the raw counts. The variance stabilizing transformed data were used for GSEA. Genome build: GRCz10 Supplementary files format and content: genes.fpkm tracking files are tab delimited text files output by cufflinks in a generic FPKM tracking format with estimated gene level expression values in the form of FPKM values and raw count.txt files are tab delimited text files output by htseq count with gene level counts | Zebrafish malignant peripheral nerve sheath tumors MPNSTs | The zebrafish atrx mutant lines were generated by the CRISPR Cas9 genome editing system using the previous described protocol Hwang et al. Nature Biotechnology 2013. The plasmid constructs pDR274 #42250 and pMLM3613 #42251 were purchased from Addgene. Oligonucleotides 5’ TAG GTC CTG AGT TCC GTA ACA A 3’ and 5’ AAA CTT GTT ACG GAA CTC AGG A 3’ were annealed and cloned into the pDR274 vector to generate single guide RNAs gRNAs targeting atrx exon 4. Each embryo was injected with 1 nl of solution containing 25 ng/μl gRNA and 600 ng/μl Cas9 mRNA at the 1 cell stage. Mosaic F0 fish with germline mutation were identified and stable mutant lines were established by outcrossing. | RNA was isolated from one half of p53/nf1/atrx deficient MPNSTs and p53/nf1 deficient control MPNSTs using the AllPrep DNA/RNA Mini Kit from Qiagen Hilden Germany and the other half was set asside for analysis by histopathology. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | Zebrafish were raised and maintained according to standard procedures. They were derived from the p53/nf1 deficient background Shin et al. Disease Models & Mechanisms 2012. All zebrafish studies and maintenance were done in accord with Dana Farber Cancer Institute IACUC approved protocol #02 107. | tp53: / |nf1b: / |nf1a:+/ |atrx:wt | GSM3561584 | GSM3561584: MPNST atrx WT A11; Danio rerio; RNA Seq | GSM3561584 | 1 | RNA was isolated from one half of p53/nf1/atrx deficient MPNSTs and p53/nf1 deficient control MPNSTs using the AllPrep DNA/RNA Mini Kit from Qiagen Hilden Germany and the other half was set asside for analysis by histopathology. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | GEO Accession:GSM3561584 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP180876 | 20170730_A11_MWZ4474_S2_R1_001.fastq.gz 20170730_A11_MWZ4474_S2_R2_001.fastq.gz | fastq fastq | 6371036850.0 | 42473579.0 | GSM3561584 r1 | 0:75 1:75 | A:1739144818;C:1449791284;G:1464375008;T:1716495405;N:1230335 | 75 | 75 | 1739144818 | 1449791284 | 1464375008 | 1716495405 | 1230335 | SRX5247075 | SRS4273263 | SRA834478 | GEO | Pediatric Oncology, Dana-Farber Cancer Institute | 2 | 0.9254 | 0.92615 | 0.08446 | 0.08397 | 0.74945 | 0.76761 | 0.51446 | 0.51395 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2019-01-14 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||
| 51032 | 51032 | SRR8439644 | SRX5247074 | SRS4273264 | SRP180876 | PRJNA515051 | Zebrafish Samples for Loss of ATRX cooperates with p53 Deficiency to promote the Development of Sarcomas and other Malignancies | GSE125040 | Transcriptome Analysis | The SWI/SNF family chromatin remodeling protein ATRX is a tumor suppressor in sarcomas gliomas and other malignancies. Its loss of function facilitates the alternative lengthening of telomeres ALT pathway in tumor cells while it also affects Polycomb repressive complex 2 PRC2 silencing of its target genes. To further define the role of inactivating ATRX mutations in carcinogenesis we knocked out atrx in our previously published p53/nf1 deficient zebrafish line that develops malignant peripheral nerve sheath tumors and gliomas. Complete inactivation of atrx using CRISPR cas9 was lethal in developing fish and resulted in an alpha thalassemia like phenotype including reduced alpha globin expression. In p53/nf1 deficient zebrafish neither peripheral nerve sheath tumors nor gliomas showed accelerated onset in atrx+/ fish but these fish developed various tumors that were not observed in their atrx+/+ siblings including epithelioid sarcoma angiosarcoma undifferentiated pleomorphic sarcoma and rare types of carcinoma. Most of these cancer types are included in the AACR Genie database of human tumors associated with mutant ATRX indicating that our zebrafish model reliably reflects a role for ATRX loss in the early pathogenesis of these types of human cancers. RNA seq of p53/nf1 and p53/nf1/atrx deficient tumors revealed that down regulation of telomerase accompanied ALT mediated lengthening of the telomeres in atrx mutant samples. Moreover inactivating mutations in atrx disturbed PRC2 target gene silencing indicating a connection between ATRX loss and PRC2 dysfunction in cancer development. Overall design: Gene expression values were derived from paired end RNA Seq data that compared zebrafish samples from p53/nf1/atrx deficient tumors to samples from atrx wildtype controls 3 vs. 3 samples. | pubmed:30970016;pubmed:32651197 | MPNST atrx WT A9 | GSM3561583 | tissue:Zebrafish malignant peripheral nerve sheath tumors MPNSTs|tp53: / |nf1b: / |nf1a:+/ |atrx:wt | MPNST atrx WT A9 | FastQC was used to evaluate read quality on raw RNA Seq reads and trimmed reads. Trimming of low quality reads and clipping of sequencing adapters was done using the program Trimmomatic version 0.36 and all reads shorter than 36bp post trimming were dropped Trimmomatic was run with settings of ILLUMINACLIP:adapters/TruSeq3 PE 2.fa: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 AVGQUAL:10. Reads were aligned to the zebrafish Danio rerio reference genome with TopHat version 2.1.0 using UCSC danRer10 and settings of x 1 g 1 r 44 mate std dev 223 with values for the flags r and mate std dev coming from the mean fragment size. Bam sorting and indexing was done with SamTools and duplicate reads were removed using Picard tools http://picard.sourceforge.net. Aligned reads processed to Fragments Per Kilobase of exon per Million fragments mapped FPKM using cufflinks version 2.2.1 http://cufflinks.cbcb.umd.edu/index.html with the G flag to use the danRer10 reference annotation to estimate isoform expression and not assemble novel transcripts and the flags max bundle frags 4000000 N compatible hits norm. Gene level counts were obtained with htseq count version 0.9.1. Differential gene expression was evaluated with the R Bioconductor package DESeq2 and normalized expression values for individual samples were obtained from DESeq2 using the variance stabilizing transform on the raw counts. The variance stabilizing transformed data were used for GSEA. Genome build: GRCz10 Supplementary files format and content: genes.fpkm tracking files are tab delimited text files output by cufflinks in a generic FPKM tracking format with estimated gene level expression values in the form of FPKM values and raw count.txt files are tab delimited text files output by htseq count with gene level counts | Zebrafish malignant peripheral nerve sheath tumors MPNSTs | The zebrafish atrx mutant lines were generated by the CRISPR Cas9 genome editing system using the previous described protocol Hwang et al. Nature Biotechnology 2013. The plasmid constructs pDR274 #42250 and pMLM3613 #42251 were purchased from Addgene. Oligonucleotides 5’ TAG GTC CTG AGT TCC GTA ACA A 3’ and 5’ AAA CTT GTT ACG GAA CTC AGG A 3’ were annealed and cloned into the pDR274 vector to generate single guide RNAs gRNAs targeting atrx exon 4. Each embryo was injected with 1 nl of solution containing 25 ng/μl gRNA and 600 ng/μl Cas9 mRNA at the 1 cell stage. Mosaic F0 fish with germline mutation were identified and stable mutant lines were established by outcrossing. | RNA was isolated from one half of p53/nf1/atrx deficient MPNSTs and p53/nf1 deficient control MPNSTs using the AllPrep DNA/RNA Mini Kit from Qiagen Hilden Germany and the other half was set asside for analysis by histopathology. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | Zebrafish were raised and maintained according to standard procedures. They were derived from the p53/nf1 deficient background Shin et al. Disease Models & Mechanisms 2012. All zebrafish studies and maintenance were done in accord with Dana Farber Cancer Institute IACUC approved protocol #02 107. | tp53: / |nf1b: / |nf1a:+/ |atrx:wt | GSM3561583 | GSM3561583: MPNST atrx WT A9; Danio rerio; RNA Seq | GSM3561583 | 1 | RNA was isolated from one half of p53/nf1/atrx deficient MPNSTs and p53/nf1 deficient control MPNSTs using the AllPrep DNA/RNA Mini Kit from Qiagen Hilden Germany and the other half was set asside for analysis by histopathology. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | GEO Accession:GSM3561583 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP180876 | 20170730_A9_MWZ4474_S1_R1_001.fastq.gz 20170730_A9_MWZ4474_S1_R2_001.fastq.gz | fastq fastq | 5832640200.0 | 38884268.0 | GSM3561583 r1 | 0:75 1:75 | A:1615650762;C:1304790543;G:1316843551;T:1594225635;N:1129709 | 75 | 75 | 1615650762 | 1304790543 | 1316843551 | 1594225635 | 1129709 | SRX5247074 | SRS4273264 | SRA834478 | GEO | Pediatric Oncology, Dana-Farber Cancer Institute | 2 | 0.9265 | 0.92606 | 0.09204 | 0.09207 | 0.76305 | 0.78084 | 0.49678 | 0.50423 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2019-01-14 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||
| 52263 | 52263 | SRR9070361 | SRX5846428 | SRS4772046 | SRP198646 | PRJNA543299 | Oncogenic CDK13 Mutations Impede Nuclear RNA Surveillance zfRNAseq | GSE131333 | Transcriptome Analysis | RNA surveillance pathways detect and degrade defective transcripts to ensure RNA fidelity. We find disrupted nuclear RNA surveillance is oncogenic. Cyclin Dependent Kinase 13 CDK13 is mutated in melanoma and patient mutated CDK13 accelerates zebrafish melanoma. CDK13 mutation causes aberrant RNA stabilization. CDK13 is required for ZC3H14 phosphorylation which is necessary and sufficient to promote nuclear RNA degradation. Mutant CDK13 fails to activate nuclear RNA surveillance causing aberrant protein coding transcripts to be stabilized and translated. Forced aberrant RNA expression accelerates melanoma in zebrafish. We find recurrent mutations in genes encoding nuclear RNA surveillance components in many malignancies establishing nuclear RNA surveillance as a tumor suppressive pathway. Activating nuclear RNA surveillance is crucial to avoid accumulation of aberrant RNAs and their ensuing consequences in development and disease. Overall design: RNA Seq in zebrafish melanoma expressing EGFP or mutant CDK13 | parent bioproject:PRJNA543289 | EGFP oe R165 | GSM3770597 | source name:Melanoma|tissue:Melanoma|cdk13 status:Wild type | EGFP oe R165 | Reads were aligned to a custom version of the danRer10 genome that also contained the human CDK13 gene sequence using bowtie with parameters library type fr unstranded no novel juncs and G set revision 90 of the Ensembl GRCz10 genes Expression of revision 90 GRCz10 genes was quantified using htseq count with parameters r name I gene name stranded=no m intersection strict Supplementary files format and content: Counts files contain gene names and htseq determined read counts | Melanoma | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | p53 / ; mitfa:BRAFV600E;Na / one cell embryos were injected with either 20ng/uL control or experimental MiniCoopR MCR DNA along with tol2 in vitro transcribed RNA for integration. In all experiments 20 zebrafish were raised per tank to control for density effects. Zebrafish were scored for the emergence of raised melanoma lesions as published. Zebrafish were sacrificed on ice and the tumors were dissected. | tissue:Melanoma|cdk13 status:Wild type | GSM3770597 | GSM3770597: EGFP oe R165; Danio rerio; RNA Seq | GSM3770597 | 1 | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | GEO Accession:GSM3770597 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP198646 | EGFP_oe_R165.L001_R1.fastq.gz EGFP_oe_R165.L001_R2.fastq.gz | fastq fastq | 3076610200.0 | 15383051.0 | GSM3770597 r1 | 0:100 1:100 | A:796769616;C:732509940;G:746291003;T:799487857;N:1551784 | 100 | 100 | 796769616 | 732509940 | 746291003 | 799487857 | 1551784 | SRX5846428 | SRS4772046 | SRA887503 | GEO | Young Lab, Whitehead Institute for Biomedical Research | 2 | 0.89789 | 0.90025 | 0.23187 | 0.23394 | 0.72054 | 0.72914 | 0.49446 | 0.49563 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-05-16 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 52264 | 52264 | SRR9070362 | SRX5846428 | SRS4772046 | SRP198646 | PRJNA543299 | Oncogenic CDK13 Mutations Impede Nuclear RNA Surveillance zfRNAseq | GSE131333 | Transcriptome Analysis | RNA surveillance pathways detect and degrade defective transcripts to ensure RNA fidelity. We find disrupted nuclear RNA surveillance is oncogenic. Cyclin Dependent Kinase 13 CDK13 is mutated in melanoma and patient mutated CDK13 accelerates zebrafish melanoma. CDK13 mutation causes aberrant RNA stabilization. CDK13 is required for ZC3H14 phosphorylation which is necessary and sufficient to promote nuclear RNA degradation. Mutant CDK13 fails to activate nuclear RNA surveillance causing aberrant protein coding transcripts to be stabilized and translated. Forced aberrant RNA expression accelerates melanoma in zebrafish. We find recurrent mutations in genes encoding nuclear RNA surveillance components in many malignancies establishing nuclear RNA surveillance as a tumor suppressive pathway. Activating nuclear RNA surveillance is crucial to avoid accumulation of aberrant RNAs and their ensuing consequences in development and disease. Overall design: RNA Seq in zebrafish melanoma expressing EGFP or mutant CDK13 | parent bioproject:PRJNA543289 | EGFP oe R165 | GSM3770597 | source name:Melanoma|tissue:Melanoma|cdk13 status:Wild type | EGFP oe R165 | Reads were aligned to a custom version of the danRer10 genome that also contained the human CDK13 gene sequence using bowtie with parameters library type fr unstranded no novel juncs and G set revision 90 of the Ensembl GRCz10 genes Expression of revision 90 GRCz10 genes was quantified using htseq count with parameters r name I gene name stranded=no m intersection strict Supplementary files format and content: Counts files contain gene names and htseq determined read counts | Melanoma | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | p53 / ; mitfa:BRAFV600E;Na / one cell embryos were injected with either 20ng/uL control or experimental MiniCoopR MCR DNA along with tol2 in vitro transcribed RNA for integration. In all experiments 20 zebrafish were raised per tank to control for density effects. Zebrafish were scored for the emergence of raised melanoma lesions as published. Zebrafish were sacrificed on ice and the tumors were dissected. | tissue:Melanoma|cdk13 status:Wild type | GSM3770597 | GSM3770597: EGFP oe R165; Danio rerio; RNA Seq | GSM3770597 | 1 | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | GEO Accession:GSM3770597 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP198646 | EGFP_oe_R165.L002_R1.fastq.gz EGFP_oe_R165.L002_R2.fastq.gz | fastq fastq | 3086197200.0 | 15430986.0 | GSM3770597 r2 | 0:100 1:100 | A:799938324;C:734747735;G:748062404;T:802632934;N:815803 | 100 | 100 | 799938324 | 734747735 | 748062404 | 802632934 | 815803 | SRX5846428 | SRS4772046 | SRA887503 | GEO | Young Lab, Whitehead Institute for Biomedical Research | 2 | 0.89887 | 0.90081 | 0.23176 | 0.23262 | 0.7204 | 0.72805 | 0.49093 | 0.49789 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-05-16 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 52265 | 52265 | SRR9070359 | SRX5846427 | SRS4772045 | SRP198646 | PRJNA543299 | Oncogenic CDK13 Mutations Impede Nuclear RNA Surveillance zfRNAseq | GSE131333 | Transcriptome Analysis | RNA surveillance pathways detect and degrade defective transcripts to ensure RNA fidelity. We find disrupted nuclear RNA surveillance is oncogenic. Cyclin Dependent Kinase 13 CDK13 is mutated in melanoma and patient mutated CDK13 accelerates zebrafish melanoma. CDK13 mutation causes aberrant RNA stabilization. CDK13 is required for ZC3H14 phosphorylation which is necessary and sufficient to promote nuclear RNA degradation. Mutant CDK13 fails to activate nuclear RNA surveillance causing aberrant protein coding transcripts to be stabilized and translated. Forced aberrant RNA expression accelerates melanoma in zebrafish. We find recurrent mutations in genes encoding nuclear RNA surveillance components in many malignancies establishing nuclear RNA surveillance as a tumor suppressive pathway. Activating nuclear RNA surveillance is crucial to avoid accumulation of aberrant RNAs and their ensuing consequences in development and disease. Overall design: RNA Seq in zebrafish melanoma expressing EGFP or mutant CDK13 | parent bioproject:PRJNA543289 | CDK13 R860Q oe R160 | GSM3770596 | source name:Melanoma|tissue:Melanoma|cdk13 status:R860Q | CDK13 R860Q oe R160 | Reads were aligned to a custom version of the danRer10 genome that also contained the human CDK13 gene sequence using bowtie with parameters library type fr unstranded no novel juncs and G set revision 90 of the Ensembl GRCz10 genes Expression of revision 90 GRCz10 genes was quantified using htseq count with parameters r name I gene name stranded=no m intersection strict Supplementary files format and content: Counts files contain gene names and htseq determined read counts | Melanoma | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | p53 / ; mitfa:BRAFV600E;Na / one cell embryos were injected with either 20ng/uL control or experimental MiniCoopR MCR DNA along with tol2 in vitro transcribed RNA for integration. In all experiments 20 zebrafish were raised per tank to control for density effects. Zebrafish were scored for the emergence of raised melanoma lesions as published. Zebrafish were sacrificed on ice and the tumors were dissected. | tissue:Melanoma|cdk13 status:R860Q | GSM3770596 | GSM3770596: CDK13 R860Q oe R160; Danio rerio; RNA Seq | GSM3770596 | 1 | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | GEO Accession:GSM3770596 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP198646 | CDK13_R860Q_oe_R160.L001_R1.fastq.gz CDK13_R860Q_oe_R160.L001_R2.fastq.gz | fastq fastq | 2678770600.0 | 13393853.0 | GSM3770596 r1 | 0:100 1:100 | A:619003093;C:719249623;G:727338824;T:611848801;N:1330259 | 100 | 100 | 619003093 | 719249623 | 727338824 | 611848801 | 1330259 | SRX5846427 | SRS4772045 | SRA887503 | GEO | Young Lab, Whitehead Institute for Biomedical Research | 2 | 0.94125 | 0.94048 | 0.19284 | 0.20048 | 0.79644 | 0.80397 | 0.62455 | 0.62265 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-05-16 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 52266 | 52266 | SRR9070360 | SRX5846427 | SRS4772045 | SRP198646 | PRJNA543299 | Oncogenic CDK13 Mutations Impede Nuclear RNA Surveillance zfRNAseq | GSE131333 | Transcriptome Analysis | RNA surveillance pathways detect and degrade defective transcripts to ensure RNA fidelity. We find disrupted nuclear RNA surveillance is oncogenic. Cyclin Dependent Kinase 13 CDK13 is mutated in melanoma and patient mutated CDK13 accelerates zebrafish melanoma. CDK13 mutation causes aberrant RNA stabilization. CDK13 is required for ZC3H14 phosphorylation which is necessary and sufficient to promote nuclear RNA degradation. Mutant CDK13 fails to activate nuclear RNA surveillance causing aberrant protein coding transcripts to be stabilized and translated. Forced aberrant RNA expression accelerates melanoma in zebrafish. We find recurrent mutations in genes encoding nuclear RNA surveillance components in many malignancies establishing nuclear RNA surveillance as a tumor suppressive pathway. Activating nuclear RNA surveillance is crucial to avoid accumulation of aberrant RNAs and their ensuing consequences in development and disease. Overall design: RNA Seq in zebrafish melanoma expressing EGFP or mutant CDK13 | parent bioproject:PRJNA543289 | CDK13 R860Q oe R160 | GSM3770596 | source name:Melanoma|tissue:Melanoma|cdk13 status:R860Q | CDK13 R860Q oe R160 | Reads were aligned to a custom version of the danRer10 genome that also contained the human CDK13 gene sequence using bowtie with parameters library type fr unstranded no novel juncs and G set revision 90 of the Ensembl GRCz10 genes Expression of revision 90 GRCz10 genes was quantified using htseq count with parameters r name I gene name stranded=no m intersection strict Supplementary files format and content: Counts files contain gene names and htseq determined read counts | Melanoma | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | p53 / ; mitfa:BRAFV600E;Na / one cell embryos were injected with either 20ng/uL control or experimental MiniCoopR MCR DNA along with tol2 in vitro transcribed RNA for integration. In all experiments 20 zebrafish were raised per tank to control for density effects. Zebrafish were scored for the emergence of raised melanoma lesions as published. Zebrafish were sacrificed on ice and the tumors were dissected. | tissue:Melanoma|cdk13 status:R860Q | GSM3770596 | GSM3770596: CDK13 R860Q oe R160; Danio rerio; RNA Seq | GSM3770596 | 1 | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | GEO Accession:GSM3770596 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP198646 | CDK13_R860Q_oe_R160.L002_R1.fastq.gz CDK13_R860Q_oe_R160.L002_R2.fastq.gz | fastq fastq | 2693583400.0 | 13467917.0 | GSM3770596 r2 | 0:100 1:100 | A:622749897;C:723537232;G:731266414;T:615327852;N:702005 | 100 | 100 | 622749897 | 723537232 | 731266414 | 615327852 | 702005 | SRX5846427 | SRS4772045 | SRA887503 | GEO | Young Lab, Whitehead Institute for Biomedical Research | 2 | 0.9417 | 0.9413 | 0.19174 | 0.19923 | 0.7921 | 0.80062 | 0.62351 | 0.62723 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-05-16 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 52267 | 52267 | SRR9070357 | SRX5846426 | SRS4772044 | SRP198646 | PRJNA543299 | Oncogenic CDK13 Mutations Impede Nuclear RNA Surveillance zfRNAseq | GSE131333 | Transcriptome Analysis | RNA surveillance pathways detect and degrade defective transcripts to ensure RNA fidelity. We find disrupted nuclear RNA surveillance is oncogenic. Cyclin Dependent Kinase 13 CDK13 is mutated in melanoma and patient mutated CDK13 accelerates zebrafish melanoma. CDK13 mutation causes aberrant RNA stabilization. CDK13 is required for ZC3H14 phosphorylation which is necessary and sufficient to promote nuclear RNA degradation. Mutant CDK13 fails to activate nuclear RNA surveillance causing aberrant protein coding transcripts to be stabilized and translated. Forced aberrant RNA expression accelerates melanoma in zebrafish. We find recurrent mutations in genes encoding nuclear RNA surveillance components in many malignancies establishing nuclear RNA surveillance as a tumor suppressive pathway. Activating nuclear RNA surveillance is crucial to avoid accumulation of aberrant RNAs and their ensuing consequences in development and disease. Overall design: RNA Seq in zebrafish melanoma expressing EGFP or mutant CDK13 | parent bioproject:PRJNA543289 | CDK13 R860Q oe R161 | GSM3770595 | source name:Melanoma|tissue:Melanoma|cdk13 status:R860Q | CDK13 R860Q oe R161 | Reads were aligned to a custom version of the danRer10 genome that also contained the human CDK13 gene sequence using bowtie with parameters library type fr unstranded no novel juncs and G set revision 90 of the Ensembl GRCz10 genes Expression of revision 90 GRCz10 genes was quantified using htseq count with parameters r name I gene name stranded=no m intersection strict Supplementary files format and content: Counts files contain gene names and htseq determined read counts | Melanoma | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | p53 / ; mitfa:BRAFV600E;Na / one cell embryos were injected with either 20ng/uL control or experimental MiniCoopR MCR DNA along with tol2 in vitro transcribed RNA for integration. In all experiments 20 zebrafish were raised per tank to control for density effects. Zebrafish were scored for the emergence of raised melanoma lesions as published. Zebrafish were sacrificed on ice and the tumors were dissected. | tissue:Melanoma|cdk13 status:R860Q | GSM3770595 | GSM3770595: CDK13 R860Q oe R161; Danio rerio; RNA Seq | GSM3770595 | 1 | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | GEO Accession:GSM3770595 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP198646 | CDK13_R860Q_oe_R161.L001_R2.fastq.gz CDK13_R860Q_oe_R161.L001_R1.fastq.gz | fastq fastq | 2519068200.0 | 12595341.0 | GSM3770595 r1 | 0:100 1:100 | A:583021128;C:674785225;G:681628903;T:578362129;N:1270815 | 100 | 100 | 583021128 | 674785225 | 681628903 | 578362129 | 1270815 | SRX5846426 | SRS4772044 | SRA887503 | GEO | Young Lab, Whitehead Institute for Biomedical Research | 2 | 0.94911 | 0.9495 | 0.18704 | 0.19367 | 0.78971 | 0.79555 | 0.60812 | 0.60963 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-05-16 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 52268 | 52268 | SRR9070358 | SRX5846426 | SRS4772044 | SRP198646 | PRJNA543299 | Oncogenic CDK13 Mutations Impede Nuclear RNA Surveillance zfRNAseq | GSE131333 | Transcriptome Analysis | RNA surveillance pathways detect and degrade defective transcripts to ensure RNA fidelity. We find disrupted nuclear RNA surveillance is oncogenic. Cyclin Dependent Kinase 13 CDK13 is mutated in melanoma and patient mutated CDK13 accelerates zebrafish melanoma. CDK13 mutation causes aberrant RNA stabilization. CDK13 is required for ZC3H14 phosphorylation which is necessary and sufficient to promote nuclear RNA degradation. Mutant CDK13 fails to activate nuclear RNA surveillance causing aberrant protein coding transcripts to be stabilized and translated. Forced aberrant RNA expression accelerates melanoma in zebrafish. We find recurrent mutations in genes encoding nuclear RNA surveillance components in many malignancies establishing nuclear RNA surveillance as a tumor suppressive pathway. Activating nuclear RNA surveillance is crucial to avoid accumulation of aberrant RNAs and their ensuing consequences in development and disease. Overall design: RNA Seq in zebrafish melanoma expressing EGFP or mutant CDK13 | parent bioproject:PRJNA543289 | CDK13 R860Q oe R161 | GSM3770595 | source name:Melanoma|tissue:Melanoma|cdk13 status:R860Q | CDK13 R860Q oe R161 | Reads were aligned to a custom version of the danRer10 genome that also contained the human CDK13 gene sequence using bowtie with parameters library type fr unstranded no novel juncs and G set revision 90 of the Ensembl GRCz10 genes Expression of revision 90 GRCz10 genes was quantified using htseq count with parameters r name I gene name stranded=no m intersection strict Supplementary files format and content: Counts files contain gene names and htseq determined read counts | Melanoma | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | p53 / ; mitfa:BRAFV600E;Na / one cell embryos were injected with either 20ng/uL control or experimental MiniCoopR MCR DNA along with tol2 in vitro transcribed RNA for integration. In all experiments 20 zebrafish were raised per tank to control for density effects. Zebrafish were scored for the emergence of raised melanoma lesions as published. Zebrafish were sacrificed on ice and the tumors were dissected. | tissue:Melanoma|cdk13 status:R860Q | GSM3770595 | GSM3770595: CDK13 R860Q oe R161; Danio rerio; RNA Seq | GSM3770595 | 1 | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | GEO Accession:GSM3770595 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP198646 | CDK13_R860Q_oe_R161.L002_R1.fastq.gz CDK13_R860Q_oe_R161.L002_R2.fastq.gz | fastq fastq | 2530033400.0 | 12650167.0 | GSM3770595 r2 | 0:100 1:100 | A:585770003;C:678037650;G:684581661;T:580984093;N:659993 | 100 | 100 | 585770003 | 678037650 | 684581661 | 580984093 | 659993 | SRX5846426 | SRS4772044 | SRA887503 | GEO | Young Lab, Whitehead Institute for Biomedical Research | 2 | 0.94949 | 0.94869 | 0.18691 | 0.19287 | 0.78904 | 0.79423 | 0.60989 | 0.60787 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-05-16 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 52269 | 52269 | SRR9070383 | SRX5846425 | SRS4772043 | SRP198646 | PRJNA543299 | Oncogenic CDK13 Mutations Impede Nuclear RNA Surveillance zfRNAseq | GSE131333 | Transcriptome Analysis | RNA surveillance pathways detect and degrade defective transcripts to ensure RNA fidelity. We find disrupted nuclear RNA surveillance is oncogenic. Cyclin Dependent Kinase 13 CDK13 is mutated in melanoma and patient mutated CDK13 accelerates zebrafish melanoma. CDK13 mutation causes aberrant RNA stabilization. CDK13 is required for ZC3H14 phosphorylation which is necessary and sufficient to promote nuclear RNA degradation. Mutant CDK13 fails to activate nuclear RNA surveillance causing aberrant protein coding transcripts to be stabilized and translated. Forced aberrant RNA expression accelerates melanoma in zebrafish. We find recurrent mutations in genes encoding nuclear RNA surveillance components in many malignancies establishing nuclear RNA surveillance as a tumor suppressive pathway. Activating nuclear RNA surveillance is crucial to avoid accumulation of aberrant RNAs and their ensuing consequences in development and disease. Overall design: RNA Seq in zebrafish melanoma expressing EGFP or mutant CDK13 | parent bioproject:PRJNA543289 | CDK13 R860Q oe R159 | GSM3770608 | source name:Melanoma|tissue:Melanoma|cdk13 status:R860Q | CDK13 R860Q oe R159 | Reads were aligned to a custom version of the danRer10 genome that also contained the human CDK13 gene sequence using bowtie with parameters library type fr unstranded no novel juncs and G set revision 90 of the Ensembl GRCz10 genes Expression of revision 90 GRCz10 genes was quantified using htseq count with parameters r name I gene name stranded=no m intersection strict Supplementary files format and content: Counts files contain gene names and htseq determined read counts | Melanoma | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | p53 / ; mitfa:BRAFV600E;Na / one cell embryos were injected with either 20ng/uL control or experimental MiniCoopR MCR DNA along with tol2 in vitro transcribed RNA for integration. In all experiments 20 zebrafish were raised per tank to control for density effects. Zebrafish were scored for the emergence of raised melanoma lesions as published. Zebrafish were sacrificed on ice and the tumors were dissected. | tissue:Melanoma|cdk13 status:R860Q | GSM3770608 | GSM3770608: CDK13 R860Q oe R159; Danio rerio; RNA Seq | GSM3770608 | 1 | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | GEO Accession:GSM3770608 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP198646 | CDK13_R860Q_oe_R159.L001_R1.fastq.gz CDK13_R860Q_oe_R159.L001_R2.fastq.gz | fastq fastq | 2474506200.0 | 12372531.0 | GSM3770608 r1 | 0:100 1:100 | A:571838531;C:662884074;G:668025271;T:570526012;N:1232312 | 100 | 100 | 571838531 | 662884074 | 668025271 | 570526012 | 1232312 | SRX5846425 | SRS4772043 | SRA887503 | GEO | Young Lab, Whitehead Institute for Biomedical Research | 2 | 0.9432 | 0.94226 | 0.19666 | 0.20251 | 0.78748 | 0.79498 | 0.61522 | 0.63143 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-05-16 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 52270 | 52270 | SRR9070384 | SRX5846425 | SRS4772043 | SRP198646 | PRJNA543299 | Oncogenic CDK13 Mutations Impede Nuclear RNA Surveillance zfRNAseq | GSE131333 | Transcriptome Analysis | RNA surveillance pathways detect and degrade defective transcripts to ensure RNA fidelity. We find disrupted nuclear RNA surveillance is oncogenic. Cyclin Dependent Kinase 13 CDK13 is mutated in melanoma and patient mutated CDK13 accelerates zebrafish melanoma. CDK13 mutation causes aberrant RNA stabilization. CDK13 is required for ZC3H14 phosphorylation which is necessary and sufficient to promote nuclear RNA degradation. Mutant CDK13 fails to activate nuclear RNA surveillance causing aberrant protein coding transcripts to be stabilized and translated. Forced aberrant RNA expression accelerates melanoma in zebrafish. We find recurrent mutations in genes encoding nuclear RNA surveillance components in many malignancies establishing nuclear RNA surveillance as a tumor suppressive pathway. Activating nuclear RNA surveillance is crucial to avoid accumulation of aberrant RNAs and their ensuing consequences in development and disease. Overall design: RNA Seq in zebrafish melanoma expressing EGFP or mutant CDK13 | parent bioproject:PRJNA543289 | CDK13 R860Q oe R159 | GSM3770608 | source name:Melanoma|tissue:Melanoma|cdk13 status:R860Q | CDK13 R860Q oe R159 | Reads were aligned to a custom version of the danRer10 genome that also contained the human CDK13 gene sequence using bowtie with parameters library type fr unstranded no novel juncs and G set revision 90 of the Ensembl GRCz10 genes Expression of revision 90 GRCz10 genes was quantified using htseq count with parameters r name I gene name stranded=no m intersection strict Supplementary files format and content: Counts files contain gene names and htseq determined read counts | Melanoma | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | p53 / ; mitfa:BRAFV600E;Na / one cell embryos were injected with either 20ng/uL control or experimental MiniCoopR MCR DNA along with tol2 in vitro transcribed RNA for integration. In all experiments 20 zebrafish were raised per tank to control for density effects. Zebrafish were scored for the emergence of raised melanoma lesions as published. Zebrafish were sacrificed on ice and the tumors were dissected. | tissue:Melanoma|cdk13 status:R860Q | GSM3770608 | GSM3770608: CDK13 R860Q oe R159; Danio rerio; RNA Seq | GSM3770608 | 1 | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | GEO Accession:GSM3770608 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP198646 | CDK13_R860Q_oe_R159.L002_R1.fastq.gz CDK13_R860Q_oe_R159.L002_R2.fastq.gz | fastq fastq | 2488931400.0 | 12444657.0 | GSM3770608 r2 | 0:100 1:100 | A:575442427;C:667013703;G:671842360;T:573980795;N:652115 | 100 | 100 | 575442427 | 667013703 | 671842360 | 573980795 | 652115 | SRX5846425 | SRS4772043 | SRA887503 | GEO | Young Lab, Whitehead Institute for Biomedical Research | 2 | 0.94385 | 0.94317 | 0.1983 | 0.20419 | 0.78624 | 0.79474 | 0.61268 | 0.62588 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-05-16 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 52271 | 52271 | SRR9070379 | SRX5846423 | SRS4772041 | SRP198646 | PRJNA543299 | Oncogenic CDK13 Mutations Impede Nuclear RNA Surveillance zfRNAseq | GSE131333 | Transcriptome Analysis | RNA surveillance pathways detect and degrade defective transcripts to ensure RNA fidelity. We find disrupted nuclear RNA surveillance is oncogenic. Cyclin Dependent Kinase 13 CDK13 is mutated in melanoma and patient mutated CDK13 accelerates zebrafish melanoma. CDK13 mutation causes aberrant RNA stabilization. CDK13 is required for ZC3H14 phosphorylation which is necessary and sufficient to promote nuclear RNA degradation. Mutant CDK13 fails to activate nuclear RNA surveillance causing aberrant protein coding transcripts to be stabilized and translated. Forced aberrant RNA expression accelerates melanoma in zebrafish. We find recurrent mutations in genes encoding nuclear RNA surveillance components in many malignancies establishing nuclear RNA surveillance as a tumor suppressive pathway. Activating nuclear RNA surveillance is crucial to avoid accumulation of aberrant RNAs and their ensuing consequences in development and disease. Overall design: RNA Seq in zebrafish melanoma expressing EGFP or mutant CDK13 | parent bioproject:PRJNA543289 | CDK13 R860Q oe R158 | GSM3770606 | source name:Melanoma|tissue:Melanoma|cdk13 status:R860Q | CDK13 R860Q oe R158 | Reads were aligned to a custom version of the danRer10 genome that also contained the human CDK13 gene sequence using bowtie with parameters library type fr unstranded no novel juncs and G set revision 90 of the Ensembl GRCz10 genes Expression of revision 90 GRCz10 genes was quantified using htseq count with parameters r name I gene name stranded=no m intersection strict Supplementary files format and content: Counts files contain gene names and htseq determined read counts | Melanoma | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | p53 / ; mitfa:BRAFV600E;Na / one cell embryos were injected with either 20ng/uL control or experimental MiniCoopR MCR DNA along with tol2 in vitro transcribed RNA for integration. In all experiments 20 zebrafish were raised per tank to control for density effects. Zebrafish were scored for the emergence of raised melanoma lesions as published. Zebrafish were sacrificed on ice and the tumors were dissected. | tissue:Melanoma|cdk13 status:R860Q | GSM3770606 | GSM3770606: CDK13 R860Q oe R158; Danio rerio; RNA Seq | GSM3770606 | 1 | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | GEO Accession:GSM3770606 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP198646 | CDK13_R860Q_oe_R158.L001_R1.fastq.gz CDK13_R860Q_oe_R158.L001_R2.fastq.gz | fastq fastq | 2825434800.0 | 14127174.0 | GSM3770606 r1 | 0:100 1:100 | A:677238441;C:734523392;G:737337121;T:674917300;N:1418546 | 100 | 100 | 677238441 | 734523392 | 737337121 | 674917300 | 1418546 | SRX5846423 | SRS4772041 | SRA887503 | GEO | Young Lab, Whitehead Institute for Biomedical Research | 2 | 0.94498 | 0.94425 | 0.18907 | 0.19315 | 0.778 | 0.78246 | 0.57411 | 0.59623 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-05-16 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 52272 | 52272 | SRR9070380 | SRX5846423 | SRS4772041 | SRP198646 | PRJNA543299 | Oncogenic CDK13 Mutations Impede Nuclear RNA Surveillance zfRNAseq | GSE131333 | Transcriptome Analysis | RNA surveillance pathways detect and degrade defective transcripts to ensure RNA fidelity. We find disrupted nuclear RNA surveillance is oncogenic. Cyclin Dependent Kinase 13 CDK13 is mutated in melanoma and patient mutated CDK13 accelerates zebrafish melanoma. CDK13 mutation causes aberrant RNA stabilization. CDK13 is required for ZC3H14 phosphorylation which is necessary and sufficient to promote nuclear RNA degradation. Mutant CDK13 fails to activate nuclear RNA surveillance causing aberrant protein coding transcripts to be stabilized and translated. Forced aberrant RNA expression accelerates melanoma in zebrafish. We find recurrent mutations in genes encoding nuclear RNA surveillance components in many malignancies establishing nuclear RNA surveillance as a tumor suppressive pathway. Activating nuclear RNA surveillance is crucial to avoid accumulation of aberrant RNAs and their ensuing consequences in development and disease. Overall design: RNA Seq in zebrafish melanoma expressing EGFP or mutant CDK13 | parent bioproject:PRJNA543289 | CDK13 R860Q oe R158 | GSM3770606 | source name:Melanoma|tissue:Melanoma|cdk13 status:R860Q | CDK13 R860Q oe R158 | Reads were aligned to a custom version of the danRer10 genome that also contained the human CDK13 gene sequence using bowtie with parameters library type fr unstranded no novel juncs and G set revision 90 of the Ensembl GRCz10 genes Expression of revision 90 GRCz10 genes was quantified using htseq count with parameters r name I gene name stranded=no m intersection strict Supplementary files format and content: Counts files contain gene names and htseq determined read counts | Melanoma | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | p53 / ; mitfa:BRAFV600E;Na / one cell embryos were injected with either 20ng/uL control or experimental MiniCoopR MCR DNA along with tol2 in vitro transcribed RNA for integration. In all experiments 20 zebrafish were raised per tank to control for density effects. Zebrafish were scored for the emergence of raised melanoma lesions as published. Zebrafish were sacrificed on ice and the tumors were dissected. | tissue:Melanoma|cdk13 status:R860Q | GSM3770606 | GSM3770606: CDK13 R860Q oe R158; Danio rerio; RNA Seq | GSM3770606 | 1 | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | GEO Accession:GSM3770606 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP198646 | CDK13_R860Q_oe_R158.L002_R1.fastq.gz CDK13_R860Q_oe_R158.L002_R2.fastq.gz | fastq fastq | 2843101200.0 | 14215506.0 | GSM3770606 r2 | 0:100 1:100 | A:681805847;C:739425518;G:741775554;T:679334464;N:759817 | 100 | 100 | 681805847 | 739425518 | 741775554 | 679334464 | 759817 | SRX5846423 | SRS4772041 | SRA887503 | GEO | Young Lab, Whitehead Institute for Biomedical Research | 2 | 0.94583 | 0.94538 | 0.19056 | 0.19593 | 0.77429 | 0.77983 | 0.58126 | 0.59795 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-05-16 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 52273 | 52273 | SRR9070369 | SRX5846418 | SRS4772036 | SRP198646 | PRJNA543299 | Oncogenic CDK13 Mutations Impede Nuclear RNA Surveillance zfRNAseq | GSE131333 | Transcriptome Analysis | RNA surveillance pathways detect and degrade defective transcripts to ensure RNA fidelity. We find disrupted nuclear RNA surveillance is oncogenic. Cyclin Dependent Kinase 13 CDK13 is mutated in melanoma and patient mutated CDK13 accelerates zebrafish melanoma. CDK13 mutation causes aberrant RNA stabilization. CDK13 is required for ZC3H14 phosphorylation which is necessary and sufficient to promote nuclear RNA degradation. Mutant CDK13 fails to activate nuclear RNA surveillance causing aberrant protein coding transcripts to be stabilized and translated. Forced aberrant RNA expression accelerates melanoma in zebrafish. We find recurrent mutations in genes encoding nuclear RNA surveillance components in many malignancies establishing nuclear RNA surveillance as a tumor suppressive pathway. Activating nuclear RNA surveillance is crucial to avoid accumulation of aberrant RNAs and their ensuing consequences in development and disease. Overall design: RNA Seq in zebrafish melanoma expressing EGFP or mutant CDK13 | parent bioproject:PRJNA543289 | CDK13 R860Q oe R157 | GSM3770601 | source name:Melanoma|tissue:Melanoma|cdk13 status:R860Q | CDK13 R860Q oe R157 | Reads were aligned to a custom version of the danRer10 genome that also contained the human CDK13 gene sequence using bowtie with parameters library type fr unstranded no novel juncs and G set revision 90 of the Ensembl GRCz10 genes Expression of revision 90 GRCz10 genes was quantified using htseq count with parameters r name I gene name stranded=no m intersection strict Supplementary files format and content: Counts files contain gene names and htseq determined read counts | Melanoma | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | p53 / ; mitfa:BRAFV600E;Na / one cell embryos were injected with either 20ng/uL control or experimental MiniCoopR MCR DNA along with tol2 in vitro transcribed RNA for integration. In all experiments 20 zebrafish were raised per tank to control for density effects. Zebrafish were scored for the emergence of raised melanoma lesions as published. Zebrafish were sacrificed on ice and the tumors were dissected. | tissue:Melanoma|cdk13 status:R860Q | GSM3770601 | GSM3770601: CDK13 R860Q oe R157; Danio rerio; RNA Seq | GSM3770601 | 1 | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | GEO Accession:GSM3770601 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP198646 | CDK13_R860Q_oe_R157.L001_R1.fastq.gz CDK13_R860Q_oe_R157.L001_R2.fastq.gz | fastq fastq | 3661632000.0 | 18308160.0 | GSM3770601 r1 | 0:100 1:100 | A:922608217;C:907144149;G:904156678;T:925925771;N:1797185 | 100 | 100 | 922608217 | 907144149 | 904156678 | 925925771 | 1797185 | SRX5846418 | SRS4772036 | SRA887503 | GEO | Young Lab, Whitehead Institute for Biomedical Research | 2 | 0.74235 | 0.73621 | 0.13938 | 0.14183 | 0.77173 | 0.7811 | 0.48933 | 0.55655 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-05-16 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 52274 | 52274 | SRR9070370 | SRX5846418 | SRS4772036 | SRP198646 | PRJNA543299 | Oncogenic CDK13 Mutations Impede Nuclear RNA Surveillance zfRNAseq | GSE131333 | Transcriptome Analysis | RNA surveillance pathways detect and degrade defective transcripts to ensure RNA fidelity. We find disrupted nuclear RNA surveillance is oncogenic. Cyclin Dependent Kinase 13 CDK13 is mutated in melanoma and patient mutated CDK13 accelerates zebrafish melanoma. CDK13 mutation causes aberrant RNA stabilization. CDK13 is required for ZC3H14 phosphorylation which is necessary and sufficient to promote nuclear RNA degradation. Mutant CDK13 fails to activate nuclear RNA surveillance causing aberrant protein coding transcripts to be stabilized and translated. Forced aberrant RNA expression accelerates melanoma in zebrafish. We find recurrent mutations in genes encoding nuclear RNA surveillance components in many malignancies establishing nuclear RNA surveillance as a tumor suppressive pathway. Activating nuclear RNA surveillance is crucial to avoid accumulation of aberrant RNAs and their ensuing consequences in development and disease. Overall design: RNA Seq in zebrafish melanoma expressing EGFP or mutant CDK13 | parent bioproject:PRJNA543289 | CDK13 R860Q oe R157 | GSM3770601 | source name:Melanoma|tissue:Melanoma|cdk13 status:R860Q | CDK13 R860Q oe R157 | Reads were aligned to a custom version of the danRer10 genome that also contained the human CDK13 gene sequence using bowtie with parameters library type fr unstranded no novel juncs and G set revision 90 of the Ensembl GRCz10 genes Expression of revision 90 GRCz10 genes was quantified using htseq count with parameters r name I gene name stranded=no m intersection strict Supplementary files format and content: Counts files contain gene names and htseq determined read counts | Melanoma | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | p53 / ; mitfa:BRAFV600E;Na / one cell embryos were injected with either 20ng/uL control or experimental MiniCoopR MCR DNA along with tol2 in vitro transcribed RNA for integration. In all experiments 20 zebrafish were raised per tank to control for density effects. Zebrafish were scored for the emergence of raised melanoma lesions as published. Zebrafish were sacrificed on ice and the tumors were dissected. | tissue:Melanoma|cdk13 status:R860Q | GSM3770601 | GSM3770601: CDK13 R860Q oe R157; Danio rerio; RNA Seq | GSM3770601 | 1 | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | GEO Accession:GSM3770601 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP198646 | CDK13_R860Q_oe_R157.L002_R1.fastq.gz CDK13_R860Q_oe_R157.L002_R2.fastq.gz | fastq fastq | 3665362400.0 | 18326812.0 | GSM3770601 r2 | 0:100 1:100 | A:924047293;C:908396365;G:904889672;T:927121273;N:907797 | 100 | 100 | 924047293 | 908396365 | 904889672 | 927121273 | 907797 | SRX5846418 | SRS4772036 | SRA887503 | GEO | Young Lab, Whitehead Institute for Biomedical Research | 2 | 0.74534 | 0.73923 | 0.13944 | 0.14274 | 0.77222 | 0.78011 | 0.47479 | 0.5489 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-05-16 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 52275 | 52275 | SRR9070367 | SRX5846417 | SRS4772035 | SRP198646 | PRJNA543299 | Oncogenic CDK13 Mutations Impede Nuclear RNA Surveillance zfRNAseq | GSE131333 | Transcriptome Analysis | RNA surveillance pathways detect and degrade defective transcripts to ensure RNA fidelity. We find disrupted nuclear RNA surveillance is oncogenic. Cyclin Dependent Kinase 13 CDK13 is mutated in melanoma and patient mutated CDK13 accelerates zebrafish melanoma. CDK13 mutation causes aberrant RNA stabilization. CDK13 is required for ZC3H14 phosphorylation which is necessary and sufficient to promote nuclear RNA degradation. Mutant CDK13 fails to activate nuclear RNA surveillance causing aberrant protein coding transcripts to be stabilized and translated. Forced aberrant RNA expression accelerates melanoma in zebrafish. We find recurrent mutations in genes encoding nuclear RNA surveillance components in many malignancies establishing nuclear RNA surveillance as a tumor suppressive pathway. Activating nuclear RNA surveillance is crucial to avoid accumulation of aberrant RNAs and their ensuing consequences in development and disease. Overall design: RNA Seq in zebrafish melanoma expressing EGFP or mutant CDK13 | parent bioproject:PRJNA543289 | EGFP oe R162 | GSM3770600 | source name:Melanoma|tissue:Melanoma|cdk13 status:Wild type | EGFP oe R162 | Reads were aligned to a custom version of the danRer10 genome that also contained the human CDK13 gene sequence using bowtie with parameters library type fr unstranded no novel juncs and G set revision 90 of the Ensembl GRCz10 genes Expression of revision 90 GRCz10 genes was quantified using htseq count with parameters r name I gene name stranded=no m intersection strict Supplementary files format and content: Counts files contain gene names and htseq determined read counts | Melanoma | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | p53 / ; mitfa:BRAFV600E;Na / one cell embryos were injected with either 20ng/uL control or experimental MiniCoopR MCR DNA along with tol2 in vitro transcribed RNA for integration. In all experiments 20 zebrafish were raised per tank to control for density effects. Zebrafish were scored for the emergence of raised melanoma lesions as published. Zebrafish were sacrificed on ice and the tumors were dissected. | tissue:Melanoma|cdk13 status:Wild type | GSM3770600 | GSM3770600: EGFP oe R162; Danio rerio; RNA Seq | GSM3770600 | 1 | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | GEO Accession:GSM3770600 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP198646 | EGFP_oe_R162.L001_R1.fastq.gz EGFP_oe_R162.L001_R2.fastq.gz | fastq fastq | 2656608000.0 | 13283040.0 | GSM3770600 r1 | 0:100 1:100 | A:588214152;C:738647621;G:741202972;T:587227120;N:1316135 | 100 | 100 | 588214152 | 738647621 | 741202972 | 587227120 | 1316135 | SRX5846417 | SRS4772035 | SRA887503 | GEO | Young Lab, Whitehead Institute for Biomedical Research | 2 | 0.96224 | 0.96157 | 0.19778 | 0.20061 | 0.83069 | 0.83711 | 0.64663 | 0.66048 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-05-16 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 52276 | 52276 | SRR9070368 | SRX5846417 | SRS4772035 | SRP198646 | PRJNA543299 | Oncogenic CDK13 Mutations Impede Nuclear RNA Surveillance zfRNAseq | GSE131333 | Transcriptome Analysis | RNA surveillance pathways detect and degrade defective transcripts to ensure RNA fidelity. We find disrupted nuclear RNA surveillance is oncogenic. Cyclin Dependent Kinase 13 CDK13 is mutated in melanoma and patient mutated CDK13 accelerates zebrafish melanoma. CDK13 mutation causes aberrant RNA stabilization. CDK13 is required for ZC3H14 phosphorylation which is necessary and sufficient to promote nuclear RNA degradation. Mutant CDK13 fails to activate nuclear RNA surveillance causing aberrant protein coding transcripts to be stabilized and translated. Forced aberrant RNA expression accelerates melanoma in zebrafish. We find recurrent mutations in genes encoding nuclear RNA surveillance components in many malignancies establishing nuclear RNA surveillance as a tumor suppressive pathway. Activating nuclear RNA surveillance is crucial to avoid accumulation of aberrant RNAs and their ensuing consequences in development and disease. Overall design: RNA Seq in zebrafish melanoma expressing EGFP or mutant CDK13 | parent bioproject:PRJNA543289 | EGFP oe R162 | GSM3770600 | source name:Melanoma|tissue:Melanoma|cdk13 status:Wild type | EGFP oe R162 | Reads were aligned to a custom version of the danRer10 genome that also contained the human CDK13 gene sequence using bowtie with parameters library type fr unstranded no novel juncs and G set revision 90 of the Ensembl GRCz10 genes Expression of revision 90 GRCz10 genes was quantified using htseq count with parameters r name I gene name stranded=no m intersection strict Supplementary files format and content: Counts files contain gene names and htseq determined read counts | Melanoma | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | p53 / ; mitfa:BRAFV600E;Na / one cell embryos were injected with either 20ng/uL control or experimental MiniCoopR MCR DNA along with tol2 in vitro transcribed RNA for integration. In all experiments 20 zebrafish were raised per tank to control for density effects. Zebrafish were scored for the emergence of raised melanoma lesions as published. Zebrafish were sacrificed on ice and the tumors were dissected. | tissue:Melanoma|cdk13 status:Wild type | GSM3770600 | GSM3770600: EGFP oe R162; Danio rerio; RNA Seq | GSM3770600 | 1 | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | GEO Accession:GSM3770600 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP198646 | EGFP_oe_R162.L002_R1.fastq.gz EGFP_oe_R162.L002_R2.fastq.gz | fastq fastq | 2677422400.0 | 13387112.0 | GSM3770600 r2 | 0:100 1:100 | A:592938070;C:744912021;G:747019801;T:591841669;N:710839 | 100 | 100 | 592938070 | 744912021 | 747019801 | 591841669 | 710839 | SRX5846417 | SRS4772035 | SRA887503 | GEO | Young Lab, Whitehead Institute for Biomedical Research | 2 | 0.96179 | 0.96197 | 0.19784 | 0.2032 | 0.83189 | 0.83857 | 0.65734 | 0.65329 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-05-16 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 52277 | 52277 | SRR9070365 | SRX5846416 | SRS4772034 | SRP198646 | PRJNA543299 | Oncogenic CDK13 Mutations Impede Nuclear RNA Surveillance zfRNAseq | GSE131333 | Transcriptome Analysis | RNA surveillance pathways detect and degrade defective transcripts to ensure RNA fidelity. We find disrupted nuclear RNA surveillance is oncogenic. Cyclin Dependent Kinase 13 CDK13 is mutated in melanoma and patient mutated CDK13 accelerates zebrafish melanoma. CDK13 mutation causes aberrant RNA stabilization. CDK13 is required for ZC3H14 phosphorylation which is necessary and sufficient to promote nuclear RNA degradation. Mutant CDK13 fails to activate nuclear RNA surveillance causing aberrant protein coding transcripts to be stabilized and translated. Forced aberrant RNA expression accelerates melanoma in zebrafish. We find recurrent mutations in genes encoding nuclear RNA surveillance components in many malignancies establishing nuclear RNA surveillance as a tumor suppressive pathway. Activating nuclear RNA surveillance is crucial to avoid accumulation of aberrant RNAs and their ensuing consequences in development and disease. Overall design: RNA Seq in zebrafish melanoma expressing EGFP or mutant CDK13 | parent bioproject:PRJNA543289 | EGFP oe R163 | GSM3770599 | source name:Melanoma|tissue:Melanoma|cdk13 status:Wild type | EGFP oe R163 | Reads were aligned to a custom version of the danRer10 genome that also contained the human CDK13 gene sequence using bowtie with parameters library type fr unstranded no novel juncs and G set revision 90 of the Ensembl GRCz10 genes Expression of revision 90 GRCz10 genes was quantified using htseq count with parameters r name I gene name stranded=no m intersection strict Supplementary files format and content: Counts files contain gene names and htseq determined read counts | Melanoma | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | p53 / ; mitfa:BRAFV600E;Na / one cell embryos were injected with either 20ng/uL control or experimental MiniCoopR MCR DNA along with tol2 in vitro transcribed RNA for integration. In all experiments 20 zebrafish were raised per tank to control for density effects. Zebrafish were scored for the emergence of raised melanoma lesions as published. Zebrafish were sacrificed on ice and the tumors were dissected. | tissue:Melanoma|cdk13 status:Wild type | GSM3770599 | GSM3770599: EGFP oe R163; Danio rerio; RNA Seq | GSM3770599 | 1 | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | GEO Accession:GSM3770599 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP198646 | EGFP_oe_R163.L001_R2.fastq.gz EGFP_oe_R163.L001_R1.fastq.gz | fastq fastq | 2200167400.0 | 11000837.0 | GSM3770599 r1 | 0:100 1:100 | A:557687138;C:532009113;G:541257695;T:568085676;N:1127778 | 100 | 100 | 557687138 | 532009113 | 541257695 | 568085676 | 1127778 | SRX5846416 | SRS4772034 | SRA887503 | GEO | Young Lab, Whitehead Institute for Biomedical Research | 2 | 0.91699 | 0.91547 | 0.25451 | 0.25122 | 0.74197 | 0.74866 | 0.49383 | 0.48521 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-05-16 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 52278 | 52278 | SRR9070366 | SRX5846416 | SRS4772034 | SRP198646 | PRJNA543299 | Oncogenic CDK13 Mutations Impede Nuclear RNA Surveillance zfRNAseq | GSE131333 | Transcriptome Analysis | RNA surveillance pathways detect and degrade defective transcripts to ensure RNA fidelity. We find disrupted nuclear RNA surveillance is oncogenic. Cyclin Dependent Kinase 13 CDK13 is mutated in melanoma and patient mutated CDK13 accelerates zebrafish melanoma. CDK13 mutation causes aberrant RNA stabilization. CDK13 is required for ZC3H14 phosphorylation which is necessary and sufficient to promote nuclear RNA degradation. Mutant CDK13 fails to activate nuclear RNA surveillance causing aberrant protein coding transcripts to be stabilized and translated. Forced aberrant RNA expression accelerates melanoma in zebrafish. We find recurrent mutations in genes encoding nuclear RNA surveillance components in many malignancies establishing nuclear RNA surveillance as a tumor suppressive pathway. Activating nuclear RNA surveillance is crucial to avoid accumulation of aberrant RNAs and their ensuing consequences in development and disease. Overall design: RNA Seq in zebrafish melanoma expressing EGFP or mutant CDK13 | parent bioproject:PRJNA543289 | EGFP oe R163 | GSM3770599 | source name:Melanoma|tissue:Melanoma|cdk13 status:Wild type | EGFP oe R163 | Reads were aligned to a custom version of the danRer10 genome that also contained the human CDK13 gene sequence using bowtie with parameters library type fr unstranded no novel juncs and G set revision 90 of the Ensembl GRCz10 genes Expression of revision 90 GRCz10 genes was quantified using htseq count with parameters r name I gene name stranded=no m intersection strict Supplementary files format and content: Counts files contain gene names and htseq determined read counts | Melanoma | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | p53 / ; mitfa:BRAFV600E;Na / one cell embryos were injected with either 20ng/uL control or experimental MiniCoopR MCR DNA along with tol2 in vitro transcribed RNA for integration. In all experiments 20 zebrafish were raised per tank to control for density effects. Zebrafish were scored for the emergence of raised melanoma lesions as published. Zebrafish were sacrificed on ice and the tumors were dissected. | tissue:Melanoma|cdk13 status:Wild type | GSM3770599 | GSM3770599: EGFP oe R163; Danio rerio; RNA Seq | GSM3770599 | 1 | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | GEO Accession:GSM3770599 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP198646 | EGFP_oe_R163.L002_R2.fastq.gz EGFP_oe_R163.L002_R1.fastq.gz | fastq fastq | 2207341000.0 | 11036705.0 | GSM3770599 r2 | 0:100 1:100 | A:560113696;C:533571442;G:542576508;T:570500106;N:579248 | 100 | 100 | 560113696 | 533571442 | 542576508 | 570500106 | 579248 | SRX5846416 | SRS4772034 | SRA887503 | GEO | Young Lab, Whitehead Institute for Biomedical Research | 2 | 0.91607 | 0.91622 | 0.24532 | 0.25042 | 0.74245 | 0.75014 | 0.49012 | 0.48115 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-05-16 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 52279 | 52279 | SRR9070363 | SRX5846415 | SRS4772033 | SRP198646 | PRJNA543299 | Oncogenic CDK13 Mutations Impede Nuclear RNA Surveillance zfRNAseq | GSE131333 | Transcriptome Analysis | RNA surveillance pathways detect and degrade defective transcripts to ensure RNA fidelity. We find disrupted nuclear RNA surveillance is oncogenic. Cyclin Dependent Kinase 13 CDK13 is mutated in melanoma and patient mutated CDK13 accelerates zebrafish melanoma. CDK13 mutation causes aberrant RNA stabilization. CDK13 is required for ZC3H14 phosphorylation which is necessary and sufficient to promote nuclear RNA degradation. Mutant CDK13 fails to activate nuclear RNA surveillance causing aberrant protein coding transcripts to be stabilized and translated. Forced aberrant RNA expression accelerates melanoma in zebrafish. We find recurrent mutations in genes encoding nuclear RNA surveillance components in many malignancies establishing nuclear RNA surveillance as a tumor suppressive pathway. Activating nuclear RNA surveillance is crucial to avoid accumulation of aberrant RNAs and their ensuing consequences in development and disease. Overall design: RNA Seq in zebrafish melanoma expressing EGFP or mutant CDK13 | parent bioproject:PRJNA543289 | EGFP oe R164 | GSM3770598 | source name:Melanoma|tissue:Melanoma|cdk13 status:Wild type | EGFP oe R164 | Reads were aligned to a custom version of the danRer10 genome that also contained the human CDK13 gene sequence using bowtie with parameters library type fr unstranded no novel juncs and G set revision 90 of the Ensembl GRCz10 genes Expression of revision 90 GRCz10 genes was quantified using htseq count with parameters r name I gene name stranded=no m intersection strict Supplementary files format and content: Counts files contain gene names and htseq determined read counts | Melanoma | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | p53 / ; mitfa:BRAFV600E;Na / one cell embryos were injected with either 20ng/uL control or experimental MiniCoopR MCR DNA along with tol2 in vitro transcribed RNA for integration. In all experiments 20 zebrafish were raised per tank to control for density effects. Zebrafish were scored for the emergence of raised melanoma lesions as published. Zebrafish were sacrificed on ice and the tumors were dissected. | tissue:Melanoma|cdk13 status:Wild type | GSM3770598 | GSM3770598: EGFP oe R164; Danio rerio; RNA Seq | GSM3770598 | 1 | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | GEO Accession:GSM3770598 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP198646 | EGFP_oe_R164.L001_R1.fastq.gz EGFP_oe_R164.L001_R2.fastq.gz | fastq fastq | 2526684200.0 | 12633421.0 | GSM3770598 r1 | 0:100 1:100 | A:560721104;C:699940935;G:697771716;T:566983213;N:1267232 | 100 | 100 | 560721104 | 699940935 | 697771716 | 566983213 | 1267232 | SRX5846415 | SRS4772033 | SRA887503 | GEO | Young Lab, Whitehead Institute for Biomedical Research | 2 | 0.95624 | 0.9564 | 0.18619 | 0.18787 | 0.79082 | 0.79766 | 0.66256 | 0.66357 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-05-16 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 52280 | 52280 | SRR9070364 | SRX5846415 | SRS4772033 | SRP198646 | PRJNA543299 | Oncogenic CDK13 Mutations Impede Nuclear RNA Surveillance zfRNAseq | GSE131333 | Transcriptome Analysis | RNA surveillance pathways detect and degrade defective transcripts to ensure RNA fidelity. We find disrupted nuclear RNA surveillance is oncogenic. Cyclin Dependent Kinase 13 CDK13 is mutated in melanoma and patient mutated CDK13 accelerates zebrafish melanoma. CDK13 mutation causes aberrant RNA stabilization. CDK13 is required for ZC3H14 phosphorylation which is necessary and sufficient to promote nuclear RNA degradation. Mutant CDK13 fails to activate nuclear RNA surveillance causing aberrant protein coding transcripts to be stabilized and translated. Forced aberrant RNA expression accelerates melanoma in zebrafish. We find recurrent mutations in genes encoding nuclear RNA surveillance components in many malignancies establishing nuclear RNA surveillance as a tumor suppressive pathway. Activating nuclear RNA surveillance is crucial to avoid accumulation of aberrant RNAs and their ensuing consequences in development and disease. Overall design: RNA Seq in zebrafish melanoma expressing EGFP or mutant CDK13 | parent bioproject:PRJNA543289 | EGFP oe R164 | GSM3770598 | source name:Melanoma|tissue:Melanoma|cdk13 status:Wild type | EGFP oe R164 | Reads were aligned to a custom version of the danRer10 genome that also contained the human CDK13 gene sequence using bowtie with parameters library type fr unstranded no novel juncs and G set revision 90 of the Ensembl GRCz10 genes Expression of revision 90 GRCz10 genes was quantified using htseq count with parameters r name I gene name stranded=no m intersection strict Supplementary files format and content: Counts files contain gene names and htseq determined read counts | Melanoma | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | p53 / ; mitfa:BRAFV600E;Na / one cell embryos were injected with either 20ng/uL control or experimental MiniCoopR MCR DNA along with tol2 in vitro transcribed RNA for integration. In all experiments 20 zebrafish were raised per tank to control for density effects. Zebrafish were scored for the emergence of raised melanoma lesions as published. Zebrafish were sacrificed on ice and the tumors were dissected. | tissue:Melanoma|cdk13 status:Wild type | GSM3770598 | GSM3770598: EGFP oe R164; Danio rerio; RNA Seq | GSM3770598 | 1 | Library prepped with random priming NEBNext Ultra RNA Library Prep Kit for Illumina E7530 fragmentation time of 15min 12 PCR cycles and sequenced on an Illumina HiSeq 2000 100bp paired end reads. Melanomas were homogenized in RLT buffer subjected to QIAshredder columns Qiagen 79656 and then RNA was isolated with a column based method with genomic DNA column removal Qiagen 74134. RNA was ribodepleted Illumina Ribozero Gold MRZG12324. Ribodepletion was confirmed with Agilent 4200 Tapestation. | GEO Accession:GSM3770598 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP198646 | EGFP_oe_R164.L002_R1.fastq.gz EGFP_oe_R164.L002_R2.fastq.gz | fastq fastq | 2537225800.0 | 12686129.0 | GSM3770598 r2 | 0:100 1:100 | A:563232695;C:703247791;G:700738652;T:569350993;N:655669 | 100 | 100 | 563232695 | 703247791 | 700738652 | 569350993 | 655669 | SRX5846415 | SRS4772033 | SRA887503 | GEO | Young Lab, Whitehead Institute for Biomedical Research | 2 | 0.95722 | 0.95739 | 0.18563 | 0.18908 | 0.79155 | 0.7989 | 0.66665 | 0.66441 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-05-16 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 53570 | 53570 | SRR9944760 | SRX6693259 | SRS5250599 | SRP218009 | PRJNA559652 | Aberrant AKT Activation Drives Ganglioneuroma and Can Be Therapeutically Targeted by mTOR Inhibitors | GSE135682 | Transcriptome Analysis | Peripheral sympathetic nervous system tumors are the most common extra cranial pediatric tumors in children and include neuroblastoma ganglioneuroma and intermixed ganglioneuroblastoma. Ganglioneuroma can be induced by activating mutations of the RET proto oncogene or activated Ras in murine models but the etiology and molecular pathogenesis of this disease is unknown for the majority of human ganglioneuromas. Surgery is the only effective therapy for ganglioneuroma which can be challenging due to tumor location and compression of surrounding structures. Thus there is great potential benefit to the definition of presurgical therapies that can reduce the size and extent of these tumors and therefore limit morbidity. We found high levels of phosphorylated AKT in most of human ganglioneuromas but only in a small portion of human poorly differentiated neuroblastomas p<0.0001 Fisher's exact test. As a result we created zebrafish transgenic for constitutively activated myr Akt2 in the sympathetic nervous system. These zebrafish were found to develop benign ganglioneuroma without xxx to neuroblastoma. Zebrafish tumors displayed high expression of phosphorylated Akt and the downstream Akt targets phosphorylated mTOR S6 and EIF4EBP1. Histopathological and comparative genomic analyses revealed that zebrafish ganglioneuroma highly resembles human ganglioneuroma. Inhibition of the downstream AKT target mTOR using clinically available inhibitors effectively reduced tumor burden in zebrafish embryos transplanted with primary ganglioneuroma. Our results implicate activated and phosphorylated AKT as a tumorigenic driver in ganglioneuroma and propose inhibition of the AKT target kinase mTOR as an ideal candidate to treat patients with ganglioneuroma. Overall design: RNA Seq for zebrafish tumor cells from MYCN and myrAKT transgenic fish | pubmed:32728700 | myrAKT#4 | GSM4026007 | tissue:Zebrafish gangli1uroma tumor cells|genotype/variation:myrAKT transgenic fish|cell type:gangli1uroma cells | myrAKT#4 | post acquiring the raw fastq format paired end RNA seq reads we inspected the sequencing quality using fastqc v0.11.5 and removed standard Illumina adapters from the 3’ end using Trim Galore v0.4.4. The processed reads were then aligned to the GRCz10 version of the zebrafish reference genome using Tophat v2.1.1. The GTF format UCSC gene models obtained from the iGenomes website was provided as an annotation reference G option of Tophat. post the alignment the BAM format files were sorted by reads name using Samtools v1.5 and the reads mapped to each gene were counted using HTSeq count v0.6.1. edgeR library was applied to normalize read counts across samples and identify genes that are differentially expressed between conditions in R. Genome build: GRCz10 Supplementary files format and content: counts | Zebrafish ganglioneuroma tumor cells | None | EGFP+ or mCherry+ tumor cells were sorted then total RNA was extracted with Trizol LS. Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer’s protocol NEBNext Ultra. post repeated quality control for average DNA input size of 300 bp the samples were sequenced on aIllumina NextSeq 500 with 2X75bp paired end reads. | EGFP+ neuroblastoma cells or mCherry+ ganglioneuroma cells were harvested from tumor bearing MYCN or myrAkt transgenic zebrafish. Tumors were mechanically homogenized and EGFP+ or mCherry+ cells were sorted directly into Trizol LS | genotype/variation:myrAKT transgenic fish|cell type:gangli1uroma cells | GSM4026007 | GSM4026007: myrAKT#4; Danio rerio; RNA Seq | GSM4026007 | 1 | EGFP+ or mCherry+ tumor cells were sorted then total RNA was extracted with Trizol LS. Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer's protocol NEBNext Ultra. post repeated quality control for average DNA input size of 300 bp the samples were sequenced on aIllumina NextSeq 500 with 2X75bp paired end reads. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP218009 | myrAKT_4_R1_001.fastq.gz myrAKT_4_R2_001.fastq.gz | fastq fastq | 8224461750.0 | 54829745.0 | GSM4026007 r1 | 0:75 1:75 | A:2181296095;C:1913052498;G:1987660432;T:2140385772;N:2066953 | 75 | 75 | 2181296095 | 1913052498 | 1987660432 | 2140385772 | 2066953 | SRX6693259 | SRS5250599 | SRA937501 | GEO | Thomas Look, Pediatric Oncology, Dana-Farber Cancer Institute | 2 | 0.94834 | 0.95102 | 0.09336 | 0.09188 | 0.71366 | 0.71528 | 0.56498 | 0.56601 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | full_length | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-08-10 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 53571 | 53571 | SRR9944759 | SRX6693258 | SRS5250598 | SRP218009 | PRJNA559652 | Aberrant AKT Activation Drives Ganglioneuroma and Can Be Therapeutically Targeted by mTOR Inhibitors | GSE135682 | Transcriptome Analysis | Peripheral sympathetic nervous system tumors are the most common extra cranial pediatric tumors in children and include neuroblastoma ganglioneuroma and intermixed ganglioneuroblastoma. Ganglioneuroma can be induced by activating mutations of the RET proto oncogene or activated Ras in murine models but the etiology and molecular pathogenesis of this disease is unknown for the majority of human ganglioneuromas. Surgery is the only effective therapy for ganglioneuroma which can be challenging due to tumor location and compression of surrounding structures. Thus there is great potential benefit to the definition of presurgical therapies that can reduce the size and extent of these tumors and therefore limit morbidity. We found high levels of phosphorylated AKT in most of human ganglioneuromas but only in a small portion of human poorly differentiated neuroblastomas p<0.0001 Fisher's exact test. As a result we created zebrafish transgenic for constitutively activated myr Akt2 in the sympathetic nervous system. These zebrafish were found to develop benign ganglioneuroma without xxx to neuroblastoma. Zebrafish tumors displayed high expression of phosphorylated Akt and the downstream Akt targets phosphorylated mTOR S6 and EIF4EBP1. Histopathological and comparative genomic analyses revealed that zebrafish ganglioneuroma highly resembles human ganglioneuroma. Inhibition of the downstream AKT target mTOR using clinically available inhibitors effectively reduced tumor burden in zebrafish embryos transplanted with primary ganglioneuroma. Our results implicate activated and phosphorylated AKT as a tumorigenic driver in ganglioneuroma and propose inhibition of the AKT target kinase mTOR as an ideal candidate to treat patients with ganglioneuroma. Overall design: RNA Seq for zebrafish tumor cells from MYCN and myrAKT transgenic fish | pubmed:32728700 | myrAKT#3 | GSM4026006 | tissue:Zebrafish gangli1uroma tumor cells|genotype/variation:myrAKT transgenic fish|cell type:gangli1uroma cells | myrAKT#3 | post acquiring the raw fastq format paired end RNA seq reads we inspected the sequencing quality using fastqc v0.11.5 and removed standard Illumina adapters from the 3’ end using Trim Galore v0.4.4. The processed reads were then aligned to the GRCz10 version of the zebrafish reference genome using Tophat v2.1.1. The GTF format UCSC gene models obtained from the iGenomes website was provided as an annotation reference G option of Tophat. post the alignment the BAM format files were sorted by reads name using Samtools v1.5 and the reads mapped to each gene were counted using HTSeq count v0.6.1. edgeR library was applied to normalize read counts across samples and identify genes that are differentially expressed between conditions in R. Genome build: GRCz10 Supplementary files format and content: counts | Zebrafish ganglioneuroma tumor cells | None | EGFP+ or mCherry+ tumor cells were sorted then total RNA was extracted with Trizol LS. Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer’s protocol NEBNext Ultra. post repeated quality control for average DNA input size of 300 bp the samples were sequenced on aIllumina NextSeq 500 with 2X75bp paired end reads. | EGFP+ neuroblastoma cells or mCherry+ ganglioneuroma cells were harvested from tumor bearing MYCN or myrAkt transgenic zebrafish. Tumors were mechanically homogenized and EGFP+ or mCherry+ cells were sorted directly into Trizol LS | genotype/variation:myrAKT transgenic fish|cell type:gangli1uroma cells | GSM4026006 | GSM4026006: myrAKT#3; Danio rerio; RNA Seq | GSM4026006 | 1 | EGFP+ or mCherry+ tumor cells were sorted then total RNA was extracted with Trizol LS. Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer's protocol NEBNext Ultra. post repeated quality control for average DNA input size of 300 bp the samples were sequenced on aIllumina NextSeq 500 with 2X75bp paired end reads. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP218009 | myrAKT_3_R1_001.fastq.gz myrAKT_3_R2_001.fastq.gz | fastq fastq | 11540448600.0 | 76936324.0 | GSM4026006 r1 | 0:75 1:75 | A:3012275404;C:2726671725;G:2851855990;T:2946734338;N:2911143 | 75 | 75 | 3012275404 | 2726671725 | 2851855990 | 2946734338 | 2911143 | SRX6693258 | SRS5250598 | SRA937501 | GEO | Thomas Look, Pediatric Oncology, Dana-Farber Cancer Institute | 2 | 0.95135 | 0.92555 | 0.08121 | 0.07749 | 0.71796 | 0.72401 | 0.56751 | 0.57038 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | full_length | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-08-10 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 53572 | 53572 | SRR9944758 | SRX6693257 | SRS5250597 | SRP218009 | PRJNA559652 | Aberrant AKT Activation Drives Ganglioneuroma and Can Be Therapeutically Targeted by mTOR Inhibitors | GSE135682 | Transcriptome Analysis | Peripheral sympathetic nervous system tumors are the most common extra cranial pediatric tumors in children and include neuroblastoma ganglioneuroma and intermixed ganglioneuroblastoma. Ganglioneuroma can be induced by activating mutations of the RET proto oncogene or activated Ras in murine models but the etiology and molecular pathogenesis of this disease is unknown for the majority of human ganglioneuromas. Surgery is the only effective therapy for ganglioneuroma which can be challenging due to tumor location and compression of surrounding structures. Thus there is great potential benefit to the definition of presurgical therapies that can reduce the size and extent of these tumors and therefore limit morbidity. We found high levels of phosphorylated AKT in most of human ganglioneuromas but only in a small portion of human poorly differentiated neuroblastomas p<0.0001 Fisher's exact test. As a result we created zebrafish transgenic for constitutively activated myr Akt2 in the sympathetic nervous system. These zebrafish were found to develop benign ganglioneuroma without xxx to neuroblastoma. Zebrafish tumors displayed high expression of phosphorylated Akt and the downstream Akt targets phosphorylated mTOR S6 and EIF4EBP1. Histopathological and comparative genomic analyses revealed that zebrafish ganglioneuroma highly resembles human ganglioneuroma. Inhibition of the downstream AKT target mTOR using clinically available inhibitors effectively reduced tumor burden in zebrafish embryos transplanted with primary ganglioneuroma. Our results implicate activated and phosphorylated AKT as a tumorigenic driver in ganglioneuroma and propose inhibition of the AKT target kinase mTOR as an ideal candidate to treat patients with ganglioneuroma. Overall design: RNA Seq for zebrafish tumor cells from MYCN and myrAKT transgenic fish | pubmed:32728700 | myrAKT#2 | GSM4026005 | tissue:Zebrafish gangli1uroma tumor cells|genotype/variation:myrAKT transgenic fish|cell type:gangli1uroma cells | myrAKT#2 | post acquiring the raw fastq format paired end RNA seq reads we inspected the sequencing quality using fastqc v0.11.5 and removed standard Illumina adapters from the 3’ end using Trim Galore v0.4.4. The processed reads were then aligned to the GRCz10 version of the zebrafish reference genome using Tophat v2.1.1. The GTF format UCSC gene models obtained from the iGenomes website was provided as an annotation reference G option of Tophat. post the alignment the BAM format files were sorted by reads name using Samtools v1.5 and the reads mapped to each gene were counted using HTSeq count v0.6.1. edgeR library was applied to normalize read counts across samples and identify genes that are differentially expressed between conditions in R. Genome build: GRCz10 Supplementary files format and content: counts | Zebrafish ganglioneuroma tumor cells | None | EGFP+ or mCherry+ tumor cells were sorted then total RNA was extracted with Trizol LS. Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer’s protocol NEBNext Ultra. post repeated quality control for average DNA input size of 300 bp the samples were sequenced on aIllumina NextSeq 500 with 2X75bp paired end reads. | EGFP+ neuroblastoma cells or mCherry+ ganglioneuroma cells were harvested from tumor bearing MYCN or myrAkt transgenic zebrafish. Tumors were mechanically homogenized and EGFP+ or mCherry+ cells were sorted directly into Trizol LS | genotype/variation:myrAKT transgenic fish|cell type:gangli1uroma cells | GSM4026005 | GSM4026005: myrAKT#2; Danio rerio; RNA Seq | GSM4026005 | 1 | EGFP+ or mCherry+ tumor cells were sorted then total RNA was extracted with Trizol LS. Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer's protocol NEBNext Ultra. post repeated quality control for average DNA input size of 300 bp the samples were sequenced on aIllumina NextSeq 500 with 2X75bp paired end reads. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP218009 | myrAKT_2_R1_001.fastq.gz myrAKT_2_R2_001.fastq.gz | fastq fastq | 12386608800.0 | 82577392.0 | GSM4026005 r1 | 0:75 1:75 | A:3216847372;C:2944029674;G:3084994278;T:3137609686;N:3127790 | 75 | 75 | 3216847372 | 2944029674 | 3084994278 | 3137609686 | 3127790 | SRX6693257 | SRS5250597 | SRA937501 | GEO | Thomas Look, Pediatric Oncology, Dana-Farber Cancer Institute | 2 | 0.94942 | 0.95273 | 0.09002 | 0.08825 | 0.72232 | 0.72527 | 0.52131 | 0.52677 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | full_length | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-08-10 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 53573 | 53573 | SRR9944757 | SRX6693256 | SRS5250596 | SRP218009 | PRJNA559652 | Aberrant AKT Activation Drives Ganglioneuroma and Can Be Therapeutically Targeted by mTOR Inhibitors | GSE135682 | Transcriptome Analysis | Peripheral sympathetic nervous system tumors are the most common extra cranial pediatric tumors in children and include neuroblastoma ganglioneuroma and intermixed ganglioneuroblastoma. Ganglioneuroma can be induced by activating mutations of the RET proto oncogene or activated Ras in murine models but the etiology and molecular pathogenesis of this disease is unknown for the majority of human ganglioneuromas. Surgery is the only effective therapy for ganglioneuroma which can be challenging due to tumor location and compression of surrounding structures. Thus there is great potential benefit to the definition of presurgical therapies that can reduce the size and extent of these tumors and therefore limit morbidity. We found high levels of phosphorylated AKT in most of human ganglioneuromas but only in a small portion of human poorly differentiated neuroblastomas p<0.0001 Fisher's exact test. As a result we created zebrafish transgenic for constitutively activated myr Akt2 in the sympathetic nervous system. These zebrafish were found to develop benign ganglioneuroma without xxx to neuroblastoma. Zebrafish tumors displayed high expression of phosphorylated Akt and the downstream Akt targets phosphorylated mTOR S6 and EIF4EBP1. Histopathological and comparative genomic analyses revealed that zebrafish ganglioneuroma highly resembles human ganglioneuroma. Inhibition of the downstream AKT target mTOR using clinically available inhibitors effectively reduced tumor burden in zebrafish embryos transplanted with primary ganglioneuroma. Our results implicate activated and phosphorylated AKT as a tumorigenic driver in ganglioneuroma and propose inhibition of the AKT target kinase mTOR as an ideal candidate to treat patients with ganglioneuroma. Overall design: RNA Seq for zebrafish tumor cells from MYCN and myrAKT transgenic fish | pubmed:32728700 | myrAKT#1 | GSM4026004 | tissue:Zebrafish gangli1uroma tumor cells|genotype/variation:myrAKT transgenic fish|cell type:gangli1uroma cells | myrAKT#1 | post acquiring the raw fastq format paired end RNA seq reads we inspected the sequencing quality using fastqc v0.11.5 and removed standard Illumina adapters from the 3’ end using Trim Galore v0.4.4. The processed reads were then aligned to the GRCz10 version of the zebrafish reference genome using Tophat v2.1.1. The GTF format UCSC gene models obtained from the iGenomes website was provided as an annotation reference G option of Tophat. post the alignment the BAM format files were sorted by reads name using Samtools v1.5 and the reads mapped to each gene were counted using HTSeq count v0.6.1. edgeR library was applied to normalize read counts across samples and identify genes that are differentially expressed between conditions in R. Genome build: GRCz10 Supplementary files format and content: counts | Zebrafish ganglioneuroma tumor cells | None | EGFP+ or mCherry+ tumor cells were sorted then total RNA was extracted with Trizol LS. Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer’s protocol NEBNext Ultra. post repeated quality control for average DNA input size of 300 bp the samples were sequenced on aIllumina NextSeq 500 with 2X75bp paired end reads. | EGFP+ neuroblastoma cells or mCherry+ ganglioneuroma cells were harvested from tumor bearing MYCN or myrAkt transgenic zebrafish. Tumors were mechanically homogenized and EGFP+ or mCherry+ cells were sorted directly into Trizol LS | genotype/variation:myrAKT transgenic fish|cell type:gangli1uroma cells | GSM4026004 | GSM4026004: myrAKT#1; Danio rerio; RNA Seq | GSM4026004 | 1 | EGFP+ or mCherry+ tumor cells were sorted then total RNA was extracted with Trizol LS. Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer's protocol NEBNext Ultra. post repeated quality control for average DNA input size of 300 bp the samples were sequenced on aIllumina NextSeq 500 with 2X75bp paired end reads. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP218009 | myrAKT_1_R2_001.fastq.gz myrAKT_1_R1_001.fastq.gz | fastq fastq | 10533443400.0 | 70222956.0 | GSM4026004 r1 | 0:75 1:75 | A:2713017255;C:2528083140;G:2625072686;T:2664616663;N:2653656 | 75 | 75 | 2713017255 | 2528083140 | 2625072686 | 2664616663 | 2653656 | SRX6693256 | SRS5250596 | SRA937501 | GEO | Thomas Look, Pediatric Oncology, Dana-Farber Cancer Institute | 2 | 0.95384 | 0.95698 | 0.0792 | 0.07709 | 0.7249 | 0.72711 | 0.53397 | 0.53326 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | full_length | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-08-10 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 53574 | 53574 | SRR9944756 | SRX6693255 | SRS5250595 | SRP218009 | PRJNA559652 | Aberrant AKT Activation Drives Ganglioneuroma and Can Be Therapeutically Targeted by mTOR Inhibitors | GSE135682 | Transcriptome Analysis | Peripheral sympathetic nervous system tumors are the most common extra cranial pediatric tumors in children and include neuroblastoma ganglioneuroma and intermixed ganglioneuroblastoma. Ganglioneuroma can be induced by activating mutations of the RET proto oncogene or activated Ras in murine models but the etiology and molecular pathogenesis of this disease is unknown for the majority of human ganglioneuromas. Surgery is the only effective therapy for ganglioneuroma which can be challenging due to tumor location and compression of surrounding structures. Thus there is great potential benefit to the definition of presurgical therapies that can reduce the size and extent of these tumors and therefore limit morbidity. We found high levels of phosphorylated AKT in most of human ganglioneuromas but only in a small portion of human poorly differentiated neuroblastomas p<0.0001 Fisher's exact test. As a result we created zebrafish transgenic for constitutively activated myr Akt2 in the sympathetic nervous system. These zebrafish were found to develop benign ganglioneuroma without xxx to neuroblastoma. Zebrafish tumors displayed high expression of phosphorylated Akt and the downstream Akt targets phosphorylated mTOR S6 and EIF4EBP1. Histopathological and comparative genomic analyses revealed that zebrafish ganglioneuroma highly resembles human ganglioneuroma. Inhibition of the downstream AKT target mTOR using clinically available inhibitors effectively reduced tumor burden in zebrafish embryos transplanted with primary ganglioneuroma. Our results implicate activated and phosphorylated AKT as a tumorigenic driver in ganglioneuroma and propose inhibition of the AKT target kinase mTOR as an ideal candidate to treat patients with ganglioneuroma. Overall design: RNA Seq for zebrafish tumor cells from MYCN and myrAKT transgenic fish | pubmed:32728700 | MYCN#4 | GSM4026003 | tissue:Zebrafish neuroblastoma tumor cells|genotype/variation:MYCN transgenic fish|cell type:neuroblastoma cells | MYCN#4 | post acquiring the raw fastq format paired end RNA seq reads we inspected the sequencing quality using fastqc v0.11.5 and removed standard Illumina adapters from the 3’ end using Trim Galore v0.4.4. The processed reads were then aligned to the GRCz10 version of the zebrafish reference genome using Tophat v2.1.1. The GTF format UCSC gene models obtained from the iGenomes website was provided as an annotation reference G option of Tophat. post the alignment the BAM format files were sorted by reads name using Samtools v1.5 and the reads mapped to each gene were counted using HTSeq count v0.6.1. edgeR library was applied to normalize read counts across samples and identify genes that are differentially expressed between conditions in R. Genome build: GRCz10 Supplementary files format and content: counts | Zebrafish neuroblastoma tumor cells | None | EGFP+ or mCherry+ tumor cells were sorted then total RNA was extracted with Trizol LS. Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer’s protocol NEBNext Ultra. post repeated quality control for average DNA input size of 300 bp the samples were sequenced on aIllumina NextSeq 500 with 2X75bp paired end reads. | EGFP+ neuroblastoma cells or mCherry+ ganglioneuroma cells were harvested from tumor bearing MYCN or myrAkt transgenic zebrafish. Tumors were mechanically homogenized and EGFP+ or mCherry+ cells were sorted directly into Trizol LS | genotype/variation:MYCN transgenic fish|cell type:neuroblastoma cells | GSM4026003 | GSM4026003: MYCN#4; Danio rerio; RNA Seq | GSM4026003 | 1 | EGFP+ or mCherry+ tumor cells were sorted then total RNA was extracted with Trizol LS. Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer's protocol NEBNext Ultra. post repeated quality control for average DNA input size of 300 bp the samples were sequenced on aIllumina NextSeq 500 with 2X75bp paired end reads. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP218009 | MYCN_4_R1_001.fastq.gz MYCN_4_R2_001.fastq.gz | fastq fastq | 12647410500.0 | 84316070.0 | GSM4026003 r1 | 0:75 1:75 | A:3192174853;C:3078742090;G:3255144371;T:3118165180;N:3184006 | 75 | 75 | 3192174853 | 3078742090 | 3255144371 | 3118165180 | 3184006 | SRX6693255 | SRS5250595 | SRA937501 | GEO | Thomas Look, Pediatric Oncology, Dana-Farber Cancer Institute | 2 | 0.9678 | 0.96946 | 0.04813 | 0.0467 | 0.7553 | 0.75972 | 0.54218 | 0.53492 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | full_length | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-08-10 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 53575 | 53575 | SRR9944755 | SRX6693254 | SRS5250594 | SRP218009 | PRJNA559652 | Aberrant AKT Activation Drives Ganglioneuroma and Can Be Therapeutically Targeted by mTOR Inhibitors | GSE135682 | Transcriptome Analysis | Peripheral sympathetic nervous system tumors are the most common extra cranial pediatric tumors in children and include neuroblastoma ganglioneuroma and intermixed ganglioneuroblastoma. Ganglioneuroma can be induced by activating mutations of the RET proto oncogene or activated Ras in murine models but the etiology and molecular pathogenesis of this disease is unknown for the majority of human ganglioneuromas. Surgery is the only effective therapy for ganglioneuroma which can be challenging due to tumor location and compression of surrounding structures. Thus there is great potential benefit to the definition of presurgical therapies that can reduce the size and extent of these tumors and therefore limit morbidity. We found high levels of phosphorylated AKT in most of human ganglioneuromas but only in a small portion of human poorly differentiated neuroblastomas p<0.0001 Fisher's exact test. As a result we created zebrafish transgenic for constitutively activated myr Akt2 in the sympathetic nervous system. These zebrafish were found to develop benign ganglioneuroma without xxx to neuroblastoma. Zebrafish tumors displayed high expression of phosphorylated Akt and the downstream Akt targets phosphorylated mTOR S6 and EIF4EBP1. Histopathological and comparative genomic analyses revealed that zebrafish ganglioneuroma highly resembles human ganglioneuroma. Inhibition of the downstream AKT target mTOR using clinically available inhibitors effectively reduced tumor burden in zebrafish embryos transplanted with primary ganglioneuroma. Our results implicate activated and phosphorylated AKT as a tumorigenic driver in ganglioneuroma and propose inhibition of the AKT target kinase mTOR as an ideal candidate to treat patients with ganglioneuroma. Overall design: RNA Seq for zebrafish tumor cells from MYCN and myrAKT transgenic fish | pubmed:32728700 | MYCN#3 | GSM4026002 | tissue:Zebrafish neuroblastoma tumor cells|genotype/variation:MYCN transgenic fish|cell type:neuroblastoma cells | MYCN#3 | post acquiring the raw fastq format paired end RNA seq reads we inspected the sequencing quality using fastqc v0.11.5 and removed standard Illumina adapters from the 3’ end using Trim Galore v0.4.4. The processed reads were then aligned to the GRCz10 version of the zebrafish reference genome using Tophat v2.1.1. The GTF format UCSC gene models obtained from the iGenomes website was provided as an annotation reference G option of Tophat. post the alignment the BAM format files were sorted by reads name using Samtools v1.5 and the reads mapped to each gene were counted using HTSeq count v0.6.1. edgeR library was applied to normalize read counts across samples and identify genes that are differentially expressed between conditions in R. Genome build: GRCz10 Supplementary files format and content: counts | Zebrafish neuroblastoma tumor cells | None | EGFP+ or mCherry+ tumor cells were sorted then total RNA was extracted with Trizol LS. Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer’s protocol NEBNext Ultra. post repeated quality control for average DNA input size of 300 bp the samples were sequenced on aIllumina NextSeq 500 with 2X75bp paired end reads. | EGFP+ neuroblastoma cells or mCherry+ ganglioneuroma cells were harvested from tumor bearing MYCN or myrAkt transgenic zebrafish. Tumors were mechanically homogenized and EGFP+ or mCherry+ cells were sorted directly into Trizol LS | genotype/variation:MYCN transgenic fish|cell type:neuroblastoma cells | GSM4026002 | GSM4026002: MYCN#3; Danio rerio; RNA Seq | GSM4026002 | 1 | EGFP+ or mCherry+ tumor cells were sorted then total RNA was extracted with Trizol LS. Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer's protocol NEBNext Ultra. post repeated quality control for average DNA input size of 300 bp the samples were sequenced on aIllumina NextSeq 500 with 2X75bp paired end reads. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP218009 | MYCN_3_R1_001.fastq.gz MYCN_3_R2_001.fastq.gz | fastq fastq | 10429575150.0 | 69530501.0 | GSM4026002 r1 | 0:75 1:75 | A:2736293587;C:2459385850;G:2579079974;T:2654428416;N:387323 | 75 | 75 | 2736293587 | 2459385850 | 2579079974 | 2654428416 | 387323 | SRX6693254 | SRS5250594 | SRA937501 | GEO | Thomas Look, Pediatric Oncology, Dana-Farber Cancer Institute | 2 | 0.95299 | 0.95438 | 0.08493 | 0.08121 | 0.73399 | 0.74432 | 0.51135 | 0.52439 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | full_length | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-08-10 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 53576 | 53576 | SRR9944754 | SRX6693253 | SRS5250593 | SRP218009 | PRJNA559652 | Aberrant AKT Activation Drives Ganglioneuroma and Can Be Therapeutically Targeted by mTOR Inhibitors | GSE135682 | Transcriptome Analysis | Peripheral sympathetic nervous system tumors are the most common extra cranial pediatric tumors in children and include neuroblastoma ganglioneuroma and intermixed ganglioneuroblastoma. Ganglioneuroma can be induced by activating mutations of the RET proto oncogene or activated Ras in murine models but the etiology and molecular pathogenesis of this disease is unknown for the majority of human ganglioneuromas. Surgery is the only effective therapy for ganglioneuroma which can be challenging due to tumor location and compression of surrounding structures. Thus there is great potential benefit to the definition of presurgical therapies that can reduce the size and extent of these tumors and therefore limit morbidity. We found high levels of phosphorylated AKT in most of human ganglioneuromas but only in a small portion of human poorly differentiated neuroblastomas p<0.0001 Fisher's exact test. As a result we created zebrafish transgenic for constitutively activated myr Akt2 in the sympathetic nervous system. These zebrafish were found to develop benign ganglioneuroma without xxx to neuroblastoma. Zebrafish tumors displayed high expression of phosphorylated Akt and the downstream Akt targets phosphorylated mTOR S6 and EIF4EBP1. Histopathological and comparative genomic analyses revealed that zebrafish ganglioneuroma highly resembles human ganglioneuroma. Inhibition of the downstream AKT target mTOR using clinically available inhibitors effectively reduced tumor burden in zebrafish embryos transplanted with primary ganglioneuroma. Our results implicate activated and phosphorylated AKT as a tumorigenic driver in ganglioneuroma and propose inhibition of the AKT target kinase mTOR as an ideal candidate to treat patients with ganglioneuroma. Overall design: RNA Seq for zebrafish tumor cells from MYCN and myrAKT transgenic fish | pubmed:32728700 | MYCN#2 | GSM4026001 | tissue:Zebrafish neuroblastoma tumor cells|genotype/variation:MYCN transgenic fish|cell type:neuroblastoma cells | MYCN#2 | post acquiring the raw fastq format paired end RNA seq reads we inspected the sequencing quality using fastqc v0.11.5 and removed standard Illumina adapters from the 3’ end using Trim Galore v0.4.4. The processed reads were then aligned to the GRCz10 version of the zebrafish reference genome using Tophat v2.1.1. The GTF format UCSC gene models obtained from the iGenomes website was provided as an annotation reference G option of Tophat. post the alignment the BAM format files were sorted by reads name using Samtools v1.5 and the reads mapped to each gene were counted using HTSeq count v0.6.1. edgeR library was applied to normalize read counts across samples and identify genes that are differentially expressed between conditions in R. Genome build: GRCz10 Supplementary files format and content: counts | Zebrafish neuroblastoma tumor cells | None | EGFP+ or mCherry+ tumor cells were sorted then total RNA was extracted with Trizol LS. Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer’s protocol NEBNext Ultra. post repeated quality control for average DNA input size of 300 bp the samples were sequenced on aIllumina NextSeq 500 with 2X75bp paired end reads. | EGFP+ neuroblastoma cells or mCherry+ ganglioneuroma cells were harvested from tumor bearing MYCN or myrAkt transgenic zebrafish. Tumors were mechanically homogenized and EGFP+ or mCherry+ cells were sorted directly into Trizol LS | genotype/variation:MYCN transgenic fish|cell type:neuroblastoma cells | GSM4026001 | GSM4026001: MYCN#2; Danio rerio; RNA Seq | GSM4026001 | 1 | EGFP+ or mCherry+ tumor cells were sorted then total RNA was extracted with Trizol LS. Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer's protocol NEBNext Ultra. post repeated quality control for average DNA input size of 300 bp the samples were sequenced on aIllumina NextSeq 500 with 2X75bp paired end reads. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP218009 | MYCN_2_R1_001.fastq.gz MYCN_2_R2_001.fastq.gz | fastq fastq | 9518711400.0 | 63458076.0 | GSM4026001 r1 | 0:75 1:75 | A:2440261186;C:2291125181;G:2425125263;T:2361842692;N:357078 | 75 | 75 | 2440261186 | 2291125181 | 2425125263 | 2361842692 | 357078 | SRX6693253 | SRS5250593 | SRA937501 | GEO | Thomas Look, Pediatric Oncology, Dana-Farber Cancer Institute | 2 | 0.95917 | 0.96071 | 0.07229 | 0.06951 | 0.74586 | 0.75666 | 0.5264 | 0.51949 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | full_length | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-08-10 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 53577 | 53577 | SRR9944753 | SRX6693252 | SRS5250592 | SRP218009 | PRJNA559652 | Aberrant AKT Activation Drives Ganglioneuroma and Can Be Therapeutically Targeted by mTOR Inhibitors | GSE135682 | Transcriptome Analysis | Peripheral sympathetic nervous system tumors are the most common extra cranial pediatric tumors in children and include neuroblastoma ganglioneuroma and intermixed ganglioneuroblastoma. Ganglioneuroma can be induced by activating mutations of the RET proto oncogene or activated Ras in murine models but the etiology and molecular pathogenesis of this disease is unknown for the majority of human ganglioneuromas. Surgery is the only effective therapy for ganglioneuroma which can be challenging due to tumor location and compression of surrounding structures. Thus there is great potential benefit to the definition of presurgical therapies that can reduce the size and extent of these tumors and therefore limit morbidity. We found high levels of phosphorylated AKT in most of human ganglioneuromas but only in a small portion of human poorly differentiated neuroblastomas p<0.0001 Fisher's exact test. As a result we created zebrafish transgenic for constitutively activated myr Akt2 in the sympathetic nervous system. These zebrafish were found to develop benign ganglioneuroma without xxx to neuroblastoma. Zebrafish tumors displayed high expression of phosphorylated Akt and the downstream Akt targets phosphorylated mTOR S6 and EIF4EBP1. Histopathological and comparative genomic analyses revealed that zebrafish ganglioneuroma highly resembles human ganglioneuroma. Inhibition of the downstream AKT target mTOR using clinically available inhibitors effectively reduced tumor burden in zebrafish embryos transplanted with primary ganglioneuroma. Our results implicate activated and phosphorylated AKT as a tumorigenic driver in ganglioneuroma and propose inhibition of the AKT target kinase mTOR as an ideal candidate to treat patients with ganglioneuroma. Overall design: RNA Seq for zebrafish tumor cells from MYCN and myrAKT transgenic fish | pubmed:32728700 | MYCN#1 | GSM4026000 | tissue:Zebrafish neuroblastoma tumor cells|genotype/variation:MYCN transgenic fish|cell type:neuroblastoma cells | MYCN#1 | post acquiring the raw fastq format paired end RNA seq reads we inspected the sequencing quality using fastqc v0.11.5 and removed standard Illumina adapters from the 3’ end using Trim Galore v0.4.4. The processed reads were then aligned to the GRCz10 version of the zebrafish reference genome using Tophat v2.1.1. The GTF format UCSC gene models obtained from the iGenomes website was provided as an annotation reference G option of Tophat. post the alignment the BAM format files were sorted by reads name using Samtools v1.5 and the reads mapped to each gene were counted using HTSeq count v0.6.1. edgeR library was applied to normalize read counts across samples and identify genes that are differentially expressed between conditions in R. Genome build: GRCz10 Supplementary files format and content: counts | Zebrafish neuroblastoma tumor cells | None | EGFP+ or mCherry+ tumor cells were sorted then total RNA was extracted with Trizol LS. Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer’s protocol NEBNext Ultra. post repeated quality control for average DNA input size of 300 bp the samples were sequenced on aIllumina NextSeq 500 with 2X75bp paired end reads. | EGFP+ neuroblastoma cells or mCherry+ ganglioneuroma cells were harvested from tumor bearing MYCN or myrAkt transgenic zebrafish. Tumors were mechanically homogenized and EGFP+ or mCherry+ cells were sorted directly into Trizol LS | genotype/variation:MYCN transgenic fish|cell type:neuroblastoma cells | GSM4026000 | GSM4026000: MYCN#1; Danio rerio; RNA Seq | GSM4026000 | 1 | EGFP+ or mCherry+ tumor cells were sorted then total RNA was extracted with Trizol LS. Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer's protocol NEBNext Ultra. post repeated quality control for average DNA input size of 300 bp the samples were sequenced on aIllumina NextSeq 500 with 2X75bp paired end reads. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP218009 | MYCN_1_R1_001.fastq.gz MYCN_1_R2_001.fastq.gz | fastq fastq | 12249512250.0 | 81663415.0 | GSM4026000 r1 | 0:75 1:75 | A:3146759551;C:2963459721;G:3078804965;T:3060035031;N:452982 | 75 | 75 | 3146759551 | 2963459721 | 3078804965 | 3060035031 | 452982 | SRX6693252 | SRS5250592 | SRA937501 | GEO | Thomas Look, Pediatric Oncology, Dana-Farber Cancer Institute | 2 | 0.95937 | 0.95322 | 0.06466 | 0.06119 | 0.7484 | 0.76071 | 0.51653 | 0.51684 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | full_length | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2019-08-10 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||
| 70257 | 70257 | SRR19641859 | SRX15691895 | SRS13388296 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D689 | GSM6239403 | source name:CICDUX4 Tumor|tissue:CICDUX4 Tumor|genotype:Wildtype AB/TL|age at sac:72 days|transgene:ptz725 BetaActin GFP2A CICDUX4 injected|cell line:n1|model:mosaic genetic tumor model | Dr D689 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | CICDUX4 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:CICDUX4 Tumor|genotype:Wildtype AB/TL|age at sac:72 days|transgene:ptz725 BetaActin GFP2A CICDUX4 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239403 | GSM6239403: Dr D689; Danio rerio; RNA Seq | GSM6239403 r1 | GSM6239403 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP379972 | A374-A375T22.R1.fastq.gz A374-A375T22.R2.fastq.gz | fastq fastq | 2617106514.0 | 25657907.0 | GSM6239403 r1 | 0:51 1:51 | A:668128727;C:651934850;G:622380865;T:674114277;N:547795 | 51 | 51 | 668128727 | 651934850 | 622380865 | 674114277 | 547795 | SRX15691895 | SRS13388296 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.91707 | 0.90863 | 0.13723 | 0.13235 | 0.72427 | 0.7288 | 0.53492 | 0.54411 | 51 | 51 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||||
| 70258 | 70258 | SRR19641860 | SRX15691894 | SRS13388295 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D688 | GSM6239402 | source name:CICDUX4 Tumor|tissue:CICDUX4 Tumor|genotype:Wildtype AB/TL|age at sac:72 days|transgene:ptz725 BetaActin GFP2A CICDUX4 injected|cell line:n1|model:mosaic genetic tumor model | Dr D688 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | CICDUX4 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:CICDUX4 Tumor|genotype:Wildtype AB/TL|age at sac:72 days|transgene:ptz725 BetaActin GFP2A CICDUX4 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239402 | GSM6239402: Dr D688; Danio rerio; RNA Seq | GSM6239402 r1 | GSM6239402 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP379972 | A374-A375T21.R1.fastq.gz A374-A375T21.R2.fastq.gz | fastq fastq | 2673732834.0 | 26213067.0 | GSM6239402 r1 | 0:51 1:51 | A:692259495;C:634526793;G:646956843;T:699430107;N:559596 | 51 | 51 | 692259495 | 634526793 | 646956843 | 699430107 | 559596 | SRX15691894 | SRS13388295 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.89959 | 0.89532 | 0.16937 | 0.15707 | 0.74341 | 0.74698 | 0.52811 | 0.47523 | 51 | 51 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||||
| 70259 | 70259 | SRR19641861 | SRX15691893 | SRS13388294 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D687 | GSM6239401 | source name:CICDUX4 Tumor|tissue:CICDUX4 Tumor|genotype:Wildtype AB/TL|age at sac:72 days|transgene:ptz725 BetaActin GFP2A CICDUX4 injected|cell line:n1|model:mosaic genetic tumor model | Dr D687 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | CICDUX4 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:CICDUX4 Tumor|genotype:Wildtype AB/TL|age at sac:72 days|transgene:ptz725 BetaActin GFP2A CICDUX4 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239401 | GSM6239401: Dr D687; Danio rerio; RNA Seq | GSM6239401 r1 | GSM6239401 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP379972 | A374-A375T20.R1.fastq.gz A374-A375T20.R2.fastq.gz | fastq fastq | 2403051864.0 | 23559332.0 | GSM6239401 r1 | 0:51 1:51 | A:610024337;C:581055807;G:599075873;T:612390824;N:505023 | 51 | 51 | 610024337 | 581055807 | 599075873 | 612390824 | 505023 | SRX15691893 | SRS13388294 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.87425 | 0.86466 | 0.17767 | 0.16415 | 0.74501 | 0.74692 | 0.51687 | 0.56997 | 51 | 51 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||||
| 70260 | 70260 | SRR19641862 | SRX15691892 | SRS13388293 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D686 | GSM6239400 | source name:CICDUX4 Tumor|tissue:CICDUX4 Tumor|genotype:Wildtype AB/TL|age at sac:72 days|transgene:ptz725 BetaActin GFP2A CICDUX4 injected|cell line:n1|model:mosaic genetic tumor model | Dr D686 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | CICDUX4 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:CICDUX4 Tumor|genotype:Wildtype AB/TL|age at sac:72 days|transgene:ptz725 BetaActin GFP2A CICDUX4 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239400 | GSM6239400: Dr D686; Danio rerio; RNA Seq | GSM6239400 r1 | GSM6239400 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP379972 | A374-A375T19.R1.fastq.gz A374-A375T19.R2.fastq.gz | fastq fastq | 2454754746.0 | 24066223.0 | GSM6239400 r1 | 0:51 1:51 | A:621412512;C:612070105;G:596995826;T:623758945;N:517358 | 51 | 51 | 621412512 | 612070105 | 596995826 | 623758945 | 517358 | SRX15691892 | SRS13388293 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.84113 | 0.83955 | 0.11653 | 0.11157 | 0.75055 | 0.7531 | 0.52327 | 0.53452 | 51 | 51 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||||
| 70261 | 70261 | SRR19641863 | SRX15691891 | SRS13388292 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D685 | GSM6239399 | source name:CICDUX4 Tumor|tissue:CICDUX4 Tumor|genotype:Wildtype AB/TL|age at sac:69 days|transgene:ptz725 BetaActin GFP2A CICDUX4 injected|cell line:n1|model:mosaic genetic tumor model | Dr D685 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | CICDUX4 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:CICDUX4 Tumor|genotype:Wildtype AB/TL|age at sac:69 days|transgene:ptz725 BetaActin GFP2A CICDUX4 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239399 | GSM6239399: Dr D685; Danio rerio; RNA Seq | GSM6239399 r1 | GSM6239399 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP379972 | A374-A375T18.R1.fastq.gz A374-A375T18.R2.fastq.gz | fastq fastq | 2658409170.0 | 26062835.0 | GSM6239399 r1 | 0:51 1:51 | A:732902369;C:609139075;G:599834418;T:715970601;N:562707 | 51 | 51 | 732902369 | 609139075 | 599834418 | 715970601 | 562707 | SRX15691891 | SRS13388292 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.9085 | 0.90047 | 0.17294 | 0.16704 | 0.7334 | 0.7362 | 0.52469 | 0.52707 | 51 | 51 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||||
| 70262 | 70262 | SRR19641864 | SRX15691890 | SRS13388291 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D684 | GSM6239398 | source name:CICDUX4 Tumor|tissue:CICDUX4 Tumor|genotype:Wildtype AB/TL|age at sac:69 days|transgene:ptz725 BetaActin GFP2A CICDUX4 injected|cell line:n1|model:mosaic genetic tumor model | Dr D684 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | CICDUX4 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:CICDUX4 Tumor|genotype:Wildtype AB/TL|age at sac:69 days|transgene:ptz725 BetaActin GFP2A CICDUX4 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239398 | GSM6239398: Dr D684; Danio rerio; RNA Seq | GSM6239398 r1 | GSM6239398 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP379972 | A374-A375T17.R1.fastq.gz A374-A375T17.R2.fastq.gz | fastq fastq | 2219629242.0 | 21761071.0 | GSM6239398 r1 | 0:51 1:51 | A:611104623;C:512652161;G:492235087;T:603173464;N:463907 | 51 | 51 | 611104623 | 512652161 | 492235087 | 603173464 | 463907 | SRX15691890 | SRS13388291 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.9139 | 0.90343 | 0.16689 | 0.15925 | 0.72318 | 0.72648 | 0.51998 | 0.53005 | 51 | 51 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||||
| 70263 | 70263 | SRR19641865 | SRX15691889 | SRS13388289 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D682 | GSM6239397 | source name:CICDUX4 Tumor|tissue:CICDUX4 Tumor|genotype:Wildtype AB/TL|age at sac:66 days|transgene:ptz725 BetaActin GFP2A CICDUX4 injected|cell line:n1|model:mosaic genetic tumor model | Dr D682 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | CICDUX4 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:CICDUX4 Tumor|genotype:Wildtype AB/TL|age at sac:66 days|transgene:ptz725 BetaActin GFP2A CICDUX4 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239397 | GSM6239397: Dr D682; Danio rerio; RNA Seq | GSM6239397 r1 | GSM6239397 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP379972 | A374-A375T16.R1.fastq.gz A374-A375T16.R2.fastq.gz | fastq fastq | 2845687800.0 | 27898900.0 | GSM6239397 r1 | 0:51 1:51 | A:774717462;C:659726501;G:662947910;T:747699347;N:596580 | 51 | 51 | 774717462 | 659726501 | 662947910 | 747699347 | 596580 | SRX15691889 | SRS13388289 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.91121 | 0.90308 | 0.13206 | 0.12784 | 0.71524 | 0.7181 | 0.49882 | 0.52283 | 51 | 51 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||||
| 70264 | 70264 | SRR19641866 | SRX15691888 | SRS13388290 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D681 | GSM6239396 | source name:CICDUX4 Tumor|tissue:CICDUX4 Tumor|genotype:Wildtype AB/TL|age at sac:62 days|transgene:ptz725 BetaActin GFP2A CICDUX4 injected|cell line:n1|model:mosaic genetic tumor model | Dr D681 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | CICDUX4 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:CICDUX4 Tumor|genotype:Wildtype AB/TL|age at sac:62 days|transgene:ptz725 BetaActin GFP2A CICDUX4 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239396 | GSM6239396: Dr D681; Danio rerio; RNA Seq | GSM6239396 r1 | GSM6239396 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP379972 | A374-A375T15.R1.fastq.gz A374-A375T15.R2.fastq.gz | fastq fastq | 2805711144.0 | 27506972.0 | GSM6239396 r1 | 0:51 1:51 | A:769449471;C:644013641;G:649265472;T:742393487;N:589073 | 51 | 51 | 769449471 | 644013641 | 649265472 | 742393487 | 589073 | SRX15691888 | SRS13388290 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.91277 | 0.90398 | 0.11915 | 0.11479 | 0.71411 | 0.71522 | 0.50093 | 0.51332 | 51 | 51 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||||
| 70265 | 70265 | SRR19641867 | SRX15691887 | SRS13388288 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D678 | GSM6239395 | source name:CICDUX4 Tumor|tissue:CICDUX4 Tumor|genotype:Wildtype AB/TL|age at sac:58 days|transgene:ptz725 BetaActin GFP2A CICDUX4 injected|cell line:n1|model:mosaic genetic tumor model | Dr D678 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | CICDUX4 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:CICDUX4 Tumor|genotype:Wildtype AB/TL|age at sac:58 days|transgene:ptz725 BetaActin GFP2A CICDUX4 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239395 | GSM6239395: Dr D678; Danio rerio; RNA Seq | GSM6239395 r1 | GSM6239395 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP379972 | A374-A375T14.R1.fastq.gz A374-A375T14.R2.fastq.gz | fastq fastq | 3309710076.0 | 32448138.0 | GSM6239395 r1 | 0:51 1:51 | A:893009563;C:769011421;G:785858655;T:861133644;N:696793 | 51 | 51 | 893009563 | 769011421 | 785858655 | 861133644 | 696793 | SRX15691887 | SRS13388288 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.93216 | 0.92298 | 0.12745 | 0.12375 | 0.70772 | 0.70954 | 0.50798 | 0.50568 | 51 | 51 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||||
| 70266 | 70266 | SRR19641868 | SRX15691886 | SRS13388286 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D669 | GSM6239394 | source name:CICDUX4 Tumor|tissue:CICDUX4 Tumor|genotype:Wildtype AB/TL|age at sac:49 days|transgene:ptz725 BetaActin GFP2A CICDUX4 injected|cell line:n1|model:mosaic genetic tumor model | Dr D669 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | CICDUX4 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:CICDUX4 Tumor|genotype:Wildtype AB/TL|age at sac:49 days|transgene:ptz725 BetaActin GFP2A CICDUX4 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239394 | GSM6239394: Dr D669; Danio rerio; RNA Seq | GSM6239394 r1 | GSM6239394 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP379972 | A374-A375T13.R1.fastq.gz A374-A375T13.R2.fastq.gz | fastq fastq | 2457041688.0 | 24088644.0 | GSM6239394 r1 | 0:51 1:51 | A:636595636;C:602627871;G:603743469;T:613558856;N:515856 | 51 | 51 | 636595636 | 602627871 | 603743469 | 613558856 | 515856 | SRX15691886 | SRS13388286 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.92183 | 0.91625 | 0.10373 | 0.09829 | 0.74259 | 0.74479 | 0.52674 | 0.53085 | 51 | 51 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||||
| 70267 | 70267 | SRR19641869 | SRX15691885 | SRS13388287 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D668 | GSM6239393 | source name:CICDUX4 Tumor|tissue:CICDUX4 Tumor|genotype:Wildtype AB/TL|age at sac:49 days|transgene:ptz725 BetaActin GFP2A CICDUX4 injected|cell line:n1|model:mosaic genetic tumor model | Dr D668 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | CICDUX4 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:CICDUX4 Tumor|genotype:Wildtype AB/TL|age at sac:49 days|transgene:ptz725 BetaActin GFP2A CICDUX4 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239393 | GSM6239393: Dr D668; Danio rerio; RNA Seq | GSM6239393 r1 | GSM6239393 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP379972 | A374-A375T12.R1.fastq.gz A374-A375T12.R2.fastq.gz | fastq fastq | 2583246288.0 | 25325944.0 | GSM6239393 r1 | 0:51 1:51 | A:655948830;C:618841870;G:630381902;T:677537654;N:536032 | 51 | 51 | 655948830 | 618841870 | 630381902 | 677537654 | 536032 | SRX15691885 | SRS13388287 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.91399 | 0.91048 | 0.12014 | 0.11607 | 0.72774 | 0.73081 | 0.52008 | 0.5314 | 51 | 51 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||||
| 70268 | 70268 | SRR19641870 | SRX15691884 | SRS13388285 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D655 | GSM6239392 | source name:CICDUX4 Tumor|tissue:CICDUX4 Tumor|genotype:Wildtype AB/TL|age at sac:85 days|transgene:ptz725 BetaActin GFP2A CICDUX4 injected|cell line:n1|model:mosaic genetic tumor model | Dr D655 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | CICDUX4 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:CICDUX4 Tumor|genotype:Wildtype AB/TL|age at sac:85 days|transgene:ptz725 BetaActin GFP2A CICDUX4 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239392 | GSM6239392: Dr D655; Danio rerio; RNA Seq | GSM6239392 r1 | GSM6239392 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP379972 | A374-A375T11.R1.fastq.gz A374-A375T11.R2.fastq.gz | fastq fastq | 2540046534.0 | 24902417.0 | GSM6239392 r1 | 0:51 1:51 | A:625214360;C:652628971;G:661207991;T:600456367;N:538845 | 51 | 51 | 625214360 | 652628971 | 661207991 | 600456367 | 538845 | SRX15691884 | SRS13388285 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.89168 | 0.89355 | 0.16202 | 0.1526 | 0.80941 | 0.81136 | 0.61281 | 0.60991 | 51 | 51 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||||
| 70276 | 70276 | SRR19641877 | SRX15691876 | SRS13388277 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D874 | GSM6239384 | source name:VGLL2 NCOA2 Tumor|tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:145 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | Dr D874 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | VGLL2 NCOA2 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:145 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239384 | GSM6239384: Dr D874; Danio rerio; RNA Seq | GSM6239384 r1 | GSM6239384 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP379972 | loader:fastq load.py | D874.R1.fastq.gz D874.R2.fastq.gz | fastq fastq | 14260336067.0 | 94505252.0 | GSM6239384 r1 | 0:75.47 1:75.42 | A:3807473632;C:3237562880;G:3338984156;T:3871195024;N:5120375 | 75 | 75 | 3807473632 | 3237562880 | 3338984156 | 3871195024 | 5120375 | SRX15691876 | SRS13388277 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.9477 | 0.94917 | 0.08609 | 0.04531 | 0.73026 | 0.73689 | 0.47935 | 0.48022 | 76 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||||
| 70277 | 70277 | SRR19641878 | SRX15691875 | SRS13388276 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D815 | GSM6239383 | source name:VGLL2 NCOA2 Tumor|tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:47 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | Dr D815 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | VGLL2 NCOA2 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:47 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239383 | GSM6239383: Dr D815; Danio rerio; RNA Seq | GSM6239383 r1 | GSM6239383 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP379972 | loader:fastq load.py | D815.R1.fastq.gz D815.R2.fastq.gz | fastq fastq | 5547049470.0 | 37001650.0 | GSM6239383 r1 | 0:75.00 1:74.91 | A:1493984328;C:1233438630;G:1231023373;T:1584983659;N:3619480 | 75 | 74 | 1493984328 | 1233438630 | 1231023373 | 1584983659 | 3619480 | SRX15691875 | SRS13388276 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.93369 | 0.93771 | 0.12918 | 0.12506 | 0.73113 | 0.73472 | 0.51681 | 0.5261 | 76 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||||
| 70278 | 70278 | SRR19641880 | SRX15691874 | SRS13388275 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D814 | GSM6239382 | source name:VGLL2 NCOA2 Tumor|tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:47 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | Dr D814 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | VGLL2 NCOA2 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:47 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239382 | GSM6239382: Dr D814; Danio rerio; RNA Seq | GSM6239382 r1 | GSM6239382 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP379972 | loader:fastq load.py | D814.R1.fastq.gz D814.R2.fastq.gz | fastq fastq | 5324319925.0 | 35553090.0 | GSM6239382 r1 | 0:74.94 1:74.81 | A:1410814162;C:1204694480;G:1203493723;T:1501738053;N:3579507 | 74 | 74 | 1410814162 | 1204694480 | 1203493723 | 1501738053 | 3579507 | SRX15691874 | SRS13388275 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.94387 | 0.94945 | 0.11185 | 0.10713 | 0.7289 | 0.73326 | 0.51623 | 0.52877 | 75 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||||
| 70279 | 70279 | SRR19641881 | SRX15691873 | SRS13388274 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D812 tail | GSM6239381 | source name:VGLL2 NCOA2 Tumor|tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:47 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | Dr D812 tail | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | VGLL2 NCOA2 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:47 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239381 | GSM6239381: Dr D812 tail; Danio rerio; RNA Seq | GSM6239381 r1 | GSM6239381 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP379972 | loader:fastq load.py | D812-TAIL.R1.fastq.gz D812-TAIL.R2.fastq.gz | fastq fastq | 4216145302.0 | 28196642.0 | GSM6239381 r1 | 0:74.88 1:74.65 | A:1160422081;C:892575288;G:892751007;T:1268085896;N:2311030 | 74 | 74 | 1160422081 | 892575288 | 892751007 | 1268085896 | 2311030 | SRX15691873 | SRS13388274 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.91904 | 0.93202 | 0.19504 | 0.18966 | 0.74012 | 0.7405 | 0.5624 | 0.56028 | 76 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||||
| 70280 | 70280 | SRR19641882 | SRX15691872 | SRS13388273 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D812 head | GSM6239380 | source name:VGLL2 NCOA2 Tumor|tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:47 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | Dr D812 head | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | VGLL2 NCOA2 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:47 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239380 | GSM6239380: Dr D812 head; Danio rerio; RNA Seq | GSM6239380 r1 | GSM6239380 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP379972 | loader:fastq load.py | D812-HEAD.R1.fastq.gz D812-HEAD.R2.fastq.gz | fastq fastq | 5573351114.0 | 37214240.0 | GSM6239380 r1 | 0:74.94 1:74.82 | A:1494050063;C:1238754114;G:1241998781;T:1594938585;N:3609571 | 74 | 74 | 1494050063 | 1238754114 | 1241998781 | 1594938585 | 3609571 | SRX15691872 | SRS13388273 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.93126 | 0.9394 | 0.14778 | 0.14546 | 0.71082 | 0.7133 | 0.52353 | 0.52925 | 76 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||||
| 70281 | 70281 | SRR19641883 | SRX15691871 | SRS13388272 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D811 | GSM6239379 | source name:VGLL2 NCOA2 Tumor|tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:47 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | Dr D811 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | VGLL2 NCOA2 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:47 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239379 | GSM6239379: Dr D811; Danio rerio; RNA Seq | GSM6239379 r1 | GSM6239379 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP379972 | loader:fastq load.py | D811.R1.fastq.gz D811.R2.fastq.gz | fastq fastq | 5867998587.0 | 39191298.0 | GSM6239379 r1 | 0:74.94 1:74.79 | A:1588850900;C:1285592386;G:1283297366;T:1706287112;N:3970823 | 74 | 74 | 1588850900 | 1285592386 | 1283297366 | 1706287112 | 3970823 | SRX15691871 | SRS13388272 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.92747 | 0.93507 | 0.16323 | 0.15851 | 0.73024 | 0.73308 | 0.52082 | 0.52509 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||||
| 70282 | 70282 | SRR19641884 | SRX15691870 | SRS13388271 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D809 | GSM6239378 | source name:VGLL2 NCOA2 Tumor|tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:44 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | Dr D809 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | VGLL2 NCOA2 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:44 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239378 | GSM6239378: Dr D809; Danio rerio; RNA Seq | GSM6239378 r1 | GSM6239378 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP379972 | loader:fastq load.py | D809.R1.fastq.gz D809.R2.fastq.gz | fastq fastq | 6007251328.0 | 40128578.0 | GSM6239378 r1 | 0:74.84 1:74.86 | A:1620179653;C:1297022916;G:1314071755;T:1772502665;N:3474339 | 74 | 74 | 1620179653 | 1297022916 | 1314071755 | 1772502665 | 3474339 | SRX15691870 | SRS13388271 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.92192 | 0.93266 | 0.17272 | 0.14371 | 0.69893 | 0.70558 | 0.51889 | 0.51407 | 76 | 76 | B | B | biological fallback assumption | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||||
| 70283 | 70283 | SRR19641885 | SRX15691869 | SRS13388270 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D813 Tail | GSM6239377 | source name:VGLL2 NCOA2 Tumor|tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:47 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | Dr D813 Tail | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | VGLL2 NCOA2 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:47 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239377 | GSM6239377: Dr D813 Tail; Danio rerio; RNA Seq | GSM6239377 r1 | GSM6239377 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP379972 | A667T29.R1.fastq.gz A667T29.R2.fastq.gz | fastq fastq | 5008267406.0 | 24793403.0 | GSM6239377 r1 | 0:101 1:101 | A:1295395829;C:1221797120;G:1229352150;T:1254821680;N:6900627 | 101 | 101 | 1295395829 | 1221797120 | 1229352150 | 1254821680 | 6900627 | SRX15691869 | SRS13388270 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.96637 | 0.96662 | 0.03488 | 0.03341 | 0.75087 | 0.75114 | 0.48187 | 0.49809 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||||
| 70284 | 70284 | SRR19641886 | SRX15691868 | SRS13388269 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D813 Back | GSM6239376 | source name:VGLL2 NCOA2 Tumor|tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:47 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | Dr D813 Back | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | VGLL2 NCOA2 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:47 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239376 | GSM6239376: Dr D813 Back; Danio rerio; RNA Seq | GSM6239376 r1 | GSM6239376 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP379972 | A667T28.R1.fastq.gz A667T28.R2.fastq.gz | fastq fastq | 5222770196.0 | 25855298.0 | GSM6239376 r1 | 0:101 1:101 | A:1362136718;C:1265274517;G:1280189541;T:1308065158;N:7104262 | 101 | 101 | 1362136718 | 1265274517 | 1280189541 | 1308065158 | 7104262 | SRX15691868 | SRS13388269 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.95967 | 0.9604 | 0.02975 | 0.02788 | 0.77413 | 0.77662 | 0.48896 | 0.48616 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||||
| 70285 | 70285 | SRR19641887 | SRX15691867 | SRS13388268 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D808 | GSM6239375 | source name:VGLL2 NCOA2 Tumor|tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:44 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | Dr D808 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | VGLL2 NCOA2 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:44 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239375 | GSM6239375: Dr D808; Danio rerio; RNA Seq | GSM6239375 r1 | GSM6239375 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP379972 | A667T27.R1.fastq.gz A667T27.R2.fastq.gz | fastq fastq | 7007351114.0 | 34689857.0 | GSM6239375 r1 | 0:101 1:101 | A:1805716658;C:1676771935;G:1682049081;T:1833195931;N:9617509 | 101 | 101 | 1805716658 | 1676771935 | 1682049081 | 1833195931 | 9617509 | SRX15691867 | SRS13388268 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.9553 | 0.95479 | 0.05006 | 0.0485 | 0.69041 | 0.69315 | 0.50616 | 0.51717 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||||
| 70286 | 70286 | SRR19641888 | SRX15691866 | SRS13388267 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D807 | GSM6239374 | source name:VGLL2 NCOA2 Tumor|tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:100 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | Dr D807 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | VGLL2 NCOA2 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:100 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239374 | GSM6239374: Dr D807; Danio rerio; RNA Seq | GSM6239374 r1 | GSM6239374 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP379972 | A667T26.R1.fastq.gz A667T26.R2.fastq.gz | fastq fastq | 5316162270.0 | 26317635.0 | GSM6239374 r1 | 0:101 1:101 | A:1389894635;C:1250633621;G:1284649584;T:1383667142;N:7317288 | 101 | 101 | 1389894635 | 1250633621 | 1284649584 | 1383667142 | 7317288 | SRX15691866 | SRS13388267 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.93738 | 0.937 | 0.06697 | 0.06513 | 0.69986 | 0.70272 | 0.50383 | 0.51428 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||||
| 70287 | 70287 | SRR19641889 | SRX15691865 | SRS13388266 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D801 | GSM6239373 | source name:VGLL2 NCOA2 Tumor|tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:75 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | Dr D801 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | VGLL2 NCOA2 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:75 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239373 | GSM6239373: Dr D801; Danio rerio; RNA Seq | GSM6239373 r1 | GSM6239373 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP379972 | A667T25.R1.fastq.gz A667T25.R2.fastq.gz | fastq fastq | 4932454988.0 | 24418094.0 | GSM6239373 r1 | 0:101 1:101 | A:1266969720;C:1183362158;G:1194417980;T:1280956395;N:6748735 | 101 | 101 | 1266969720 | 1183362158 | 1194417980 | 1280956395 | 6748735 | SRX15691865 | SRS13388266 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.95981 | 0.96067 | 0.04375 | 0.04178 | 0.72005 | 0.7207 | 0.51499 | 0.51772 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||||
| 70288 | 70288 | SRR19641890 | SRX15691864 | SRS13388265 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D800 | GSM6239372 | source name:VGLL2 NCOA2 Tumor|tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:75 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | Dr D800 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | VGLL2 NCOA2 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:75 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239372 | GSM6239372: Dr D800; Danio rerio; RNA Seq | GSM6239372 r1 | GSM6239372 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP379972 | A667T24.R1.fastq.gz A667T24.R2.fastq.gz | fastq fastq | 6530620004.0 | 32329802.0 | GSM6239372 r1 | 0:101 1:101 | A:1744475657;C:1531391274;G:1543099117;T:1702743393;N:8910563 | 101 | 101 | 1744475657 | 1531391274 | 1543099117 | 1702743393 | 8910563 | SRX15691864 | SRS13388265 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.94074 | 0.9399 | 0.0754 | 0.07407 | 0.72567 | 0.72786 | 0.5089 | 0.51474 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||||
| 70289 | 70289 | SRR19641891 | SRX15691863 | SRS13388264 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D799 | GSM6239371 | source name:VGLL2 NCOA2 Tumor|tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:75 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | Dr D799 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | VGLL2 NCOA2 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:75 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239371 | GSM6239371: Dr D799; Danio rerio; RNA Seq | GSM6239371 r1 | GSM6239371 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP379972 | A667T23.R1.fastq.gz A667T23.R2.fastq.gz | fastq fastq | 7005731680.0 | 34681840.0 | GSM6239371 r1 | 0:101 1:101 | A:1881482875;C:1633750252;G:1634087895;T:1846788553;N:9622105 | 101 | 101 | 1881482875 | 1633750252 | 1634087895 | 1846788553 | 9622105 | SRX15691863 | SRS13388264 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.9411 | 0.94019 | 0.07185 | 0.06942 | 0.6985 | 0.7007 | 0.50507 | 0.50454 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||||
| 70290 | 70290 | SRR19641892 | SRX15691862 | SRS13388263 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D777 | GSM6239370 | source name:VGLL2 NCOA2 Tumor|tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:50 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | Dr D777 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | VGLL2 NCOA2 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:50 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239370 | GSM6239370: Dr D777; Danio rerio; RNA Seq | GSM6239370 r1 | GSM6239370 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP379972 | A667T22.R1.fastq.gz A667T22.R2.fastq.gz | fastq fastq | 5807085294.0 | 28747947.0 | GSM6239370 r1 | 0:101 1:101 | A:1489781446;C:1427248662;G:1447280289;T:1434849275;N:7925622 | 101 | 101 | 1489781446 | 1427248662 | 1447280289 | 1434849275 | 7925622 | SRX15691862 | SRS13388263 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.97338 | 0.95461 | 0.02103 | 0.01988 | 0.76672 | 0.7694 | 0.45154 | 0.45491 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||||
| 70291 | 70291 | SRR19641893 | SRX15691861 | SRS13388262 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D742 | GSM6239369 | source name:VGLL2 NCOA2 Tumor|tissue:VGLL2 NCOA2 Tumor|genotype:tp53M214K mutant|age at sac:51 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | Dr D742 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | VGLL2 NCOA2 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:VGLL2 NCOA2 Tumor|genotype:tp53M214K mutant|age at sac:51 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239369 | GSM6239369: Dr D742; Danio rerio; RNA Seq | GSM6239369 r1 | GSM6239369 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP379972 | A667T21.R1.fastq.gz A667T21.R2.fastq.gz | fastq fastq | 5316618790.0 | 26319895.0 | GSM6239369 r1 | 0:101 1:101 | A:1354080088;C:1318695936;G:1325454710;T:1311155058;N:7232998 | 101 | 101 | 1354080088 | 1318695936 | 1325454710 | 1311155058 | 7232998 | SRX15691861 | SRS13388262 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.97911 | 0.96178 | 0.01922 | 0.01828 | 0.7835 | 0.78654 | 0.45514 | 0.44303 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||||
| 70292 | 70292 | SRR19641894 | SRX15691860 | SRS13388261 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D739 | GSM6239368 | source name:VGLL2 NCOA2 Tumor|tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:49 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | Dr D739 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | VGLL2 NCOA2 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:VGLL2 NCOA2 Tumor|genotype:Wildtype AB/TL|age at sac:49 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239368 | GSM6239368: Dr D739; Danio rerio; RNA Seq | GSM6239368 r1 | GSM6239368 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP379972 | A667T20.R1.fastq.gz A667T20.R2.fastq.gz | fastq fastq | 6748682640.0 | 33409320.0 | GSM6239368 r1 | 0:101 1:101 | A:1772019785;C:1619285509;G:1617242140;T:1730917979;N:9217227 | 101 | 101 | 1772019785 | 1619285509 | 1617242140 | 1730917979 | 9217227 | SRX15691860 | SRS13388261 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.95842 | 0.95712 | 0.04983 | 0.04815 | 0.71875 | 0.72046 | 0.48597 | 0.47695 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||||
| 70293 | 70293 | SRR19641895 | SRX15691859 | SRS13388260 | SRP379972 | PRJNA848822 | VGLL2 NCOA2 leverages developmental programs for pediatric sarcomagenesis | GSE206039 | Other | Clinical sequencing efforts are rapidly identifying sarcoma gene fusions that lack functional validation. An example is the new fusion of transcriptional coactivators VGLL2 NCOA2 found in infantile rhabdomyosarcoma. To delineate VGLL2 NCOA2 tumorigenic mechanisms and identify therapeutic vulnerabilities we implemented a cross species comparative oncology approach with zebrafish mouse allograft and patient samples. We found that VGLL2 NCOA2 is sufficient to generate mesenchymal tumors that display features of immature skeletal muscle and recapitulate the human disease. A subset of VGLL2 NCOA2 zebrafish tumors transcriptionally cluster with embryonic somitogenesis and identify VGLL2 NCOA2 developmental targets including a RAS family GTPase arf6/ARF6. In VGLL2 NCOA2 zebrafish mouse allograft and patient tumors arf6/ARF6 is highly expressed and is absent from mature skeletal muscle. Moreover ARF6 is overexpressed in adult and pediatric sarcoma subtypes. Our data indicate that VGLL2 NCOA2 is an oncogene which leverages developmental programs for tumorigenesis and that the reactivation or persistence of arf6/ARF6 could represent a therapeutic opportunity. Overall design: Examination of RNA seq transcriptional profiles from zebrafish tumors derived from mosaic human VGLL2 NCOA2 expression and a comparison to mature zebrafish skeletal muscle and CIC DUX4 generated zebrafish tumors. Examination of C2C12 mouse myoblasts stably transfected with human VGLL2 NCOA2 and allografted to generate tumor models. These are compared to allografts of C2C12 empty controls. | pubmed:36656711 | Dr D738 | GSM6239367 | source name:VGLL2 NCOA2 Tumor|tissue:VGLL2 NCOA2 Tumor|genotype:tp53M214K mutant|age at sac:44 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | Dr D738 | Reads were trimmed with trim galore 0.6.4 and then trimmed to a maxiumum of 150bp Reads were aligned with STAR 2.7.2b against the zebrafish genome danRer11 or the mouse genome mm10 Reads per gene were counted using HTseq 0.12.4 and the outputs were merged within R Read counts were normalized in R using EdgeR All code used in processing is available at https://github.com/MVesuviusC/2022 VGLL2 NCOA2 paper Assembly: danRer11 or mm10 Supplementary files format and content: geneCountsCombinedDr norm.txt.gz and geneCountsCombinedDr norm.txt.gz are tables containing normalized gene counts | VGLL2 NCOA2 Tumor | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | Here we describe transgenic zebrafish and mouse allograft models. For our transgenic zebrafish Gateway cloning was performed to generate CMV GFP2A VGLL2NCOA2 and BetaActin GFP2A CICDUX4 injection constructs each containing the human form of the fusion oncogene. These were injected into zebrafish in combination with Tol2 mRNA at the single cell stage and fish were monitored for tumor formation. For our mouse allograft models C2C12 cells were grown in DMEM+20% FBS and were stably transfected with pcDNA3.1 control or pcDNA3.1 VGLL2NCOA2. Two million cells were injected intramuscularly to generate allograft VGLL2 NCOA2 tumor models. | tissue:VGLL2 NCOA2 Tumor|genotype:tp53M214K mutant|age at sac:44 days|transgene:ptz876 cmv GFP2A VGLL2NCOA2 injected|cell line:n1|model:mosaic genetic tumor model | GSM6239367 | GSM6239367: Dr D738; Danio rerio; RNA Seq | GSM6239367 r1 | GSM6239367 | 1 | For zebrafish GFP positive and thus transgene positive tumors was extracted and flash frozen. Total RNA was isolated using the QIAGEN Rneasy Microkit. For zebrafish skeletal muscle total RNA was isolated with a QIAGEN Rneasy Minikit using an additional proteinase K step. For mouse allograft models total RNA was isolated using TRIZOL. RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP379972 | A667T19.R1.fastq.gz A667T19.R2.fastq.gz | fastq fastq | 5463481072.0 | 27046936.0 | GSM6239367 r1 | 0:101 1:101 | A:1405590484;C:1338255233;G:1348752299;T:1363408679;N:7474377 | 101 | 101 | 1405590484 | 1338255233 | 1348752299 | 1363408679 | 7474377 | SRX15691859 | SRS13388260 | Kendall Lab, Nationwide Children's Hospital / The Ohio State University | 2 | 0.96783 | 0.9504 | 0.03009 | 0.02841 | 0.73529 | 0.7387 | 0.47624 | 0.46331 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2022-06-13 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | |||||||||||||
| 73975 | 73975 | SRR23290625 | SRX19233905 | SRS16638363 | SRP420306 | PRJNA929991 | Genetic Predisposition to Neuroblastoma Results from a Regulatory Polymorphism that Promotes the Adrenergic Cell State | GSE224158 | Transcriptome Analysis | Childhood neuroblastomas exhibit plasticity between an undifferentiated neural crest like “mesenchymal” cell state and a more differentiated sympathetic “adrenergic” cell state. These cell states are governed by autoregulatory transcriptional loops called core regulatory circuitries CRCs which drive the early development of sympathetic neuronal progenitors from migratory neural crest cells during embryogenesis. The adrenergic cell identity of neuroblastoma requires LMO1 as a transcriptional co factor. Both LMO1 expression levels and the risk of developing neuroblastoma in children are associated with a single nucleotide polymorphism G/T that affects a GATA motif in the first intron of LMO1. Here we showed that wild type zebrafish with the GATA genotype developed adrenergic neuroblastoma while knock in of the protective TATA allele at this locus reduced the penetrance of MYCN driven tumors which were restricted to the mesenchymal cell state. Whole genome sequencing of childhood neuroblastomas demonstrated that TATA/TATA tumors also exhibited a mesenchymal cell state and were low risk at diagnosis. Thus conversion of the regulatory GATA to a TATA allele in the first intron of LMO1 reduced the neuroblastoma initiation rate by preventing formation of the adrenergic cell state a mechanism that was conserved over 400 million yrs of evolution separating zebrafish and humans. Overall design: Ribosome depleted RNA seq in zebrafish bearing genomes with TATA/TATA or KO alleles of lmo1 | pubmed:37183825 | lmo1 TATATATA MYCN 2 | GSM7016833 | source name:neuroblastoma|tissue:neuroblastoma|cell type:EGFP+ neuroblastoma cells|genotype:d{beta}h:EGFP;MYCN;TATA/TATA | lmo1 TATATATA MYCN 2 | RNA Seq reads were aligned to the danRer10 revision of the zebrafish reference genome using hisat2 version 2.1.0 PMID 31375807 in paired end mode. Reads in v90 of GRCz10 Ensembl genes were quantified using htseq count PMID 25260700 with parameters i gene name stranded=reverse m intersection strict. Expression as reads normalized by kilobase of exon per million mapped reads RPKM were calculated by counting the number of non redundant basepairs in all isoforms of each gene with the same gene name. Assembly: danRer10 Supplementary files format and content: RPKM files contain gene name read count total exon length and reads per kilobase of exon per million reads normalized values | neuroblastoma | To generate stable zebrafish lines carrying the TATA allele in the first intron of lmo1 Transcription Activator Like Effector Nuclease TALEN recognition sequences were designed to bind to the first intron of lmo1 surrounding the GATA site: TALEN1 five prime TACGACTGATTTGATTTT three prime and TALEN2 five prime TTCATTTCAAGTTCCAT three prime. TALEN expression vectors harboring a wild type FokI nuclease were generated as previously described Cade et al. Nucleic Acids Res. 2012 linearized by PmeI and used as templates for TALEN mRNA synthesis using the mMessage mMachine T3 Kit Ambion. For the targeted integration of the TATA allele a 41 nucleotide single stranded oligonucleotide containing the T allele sequence with 20 flanking nucleotides on either side of the T was designed. Equal amounts of TALEN1 and 2 mRNA 100 ng/L together with 100pg of oligonucleotide were injected together into 1 cell stage zebrafish embryos. To identify positive founder fish with a successful TATA knock in germline DNA was extracted by tail clip and the DNA fragment surrounding the TATA site was amplified by PCR and analyzed. The lmo1 knockout zebrafish line lmo1 / was generated by using CRISPR Cas9 genome editing technology targeting exon 2 Hwang et al. Nature Biotechnology 2013. The following lmo1 exon 2 CRISPR site was designed using a CRISPR Design web tool http://crispr.mit.edu: 5′ GGAGAGGGAGATCAGATCGA 3′ CRISPR gRNA was prepared by the cloning free single guide RNA synthesis method 61 using the Ambion T7 MEGAscript Kit AM1334M Ambion and purified with the Qiagen miRNeasy Kit 217004 Qiagen. Cas9 nuclease was purchased from New England Biolabs M0386T. Each embryo was injected with 1 nl of solution containing lmo1 specific gRNA 60 ng/ul and Cas9 30 ng/ul at the one cell stage. Mosaic F0 fish with germline mutation were identified and stable mutant lines were established by outcrossing. | Tumors were extractyed and EGFP+ cells were sorted. Total RNA was extracted using the QIAzol lysis reagent Qiagen and was cleaned using the RNeasy kit Qiagen. Samples were treated with the TURBO DNase TURBO DNA free Kit; Ambion and cleaned using the RNeasy MinElute Cleanup kit Qiagen.Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer’s protocol NEBNext Ultra. Strand specific library construction and Illumina NextSeq 500 sequencing of paired end 100 bp long reads were performed. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | All zebrafish studies and maintenance were done in accord with Dana Farber Cancer Institute IACUC approved protocol #02 107. EGFP+ neuroblastoma cells were harvested from tumor bearing MYCN transgenic zebrafish. Tumors were mechanically homogenized and EGFP+ cells were sorted. | tissue:neuroblastoma|cell type:EGFP+ neuroblastoma cells|genotype:d{beta}h:EGFP;MYCN;TATA/TATA | GSM7016833 | GSM7016833: lmo1 TATATATA MYCN 2; Danio rerio; RNA Seq | GSM7016833 r1 | GSM7016833 | 1 | Tumors were extractyed and EGFP+ cells were sorted. Total RNA was extracted using the QIAzol lysis reagent Qiagen and was cleaned using the RNeasy kit Qiagen. Samples were treated with the TURBO DNase TURBO DNA free Kit; Ambion and cleaned using the RNeasy MinElute Cleanup kit Qiagen.Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer's protocol NEBNext Ultra. Strand specific library construction and Illumina NextSeq 500 sequencing of paired end 100 bp long reads were performed. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP420306 | 20171227_TT10_TT5121_S10_R1_001.fastq.gz 20171227_TT10_TT5121_S10_R2_001.fastq.gz | fastq fastq | 5747928750.0 | 38319525.0 | GSM7016833 r1 | 0:75 1:75 | A:1473687377;C:1375008205;G:1440665930;T:1454485418;N:4081820 | 75 | 75 | 1473687377 | 1375008205 | 1440665930 | 1454485418 | 4081820 | SRX19233905 | SRS16638363 | SRA1582957 | Young Lab, Whitehead Institute for Biomedical Research | Young Lab, Whitehead Institute for Biomedical Research | 2 | 0.95703 | 0.95708 | 0.05038 | 0.04997 | 0.72557 | 0.72997 | 0.54098 | 0.5574 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | 5prime | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2023-01-31 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||
| 73976 | 73976 | SRR23290626 | SRX19233904 | SRS16638362 | SRP420306 | PRJNA929991 | Genetic Predisposition to Neuroblastoma Results from a Regulatory Polymorphism that Promotes the Adrenergic Cell State | GSE224158 | Transcriptome Analysis | Childhood neuroblastomas exhibit plasticity between an undifferentiated neural crest like “mesenchymal” cell state and a more differentiated sympathetic “adrenergic” cell state. These cell states are governed by autoregulatory transcriptional loops called core regulatory circuitries CRCs which drive the early development of sympathetic neuronal progenitors from migratory neural crest cells during embryogenesis. The adrenergic cell identity of neuroblastoma requires LMO1 as a transcriptional co factor. Both LMO1 expression levels and the risk of developing neuroblastoma in children are associated with a single nucleotide polymorphism G/T that affects a GATA motif in the first intron of LMO1. Here we showed that wild type zebrafish with the GATA genotype developed adrenergic neuroblastoma while knock in of the protective TATA allele at this locus reduced the penetrance of MYCN driven tumors which were restricted to the mesenchymal cell state. Whole genome sequencing of childhood neuroblastomas demonstrated that TATA/TATA tumors also exhibited a mesenchymal cell state and were low risk at diagnosis. Thus conversion of the regulatory GATA to a TATA allele in the first intron of LMO1 reduced the neuroblastoma initiation rate by preventing formation of the adrenergic cell state a mechanism that was conserved over 400 million yrs of evolution separating zebrafish and humans. Overall design: Ribosome depleted RNA seq in zebrafish bearing genomes with TATA/TATA or KO alleles of lmo1 | pubmed:37183825 | lmo1 TATATATA MYCN 1 | GSM7016832 | source name:neuroblastoma|tissue:neuroblastoma|cell type:EGFP+ neuroblastoma cells|genotype:d{beta}h:EGFP;MYCN;TATA/TATA | lmo1 TATATATA MYCN 1 | RNA Seq reads were aligned to the danRer10 revision of the zebrafish reference genome using hisat2 version 2.1.0 PMID 31375807 in paired end mode. Reads in v90 of GRCz10 Ensembl genes were quantified using htseq count PMID 25260700 with parameters i gene name stranded=reverse m intersection strict. Expression as reads normalized by kilobase of exon per million mapped reads RPKM were calculated by counting the number of non redundant basepairs in all isoforms of each gene with the same gene name. Assembly: danRer10 Supplementary files format and content: RPKM files contain gene name read count total exon length and reads per kilobase of exon per million reads normalized values | neuroblastoma | To generate stable zebrafish lines carrying the TATA allele in the first intron of lmo1 Transcription Activator Like Effector Nuclease TALEN recognition sequences were designed to bind to the first intron of lmo1 surrounding the GATA site: TALEN1 five prime TACGACTGATTTGATTTT three prime and TALEN2 five prime TTCATTTCAAGTTCCAT three prime. TALEN expression vectors harboring a wild type FokI nuclease were generated as previously described Cade et al. Nucleic Acids Res. 2012 linearized by PmeI and used as templates for TALEN mRNA synthesis using the mMessage mMachine T3 Kit Ambion. For the targeted integration of the TATA allele a 41 nucleotide single stranded oligonucleotide containing the T allele sequence with 20 flanking nucleotides on either side of the T was designed. Equal amounts of TALEN1 and 2 mRNA 100 ng/L together with 100pg of oligonucleotide were injected together into 1 cell stage zebrafish embryos. To identify positive founder fish with a successful TATA knock in germline DNA was extracted by tail clip and the DNA fragment surrounding the TATA site was amplified by PCR and analyzed. The lmo1 knockout zebrafish line lmo1 / was generated by using CRISPR Cas9 genome editing technology targeting exon 2 Hwang et al. Nature Biotechnology 2013. The following lmo1 exon 2 CRISPR site was designed using a CRISPR Design web tool http://crispr.mit.edu: 5′ GGAGAGGGAGATCAGATCGA 3′ CRISPR gRNA was prepared by the cloning free single guide RNA synthesis method 61 using the Ambion T7 MEGAscript Kit AM1334M Ambion and purified with the Qiagen miRNeasy Kit 217004 Qiagen. Cas9 nuclease was purchased from New England Biolabs M0386T. Each embryo was injected with 1 nl of solution containing lmo1 specific gRNA 60 ng/ul and Cas9 30 ng/ul at the one cell stage. Mosaic F0 fish with germline mutation were identified and stable mutant lines were established by outcrossing. | Tumors were extractyed and EGFP+ cells were sorted. Total RNA was extracted using the QIAzol lysis reagent Qiagen and was cleaned using the RNeasy kit Qiagen. Samples were treated with the TURBO DNase TURBO DNA free Kit; Ambion and cleaned using the RNeasy MinElute Cleanup kit Qiagen.Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer’s protocol NEBNext Ultra. Strand specific library construction and Illumina NextSeq 500 sequencing of paired end 100 bp long reads were performed. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | All zebrafish studies and maintenance were done in accord with Dana Farber Cancer Institute IACUC approved protocol #02 107. EGFP+ neuroblastoma cells were harvested from tumor bearing MYCN transgenic zebrafish. Tumors were mechanically homogenized and EGFP+ cells were sorted. | tissue:neuroblastoma|cell type:EGFP+ neuroblastoma cells|genotype:d{beta}h:EGFP;MYCN;TATA/TATA | GSM7016832 | GSM7016832: lmo1 TATATATA MYCN 1; Danio rerio; RNA Seq | GSM7016832 r1 | GSM7016832 | 1 | Tumors were extractyed and EGFP+ cells were sorted. Total RNA was extracted using the QIAzol lysis reagent Qiagen and was cleaned using the RNeasy kit Qiagen. Samples were treated with the TURBO DNase TURBO DNA free Kit; Ambion and cleaned using the RNeasy MinElute Cleanup kit Qiagen.Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer's protocol NEBNext Ultra. Strand specific library construction and Illumina NextSeq 500 sequencing of paired end 100 bp long reads were performed. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP420306 | 20171227_TT9_TT5121_S9_R1_001.fastq.gz 20171227_TT9_TT5121_S9_R2_001.fastq.gz | fastq fastq | 6123774750.0 | 40825165.0 | GSM7016832 r1 | 0:75 1:75 | A:1585035458;C:1440745361;G:1549523490;T:1544047134;N:4423307 | 75 | 75 | 1585035458 | 1440745361 | 1549523490 | 1544047134 | 4423307 | SRX19233904 | SRS16638362 | SRA1582957 | Young Lab, Whitehead Institute for Biomedical Research | Young Lab, Whitehead Institute for Biomedical Research | 2 | 0.95657 | 0.95975 | 0.05348 | 0.05262 | 0.72441 | 0.73058 | 0.54992 | 0.55373 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | 5prime | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2023-01-31 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||
| 73977 | 73977 | SRR23290627 | SRX19233903 | SRS16638361 | SRP420306 | PRJNA929991 | Genetic Predisposition to Neuroblastoma Results from a Regulatory Polymorphism that Promotes the Adrenergic Cell State | GSE224158 | Transcriptome Analysis | Childhood neuroblastomas exhibit plasticity between an undifferentiated neural crest like “mesenchymal” cell state and a more differentiated sympathetic “adrenergic” cell state. These cell states are governed by autoregulatory transcriptional loops called core regulatory circuitries CRCs which drive the early development of sympathetic neuronal progenitors from migratory neural crest cells during embryogenesis. The adrenergic cell identity of neuroblastoma requires LMO1 as a transcriptional co factor. Both LMO1 expression levels and the risk of developing neuroblastoma in children are associated with a single nucleotide polymorphism G/T that affects a GATA motif in the first intron of LMO1. Here we showed that wild type zebrafish with the GATA genotype developed adrenergic neuroblastoma while knock in of the protective TATA allele at this locus reduced the penetrance of MYCN driven tumors which were restricted to the mesenchymal cell state. Whole genome sequencing of childhood neuroblastomas demonstrated that TATA/TATA tumors also exhibited a mesenchymal cell state and were low risk at diagnosis. Thus conversion of the regulatory GATA to a TATA allele in the first intron of LMO1 reduced the neuroblastoma initiation rate by preventing formation of the adrenergic cell state a mechanism that was conserved over 400 million yrs of evolution separating zebrafish and humans. Overall design: Ribosome depleted RNA seq in zebrafish bearing genomes with TATA/TATA or KO alleles of lmo1 | pubmed:37183825 | lmo1 KO MYCN 3 | GSM7016831 | source name:neuroblastoma|tissue:neuroblastoma|cell type:EGFP+ neuroblastoma cells|genotype:d{beta}h:EGFP;MYCN;lmo1 / | lmo1 KO MYCN 3 | RNA Seq reads were aligned to the danRer10 revision of the zebrafish reference genome using hisat2 version 2.1.0 PMID 31375807 in paired end mode. Reads in v90 of GRCz10 Ensembl genes were quantified using htseq count PMID 25260700 with parameters i gene name stranded=reverse m intersection strict. Expression as reads normalized by kilobase of exon per million mapped reads RPKM were calculated by counting the number of non redundant basepairs in all isoforms of each gene with the same gene name. Assembly: danRer10 Supplementary files format and content: RPKM files contain gene name read count total exon length and reads per kilobase of exon per million reads normalized values | neuroblastoma | To generate stable zebrafish lines carrying the TATA allele in the first intron of lmo1 Transcription Activator Like Effector Nuclease TALEN recognition sequences were designed to bind to the first intron of lmo1 surrounding the GATA site: TALEN1 five prime TACGACTGATTTGATTTT three prime and TALEN2 five prime TTCATTTCAAGTTCCAT three prime. TALEN expression vectors harboring a wild type FokI nuclease were generated as previously described Cade et al. Nucleic Acids Res. 2012 linearized by PmeI and used as templates for TALEN mRNA synthesis using the mMessage mMachine T3 Kit Ambion. For the targeted integration of the TATA allele a 41 nucleotide single stranded oligonucleotide containing the T allele sequence with 20 flanking nucleotides on either side of the T was designed. Equal amounts of TALEN1 and 2 mRNA 100 ng/L together with 100pg of oligonucleotide were injected together into 1 cell stage zebrafish embryos. To identify positive founder fish with a successful TATA knock in germline DNA was extracted by tail clip and the DNA fragment surrounding the TATA site was amplified by PCR and analyzed. The lmo1 knockout zebrafish line lmo1 / was generated by using CRISPR Cas9 genome editing technology targeting exon 2 Hwang et al. Nature Biotechnology 2013. The following lmo1 exon 2 CRISPR site was designed using a CRISPR Design web tool http://crispr.mit.edu: 5′ GGAGAGGGAGATCAGATCGA 3′ CRISPR gRNA was prepared by the cloning free single guide RNA synthesis method 61 using the Ambion T7 MEGAscript Kit AM1334M Ambion and purified with the Qiagen miRNeasy Kit 217004 Qiagen. Cas9 nuclease was purchased from New England Biolabs M0386T. Each embryo was injected with 1 nl of solution containing lmo1 specific gRNA 60 ng/ul and Cas9 30 ng/ul at the one cell stage. Mosaic F0 fish with germline mutation were identified and stable mutant lines were established by outcrossing. | Tumors were extractyed and EGFP+ cells were sorted. Total RNA was extracted using the QIAzol lysis reagent Qiagen and was cleaned using the RNeasy kit Qiagen. Samples were treated with the TURBO DNase TURBO DNA free Kit; Ambion and cleaned using the RNeasy MinElute Cleanup kit Qiagen.Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer’s protocol NEBNext Ultra. Strand specific library construction and Illumina NextSeq 500 sequencing of paired end 100 bp long reads were performed. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | All zebrafish studies and maintenance were done in accord with Dana Farber Cancer Institute IACUC approved protocol #02 107. EGFP+ neuroblastoma cells were harvested from tumor bearing MYCN transgenic zebrafish. Tumors were mechanically homogenized and EGFP+ cells were sorted. | tissue:neuroblastoma|cell type:EGFP+ neuroblastoma cells|genotype:d{beta}h:EGFP;MYCN;lmo1 / | GSM7016831 | GSM7016831: lmo1 KO MYCN 3; Danio rerio; RNA Seq | GSM7016831 r1 | GSM7016831 | 1 | Tumors were extractyed and EGFP+ cells were sorted. Total RNA was extracted using the QIAzol lysis reagent Qiagen and was cleaned using the RNeasy kit Qiagen. Samples were treated with the TURBO DNase TURBO DNA free Kit; Ambion and cleaned using the RNeasy MinElute Cleanup kit Qiagen.Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer's protocol NEBNext Ultra. Strand specific library construction and Illumina NextSeq 500 sequencing of paired end 100 bp long reads were performed. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP420306 | 20171227_TT8_TT5121_S8_R1_001.fastq.gz 20171227_TT8_TT5121_S8_R2_001.fastq.gz | fastq fastq | 5657754150.0 | 37718361.0 | GSM7016831 r1 | 0:75 1:75 | A:1447834797;C:1365984982;G:1411385887;T:1428492012;N:4056472 | 75 | 75 | 1447834797 | 1365984982 | 1411385887 | 1428492012 | 4056472 | SRX19233903 | SRS16638361 | SRA1582957 | Young Lab, Whitehead Institute for Biomedical Research | Young Lab, Whitehead Institute for Biomedical Research | 2 | 0.96187 | 0.96571 | 0.04272 | 0.04141 | 0.75613 | 0.75943 | 0.54076 | 0.53376 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | 5prime | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2023-01-31 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||
| 73978 | 73978 | SRR23290628 | SRX19233902 | SRS16638360 | SRP420306 | PRJNA929991 | Genetic Predisposition to Neuroblastoma Results from a Regulatory Polymorphism that Promotes the Adrenergic Cell State | GSE224158 | Transcriptome Analysis | Childhood neuroblastomas exhibit plasticity between an undifferentiated neural crest like “mesenchymal” cell state and a more differentiated sympathetic “adrenergic” cell state. These cell states are governed by autoregulatory transcriptional loops called core regulatory circuitries CRCs which drive the early development of sympathetic neuronal progenitors from migratory neural crest cells during embryogenesis. The adrenergic cell identity of neuroblastoma requires LMO1 as a transcriptional co factor. Both LMO1 expression levels and the risk of developing neuroblastoma in children are associated with a single nucleotide polymorphism G/T that affects a GATA motif in the first intron of LMO1. Here we showed that wild type zebrafish with the GATA genotype developed adrenergic neuroblastoma while knock in of the protective TATA allele at this locus reduced the penetrance of MYCN driven tumors which were restricted to the mesenchymal cell state. Whole genome sequencing of childhood neuroblastomas demonstrated that TATA/TATA tumors also exhibited a mesenchymal cell state and were low risk at diagnosis. Thus conversion of the regulatory GATA to a TATA allele in the first intron of LMO1 reduced the neuroblastoma initiation rate by preventing formation of the adrenergic cell state a mechanism that was conserved over 400 million yrs of evolution separating zebrafish and humans. Overall design: Ribosome depleted RNA seq in zebrafish bearing genomes with TATA/TATA or KO alleles of lmo1 | pubmed:37183825 | lmo1 KO MYCN 2 | GSM7016830 | source name:neuroblastoma|tissue:neuroblastoma|cell type:EGFP+ neuroblastoma cells|genotype:d{beta}h:EGFP;MYCN;lmo1 / | lmo1 KO MYCN 2 | RNA Seq reads were aligned to the danRer10 revision of the zebrafish reference genome using hisat2 version 2.1.0 PMID 31375807 in paired end mode. Reads in v90 of GRCz10 Ensembl genes were quantified using htseq count PMID 25260700 with parameters i gene name stranded=reverse m intersection strict. Expression as reads normalized by kilobase of exon per million mapped reads RPKM were calculated by counting the number of non redundant basepairs in all isoforms of each gene with the same gene name. Assembly: danRer10 Supplementary files format and content: RPKM files contain gene name read count total exon length and reads per kilobase of exon per million reads normalized values | neuroblastoma | To generate stable zebrafish lines carrying the TATA allele in the first intron of lmo1 Transcription Activator Like Effector Nuclease TALEN recognition sequences were designed to bind to the first intron of lmo1 surrounding the GATA site: TALEN1 five prime TACGACTGATTTGATTTT three prime and TALEN2 five prime TTCATTTCAAGTTCCAT three prime. TALEN expression vectors harboring a wild type FokI nuclease were generated as previously described Cade et al. Nucleic Acids Res. 2012 linearized by PmeI and used as templates for TALEN mRNA synthesis using the mMessage mMachine T3 Kit Ambion. For the targeted integration of the TATA allele a 41 nucleotide single stranded oligonucleotide containing the T allele sequence with 20 flanking nucleotides on either side of the T was designed. Equal amounts of TALEN1 and 2 mRNA 100 ng/L together with 100pg of oligonucleotide were injected together into 1 cell stage zebrafish embryos. To identify positive founder fish with a successful TATA knock in germline DNA was extracted by tail clip and the DNA fragment surrounding the TATA site was amplified by PCR and analyzed. The lmo1 knockout zebrafish line lmo1 / was generated by using CRISPR Cas9 genome editing technology targeting exon 2 Hwang et al. Nature Biotechnology 2013. The following lmo1 exon 2 CRISPR site was designed using a CRISPR Design web tool http://crispr.mit.edu: 5′ GGAGAGGGAGATCAGATCGA 3′ CRISPR gRNA was prepared by the cloning free single guide RNA synthesis method 61 using the Ambion T7 MEGAscript Kit AM1334M Ambion and purified with the Qiagen miRNeasy Kit 217004 Qiagen. Cas9 nuclease was purchased from New England Biolabs M0386T. Each embryo was injected with 1 nl of solution containing lmo1 specific gRNA 60 ng/ul and Cas9 30 ng/ul at the one cell stage. Mosaic F0 fish with germline mutation were identified and stable mutant lines were established by outcrossing. | Tumors were extractyed and EGFP+ cells were sorted. Total RNA was extracted using the QIAzol lysis reagent Qiagen and was cleaned using the RNeasy kit Qiagen. Samples were treated with the TURBO DNase TURBO DNA free Kit; Ambion and cleaned using the RNeasy MinElute Cleanup kit Qiagen.Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer’s protocol NEBNext Ultra. Strand specific library construction and Illumina NextSeq 500 sequencing of paired end 100 bp long reads were performed. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | All zebrafish studies and maintenance were done in accord with Dana Farber Cancer Institute IACUC approved protocol #02 107. EGFP+ neuroblastoma cells were harvested from tumor bearing MYCN transgenic zebrafish. Tumors were mechanically homogenized and EGFP+ cells were sorted. | tissue:neuroblastoma|cell type:EGFP+ neuroblastoma cells|genotype:d{beta}h:EGFP;MYCN;lmo1 / | GSM7016830 | GSM7016830: lmo1 KO MYCN 2; Danio rerio; RNA Seq | GSM7016830 r1 | GSM7016830 | 1 | Tumors were extractyed and EGFP+ cells were sorted. Total RNA was extracted using the QIAzol lysis reagent Qiagen and was cleaned using the RNeasy kit Qiagen. Samples were treated with the TURBO DNase TURBO DNA free Kit; Ambion and cleaned using the RNeasy MinElute Cleanup kit Qiagen.Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer's protocol NEBNext Ultra. Strand specific library construction and Illumina NextSeq 500 sequencing of paired end 100 bp long reads were performed. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP420306 | 20171227_TT7_TT5121_S7_R1_001.fastq.gz 20171227_TT7_TT5121_S7_R2_001.fastq.gz | fastq fastq | 4910126850.0 | 32734179.0 | GSM7016830 r1 | 0:75 1:75 | A:1248071509;C:1196778216;G:1230571847;T:1231187681;N:3517597 | 75 | 75 | 1248071509 | 1196778216 | 1230571847 | 1231187681 | 3517597 | SRX19233902 | SRS16638360 | SRA1582957 | Young Lab, Whitehead Institute for Biomedical Research | Young Lab, Whitehead Institute for Biomedical Research | 2 | 0.96769 | 0.97217 | 0.0338 | 0.0335 | 0.77585 | 0.77837 | 0.54954 | 0.52985 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | 5prime | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2023-01-31 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor | ||||||||||
| 73979 | 73979 | SRR23290629 | SRX19233901 | SRS16638359 | SRP420306 | PRJNA929991 | Genetic Predisposition to Neuroblastoma Results from a Regulatory Polymorphism that Promotes the Adrenergic Cell State | GSE224158 | Transcriptome Analysis | Childhood neuroblastomas exhibit plasticity between an undifferentiated neural crest like “mesenchymal” cell state and a more differentiated sympathetic “adrenergic” cell state. These cell states are governed by autoregulatory transcriptional loops called core regulatory circuitries CRCs which drive the early development of sympathetic neuronal progenitors from migratory neural crest cells during embryogenesis. The adrenergic cell identity of neuroblastoma requires LMO1 as a transcriptional co factor. Both LMO1 expression levels and the risk of developing neuroblastoma in children are associated with a single nucleotide polymorphism G/T that affects a GATA motif in the first intron of LMO1. Here we showed that wild type zebrafish with the GATA genotype developed adrenergic neuroblastoma while knock in of the protective TATA allele at this locus reduced the penetrance of MYCN driven tumors which were restricted to the mesenchymal cell state. Whole genome sequencing of childhood neuroblastomas demonstrated that TATA/TATA tumors also exhibited a mesenchymal cell state and were low risk at diagnosis. Thus conversion of the regulatory GATA to a TATA allele in the first intron of LMO1 reduced the neuroblastoma initiation rate by preventing formation of the adrenergic cell state a mechanism that was conserved over 400 million yrs of evolution separating zebrafish and humans. Overall design: Ribosome depleted RNA seq in zebrafish bearing genomes with TATA/TATA or KO alleles of lmo1 | pubmed:37183825 | lmo1 KO MYCN 1 | GSM7016829 | source name:neuroblastoma|tissue:neuroblastoma|cell type:EGFP+ neuroblastoma cells|genotype:d{beta}h:EGFP;MYCN;lmo1 / | lmo1 KO MYCN 1 | RNA Seq reads were aligned to the danRer10 revision of the zebrafish reference genome using hisat2 version 2.1.0 PMID 31375807 in paired end mode. Reads in v90 of GRCz10 Ensembl genes were quantified using htseq count PMID 25260700 with parameters i gene name stranded=reverse m intersection strict. Expression as reads normalized by kilobase of exon per million mapped reads RPKM were calculated by counting the number of non redundant basepairs in all isoforms of each gene with the same gene name. Assembly: danRer10 Supplementary files format and content: RPKM files contain gene name read count total exon length and reads per kilobase of exon per million reads normalized values | neuroblastoma | To generate stable zebrafish lines carrying the TATA allele in the first intron of lmo1 Transcription Activator Like Effector Nuclease TALEN recognition sequences were designed to bind to the first intron of lmo1 surrounding the GATA site: TALEN1 five prime TACGACTGATTTGATTTT three prime and TALEN2 five prime TTCATTTCAAGTTCCAT three prime. TALEN expression vectors harboring a wild type FokI nuclease were generated as previously described Cade et al. Nucleic Acids Res. 2012 linearized by PmeI and used as templates for TALEN mRNA synthesis using the mMessage mMachine T3 Kit Ambion. For the targeted integration of the TATA allele a 41 nucleotide single stranded oligonucleotide containing the T allele sequence with 20 flanking nucleotides on either side of the T was designed. Equal amounts of TALEN1 and 2 mRNA 100 ng/L together with 100pg of oligonucleotide were injected together into 1 cell stage zebrafish embryos. To identify positive founder fish with a successful TATA knock in germline DNA was extracted by tail clip and the DNA fragment surrounding the TATA site was amplified by PCR and analyzed. The lmo1 knockout zebrafish line lmo1 / was generated by using CRISPR Cas9 genome editing technology targeting exon 2 Hwang et al. Nature Biotechnology 2013. The following lmo1 exon 2 CRISPR site was designed using a CRISPR Design web tool http://crispr.mit.edu: 5′ GGAGAGGGAGATCAGATCGA 3′ CRISPR gRNA was prepared by the cloning free single guide RNA synthesis method 61 using the Ambion T7 MEGAscript Kit AM1334M Ambion and purified with the Qiagen miRNeasy Kit 217004 Qiagen. Cas9 nuclease was purchased from New England Biolabs M0386T. Each embryo was injected with 1 nl of solution containing lmo1 specific gRNA 60 ng/ul and Cas9 30 ng/ul at the one cell stage. Mosaic F0 fish with germline mutation were identified and stable mutant lines were established by outcrossing. | Tumors were extractyed and EGFP+ cells were sorted. Total RNA was extracted using the QIAzol lysis reagent Qiagen and was cleaned using the RNeasy kit Qiagen. Samples were treated with the TURBO DNase TURBO DNA free Kit; Ambion and cleaned using the RNeasy MinElute Cleanup kit Qiagen.Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer’s protocol NEBNext Ultra. Strand specific library construction and Illumina NextSeq 500 sequencing of paired end 100 bp long reads were performed. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | All zebrafish studies and maintenance were done in accord with Dana Farber Cancer Institute IACUC approved protocol #02 107. EGFP+ neuroblastoma cells were harvested from tumor bearing MYCN transgenic zebrafish. Tumors were mechanically homogenized and EGFP+ cells were sorted. | tissue:neuroblastoma|cell type:EGFP+ neuroblastoma cells|genotype:d{beta}h:EGFP;MYCN;lmo1 / | GSM7016829 | GSM7016829: lmo1 KO MYCN 1; Danio rerio; RNA Seq | GSM7016829 r1 | GSM7016829 | 1 | Tumors were extractyed and EGFP+ cells were sorted. Total RNA was extracted using the QIAzol lysis reagent Qiagen and was cleaned using the RNeasy kit Qiagen. Samples were treated with the TURBO DNase TURBO DNA free Kit; Ambion and cleaned using the RNeasy MinElute Cleanup kit Qiagen.Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer's protocol NEBNext Ultra. Strand specific library construction and Illumina NextSeq 500 sequencing of paired end 100 bp long reads were performed. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP420306 | 20171227_TT5_TT5121_S5_R1_001.fastq.gz 20171227_TT5_TT5121_S5_R2_001.fastq.gz | fastq fastq | 5589263250.0 | 37261755.0 | GSM7016829 r1 | 0:75 1:75 | A:1413596826;C:1309109613;G:1543445082;T:1319083199;N:4028530 | 75 | 75 | 1413596826 | 1309109613 | 1543445082 | 1319083199 | 4028530 | SRX19233901 | SRS16638359 | SRA1582957 | Young Lab, Whitehead Institute for Biomedical Research | Young Lab, Whitehead Institute for Biomedical Research | 2 | 0.96383 | 0.96683 | 0.04393 | 0.04363 | 0.77035 | 0.77431 | 0.51952 | 0.51419 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | 5prime | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2023-01-31 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;