RNAquarium Metadata Server
Institute Website Terms of Use Privacy Policy

run_metadata

14 rows where devstage_curation_coarse = "Embryo" and tissue_curation = "Skin"

✎ View and edit SQL

This data as json, CSV (advanced)

experiment.library_selection 3

technology 2

experiment.library_source 2

experiment.library_layout 2

devstage_curation 2

tissue_curation_coarse 1

tissue_curation 1

  • Skin · 14 ✖

experiment.platform 1

experiment.library_strategy 1

devstage_curation_coarse 1

  • Embryo · 14 ✖
Link rowid ▼ run.accession experiment.accession sample.accession study.accession bioproject study.title study.alias study.type study.abstract study.attributes study.PMIDs sample.description sample.title sample.alias sample.centername sample.attributes GEOsample.title GEOsample.dataprocessing GEOsample.source GEOsample.treatmentprotocol GEOsample.extractprotocol GEOsample.growthprotocol GEOsample.characteristics GEOsample.accession experiment.title experiment.alias experiment.library_name experiment.design_description experiment.library_construction_protocol experiment.attributes experiment.library_strategy experiment.library_source experiment.library_selection experiment.library_layout experiment.platform experiment.instrument_model experiment.spot_descriptor experiment.study_ref run.title run.attributes run.filename run.semantic_name run.total_bases run.total_spots run.alias run.read_lengths run.base_counts run.r1_length run.r2_length run.r3_length run.r4_length run.Acount run.Ccount run.Gcount run.Tcount run.Ncount run.experiment run.pool_member submission.accession submission.srasource submission.bioprojectsource seqdetective.n_mates seqdetective.mapping_rate.mate1 seqdetective.mapping_rate.mate2 seqdetective.nofeature_rate.mate1 seqdetective.nofeature_rate.mate2 seqdetective.sparsity.mate1 seqdetective.sparsity.mate2 seqdetective.pos_strand_rate.mate1 seqdetective.pos_strand_rate.mate2 seqdetective.readlen.mate1 seqdetective.readlen.mate2 seqdetective.judgement.mate1 seqdetective.judgement.mate2 seqdetective.judgement.reason platform_family instrument_generation read_bias selection_class prep_kit sc_or_bulk tech_class technology tech_variant submission.bioprojectsource.country earliest_date devstage_curation devstage_curation_coarse tissue_curation tissue_curation_coarse
33892 33892 SRR30866052 SRX26263961 SRS22803217 SRP536276 PRJNA1168147 Mgat4b mediated selective N glycosyl modification regulates melanocyte development and melanoma progression [scRNA seq] GSE278654 Transcriptome Analysis Dysregulated melanocyte state transitions are a pivotal driver of melanoma development highlighting the need to identify key regulators of these processes. Understanding these factors is key to know how normal melanocyte functions and shift towards initiation of melanoma. Our study identifies Mgat4b a glycosyl transferase involved in selective N glycan branching enriched in pigment progenitors as a key regulator of directional melanocyte migration and establishment of Melanocyte stem cell McSC pool during early development in zebrafish and mammalian melanocytes. Single cell RNA sequencing analysis in zebrafish upon targeted disruption of Mgat4b reveals that a subset of melanocytes marked by aberrant galectin expression are impaired in migration and are lost. Lectin binding proteomic analysis reveals the glycosylation of key melanocyte proteins Gpnmb Kit and Tyrp1 to be under the control of Mgat4b. Additionally mislocalization of Gamma catenin Jup explains the observed defects in cell adhesion and migration to be regulated by mgat4b but not its isozyme mgat4a. Our meta analysis further revealed that melanoma patients with both the BrafV600E mutation and elevated Mgat4b levels have significantly worse survival outcomes compared to those with only the BrafV600E mutation. By leveraging the MAZERATI platform to model BrafV600E driver mutation in vivo we show that Mgat4b mutant cells fail to aggregate and initiate tumors. Our study underscores the importance of selective N glycan branching in both melanocyte development and melanoma initiation suggesting a Mitf controlled Mgat4b as a promising therapeutic target for melanoma treatment. Overall design: To understand how selective N glycosylation modification performed by mgat4b promote melanocyte development we performed single cell RNA sequencing of mitfa+ve melanophores sorted from the 36hpf staged zebrafish.       m4b mut GSM8552316   tissue:melanocytes|cell type:melanocytes|age:36 hpf|genotype:mgat4b mutant|treatment:No|geo loc name:missing|collection date:missing m4b mut Cellranger mkfastq pipeline was used to generate fastq files The fastq files were then aligned with custom zebrafish reference assembly GRCz11 using cellranger. Assembly: GRCz11 Supplementary files format and content: tab delimited text file including barcodes and features and matrix files melanocytes   The gfp positive cells are isolated using FACS and 10x Genomics Next GEM three primereagent kit Dual Index was used for bead generation and cDNA synthesis 10x Genomics Next GEM three primereagent kit Dual Index was used for library construction   cell type:melanocytes|age:36 hpf|genotype:mgat4b mutant|treatment:No GSM8552316 GSM8552316: m4b mut; Danio rerio; RNA Seq GSM8552316 r1 GSM8552316 1 The gfp positive cells are isolated using FACS and 10x Genomics Next GEM three primereagent kit Dual Index was used for bead generation and cDNA synthesis 10x Genomics Next GEM three primereagent kit Dual Index was used for library construction   RNA-Seq TRANSCRIPTOMIC SINGLE CELL cDNA PAIRED ILLUMINA NextSeq 2000   SRP536276   loader:fastq load.py m4b_mut_S2_L001_I1_001.fastq.gz m4b_mut_S2_L001_I2_001.fastq.gz m4b_mut_S2_L001_R1_001.fastq.gz m4b_mut_S2_L001_R2_001.fastq.gz fastq fastq fastq fastq 18274385040.0 132423080.0 GSM8552316 r1 0:10 1:10 2:28 3:90 A:3788703303;C:2355223955;G:2645521958;T:3126630009;N:1997975 10 10 28 90 3788703303 2355223955 2645521958 3126630009 1997975 SRX26263961 SRS22803217 SRA1984944 Pigment Cell Biology Lab, CSIR-IGIB Pigment Cell Biology Lab, CSIR-IGIB                       B   usable mapping rate illumina nextseq_v2 unknown cdna_unspecified unknown sc single_cell_droplet 10x   India 2024-10-02 Pharyngula Embryo Skin Surface Structure
33893 33893 SRR30866053 SRX26263960 SRS22803216 SRP536276 PRJNA1168147 Mgat4b mediated selective N glycosyl modification regulates melanocyte development and melanoma progression [scRNA seq] GSE278654 Transcriptome Analysis Dysregulated melanocyte state transitions are a pivotal driver of melanoma development highlighting the need to identify key regulators of these processes. Understanding these factors is key to know how normal melanocyte functions and shift towards initiation of melanoma. Our study identifies Mgat4b a glycosyl transferase involved in selective N glycan branching enriched in pigment progenitors as a key regulator of directional melanocyte migration and establishment of Melanocyte stem cell McSC pool during early development in zebrafish and mammalian melanocytes. Single cell RNA sequencing analysis in zebrafish upon targeted disruption of Mgat4b reveals that a subset of melanocytes marked by aberrant galectin expression are impaired in migration and are lost. Lectin binding proteomic analysis reveals the glycosylation of key melanocyte proteins Gpnmb Kit and Tyrp1 to be under the control of Mgat4b. Additionally mislocalization of Gamma catenin Jup explains the observed defects in cell adhesion and migration to be regulated by mgat4b but not its isozyme mgat4a. Our meta analysis further revealed that melanoma patients with both the BrafV600E mutation and elevated Mgat4b levels have significantly worse survival outcomes compared to those with only the BrafV600E mutation. By leveraging the MAZERATI platform to model BrafV600E driver mutation in vivo we show that Mgat4b mutant cells fail to aggregate and initiate tumors. Our study underscores the importance of selective N glycan branching in both melanocyte development and melanoma initiation suggesting a Mitf controlled Mgat4b as a promising therapeutic target for melanoma treatment. Overall design: To understand how selective N glycosylation modification performed by mgat4b promote melanocyte development we performed single cell RNA sequencing of mitfa+ve melanophores sorted from the 36hpf staged zebrafish.       Control GSM8552315   tissue:melanocytes|cell type:melanocytes|age:36 hpf|genotype:control|treatment:No|geo loc name:missing|collection date:missing Control Cellranger mkfastq pipeline was used to generate fastq files The fastq files were then aligned with custom zebrafish reference assembly GRCz11 using cellranger. Assembly: GRCz11 Supplementary files format and content: tab delimited text file including barcodes and features and matrix files melanocytes   The gfp positive cells are isolated using FACS and 10x Genomics Next GEM three primereagent kit Dual Index was used for bead generation and cDNA synthesis 10x Genomics Next GEM three primereagent kit Dual Index was used for library construction   cell type:melanocytes|age:36 hpf|genotype:control|treatment:No GSM8552315 GSM8552315: Control; Danio rerio; RNA Seq GSM8552315 r1 GSM8552315 1 The gfp positive cells are isolated using FACS and 10x Genomics Next GEM three primereagent kit Dual Index was used for bead generation and cDNA synthesis 10x Genomics Next GEM three primereagent kit Dual Index was used for library construction   RNA-Seq TRANSCRIPTOMIC SINGLE CELL cDNA PAIRED ILLUMINA NextSeq 2000   SRP536276   loader:fastq load.py con_S1_L001_I1_001.fastq.gz con_S1_L001_I2_001.fastq.gz con_S1_L001_R1_001.fastq.gz con_S1_L001_R2_001.fastq.gz fastq fastq fastq fastq 15825218034.0 114675493.0 GSM8552315 r1 0:10 1:10 2:28 3:90 A:3074750870;C:2137365424;G:2401965854;T:2704984993;N:1727229 10 10 28 90 3074750870 2137365424 2401965854 2704984993 1727229 SRX26263960 SRS22803216 SRA1984944 Pigment Cell Biology Lab, CSIR-IGIB Pigment Cell Biology Lab, CSIR-IGIB                       B   usable mapping rate illumina nextseq_v2 unknown cdna_unspecified unknown sc single_cell_droplet 10x   India 2024-10-02 Pharyngula Embryo Skin Surface Structure
38119 38119 SRR1551796 SRX681416 SRS685079 SRP045504 PRJNA258223 Danio rerio strain:TL Transcriptome or Gene expression PRJNA258223 Other Transcriptome profiling of keratocytes derived from 2dpf and 4dpf embryos       Transcriptome from 2dpf keratocytes keratocytes from 2dpf embryos   breed:TL|strain:TL|age:2dpf|biomaterial provider:Julie Theriot Stanford University|sex:not collected|tissue:keratocytes skin|cell type:keratocyte|dev stage:2dpf|BioSampleModel:Model organism or animal                 Transcriptome from 2dpf keratocytes replicate 3 2dpf 3 2dpf 3 RNA was extracted from approximately 1 x 105 keratocytes per sample using Trizol Invitrogen. Three biological replicates were collected for each developmental stage. Ribosomal RNA was depleted using the Ribo Zero magnetic kit Epicentre. The remaining mRNA was then fragmented with 8 minutes incubation in 50mM sodium carbonate/bicarbonate 1mM EDTA pH 9.2 at 95 degrees. To prepare cDNA first strand synthesis was performed with Superscript III Invitrogen using random hexamer priming and second strand synthesis was performed with DNA Polymerase I NEB. Illumina libraries were prepared from the cDNA in an automated fashion using the Illumina TruSeq sample prep kit with TruSeq adapters on a SPRIworks System I Beckman Coulter. Sequencing reactions were performed on an Illumina Genome Analyzer IIX according to manufacturer’s instructions to generate 40nt single ended reads.     RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA Illumina Genome Analyzer IIx <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>40</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP045504     lane3_2dpf629.fastq fastq 551787520.0 13794688.0 2dpf 3 0:40 A:138660463;C:132605577;G:134640312;T:145852714;N:28454 40       138660463 132605577 134640312 145852714 28454 SRX681416 SRS685079 SRA179323 Stanford University|Julie Theriot Stanford University 1 0.91375   0.21598   0.75317   0.47881   40   B   usable mapping rate illumina early_illumina unknown poly_a trueseq bulk unknown unknown   United States 2014-08-14 Hatching Embryo Skin Surface Structure
38120 38120 SRR1551795 SRX681415 SRS685079 SRP045504 PRJNA258223 Danio rerio strain:TL Transcriptome or Gene expression PRJNA258223 Other Transcriptome profiling of keratocytes derived from 2dpf and 4dpf embryos       Transcriptome from 2dpf keratocytes keratocytes from 2dpf embryos   breed:TL|strain:TL|age:2dpf|biomaterial provider:Julie Theriot Stanford University|sex:not collected|tissue:keratocytes skin|cell type:keratocyte|dev stage:2dpf|BioSampleModel:Model organism or animal                 Transcriptome from 2dpf keratocytes 2dpf 2 2dpf 2 RNA was extracted from approximately 1 x 105 keratocytes per sample using Trizol Invitrogen. Three biological replicates were collected for each developmental stage. Ribosomal RNA was depleted using the Ribo Zero magnetic kit Epicentre. The remaining mRNA was then fragmented with 8 minutes incubation in 50mM sodium carbonate/bicarbonate 1mM EDTA pH 9.2 at 95 degrees. To prepare cDNA first strand synthesis was performed with Superscript III Invitrogen using random hexamer priming and second strand synthesis was performed with DNA Polymerase I NEB. Illumina libraries were prepared from the cDNA in an automated fashion using the Illumina TruSeq sample prep kit with TruSeq adapters on a SPRIworks System I Beckman Coulter. Sequencing reactions were performed on an Illumina Genome Analyzer IIX according to manufacturer’s instructions to generate 40nt single ended reads.     RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA Illumina Genome Analyzer IIx <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>40</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP045504     lane1_2dpf.fastq fastq 796874112.0 22135392.0 2dpf 2 0:36 A:209956517;C:184659684;G:185142987;T:216055902;N:1059022 36       209956517 184659684 185142987 216055902 1059022 SRX681415 SRS685079 SRA179323 Stanford University|Julie Theriot Stanford University 1 0.89178   0.17837   0.7609   0.49774   36   B   usable mapping rate illumina early_illumina unknown poly_a trueseq bulk unknown unknown   United States 2015-04-07 Hatching Embryo Skin Surface Structure
38121 38121 SRR1551782 SRX681402 SRS685079 SRP045504 PRJNA258223 Danio rerio strain:TL Transcriptome or Gene expression PRJNA258223 Other Transcriptome profiling of keratocytes derived from 2dpf and 4dpf embryos       Transcriptome from 2dpf keratocytes keratocytes from 2dpf embryos   breed:TL|strain:TL|age:2dpf|biomaterial provider:Julie Theriot Stanford University|sex:not collected|tissue:keratocytes skin|cell type:keratocyte|dev stage:2dpf|BioSampleModel:Model organism or animal                 2dpf keratocytes replicate 1 2dpf 1 2dpf 1 RNA was extracted from approximately 1 x 105 keratocytes per sample using Trizol Invitrogen. Three biological replicates were collected for each developmental stage. Ribosomal RNA was depleted using the Ribo Zero magnetic kit Epicentre. The remaining mRNA was then fragmented with 8 minutes incubation in 50mM sodium carbonate/bicarbonate 1mM EDTA pH 9.2 at 95 degrees. To prepare cDNA first strand synthesis was performed with Superscript III Invitrogen using random hexamer priming and second strand synthesis was performed with DNA Polymerase I NEB. Illumina libraries were prepared from the cDNA in an automated fashion using the Illumina TruSeq sample prep kit with TruSeq adapters on a SPRIworks System I Beckman Coulter. Sequencing reactions were performed on an Illumina Genome Analyzer IIX according to manufacturer’s instructions to generate 40nt single ended reads.     RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA Illumina Genome Analyzer IIx <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>40</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP045504     lane6_2dpf.fastq fastq 647944118.0 17051161.0 2dpf 1 0:38 A:145735255;C:167786338;G:186677806;T:141598169;N:6146550 38       145735255 167786338 186677806 141598169 6146550 SRX681402 SRS685079 SRA179323 Stanford University|Julie Theriot Stanford University 1 0.7695   0.15816   0.81491   0.44972   38   B   usable mapping rate illumina early_illumina unknown poly_a trueseq bulk unknown unknown   United States 2014-08-14 Hatching Embryo Skin Surface Structure
52812 52812 SRR9211490 SRX5982381 SRS4887886 SRP200656 PRJNA547573 Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos GSE132304 Transcriptome Analysis We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.   pubmed:31431477   52 hpf nonskin2 only replicate GSM3855898   source name:FACS isolated nonskin cells from whole embryos|strain:AB+TU|developmental stage:52 hpf|tissue:FACS nonskin2|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed;krt5:GFP 52 hpf nonskin2 only replicate Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication. FACS isolated nonskin cells from whole embryos Transgenic embryos without xxx treatment Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit. Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle. strain:AB+TU|developmental stage:52 hpf|tissue:FACS nonskin2|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed;krt5:GFP GSM3855898 GSM3855898: 52 hpf nonskin2 only replicate; Danio rerio; RNA Seq GSM3855898   1 Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit. GEO Accession:GSM3855898 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP200656     ZFishSkin_Reads_c09_52hpf-nonskin2_once_i12.CTTGTAA.pf1_VA061L6.fastq.gz fastq 1497326340.0 29359340.0 GSM3855898 r1 0:51 A:395115715;C:356520233;G:354572362;T:391098396;N:19634 51       395115715 356520233 354572362 391098396 19634 SRX5982381 SRS4887886 SRA894819 GEO UCLA 1 0.93658   0.08376   0.70201   0.47789   51   B   usable mapping rate illumina hiseq_era unknown poly_a trueseq bulk unknown unknown   United States 2019-06-06 Hatching Embryo Skin Surface Structure
52813 52813 SRR9211489 SRX5982380 SRS4887885 SRP200656 PRJNA547573 Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos GSE132304 Transcriptome Analysis We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.   pubmed:31431477   52 hpf all skin replicate B GSM3855897   source name:FACS isolated all skin cells from whole embryos|strain:AB+TU|developmental stage:52 hpf|tissue:FACS all skin|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed 52 hpf all skin replicate B Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication. FACS isolated all skin cells from whole embryos Transgenic embryos without xxx treatment Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit. Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle. strain:AB+TU|developmental stage:52 hpf|tissue:FACS all skin|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed GSM3855897 GSM3855897: 52 hpf all skin replicate B; Danio rerio; RNA Seq GSM3855897   1 Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit. GEO Accession:GSM3855897 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP200656     ZFishSkin_Reads_c08_52hpf-allSkin-_repB_i03.TTAGGCA.pf1_XB039L2.fastq.gz fastq 1519404450.0 30388089.0 GSM3855897 r1 0:50 A:387412457;C:374238433;G:369512809;T:388217220;N:23531 50       387412457 374238433 369512809 388217220 23531 SRX5982380 SRS4887885 SRA894819 GEO UCLA 1 0.93866   0.05037   0.76437   0.37263   50   B   usable mapping rate illumina hiseq_era unknown poly_a trueseq bulk unknown unknown   United States 2019-06-06 Hatching Embryo Skin Surface Structure
52814 52814 SRR9211488 SRX5982379 SRS4887884 SRP200656 PRJNA547573 Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos GSE132304 Transcriptome Analysis We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.   pubmed:31431477   52 hpf all skin replicate A GSM3855896   source name:FACS isolated all skin cells from whole embryos|strain:AB+TU|developmental stage:52 hpf|tissue:FACS all skin|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed 52 hpf all skin replicate A Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication. FACS isolated all skin cells from whole embryos Transgenic embryos without xxx treatment Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit. Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle. strain:AB+TU|developmental stage:52 hpf|tissue:FACS all skin|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed GSM3855896 GSM3855896: 52 hpf all skin replicate A; Danio rerio; RNA Seq GSM3855896   1 Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit. GEO Accession:GSM3855896 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP200656     ZFishSkin_Reads_c07_52hpf-allSkin-_repA_i05.ACAGTGA.pf1_XA025L6plusXB039L2.fastq.gz fastq 1419182550.0 28383651.0 GSM3855896 r1 0:50 A:352916142;C:345678567;G:351315754;T:364989027;N:4283060 50       352916142 345678567 351315754 364989027 4283060 SRX5982379 SRS4887884 SRA894819 GEO UCLA 1 0.92139   0.06056   0.76763   0.39214   50   B   usable mapping rate illumina hiseq_era unknown poly_a trueseq bulk unknown unknown   United States 2019-06-06 Hatching Embryo Skin Surface Structure
52815 52815 SRR9211487 SRX5982378 SRS4887883 SRP200656 PRJNA547573 Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos GSE132304 Transcriptome Analysis We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.   pubmed:31431477   52 hpf nonskin1 replicate B GSM3855895   source name:FACS isolated nonskin cells from whole embryos|strain:AB+TU|developmental stage:52 hpf|tissue:FACS nonskin1|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed 52 hpf nonskin1 replicate B Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication. FACS isolated nonskin cells from whole embryos Transgenic embryos without xxx treatment Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit. Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle. strain:AB+TU|developmental stage:52 hpf|tissue:FACS nonskin1|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed GSM3855895 GSM3855895: 52 hpf nonskin1 replicate B; Danio rerio; RNA Seq GSM3855895   1 Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit. GEO Accession:GSM3855895 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP200656     ZFishSkin_Reads_c06_52hpf-nonskin1_repB_i01.ATCACGA.pf1_XB039L2.fastq.gz fastq 2006001000.0 40120020.0 GSM3855895 r1 0:50 A:519738512;C:486660134;G:481964980;T:517604839;N:32535 50       519738512 486660134 481964980 517604839 32535 SRX5982378 SRS4887883 SRA894819 GEO UCLA 1 0.9459   0.07046   0.68389   0.48047   50   B   usable mapping rate illumina hiseq_era unknown poly_a trueseq bulk unknown unknown   United States 2019-06-06 Hatching Embryo Skin Surface Structure
52816 52816 SRR9211486 SRX5982377 SRS4887882 SRP200656 PRJNA547573 Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos GSE132304 Transcriptome Analysis We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.   pubmed:31431477   52 hpf nonskin1 replicate A GSM3855894   source name:FACS isolated nonskin cells from whole embryos|strain:AB+TU|developmental stage:52 hpf|tissue:FACS nonskin1|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed 52 hpf nonskin1 replicate A Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication. FACS isolated nonskin cells from whole embryos Transgenic embryos without xxx treatment Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit. Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle. strain:AB+TU|developmental stage:52 hpf|tissue:FACS nonskin1|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed GSM3855894 GSM3855894: 52 hpf nonskin1 replicate A; Danio rerio; RNA Seq GSM3855894   1 Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit. GEO Accession:GSM3855894 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP200656     ZFishSkin_Reads_c05_52hpf-nonskin1_repA_i06.GCCAATA.pf1_XA025L6plusXB039L2.fastq.gz fastq 1349409700.0 26988194.0 GSM3855894 r1 0:50 A:342685736;C:323811588;G:328073629;T:350810627;N:4028120 50       342685736 323811588 328073629 350810627 4028120 SRX5982377 SRS4887882 SRA894819 GEO UCLA 1 0.92593   0.09166   0.70532   0.47167   50   B   usable mapping rate illumina hiseq_era unknown poly_a trueseq bulk unknown unknown   United States 2019-06-06 Hatching Embryo Skin Surface Structure
53011 53011 SRR9662028 SRX6422904 SRS5079694 SRP213938 PRJNA553572 A map of cis regulatory elements and 3D genome structures in zebrafish GSE134055 Other The zebrafish has been widely used for the study of human disease and development as 70% of the protein coding genes are conserved between the two species. Annotation of functional control elements of the zebrafish genome however has lagged behind that of other model systems such as mouse and Drosophila. Based on multi omics approaches taken in the ENCODE and Roadmap Epigenomics projects we performed RNA seq ATAC seq ChIP seq and Hi C experiments in ten adult and two embryonic tissues to generate a comprehensive map of transcriptomes and regulatory elements in the zebrafish Tuebingen reference strain. Overall we have identified 235 596 cis regulatory elements which potentially shape the tissue specific and developmental stage specific gene expression in zebrafish. A comparison of zebrafish human and mouse regulatory elements allowed us to identify both evolutionarily conserved and species specific regulatory sequences. Furthermore through the analysis of Hi C data in zebrafish brain and muscle we observed different levels of 3D genome organization including compartment topological associating domains TADs and chromatin loops in zebrafish. A subset of TADs are deeply conserved between zebrafish and human. This work provides an additional epigenomic anchor for the functional annotation of vertebrate genomes and the study of evolutionally conserved elements of 3D genome organization. Overall design: 13 tissues from adult and embryonic stage were examined using ChIP Seq H3K27ac and H3K4me3 RNA Seq 11 of them were examined using ATAC seq WGBS and ChIP seq H3K9me3 and H3K9me2 and one scATAC seq in brain. Additionally we performed HiC experiments in adult muscle and brain. Please note that for the samples GSM4661977 GSM4662088 [1] each processed data generated from both replicates is linked to the corresponding *rep1 sample records [2] the input sample used for each ChIP sample is indicated in the description field in the corresponding input sample records.   pubmed:33239788;pubmed:35649578   YueLab RNA Seq Skin rep2 GSM3934896   source name:Tissue|strain:Tuebingen|tissue:Skin YueLab RNA Seq Skin rep2 RNA seq reads were aligned to zv10 genome assembly using STAR; ChIP seq and ATAC seq reads were aligned to zv10 genome assembly using BWA HiC reads were aligned to zv10 genome assembly using Bowtie2 The TPM value of gene expression was caculated using RSEM ChIP seq and ATAC seq peaks were called using MACS2 with the following setting: ChIP seq q value <10e 2 p value<10e 5 Change>1 FC>2. ATAC seq: q value<10e 2 and p value<10e 5 HiC matrix was generated using HiC Pro Genome build: zv10 Supplementary files format and content: tab delimited text files include TPM values for each Sample; the narrowPeak files included the peaks for each Sample; The .hic file were the matrix of Hi C for each Sample.**All replicates were merged Tissue   For each RNA seq experiment the same tissues combined from at least two Tuebingen fish were used as one replicate. For embryonic trunk ten 1 dpf fish were dechorionated with pronase and trunk were cut off for RNA seq. For embryonic neuron green cells from TgHuc:Kaede cells were sorted by FACS and approxinately 20 000 cells were used for one replicate. The tissue RNA was extracted from Trizol® according to the protocol Invitrogen. The cDNA libraries were performed using SureSelect Strand Specific RNA Library Preparation Kit Agilent according to the manufacturer’s protocol. Briefly polyA RNA was purified from 1000 ng of total RNA using oligo dT beads Invitrogen. Extracted RNA was first fragmented then followed by reverse transcription end repair adenylation adaptor ligation and subsequent PCR amplification. The final product was checked by size distribution and concentration using BioAnalyzer High Sensitivity DNA Kit Agilent and Kapa Library Quantification Kit Kapa Biosystems and then followed by pair end 2X 50 bp high throughput sequencing using HiSeq 2500 Illumina. Embryonic and ault Tuebingen zebrafish were raised under standard laboratory conditions strain:Tuebingen|tissue:Skin GSM3934896 GSM3934896: YueLab RNA Seq Skin rep2; Danio rerio; RNA Seq GSM3934896   1 For each RNA seq experiment the same tissues combined from at least two Tuebingen fish were used as one replicate. For embryonic trunk ten 1 dpf fish were dechorionated with pronase and trunk were cut off for RNA seq. For embryonic neuron green cells from TgHuc:Kaede cells were sorted by FACS and approxinately 20 000 cells were used for one replicate. The tissue RNA was extracted from Trizol® according to the protocol Invitrogen. The cDNA libraries were performed using SureSelect Strand Specific RNA Library Preparation Kit Agilent according to the manufacturer's protocol. Briefly polyA RNA was purified from 1000 ng of total RNA using oligo dT beads Invitrogen. Extracted RNA was first fragmented then followed by reverse transcription end repair adenylation adaptor ligation and subsequent PCR amplification. The final product was checked by size distribution and concentration using BioAnalyzer High Sensitivity DNA Kit Agilent and Kapa Library Quantification Kit Kapa Biosystems and then followed by pair end 2X 50 bp high throughput sequencing using HiSeq 2500 Illumina. GEO Accession:GSM3934896 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina Genome Analyzer   SRP213938     YueLab-RNA-Seq-Skin-rep2_1.fastq.gz YueLab-RNA-Seq-Skin-rep2_2.fastq.gz fastq fastq 3369540489.0 27929926.0 GSM3934896 r1 0:60.47 1:60.17 A:881257889;C:784720097;G:773160075;T:930047288;N:355140 60 60     881257889 784720097 773160075 930047288 355140 SRX6422904 SRS5079694 SRA919194 GEO Feng Yue, Department of Biochemistry and Molecular Genetics, Northwestern University Feinberg School of Medicine 2 0.96098 0.96359 0.1219 0.11985 0.69962 0.70161 0.48503 0.4877 61 60 B B biological fallback assumption illumina early_illumina unknown poly_a unknown bulk unknown unknown   United States 2019-07-09 Pharyngula Embryo Skin Surface Structure
53012 53012 SRR9662027 SRX6422903 SRS5079693 SRP213938 PRJNA553572 A map of cis regulatory elements and 3D genome structures in zebrafish GSE134055 Other The zebrafish has been widely used for the study of human disease and development as 70% of the protein coding genes are conserved between the two species. Annotation of functional control elements of the zebrafish genome however has lagged behind that of other model systems such as mouse and Drosophila. Based on multi omics approaches taken in the ENCODE and Roadmap Epigenomics projects we performed RNA seq ATAC seq ChIP seq and Hi C experiments in ten adult and two embryonic tissues to generate a comprehensive map of transcriptomes and regulatory elements in the zebrafish Tuebingen reference strain. Overall we have identified 235 596 cis regulatory elements which potentially shape the tissue specific and developmental stage specific gene expression in zebrafish. A comparison of zebrafish human and mouse regulatory elements allowed us to identify both evolutionarily conserved and species specific regulatory sequences. Furthermore through the analysis of Hi C data in zebrafish brain and muscle we observed different levels of 3D genome organization including compartment topological associating domains TADs and chromatin loops in zebrafish. A subset of TADs are deeply conserved between zebrafish and human. This work provides an additional epigenomic anchor for the functional annotation of vertebrate genomes and the study of evolutionally conserved elements of 3D genome organization. Overall design: 13 tissues from adult and embryonic stage were examined using ChIP Seq H3K27ac and H3K4me3 RNA Seq 11 of them were examined using ATAC seq WGBS and ChIP seq H3K9me3 and H3K9me2 and one scATAC seq in brain. Additionally we performed HiC experiments in adult muscle and brain. Please note that for the samples GSM4661977 GSM4662088 [1] each processed data generated from both replicates is linked to the corresponding *rep1 sample records [2] the input sample used for each ChIP sample is indicated in the description field in the corresponding input sample records.   pubmed:33239788;pubmed:35649578   YueLab RNA Seq Skin rep1 GSM3934895   source name:Tissue|strain:Tuebingen|tissue:Skin YueLab RNA Seq Skin rep1 RNA seq reads were aligned to zv10 genome assembly using STAR; ChIP seq and ATAC seq reads were aligned to zv10 genome assembly using BWA HiC reads were aligned to zv10 genome assembly using Bowtie2 The TPM value of gene expression was caculated using RSEM ChIP seq and ATAC seq peaks were called using MACS2 with the following setting: ChIP seq q value <10e 2 p value<10e 5 Change>1 FC>2. ATAC seq: q value<10e 2 and p value<10e 5 HiC matrix was generated using HiC Pro Genome build: zv10 Supplementary files format and content: tab delimited text files include TPM values for each Sample; the narrowPeak files included the peaks for each Sample; The .hic file were the matrix of Hi C for each Sample.**All replicates were merged Tissue   For each RNA seq experiment the same tissues combined from at least two Tuebingen fish were used as one replicate. For embryonic trunk ten 1 dpf fish were dechorionated with pronase and trunk were cut off for RNA seq. For embryonic neuron green cells from TgHuc:Kaede cells were sorted by FACS and approxinately 20 000 cells were used for one replicate. The tissue RNA was extracted from Trizol® according to the protocol Invitrogen. The cDNA libraries were performed using SureSelect Strand Specific RNA Library Preparation Kit Agilent according to the manufacturer’s protocol. Briefly polyA RNA was purified from 1000 ng of total RNA using oligo dT beads Invitrogen. Extracted RNA was first fragmented then followed by reverse transcription end repair adenylation adaptor ligation and subsequent PCR amplification. The final product was checked by size distribution and concentration using BioAnalyzer High Sensitivity DNA Kit Agilent and Kapa Library Quantification Kit Kapa Biosystems and then followed by pair end 2X 50 bp high throughput sequencing using HiSeq 2500 Illumina. Embryonic and ault Tuebingen zebrafish were raised under standard laboratory conditions strain:Tuebingen|tissue:Skin GSM3934895 GSM3934895: YueLab RNA Seq Skin rep1; Danio rerio; RNA Seq GSM3934895   1 For each RNA seq experiment the same tissues combined from at least two Tuebingen fish were used as one replicate. For embryonic trunk ten 1 dpf fish were dechorionated with pronase and trunk were cut off for RNA seq. For embryonic neuron green cells from TgHuc:Kaede cells were sorted by FACS and approxinately 20 000 cells were used for one replicate. The tissue RNA was extracted from Trizol® according to the protocol Invitrogen. The cDNA libraries were performed using SureSelect Strand Specific RNA Library Preparation Kit Agilent according to the manufacturer's protocol. Briefly polyA RNA was purified from 1000 ng of total RNA using oligo dT beads Invitrogen. Extracted RNA was first fragmented then followed by reverse transcription end repair adenylation adaptor ligation and subsequent PCR amplification. The final product was checked by size distribution and concentration using BioAnalyzer High Sensitivity DNA Kit Agilent and Kapa Library Quantification Kit Kapa Biosystems and then followed by pair end 2X 50 bp high throughput sequencing using HiSeq 2500 Illumina. GEO Accession:GSM3934895 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina Genome Analyzer   SRP213938     YueLab-RNA-Seq-Skin-rep1_1.fastq.gz YueLab-RNA-Seq-Skin-rep1_2.fastq.gz fastq fastq 2565035707.0 21260839.0 GSM3934895 r1 0:60.48 1:60.17 A:670789880;C:599392091;G:585931498;T:708654706;N:267532 60 60     670789880 599392091 585931498 708654706 267532 SRX6422903 SRS5079693 SRA919194 GEO Feng Yue, Department of Biochemistry and Molecular Genetics, Northwestern University Feinberg School of Medicine 2 0.96148 0.96283 0.12215 0.11903 0.70015 0.70114 0.47321 0.47375 60 60 B B biological fallback assumption illumina early_illumina unknown poly_a unknown bulk unknown unknown   United States 2019-07-09 Pharyngula Embryo Skin Surface Structure
71777 71777 SRR22094621 SRX18074628 SRS15579663 SRP405171 PRJNA893397 RNA sequencing of the zebrafish superficial epithelial cells PRJNA893397 Other We discovered that the superficial epithelial cells SECs of zebrafish larvae could adapt a unique kind of cell division during rapid growth conditions. We termed it "asynthetic fission". We determined that asynthetic fission occurs in the absence of DNA replication generating progeny cells with reduced genome size. Here we aim to define the transcriptional landscape of the SECs during asynthetic fission by applying RNA sequencing.     replicate SEC 2dpf r SEC 2dpf r   strain:EK|age:2dpf|dev stage:2dpf|sex:NA|tissue:skin superficial epithelial cell|BioSampleModel:Model organism or animal                 RNA sequencing of zebrafish:superficial epithelial cells 2dpf replicate LTS21 YW01 LTS21 YW01 100 150 larvae at 2 dpf 6 dpf 14 dpf and 21 dpf were first rinsed with 1x DPBS Gibco 14190 144 then digested with collagenase Sigma C9891 and 0.25% trypsin EDTA Sigma T4049. Digestion was stopped with DMEM Gibco 11995 065 with 10% NCS and rinsed with 1 x DPBS. Then cells were suspended in DMEM 10% NCS and filtered with a 35 m cell strainer tube. Dissociated cells were stained with PI 1 g/ml for 106 cells per mL for 5 min in the dark. All EGFP+ and PI cells were sorted by FACSAria IIIu BD Biosciences. Cells were directly sorted in buffer RLT supplemented with 1% mercapto ethanol provided in RNeasy Micro kit Qiagen and stored in 80 C until RNA extraction was performed. Total 2 replicates for each timepoint were collected. RNA extraction was carried out using RNeasy Micro kit according to manufacturers instructions. Sequencing was performed by the NGS High Throughput Genomics Core in Biodiversity Research Center Academia Sinica Taiwan using Illumina NextSeq2000 with paired end 2 x 150 bp chemistry and a library selection of low input stranded RNA library preparation Poly A.     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA NextSeq 2000   SRP405171     LTS21_YW01_S3_L001_R1_001.fastq.gz LTS21_YW01_S3_L001_R2_001.fastq.gz fastq fastq 19999530824.0 66223612.0 LTS21 YW01 S3 L001 R1 001.fastq.gz 0:151 1:151 A:5239226851;C:4832853944;G:4579224440;T:5331222900;N:17002689 151 151     5239226851 4832853944 4579224440 5331222900 17002689 SRX18074628 SRS15579663 SRA1530145 Academia Sinica|Institute of Cellular and Organismic Biology Academia Sinica 2 0.77399 0.76874 0.04763 0.04655 0.75035 0.75087 0.423 0.42383 151 151 B B biological fallback assumption illumina nextseq_v2 unknown poly_a unknown bulk unknown unknown   Taiwan 2022-10-29 Hatching Embryo Skin Surface Structure
71778 71778 SRR22094622 SRX18074627 SRS15579662 SRP405171 PRJNA893397 RNA sequencing of the zebrafish superficial epithelial cells PRJNA893397 Other We discovered that the superficial epithelial cells SECs of zebrafish larvae could adapt a unique kind of cell division during rapid growth conditions. We termed it "asynthetic fission". We determined that asynthetic fission occurs in the absence of DNA replication generating progeny cells with reduced genome size. Here we aim to define the transcriptional landscape of the SECs during asynthetic fission by applying RNA sequencing.       SEC 2dpf Zebrafish SEC 2dpf   strain:EK|age:2dpf|dev stage:2dpf|sex:NA|tissue:Skin|BioSampleModel:Model organism or animal                 RNA sequencing of zebrafish:superficial epithelial cells 2dpf LTS21 YG01 LTS21 YG01 100 150 larvae at 2 dpf 6 dpf 14 dpf and 21 dpf were first rinsed with 1x DPBS Gibco 14190 144 then digested with collagenase Sigma C9891 and 0.25% trypsin EDTA Sigma T4049. Digestion was stopped with DMEM Gibco 11995 065 with 10% NCS and rinsed with 1 x DPBS. Then cells were suspended in DMEM 10% NCS and filtered with a 35 m cell strainer tube. Dissociated cells were stained with PI 1 g/ml for 106 cells per mL for 5 min in the dark. All EGFP+ and PI cells were sorted by FACSAria IIIu BD Biosciences. Cells were directly sorted in buffer RLT supplemented with 1% mercapto ethanol provided in RNeasy Micro kit Qiagen and stored in 80 C until RNA extraction was performed. Total 2 replicates for each timepoint were collected. RNA extraction was carried out using RNeasy Micro kit according to manufacturers instructions. Sequencing was performed by the NGS High Throughput Genomics Core in Biodiversity Research Center Academia Sinica Taiwan using Illumina NextSeq2000 with paired end 2 x 150 bp chemistry and a library selection of low input stranded RNA library preparation Poly A.     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA NextSeq 2000   SRP405171     LTS21_YG01_S1_L001_R1_001.fastq.gz LTS21_YG01_S1_L001_R2_001.fastq.gz fastq fastq 18171646530.0 60171015.0 LTS21 YG01 S1 L001 R1 001.fastq.gz 0:151 1:151 A:4727063040;C:4426085600;G:4200458773;T:4802148545;N:15890572 151 151     4727063040 4426085600 4200458773 4802148545 15890572 SRX18074627 SRS15579662 SRA1530145 Academia Sinica|Institute of Cellular and Organismic Biology Academia Sinica 2 0.76303 0.75602 0.03268 0.03163 0.78427 0.78484 0.3601 0.35972 151 151 B B biological fallback assumption illumina nextseq_v2 unknown poly_a unknown bulk unknown unknown   Taiwan 2022-10-29 Hatching Embryo Skin Surface Structure

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;