metadata: run_metadata: 3,835 rows where devstage_curation_coarse = "Embryo" and technology = "smartseq"

3,835 rows where devstage_curation_coarse = "Embryo" and technology = "smartseq"

descending

Link	rowid ▼	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.description	sample.title	sample.alias	sample.centername	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.study_ref	run.title	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.mapping_rate.mate2	seqdetective.nofeature_rate.mate1	seqdetective.nofeature_rate.mate2	seqdetective.sparsity.mate1	seqdetective.sparsity.mate2	seqdetective.pos_strand_rate.mate1	seqdetective.pos_strand_rate.mate2	seqdetective.readlen.mate1	seqdetective.readlen.mate2	seqdetective.judgement.mate1	seqdetective.judgement.mate2	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
9775	9775	ERR3838754	ERX3851420	ERS4266444	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Soma prim5 wt rep2	SAMEA6501995	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:01Z\|External Id:SAMEA6501995\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:01Z\|INSDC status:public\|Submitter Id:E MTAB 8707:Soma prim5 wt rep2\|age:24\|broker name:ArrayExpress\|cell type:whole embryo\|common name:zebrafish\|developmental stage:pharyngula prim 5\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:Soma prim5 wt rep2\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:Soma prim5 wt rep2 p	Soma prim5 wt rep2 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:pharyngula prim 5\|Experimental Factor: compound:n1\|Experimental Factor: cell type:whole embryo	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	Somatic_prim5_rep2_R1.fastq.gz Somatic_prim5_rep2_R2.fastq.gz	fastq fastq	2664555542.0	17942996.0	E MTAB 8707:Somatic prim5 rep2 R	0:74.25 1:74.25	A:757990974;C:568005838;G:586848520;T:749991976;N:1718234	74	74	757990974	568005838	586848520	749991976	1718234	ERX3851420	ERS4266444	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.92034	0.91779	0.22669	0.22761	0.74769	0.74911	0.45866	0.45282	76	76	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Pharyngula	Embryo	Whole Organism	All anatomical structures
9776	9776	ERR3838753	ERX3851419	ERS4266443	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Soma prim5 wt rep1	SAMEA6501994	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:01Z\|External Id:SAMEA6501994\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:01Z\|INSDC status:public\|Submitter Id:E MTAB 8707:Soma prim5 wt rep1\|age:24\|broker name:ArrayExpress\|cell type:whole embryo\|common name:zebrafish\|developmental stage:pharyngula prim 5\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:Soma prim5 wt rep1\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:Soma prim5 wt rep1 p	Soma prim5 wt rep1 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:pharyngula prim 5\|Experimental Factor: compound:n1\|Experimental Factor: cell type:whole embryo	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	Somatic_prim5_rep1_R1.fastq.gz Somatic_prim5_rep1_R2.fastq.gz	fastq fastq	1847156504.0	12386853.0	E MTAB 8707:Somatic prim5 rep1 R	0:74.56 1:74.56	A:519724449;C:399975516;G:411702918;T:514818493;N:935128	74	74	519724449	399975516	411702918	514818493	935128	ERX3851419	ERS4266443	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.93526	0.93319	0.24244	0.24304	0.75073	0.75201	0.44773	0.44885	76	75	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Pharyngula	Embryo	Whole Organism	All anatomical structures
9777	9777	ERR3838752	ERX3851418	ERS4266442	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Soma prim5 Morpholino rep2	SAMEA6501993	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:01Z\|External Id:SAMEA6501993\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:01Z\|INSDC status:public\|Submitter Id:E MTAB 8707:Soma prim5 Morpholino rep2\|age:24\|broker name:ArrayExpress\|cell type:whole embryo\|common name:zebrafish\|developmental stage:pharyngula prim 5\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:Soma prim5 Morpholino rep2\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:Soma prim5 Morpholino rep2 p	Soma prim5 Morpholino rep2 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:pharyngula prim 5\|Experimental Factor: compound:Morpholino antisense oligo against Tdrd7 transcript\|Experimental Factor: dose:0.3\|Experimental Factor: cell type:whole embryo	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	S14_R1.fastq.gz S14_R2.fastq.gz	fastq fastq	953947657.0	6389852.0	E MTAB 8707:S14 R	0:74.64 1:74.65	A:271485260;C:204208876;G:210319402;T:267490986;N:443133	74	74	271485260	204208876	210319402	267490986	443133	ERX3851418	ERS4266442	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.93577	0.93619	0.1141	0.11516	0.72644	0.72892	0.4694	0.46965	75	76	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Pharyngula	Embryo	Whole Organism	All anatomical structures
9778	9778	ERR3838751	ERX3851417	ERS4266441	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Soma prim5 Morpholino rep1	SAMEA6501992	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:01Z\|External Id:SAMEA6501992\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:01Z\|INSDC status:public\|Submitter Id:E MTAB 8707:Soma prim5 Morpholino rep1\|age:24\|broker name:ArrayExpress\|cell type:whole embryo\|common name:zebrafish\|developmental stage:pharyngula prim 5\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:Soma prim5 Morpholino rep1\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:Soma prim5 Morpholino rep1 p	Soma prim5 Morpholino rep1 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:pharyngula prim 5\|Experimental Factor: compound:Morpholino antisense oligo against Tdrd7 transcript\|Experimental Factor: dose:0.3\|Experimental Factor: cell type:whole embryo	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	S12_R1.fastq.gz S12_R2.fastq.gz	fastq fastq	753719404.0	5057589.0	E MTAB 8707:S12 R	0:74.51 1:74.52	A:216097326;C:160004832;G:164724356;T:212507268;N:385622	74	74	216097326	160004832	164724356	212507268	385622	ERX3851417	ERS4266441	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.93958	0.93943	0.10854	0.1092	0.73267	0.73663	0.45629	0.47862	76	76	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Pharyngula	Embryo	Whole Organism	All anatomical structures
9779	9779	ERR3838750	ERX3851416	ERS4266440	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Soma prim5 5mismatch Morpholino rep2	SAMEA6501991	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:01Z\|External Id:SAMEA6501991\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:01Z\|INSDC status:public\|Submitter Id:E MTAB 8707:Soma prim5 5mismatch Morpholino rep2\|age:24\|broker name:ArrayExpress\|cell type:whole embryo\|common name:zebrafish\|developmental stage:pharyngula prim 5\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:Soma prim5 5mismatch Morpholino rep2\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:Soma prim5 5mismatch Morpholino rep2 p	Soma prim5 5mismatch Morpholino rep2 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:pharyngula prim 5\|Experimental Factor: compound:Control morpholino antisense oligo with 5 mismatches\|Experimental Factor: dose:0.3\|Experimental Factor: cell type:whole embryo	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	S18_R1.fastq.gz S18_R2.fastq.gz	fastq fastq	847966718.0	5668126.0	E MTAB 8707:S18 R	0:74.80 1:74.80	A:230723434;C:191446710;G:197114792;T:228326953;N:354829	74	74	230723434	191446710	197114792	228326953	354829	ERX3851416	ERS4266440	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.92436	0.92488	0.08973	0.09012	0.73971	0.74192	0.45291	0.45397	76	73	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Pharyngula	Embryo	Whole Organism	All anatomical structures
9780	9780	ERR3838749	ERX3851415	ERS4266439	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Soma prim5 5mismatch Morpholino rep1	SAMEA6501990	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:01Z\|External Id:SAMEA6501990\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:01Z\|INSDC status:public\|Submitter Id:E MTAB 8707:Soma prim5 5mismatch Morpholino rep1\|age:24\|broker name:ArrayExpress\|cell type:whole embryo\|common name:zebrafish\|developmental stage:pharyngula prim 5\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:Soma prim5 5mismatch Morpholino rep1\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:Soma prim5 5mismatch Morpholino rep1 p	Soma prim5 5mismatch Morpholino rep1 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:pharyngula prim 5\|Experimental Factor: compound:Control morpholino antisense oligo with 5 mismatches\|Experimental Factor: dose:0.3\|Experimental Factor: cell type:whole embryo	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	S16_R1.fastq.gz S16_R2.fastq.gz	fastq fastq	444518989.0	2971315.0	E MTAB 8707:S16 R	0:74.80 1:74.80	A:121398448;C:100282796;G:103112415;T:119559792;N:165538	74	74	121398448	100282796	103112415	119559792	165538	ERX3851415	ERS4266439	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.92469	0.92438	0.09917	0.10006	0.72279	0.7251	0.45852	0.46016	73	76	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Pharyngula	Embryo	Whole Organism	All anatomical structures
9781	9781	ERR3838748	ERX3851414	ERS4266438	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Soma High rep2	SAMEA6501989	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:01Z\|External Id:SAMEA6501989\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:01Z\|INSDC status:public\|Submitter Id:E MTAB 8707:Soma High rep2\|age:3.3\|broker name:ArrayExpress\|cell type:whole embryo\|common name:zebrafish\|developmental stage:blastula high\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:Soma High rep2\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:Soma High rep2 p	Soma High rep2 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:blastula high\|Experimental Factor: compound:n1\|Experimental Factor: cell type:whole embryo	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	Fabio_High_rep2_soma_R1.fastq.gz Fabio_High_rep2_soma_R2.fastq.gz	fastq fastq	2072343523.0	13904136.0	E MTAB 8707:Fabio High rep2 soma R	0:74.52 1:74.53	A:596021076;C:439789413;G:451992691;T:583604290;N:936053	74	74	596021076	439789413	451992691	583604290	936053	ERX3851414	ERS4266438	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.94263	0.94098	0.04804	0.04844	0.75797	0.76039	0.50847	0.5014	75	76	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Blastula	Embryo	Whole Organism	All anatomical structures
9782	9782	ERR3838747	ERX3851413	ERS4266437	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Soma High rep1	SAMEA6501988	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:01Z\|External Id:SAMEA6501988\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:01Z\|INSDC status:public\|Submitter Id:E MTAB 8707:Soma High rep1\|age:3.3\|broker name:ArrayExpress\|cell type:whole embryo\|common name:zebrafish\|developmental stage:blastula high\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:Soma High rep1\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:Soma High rep1 p	Soma High rep1 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:blastula high\|Experimental Factor: compound:n1\|Experimental Factor: cell type:whole embryo	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	Somatic_High_rep1_R1.fastq.gz Somatic_High_rep1_R2.fastq.gz	fastq fastq	6013555644.0	40662218.0	E MTAB 8707:Somatic High rep1 R	0:73.94 1:73.95	A:1821348300;C:1185534582;G:1227848010;T:1774836657;N:3988095	73	73	1821348300	1185534582	1227848010	1774836657	3988095	ERX3851413	ERS4266437	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.93539	0.9357	0.07066	0.07028	0.76197	0.76386	0.54301	0.54343	76	75	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Blastula	Embryo	Whole Organism	All anatomical structures
9783	9783	ERR3838746	ERX3851412	ERS4266436	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Soma dome rep2	SAMEA6501987	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:00Z\|External Id:SAMEA6501987\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:00Z\|INSDC status:public\|Submitter Id:E MTAB 8707:Soma dome rep2\|age:4.3\|broker name:ArrayExpress\|cell type:whole embryo\|common name:zebrafish\|developmental stage:blastula dome\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:Soma dome rep2\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:Soma dome rep2 p	Soma dome rep2 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:blastula dome\|Experimental Factor: compound:n1\|Experimental Factor: cell type:whole embryo	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	S10_R1.fastq.gz S10_R2.fastq.gz	fastq fastq	1086124503.0	7272505.0	E MTAB 8707:S10 R	0:74.67 1:74.68	A:305920447;C:235855931;G:243442186;T:300439294;N:466645	74	74	305920447	235855931	243442186	300439294	466645	ERX3851412	ERS4266436	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.94089	0.94085	0.04872	0.04916	0.7419	0.74355	0.51209	0.5119	74	76	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Blastula	Embryo	Whole Organism	All anatomical structures
9784	9784	ERR3838745	ERX3851411	ERS4266435	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Soma dome rep1	SAMEA6501986	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:00Z\|External Id:SAMEA6501986\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:00Z\|INSDC status:public\|Submitter Id:E MTAB 8707:Soma dome rep1\|age:4.3\|broker name:ArrayExpress\|cell type:whole embryo\|common name:zebrafish\|developmental stage:blastula dome\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:Soma dome rep1\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:Soma dome rep1 p	Soma dome rep1 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:blastula dome\|Experimental Factor: compound:n1\|Experimental Factor: cell type:whole embryo	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	S8_R1.fastq.gz S8_R2.fastq.gz	fastq fastq	336100162.0	2240589.0	E MTAB 8707:S8 R	0:75.00 1:75.00	A:93960580;C:73499585;G:75981355;T:92580945;N:77697	75	75	93960580	73499585	75981355	92580945	77697	ERX3851411	ERS4266435	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.93874	0.93856	0.05265	0.0517	0.74188	0.74381	0.51181	0.51086	75	75	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Blastula	Embryo	Whole Organism	All anatomical structures
9785	9785	ERR3838744	ERX3851410	ERS4266434	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Soma 256 cell rep2	SAMEA6501985	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:00Z\|External Id:SAMEA6501985\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:00Z\|INSDC status:public\|Submitter Id:E MTAB 8707:Soma 256 cell rep2\|age:2.5\|broker name:ArrayExpress\|cell type:whole embryo\|common name:zebrafish\|developmental stage:blastula 256 cell\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:Soma 256 cell rep2\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:Soma 256 cell rep2 p	Soma 256 cell rep2 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:blastula 256 cell\|Experimental Factor: compound:n1\|Experimental Factor: cell type:whole embryo	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	S2_R1.fastq.gz S2_R2.fastq.gz	fastq fastq	1272080863.0	8551103.0	E MTAB 8707:S2 R	0:74.38 1:74.38	A:364033393;C:268850689;G:276270908;T:362172455;N:753418	74	74	364033393	268850689	276270908	362172455	753418	ERX3851410	ERS4266434	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.80562	0.80436	0.23702	0.23786	0.77914	0.77991	0.51225	0.5092	76	76	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Blastula	Embryo	Whole Organism	All anatomical structures
9786	9786	ERR3838743	ERX3851409	ERS4266433	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Soma 256 cell rep1	SAMEA6501984	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:00Z\|External Id:SAMEA6501984\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:00Z\|INSDC status:public\|Submitter Id:E MTAB 8707:Soma 256 cell rep1\|age:2.5\|broker name:ArrayExpress\|cell type:whole embryo\|common name:zebrafish\|developmental stage:blastula 256 cell\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:Soma 256 cell rep1\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:Soma 256 cell rep1 p	Soma 256 cell rep1 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:blastula 256 cell\|Experimental Factor: compound:n1\|Experimental Factor: cell type:whole embryo	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	Somatic_256_rep1_R1.fastq.gz Somatic_256_rep1_R2.fastq.gz	fastq fastq	2254901578.0	15144857.0	E MTAB 8707:Somatic 256 rep1 R	0:74.44 1:74.45	A:648357135;C:475813294;G:492914743;T:636658631;N:1157775	74	74	648357135	475813294	492914743	636658631	1157775	ERX3851409	ERS4266433	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.92992	0.92787	0.07245	0.07214	0.7599	0.76084	0.53758	0.53839	74	76	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Blastula	Embryo	Whole Organism	All anatomical structures
9787	9787	ERR3838742	ERX3851408	ERS4266432	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Soma 10somites rep2	SAMEA6501983	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:00Z\|External Id:SAMEA6501983\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:00Z\|INSDC status:public\|Submitter Id:E MTAB 8707:Soma 10somites rep2\|age:14\|broker name:ArrayExpress\|cell type:whole embryo\|common name:zebrafish\|developmental stage:10 somites\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:Soma 10somites rep2\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:Soma 10somites rep2 p	Soma 10somites rep2 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:10 somites\|Experimental Factor: compound:n1\|Experimental Factor: cell type:whole embryo	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	S6_R1.fastq.gz S6_R2.fastq.gz	fastq fastq	1244080980.0	8338002.0	E MTAB 8707:S6 R	0:74.60 1:74.60	A:356418931;C:263292901;G:270630630;T:353140798;N:597720	74	74	356418931	263292901	270630630	353140798	597720	ERX3851408	ERS4266432	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.86791	0.86732	0.20223	0.20398	0.75588	0.75883	0.4862	0.48313	76	75	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Segmentation	Embryo	Whole Organism	All anatomical structures
9788	9788	ERR3838741	ERX3851407	ERS4266431	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Soma 10somites rep1	SAMEA6501982	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:00Z\|External Id:SAMEA6501982\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:00Z\|INSDC status:public\|Submitter Id:E MTAB 8707:Soma 10somites rep1\|age:14\|broker name:ArrayExpress\|cell type:whole embryo\|common name:zebrafish\|developmental stage:10 somites\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:Soma 10somites rep1\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:Soma 10somites rep1 p	Soma 10somites rep1 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:10 somites\|Experimental Factor: compound:n1\|Experimental Factor: cell type:whole embryo	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	S4_R1.fastq.gz S4_R2.fastq.gz	fastq fastq	946153328.0	6354843.0	E MTAB 8707:S4 R	0:74.44 1:74.45	A:268310887;C:203457903;G:208969410;T:264875129;N:539999	74	74	268310887	203457903	208969410	264875129	539999	ERX3851407	ERS4266431	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.92415	0.92372	0.12138	0.12268	0.74061	0.74422	0.47246	0.47448	76	76	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Segmentation	Embryo	Whole Organism	All anatomical structures
9789	9789	ERR3838740	ERX3851406	ERS4266430	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	PGC prim5 wt rep2	SAMEA6501981	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:00Z\|External Id:SAMEA6501981\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:00Z\|INSDC status:public\|Submitter Id:E MTAB 8707:PGC prim5 wt rep2\|age:24\|broker name:ArrayExpress\|cell type:primordial germ cell\|common name:zebrafish\|developmental stage:pharyngula prim 5\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:PGC prim5 wt rep2\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:PGC prim5 wt rep2 p	PGC prim5 wt rep2 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:pharyngula prim 5\|Experimental Factor: compound:n1\|Experimental Factor: cell type:primordial germ cell	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	PGC_prim5_rep2_R1.fastq.gz PGC_prim5_rep2_R2.fastq.gz	fastq fastq	2236371655.0	15023634.0	E MTAB 8707:PGC prim5 rep2 R	0:74.43 1:74.43	A:619039687;C:495191024;G:509021767;T:611885185;N:1233992	74	74	619039687	495191024	509021767	611885185	1233992	ERX3851406	ERS4266430	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.93137	0.92838	0.23991	0.24045	0.71435	0.71591	0.49054	0.49302	76	76	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Pharyngula	Embryo	Whole Organism	All anatomical structures
9790	9790	ERR3838739	ERX3851405	ERS4266429	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	PGC prim5 wt rep1	SAMEA6501980	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:00Z\|External Id:SAMEA6501980\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:00Z\|INSDC status:public\|Submitter Id:E MTAB 8707:PGC prim5 wt rep1\|age:24\|broker name:ArrayExpress\|cell type:primordial germ cell\|common name:zebrafish\|developmental stage:pharyngula prim 5\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:PGC prim5 wt rep1\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:PGC prim5 wt rep1 p	PGC prim5 wt rep1 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:pharyngula prim 5\|Experimental Factor: compound:n1\|Experimental Factor: cell type:primordial germ cell	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	PGC_prim5_rep1_R1.fastq.gz PGC_prim5_rep1_R2.fastq.gz	fastq fastq	1619398294.0	10873533.0	E MTAB 8707:PGC prim5 rep1 R	0:74.46 1:74.47	A:450612629;C:355178930;G:365650222;T:447083613;N:872900	74	74	450612629	355178930	365650222	447083613	872900	ERX3851405	ERS4266429	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.92755	0.92901	0.22893	0.22952	0.71131	0.71372	0.49829	0.50019	76	76	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Pharyngula	Embryo	Whole Organism	All anatomical structures
9791	9791	ERR3838738	ERX3851404	ERS4266428	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	PGC prim5 Morpholino rep2	SAMEA6501979	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:00Z\|External Id:SAMEA6501979\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:00Z\|INSDC status:public\|Submitter Id:E MTAB 8707:PGC prim5 Morpholino rep2\|age:24\|broker name:ArrayExpress\|cell type:primordial germ cell\|common name:zebrafish\|developmental stage:pharyngula prim 5\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:PGC prim5 Morpholino rep2\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:PGC prim5 Morpholino rep2 p	PGC prim5 Morpholino rep2 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:pharyngula prim 5\|Experimental Factor: compound:Morpholino antisense oligo against Tdrd7 transcript\|Experimental Factor: dose:0.3\|Experimental Factor: cell type:primordial germ cell	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	S13_R1.fastq.gz S13_R2.fastq.gz	fastq fastq	906443913.0	6069224.0	E MTAB 8707:S13 R	0:74.67 1:74.68	A:256935983;C:195137600;G:200975999;T:253026767;N:367564	74	74	256935983	195137600	200975999	253026767	367564	ERX3851404	ERS4266428	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.93468	0.93605	0.09793	0.09817	0.71163	0.71291	0.48766	0.48921	75	76	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Pharyngula	Embryo	Whole Organism	All anatomical structures
9792	9792	ERR3838737	ERX3851403	ERS4266427	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	PGC prim5 Morpholino rep1	SAMEA6501978	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:00Z\|External Id:SAMEA6501978\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:00Z\|INSDC status:public\|Submitter Id:E MTAB 8707:PGC prim5 Morpholino rep1\|age:24\|broker name:ArrayExpress\|cell type:primordial germ cell\|common name:zebrafish\|developmental stage:pharyngula prim 5\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:PGC prim5 Morpholino rep1\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:PGC prim5 Morpholino rep1 p	PGC prim5 Morpholino rep1 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:pharyngula prim 5\|Experimental Factor: compound:Morpholino antisense oligo against Tdrd7 transcript\|Experimental Factor: dose:0.3\|Experimental Factor: cell type:primordial germ cell	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	Fabio_cat_11_R1.fastq.gz Fabio_cat_11_R2.fastq.gz	fastq fastq	1078919524.0	7241200.0	E MTAB 8707:Fabio cat 11 R	0:74.50 1:74.50	A:308200726;C:229836659;G:236649504;T:303673221;N:559414	74	74	308200726	229836659	236649504	303673221	559414	ERX3851403	ERS4266427	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.93808	0.93753	0.10449	0.10446	0.70733	0.71017	0.48103	0.48247	75	76	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Pharyngula	Embryo	Whole Organism	All anatomical structures
9793	9793	ERR3838736	ERX3851402	ERS4266426	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	PGC prim5 5mismatch Morpholino rep2	SAMEA6501977	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:00Z\|External Id:SAMEA6501977\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:00Z\|INSDC status:public\|Submitter Id:E MTAB 8707:PGC prim5 5mismatch Morpholino rep2\|age:24\|broker name:ArrayExpress\|cell type:primordial germ cell\|common name:zebrafish\|developmental stage:pharyngula prim 5\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:PGC prim5 5mismatch Morpholino rep2\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:PGC prim5 5mismatch Morpholino rep2 p	PGC prim5 5mismatch Morpholino rep2 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:pharyngula prim 5\|Experimental Factor: compound:Control morpholino antisense oligo with 5 mismatches\|Experimental Factor: dose:0.3\|Experimental Factor: cell type:primordial germ cell	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	S17_R1.fastq.gz S17_R2.fastq.gz	fastq fastq	673911944.0	4501723.0	E MTAB 8707:S17 R	0:74.85 1:74.85	A:184466911;C:150779527;G:155693395;T:182720480;N:251631	74	74	184466911	150779527	155693395	182720480	251631	ERX3851402	ERS4266426	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.9199	0.92023	0.08791	0.08923	0.70132	0.70378	0.49183	0.49425	75	75	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Pharyngula	Embryo	Whole Organism	All anatomical structures
9794	9794	ERR3838735	ERX3851401	ERS4266425	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	PGC prim5 5mismatch Morpholino rep1	SAMEA6501976	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:00Z\|External Id:SAMEA6501976\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:00Z\|INSDC status:public\|Submitter Id:E MTAB 8707:PGC prim5 5mismatch Morpholino rep1\|age:24\|broker name:ArrayExpress\|cell type:primordial germ cell\|common name:zebrafish\|developmental stage:pharyngula prim 5\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:PGC prim5 5mismatch Morpholino rep1\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:PGC prim5 5mismatch Morpholino rep1 p	PGC prim5 5mismatch Morpholino rep1 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:pharyngula prim 5\|Experimental Factor: compound:Control morpholino antisense oligo with 5 mismatches\|Experimental Factor: dose:0.3\|Experimental Factor: cell type:primordial germ cell	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	S15_R1.fastq.gz S15_R2.fastq.gz	fastq fastq	565636692.0	3782000.0	E MTAB 8707:S15 R	0:74.78 1:74.78	A:157353454;C:124504476;G:128260137;T:155314004;N:204621	74	74	157353454	124504476	128260137	155314004	204621	ERX3851401	ERS4266425	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.91956	0.91996	0.08306	0.08458	0.69982	0.70203	0.48525	0.48771	76	76	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Pharyngula	Embryo	Whole Organism	All anatomical structures
9795	9795	ERR3838734	ERX3851400	ERS4266424	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	PGC High rep2	SAMEA6501975	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:00Z\|External Id:SAMEA6501975\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:00Z\|INSDC status:public\|Submitter Id:E MTAB 8707:PGC High rep2\|age:3.3\|broker name:ArrayExpress\|cell type:primordial germ cell\|common name:zebrafish\|developmental stage:blastula high\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:PGC High rep2\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:PGC High rep2 p	PGC High rep2 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:blastula high\|Experimental Factor: compound:n1\|Experimental Factor: cell type:primordial germ cell	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	PGC_High_rep2_R1.fastq.gz PGC_High_rep2_R2.fastq.gz	fastq fastq	2491013839.0	16740632.0	E MTAB 8707:PGC High rep2 R	0:74.40 1:74.40	A:715637079;C:527451931;G:545855323;T:700774175;N:1295331	74	74	715637079	527451931	545855323	700774175	1295331	ERX3851400	ERS4266424	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.93381	0.93556	0.06095	0.06172	0.76094	0.76364	0.52942	0.53118	74	76	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Blastula	Embryo	Whole Organism	All anatomical structures
9796	9796	ERR3838733	ERX3851399	ERS4266423	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	PGC High rep1	SAMEA6501974	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:00Z\|External Id:SAMEA6501974\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:00Z\|INSDC status:public\|Submitter Id:E MTAB 8707:PGC High rep1\|age:3.3\|broker name:ArrayExpress\|cell type:primordial germ cell\|common name:zebrafish\|developmental stage:blastula high\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:PGC High rep1\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:PGC High rep1 p	PGC High rep1 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:blastula high\|Experimental Factor: compound:n1\|Experimental Factor: cell type:primordial germ cell	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	PGC_High_rep1_R1.fastq.gz PGC_High_rep1_R2.fastq.gz	fastq fastq	2055218051.0	13801653.0	E MTAB 8707:PGC High rep1 R	0:74.45 1:74.46	A:594747301;C:431446277;G:445665283;T:582330624;N:1028566	74	74	594747301	431446277	445665283	582330624	1028566	ERX3851399	ERS4266423	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.93644	0.93494	0.06937	0.07015	0.76353	0.7653	0.45909	0.44979	76	76	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Blastula	Embryo	Whole Organism	All anatomical structures
9797	9797	ERR3838732	ERX3851398	ERS4266422	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	PGC dome rep2	SAMEA6501973	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:00Z\|External Id:SAMEA6501973\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:00Z\|INSDC status:public\|Submitter Id:E MTAB 8707:PGC dome rep2\|age:4.3\|broker name:ArrayExpress\|cell type:primordial germ cell\|common name:zebrafish\|developmental stage:blastula dome\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:PGC dome rep2\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:PGC dome rep2 p	PGC dome rep2 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:blastula dome\|Experimental Factor: compound:n1\|Experimental Factor: cell type:primordial germ cell	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	S9_R1.fastq.gz S9_R2.fastq.gz	fastq fastq	882858901.0	5912255.0	E MTAB 8707:S9 R	0:74.66 1:74.67	A:246639630;C:193554406;G:199940889;T:242369366;N:354610	74	74	246639630	193554406	199940889	242369366	354610	ERX3851398	ERS4266422	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.94045	0.9404	0.04635	0.04658	0.74582	0.74777	0.4915	0.49248	76	76	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Blastula	Embryo	Whole Organism	All anatomical structures
9798	9798	ERR3838731	ERX3851397	ERS4266421	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	PGC dome rep1	SAMEA6501972	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:00Z\|External Id:SAMEA6501972\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:00Z\|INSDC status:public\|Submitter Id:E MTAB 8707:PGC dome rep1\|age:4.3\|broker name:ArrayExpress\|cell type:primordial germ cell\|common name:zebrafish\|developmental stage:blastula dome\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:PGC dome rep1\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:PGC dome rep1 p	PGC dome rep1 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:blastula dome\|Experimental Factor: compound:n1\|Experimental Factor: cell type:primordial germ cell	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	S7_R1.fastq.gz S7_R2.fastq.gz	fastq fastq	592299285.0	3961989.0	E MTAB 8707:S7 R	0:74.75 1:74.75	A:166664600;C:128421892;G:132787149;T:164189412;N:236232	74	74	166664600	128421892	132787149	164189412	236232	ERX3851397	ERS4266421	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.93981	0.94032	0.04868	0.04843	0.74627	0.74722	0.49243	0.48872	75	76	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Blastula	Embryo	Whole Organism	All anatomical structures
9799	9799	ERR3838730	ERX3851396	ERS4266420	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	PGC 256 cell rep2	SAMEA6501971	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:00Z\|External Id:SAMEA6501971\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:00Z\|INSDC status:public\|Submitter Id:E MTAB 8707:PGC 256 cell rep2\|age:2.5\|broker name:ArrayExpress\|cell type:primordial germ cell\|common name:zebrafish\|developmental stage:blastula 256 cell\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:PGC 256 cell rep2\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:PGC 256 cell rep2 p	PGC 256 cell rep2 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:blastula 256 cell\|Experimental Factor: compound:n1\|Experimental Factor: cell type:primordial germ cell	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	S1_R1.fastq.gz S1_R2.fastq.gz	fastq fastq	745277323.0	4983607.0	E MTAB 8707:S1 R	0:74.77 1:74.77	A:208352741;C:163024343;G:168234953;T:205391192;N:274094	74	74	208352741	163024343	168234953	205391192	274094	ERX3851396	ERS4266420	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.9393	0.9395	0.03941	0.03941	0.75473	0.75708	0.51338	0.51754	75	76	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Blastula	Embryo	Whole Organism	All anatomical structures
9800	9800	ERR3838729	ERX3851395	ERS4266419	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	PGC 256 cell rep1	SAMEA6501970	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:00Z\|External Id:SAMEA6501970\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:00Z\|INSDC status:public\|Submitter Id:E MTAB 8707:PGC 256 cell rep1\|age:2.5\|broker name:ArrayExpress\|cell type:primordial germ cell\|common name:zebrafish\|developmental stage:blastula 256 cell\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:PGC 256 cell rep1\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:PGC 256 cell rep1 p	PGC 256 cell rep1 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:blastula 256 cell\|Experimental Factor: compound:n1\|Experimental Factor: cell type:primordial germ cell	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	PGC_256_rep1_R1.fastq.gz PGC_256_rep1_R2.fastq.gz	fastq fastq	1876891175.0	12625794.0	E MTAB 8707:PGC 256 rep1 R	0:74.32 1:74.33	A:539140549;C:396392844;G:411568412;T:528672735;N:1116635	74	74	539140549	396392844	411568412	528672735	1116635	ERX3851395	ERS4266419	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.92251	0.92173	0.06705	0.06723	0.76059	0.76374	0.54467	0.54135	76	75	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Blastula	Embryo	Whole Organism	All anatomical structures
9801	9801	ERR3838728	ERX3851394	ERS4266418	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	PGC 10somites rep2	SAMEA6501969	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:00Z\|External Id:SAMEA6501969\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:00Z\|INSDC status:public\|Submitter Id:E MTAB 8707:PGC 10somites rep2\|age:14\|broker name:ArrayExpress\|cell type:primordial germ cell\|common name:zebrafish\|developmental stage:10 somites\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:PGC 10somites rep2\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:PGC 10somites rep2 p	PGC 10somites rep2 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:10 somites\|Experimental Factor: compound:n1\|Experimental Factor: cell type:primordial germ cell	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	S5_R1.fastq.gz S5_R2.fastq.gz	fastq fastq	1186993033.0	7958634.0	E MTAB 8707:S5 R	0:74.57 1:74.58	A:332263881;C:259239478;G:267014990;T:327946611;N:528073	74	74	332263881	259239478	267014990	327946611	528073	ERX3851394	ERS4266418	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.90713	0.9062	0.10071	0.1016	0.73058	0.73279	0.48458	0.48038	74	75	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Segmentation	Embryo	Whole Organism	All anatomical structures
9802	9802	ERR3838727	ERX3851393	ERS4266417	ERP119601	PRJEB36411	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-8707	Transcriptome Analysis	Zebrafish Primordial Germ Cells PGCs were tracked in the TgBuc GFP line where the germ plasm protein Buc is fused to GFP. GFP positive cells were isolated via FACS and RNA seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256 cell high dome 10 somites and prim 5 stages. Two hundred cells were used for each biological replicate. RNA seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	PGC 10somites rep1	SAMEA6501968	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA FIRST PUBLIC:2020 04 30T04:03:48Z\|ENA LAST UPDATE:2020 01 24T08:44:00Z\|External Id:SAMEA6501968\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 04 30T04:03:48Z\|INSDC last update:2020 01 24T08:44:00Z\|INSDC status:public\|Submitter Id:E MTAB 8707:PGC 10somites rep1\|age:14\|broker name:ArrayExpress\|cell type:primordial germ cell\|common name:zebrafish\|developmental stage:10 somites\|genotype:tgbuc:egfp\|phenotype:fluorescent PGCs due to germ plasm localised GFP\|sample name:E MTAB 8707:PGC 10somites rep1\|scientific name:Danio rerio\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 8707:PGC 10somites rep1 p	PGC 10somites rep1 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: developmental stage:10 somites\|Experimental Factor: compound:n1\|Experimental Factor: cell type:primordial germ cell	OTHER	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP119601	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 01 24	S3_R1.fastq.gz S3_R2.fastq.gz	fastq fastq	1230551446.0	8251644.0	E MTAB 8707:S3 R	0:74.56 1:74.57	A:345409587;C:267720436;G:275626594;T:341185818;N:609011	74	74	345409587	267720436	275626594	341185818	609011	ERX3851393	ERS4266417	ERA2354529	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.90983	0.90985	0.1005	0.10037	0.72622	0.72825	0.49116	0.49135	76	75	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-01-24	Segmentation	Embryo	Whole Organism	All anatomical structures
10111	10111	ERR4911024	ERX4777847	ERS5435613	ERP125516	PRJEB41701	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-9857	Transcriptome Analysis	In this rescue experiment embryos were injected with a Tdrd7 targeting morpholino to block translation of tdrd7 RNA and simultaneously provided with a Tdrd7 morpholino resistant RNA.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 12 02		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. A rescue experiment was performed with Tdrd7 MO resistant RNA from tdrd7 transcript. The RNA was in vitro transcribed and co injected in once cell embryo to rescue MO mediated Tdrd7 KD. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	PGC Rescue rep2	SAMEA7678632	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA first public:2020 12 24\|ENA last update:2020 12 02\|External Id:SAMEA7678632\|INSDC center alias:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 12 24T04:05:28Z\|INSDC last update:2020 12 02T17:13:26Z\|INSDC status:public\|Submitter Id:E MTAB 9857:PGC Rescue rep2\|age:24\|broker name:ArrayExpress\|cell type:primordial germ cell\|common name:zebrafish\|developmental stage:pharyngula prim 5\|genotype:tgbuc:gfp\|sample name:E MTAB 9857:PGC Rescue rep2\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 9857:PGC Rescue rep2 p	PGC Rescue rep2 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. A rescue experiment was performed with Tdrd7 MO resistant RNA from tdrd7 transcript. The RNA was in vitro transcribed and co injected in once cell embryo to rescue MO mediated Tdrd7 KD. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: compound:tdrd7 MO + tdrd7 rescue RNA	RNA-Seq	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP125516	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 12 09	Tdrd7_Rescue_PGC_rep2_R1.fastq.gz Tdrd7_Rescue_PGC_rep2_R2.fastq.gz	fastq fastq	6487121744.0	43103086.0	E MTAB 9857:Tdrd7 Rescue PGC rep2 R	0:75.26 1:75.24	A:1769293880;C:1469053016;G:1516553427;T:1729496045;N:2725376	75	75	1769293880	1469053016	1516553427	1729496045	2725376	ERX4777847	ERS5435613	ERA3184570	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.95185	0.95349	0.04302	0.04315	0.72829	0.73022	0.47176	0.47104	75	76	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-12-02	Pharyngula	Embryo	Whole Organism	All anatomical structures
10112	10112	ERR4911023	ERX4777846	ERS5435612	ERP125516	PRJEB41701	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-9857	Transcriptome Analysis	In this rescue experiment embryos were injected with a Tdrd7 targeting morpholino to block translation of tdrd7 RNA and simultaneously provided with a Tdrd7 morpholino resistant RNA.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 12 02		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. A rescue experiment was performed with Tdrd7 MO resistant RNA from tdrd7 transcript. The RNA was in vitro transcribed and co injected in once cell embryo to rescue MO mediated Tdrd7 KD. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	PGC Rescue rep1	SAMEA7678631	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA first public:2020 12 24\|ENA last update:2020 12 02\|External Id:SAMEA7678631\|INSDC center alias:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 12 24T04:05:28Z\|INSDC last update:2020 12 02T17:13:26Z\|INSDC status:public\|Submitter Id:E MTAB 9857:PGC Rescue rep1\|age:24\|broker name:ArrayExpress\|cell type:primordial germ cell\|common name:zebrafish\|developmental stage:pharyngula prim 5\|genotype:tgbuc:gfp\|sample name:E MTAB 9857:PGC Rescue rep1\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 9857:PGC Rescue rep1 p	PGC Rescue rep1 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. A rescue experiment was performed with Tdrd7 MO resistant RNA from tdrd7 transcript. The RNA was in vitro transcribed and co injected in once cell embryo to rescue MO mediated Tdrd7 KD. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: compound:tdrd7 MO + tdrd7 rescue RNA	RNA-Seq	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP125516	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 12 09	Tdrd7_Rescue_PGC_rep1_R1.fastq.gz Tdrd7_Rescue_PGC_rep1_R2.fastq.gz	fastq fastq	5952473889.0	39454929.0	E MTAB 9857:Tdrd7 Rescue PGC rep1 R	0:75.44 1:75.43	A:1640467527;C:1332668425;G:1380033115;T:1597665169;N:1639653	75	75	1640467527	1332668425	1380033115	1597665169	1639653	ERX4777846	ERS5435612	ERA3184570	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.95086	0.95226	0.06292	0.0629	0.70341	0.70579	0.46524	0.46691	75	76	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-12-02	Pharyngula	Embryo	Whole Organism	All anatomical structures
10113	10113	ERR4911022	ERX4777845	ERS5435611	ERP125516	PRJEB41701	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-9857	Transcriptome Analysis	In this rescue experiment embryos were injected with a Tdrd7 targeting morpholino to block translation of tdrd7 RNA and simultaneously provided with a Tdrd7 morpholino resistant RNA.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 12 02		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. A rescue experiment was performed with Tdrd7 MO resistant RNA from tdrd7 transcript. The RNA was in vitro transcribed and co injected in once cell embryo to rescue MO mediated Tdrd7 KD. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	PGC MO rep2	SAMEA7678630	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA first public:2020 12 24\|ENA last update:2020 12 02\|External Id:SAMEA7678630\|INSDC center alias:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 12 24T04:05:28Z\|INSDC last update:2020 12 02T17:13:26Z\|INSDC status:public\|Submitter Id:E MTAB 9857:PGC MO rep2\|age:24\|broker name:ArrayExpress\|cell type:primordial germ cell\|common name:zebrafish\|developmental stage:pharyngula prim 5\|genotype:tgbuc:gfp\|sample name:E MTAB 9857:PGC MO rep2\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 9857:PGC MO rep2 p	PGC MO rep2 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. A rescue experiment was performed with Tdrd7 MO resistant RNA from tdrd7 transcript. The RNA was in vitro transcribed and co injected in once cell embryo to rescue MO mediated Tdrd7 KD. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: compound:tdrd7 targeting MO	RNA-Seq	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP125516	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 12 09	Tdrd7_MO_PGC_rep2_R1.fastq.gz Tdrd7_MO_PGC_rep2_R2.fastq.gz	fastq fastq	906443913.0	6069224.0	E MTAB 9857:Tdrd7 MO PGC rep2 R	0:74.67 1:74.68	A:256935983;C:195137600;G:200975999;T:253026767;N:367564	74	74	256935983	195137600	200975999	253026767	367564	ERX4777845	ERS5435611	ERA3184570	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.93468	0.93603	0.09796	0.09848	0.7119	0.71439	0.48682	0.48933	75	76	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-12-02	Pharyngula	Embryo	Whole Organism	All anatomical structures
10114	10114	ERR4911021	ERX4777844	ERS5435610	ERP125516	PRJEB41701	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-9857	Transcriptome Analysis	In this rescue experiment embryos were injected with a Tdrd7 targeting morpholino to block translation of tdrd7 RNA and simultaneously provided with a Tdrd7 morpholino resistant RNA.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 12 02		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. A rescue experiment was performed with Tdrd7 MO resistant RNA from tdrd7 transcript. The RNA was in vitro transcribed and co injected in once cell embryo to rescue MO mediated Tdrd7 KD. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	PGC MO rep1	SAMEA7678629	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA first public:2020 12 24\|ENA last update:2020 12 02\|External Id:SAMEA7678629\|INSDC center alias:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 12 24T04:05:28Z\|INSDC last update:2020 12 02T17:13:26Z\|INSDC status:public\|Submitter Id:E MTAB 9857:PGC MO rep1\|age:24\|broker name:ArrayExpress\|cell type:primordial germ cell\|common name:zebrafish\|developmental stage:pharyngula prim 5\|genotype:tgbuc:gfp\|sample name:E MTAB 9857:PGC MO rep1\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 9857:PGC MO rep1 p	PGC MO rep1 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. A rescue experiment was performed with Tdrd7 MO resistant RNA from tdrd7 transcript. The RNA was in vitro transcribed and co injected in once cell embryo to rescue MO mediated Tdrd7 KD. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: compound:tdrd7 targeting MO	RNA-Seq	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP125516	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 12 09	Tdrd7_MO_PGC_rep1_R1.fastq.gz Tdrd7_MO_PGC_rep1_R2.fastq.gz	fastq fastq	1078919524.0	7241200.0	E MTAB 9857:Tdrd7 MO PGC rep1 R	0:74.50 1:74.50	A:308200726;C:229836659;G:236649504;T:303673221;N:559414	74	74	308200726	229836659	236649504	303673221	559414	ERX4777844	ERS5435610	ERA3184570	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.938	0.93748	0.10463	0.10431	0.7077	0.70999	0.48098	0.48239	75	76	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-12-02	Pharyngula	Embryo	Whole Organism	All anatomical structures
10115	10115	ERR4911020	ERX4777843	ERS5435609	ERP125516	PRJEB41701	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-9857	Transcriptome Analysis	In this rescue experiment embryos were injected with a Tdrd7 targeting morpholino to block translation of tdrd7 RNA and simultaneously provided with a Tdrd7 morpholino resistant RNA.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 12 02		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. A rescue experiment was performed with Tdrd7 MO resistant RNA from tdrd7 transcript. The RNA was in vitro transcribed and co injected in once cell embryo to rescue MO mediated Tdrd7 KD. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	PGC 5mm rep2	SAMEA7678628	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA first public:2020 12 24\|ENA last update:2020 12 02\|External Id:SAMEA7678628\|INSDC center alias:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 12 24T04:05:28Z\|INSDC last update:2020 12 02T17:13:26Z\|INSDC status:public\|Submitter Id:E MTAB 9857:PGC 5mm rep2\|age:24\|broker name:ArrayExpress\|cell type:primordial germ cell\|common name:zebrafish\|developmental stage:pharyngula prim 5\|genotype:tgbuc:gfp\|sample name:E MTAB 9857:PGC 5mm rep2\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 9857:PGC 5mm rep2 p	PGC 5mm rep2 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. A rescue experiment was performed with Tdrd7 MO resistant RNA from tdrd7 transcript. The RNA was in vitro transcribed and co injected in once cell embryo to rescue MO mediated Tdrd7 KD. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: compound:tdrd7 5mismatch MO	RNA-Seq	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP125516	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 12 09	Tdrd7_5mm_PGC_rep2_R1.fastq.gz Tdrd7_5mm_PGC_rep2_R2.fastq.gz	fastq fastq	673911944.0	4501723.0	E MTAB 9857:Tdrd7 5mm PGC rep2 R	0:74.85 1:74.85	A:184466911;C:150779527;G:155693395;T:182720480;N:251631	74	74	184466911	150779527	155693395	182720480	251631	ERX4777843	ERS5435609	ERA3184570	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.91989	0.92025	0.08795	0.08919	0.70096	0.70416	0.49184	0.49415	75	75	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-12-02	Pharyngula	Embryo	Whole Organism	All anatomical structures
10116	10116	ERR4911019	ERX4777842	ERS5435608	ERP125516	PRJEB41701	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E-MTAB-9857	Transcriptome Analysis	In this rescue experiment embryos were injected with a Tdrd7 targeting morpholino to block translation of tdrd7 RNA and simultaneously provided with a Tdrd7 morpholino resistant RNA.	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 12 02		Protocols: Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. A rescue experiment was performed with Tdrd7 MO resistant RNA from tdrd7 transcript. The RNA was in vitro transcribed and co injected in once cell embryo to rescue MO mediated Tdrd7 KD. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	PGC 5mm rep1	SAMEA7678627	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK	ENA first public:2020 12 24\|ENA last update:2020 12 02\|External Id:SAMEA7678627\|INSDC center alias:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC center name:MRC London Institute of Medical Sciences and Faculty of Medicine Imperial College London UK\|INSDC first public:2020 12 24T04:05:28Z\|INSDC last update:2020 12 02T17:13:26Z\|INSDC status:public\|Submitter Id:E MTAB 9857:PGC 5mm rep1\|age:24\|broker name:ArrayExpress\|cell type:primordial germ cell\|common name:zebrafish\|developmental stage:pharyngula prim 5\|genotype:tgbuc:gfp\|sample name:E MTAB 9857:PGC 5mm rep1\|strain:AB									NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	E MTAB 9857:PGC 5mm rep1 p	PGC 5mm rep1 p	RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	Zebrafish PGCs were isolated via FACS post embryo dissociation. The embryos were grown until the desired stage at 28.5C and collected in synchronous batches. Cell dissociation occurred via pipetting thoroughly up and down the pooled embryos until the solution appeared homogeneous. Yolk excess was removed by two rounds of centrifugation at 300 x g 5 minutes. Cells were passed through a 50 μm mesh and loaded into a FACS Aria II machine for cell sorting. Morpholino antisense oligos were used in order to inhibit Tdrd7 translation during zebrafish development. Stock morpholinos were diluted in phenol red and about 0.3 pM were injected into the yolk of a fertilised zebrafish embryo. As experimental control a group of embryos were injected with morpholinos having 5 mismatches for the target Tdrd7 transcript. A rescue experiment was performed with Tdrd7 MO resistant RNA from tdrd7 transcript. The RNA was in vitro transcribed and co injected in once cell embryo to rescue MO mediated Tdrd7 KD. Cells were lysed in presence of RNAse inhibitor 0.2 U/μl and cDNA generated from the cell lysate. cDNA was generated with the Takara SMART Seq® v4 Ultra® Low Input RNA Kit as from manufacturer's instruction. In brief reverse transcription was carried out in presence of the SMART Seq CDS Primer II A and SMARTScribeTM Reverse Transcriptase Takara Bio Europe 634889 France. Library amplification occurred according to protocol recommendations and the amplified cDNA purified via the Agencourt AMPure XP beads kit Beckman Coulter A63880 USA.	Experimental Factor: compound:tdrd7 5mismatch MO	RNA-Seq	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	ILLUMINA	NextSeq 550	ERP125516	NextSeq 550 paired end sequencing; RNA seq of zebrafish primordial germ cells and somatic cells during early embryogenesis	ENA FIRST PUBLIC:2020 12 24\|ENA LAST UPDATE:2020 12 09	Tdrd7_5mm_PGC_rep1_R1.fastq.gz Tdrd7_5mm_PGC_rep1_R2.fastq.gz	fastq fastq	565636692.0	3782000.0	E MTAB 9857:Tdrd7 5mm PGC rep1 R	0:74.78 1:74.78	A:157353454;C:124504476;G:128260137;T:155314004;N:204621	74	74	157353454	124504476	128260137	155314004	204621	ERX4777842	ERS5435608	ERA3184570	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	MRC London Institute of Medical Sciences and Faculty of Medicine, Imperial College, London, UK\|European Nucleotide Archive	2	0.91957	0.91995	0.08301	0.0845	0.69929	0.70195	0.48544	0.4877	76	76	B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	United Kingdom	2020-12-02	Pharyngula	Embryo	Whole Organism	All anatomical structures
19087	19087	ERR13834862	ERX13237628	ERS21098715	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	48HC1 S20 R1 001.fastq.gz	SAMEA116100635	GIMM	ENA first public:2024 01 01\|INSDC center name:GIMM\|INSDC status:public\|Submitter Id:48 HC1\|collected by:Jaakko Lehtimaki\|collection date:2021 11 24\|common name:zebrafish\|dev stage:48 hpf location country and/or sea:Portugal\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|sample name:48 HC1\|scientific name:Danio rerio\|tissue type:retina									Raw reads: 48 HC1	webin reads 48 HC1					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 48 HC1	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	48HC1_S20_R1_001.fastq.gz	fastq	3768442091.0	38065677.0	webin reads 48 HC1	0:99.00	A:1055463738;C:792073627;G:817607736;T:1103223790;N:73200	99		1055463738	792073627	817607736	1103223790	73200	ERX13237628	ERS21098715	ERA30883416	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2024-01-01	Hatching	Embryo	Eye	Sensory System
19088	19088	ERR13834951	ERX13237717	ERS21098721	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	58PR3 S26 R1 001.fastq.gz	58 PR3		organism:Danio rerio\|collection date:2021 12 02\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:58 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 58 PR3	webin reads 58 PR3					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 58 PR3	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	58PR3_S26_R1_001.fastq.gz	fastq	3869469736.0	38850717.0	webin reads 58 PR3	0:99.60	A:1103909449;C:804146524;G:827344036;T:1134036010;N:33717	99		1103909449	804146524	827344036	1134036010	33717	ERX13237717	ERS21098721	ERA30883529	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Hatching	Embryo	Eye	Sensory System
19089	19089	ERR13835010	ERX13237776	ERS21098726	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	58AC4 S31 R1 001.fastq.gz	SAMEA116100646	GIMM	ENA first public:2024 01 01\|INSDC center name:GIMM\|INSDC status:public\|Submitter Id:58 AC4\|collected by:Jaakko Lehtimaki\|collection date:2021 12 02\|common name:zebrafish\|dev stage:58 hpf location country and/or sea:Portugal\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|sample name:58 AC4\|scientific name:Danio rerio\|tissue type:retina									Raw reads: 58 AC4	webin reads 58 AC4					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 58 AC4	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	58AC4_S31_R1_001.fastq.gz	fastq	3607648651.0	36331933.0	webin reads 58 AC4	0:99.30	A:1038047870;C:736262498;G:759315202;T:1073962987;N:60094	99		1038047870	736262498	759315202	1073962987	60094	ERX13237776	ERS21098726	ERA30883721	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2024-01-01	Hatching	Embryo	Eye	Sensory System
19090	19090	ERR13822794	ERX13225546	ERS21098708	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	48PR2 S13 R1 001.fastq.gz	48 PR2		organism:Danio rerio\|collection date:2021 11 24\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:48 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 48 PR2	webin reads 48 PR2					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 48 PR2	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	48PR2_S13_R1_001.fastq.gz	fastq	3809299607.0	38404185.0	webin reads 48 PR2	0:99.19	A:1067728192;C:802585802;G:828435932;T:1110435904;N:113777	99		1067728192	802585802	828435932	1110435904	113777	ERX13225546	ERS21098708	ERA30879682	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Hatching	Embryo	Eye	Sensory System
19091	19091	ERR13834854	ERX13237620	ERS21098714	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	48AC4 S19 R1 001.fastq.gz	48 AC4		organism:Danio rerio\|collection date:2021 11 24\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:48 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 48 AC4	webin reads 48 AC4					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 48 AC4	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	48AC4_S19_R1_001.fastq.gz	fastq	3410801894.0	34443068.0	webin reads 48 AC4	0:99.03	A:966160063;C:707754156;G:733039262;T:1003772756;N:75657	99		966160063	707754156	733039262	1003772756	75657	ERX13237620	ERS21098714	ERA30883390	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Hatching	Embryo	Eye	Sensory System
19092	19092	ERR13828824	ERX13231590	ERS21098710	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	48PR4 S15 R1 001.fastq.gz	48 PR4		organism:Danio rerio\|collection date:2021 11 24\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:48 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 48 PR4	webin reads 48 PR4					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 48 PR4	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	48PR4_S15_R1_001.fastq.gz	fastq	4365943927.0	44278278.0	webin reads 48 PR4	0:98.60	A:1214448497;C:927512154;G:957491418;T:1266385355;N:106503	98		1214448497	927512154	957491418	1266385355	106503	ERX13231590	ERS21098710	ERA30883309	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Hatching	Embryo	Eye	Sensory System
19093	19093	ERR13834993	ERX13237759	ERS21098723	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	58AC1 S28 R1 001.fastq.gz	58 AC1		organism:Danio rerio\|collection date:2021 12 02\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:58 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 58 AC1	webin reads 58 AC1					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 58 AC1	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	58AC1_S28_R1_001.fastq.gz	fastq	3710768269.0	37364763.0	webin reads 58 AC1	0:99.31	A:1060419097;C:761984557;G:786533722;T:1101603428;N:227465	99		1060419097	761984557	786533722	1101603428	227465	ERX13237759	ERS21098723	ERA30883659	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Hatching	Embryo	Eye	Sensory System
19094	19094	ERR13834875	ERX13237641	ERS21098717	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	48HC3 S22 R1 001.fastq.gz	48 HC3		organism:Danio rerio\|collection date:2021 11 24\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:48 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 48 HC3	webin reads 48 HC3					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 48 HC3	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	48HC3_S22_R1_001.fastq.gz	fastq	3083078586.0	31073491.0	webin reads 48 HC3	0:99.22	A:856250957;C:655140994;G:677078911;T:894558582;N:49142	99		856250957	655140994	677078911	894558582	49142	ERX13237641	ERS21098717	ERA30883447	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Hatching	Embryo	Eye	Sensory System
19095	19095	ERR13834899	ERX13237665	ERS21098720	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	58PR2 S25 R1 001.fastq.gz	58 PR2		organism:Danio rerio\|collection date:2021 12 02\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:58 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 58 PR2	webin reads 58 PR2					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 58 PR2	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	58PR2_S25_R1_001.fastq.gz	fastq	3849571818.0	38706841.0	webin reads 58 PR2	0:99.45	A:1089593011;C:803322469;G:827777017;T:1128836774;N:42547	99		1089593011	803322469	827777017	1128836774	42547	ERX13237665	ERS21098720	ERA30883518	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Hatching	Embryo	Eye	Sensory System
19096	19096	ERR13834889	ERX13237655	ERS21098719	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	58PR1 S24 R1 001.fastq.gz	58 PR1		organism:Danio rerio\|collection date:2021 12 02\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:58 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 58 PR1	webin reads 58 PR1					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 58 PR1	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	58PR1_S24_R1_001.fastq.gz	fastq	3945671240.0	39514922.0	webin reads 58 PR1	0:99.85	A:1135075173;C:807489123;G:827964380;T:1175109762;N:32802	99		1135075173	807489123	827964380	1175109762	32802	ERX13237655	ERS21098719	ERA30883497	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Hatching	Embryo	Eye	Sensory System
19097	19097	ERR13835019	ERX13237785	ERS21098728	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	58HC2 S33 R1 001.fastq.gz	SAMEA116100648	GIMM	ENA first public:2024 01 01\|INSDC center name:GIMM\|INSDC status:public\|Submitter Id:58 HC2\|collected by:Jaakko Lehtimaki\|collection date:2021 12 02\|common name:zebrafish\|dev stage:58 hpf location country and/or sea:Portugal\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|sample name:58 HC2\|scientific name:Danio rerio\|tissue type:retina									Raw reads: 58 HC2	webin reads 58 HC2					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 58 HC2	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	58HC2_S33_R1_001.fastq.gz	fastq	3711237069.0	37217240.0	webin reads 58 HC2	0:99.72	A:1070592288;C:757099665;G:780689044;T:1102575310;N:280762	99		1070592288	757099665	780689044	1102575310	280762	ERX13237785	ERS21098728	ERA30883748	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2024-01-01	Hatching	Embryo	Eye	Sensory System
19098	19098	ERR13822110	ERX13224862	ERS21098697	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	38PR2 S2 R1 001.fastq.gz	38 PR2		organism:Danio rerio\|collection date:2021 11 30\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:38 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 38 PR2	webin reads 38 PR2					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 38 PR2	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	38PR2_S2_R1_001.fastq.gz	fastq	3463281109.0	34821985.0	webin reads 38 PR2	0:99.46	A:969862466;C:733798241;G:755135957;T:1004440555;N:43890	99		969862466	733798241	755135957	1004440555	43890	ERX13224862	ERS21098697	ERA30879238	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Pharyngula	Embryo	Eye	Sensory System
19099	19099	ERR13822784	ERX13225536	ERS21098706	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	38HC3 S11 R1 001.fastq.gz	38 HC3		organism:Danio rerio\|collection date:2021 12 07\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:38 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 38 HC3	webin reads 38 HC3					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 38 HC3	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	38HC3_S11_R1_001.fastq.gz	fastq	4360921873.0	44107486.0	webin reads 38 HC3	0:98.87	A:1222778761;C:918257887;G:948838973;T:1270939370;N:106882	98		1222778761	918257887	948838973	1270939370	106882	ERX13225536	ERS21098706	ERA30879613	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Pharyngula	Embryo	Eye	Sensory System
19100	19100	ERR13828836	ERX13231602	ERS21098712	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	48AC2 S17 R1 001.fastq.gz	48 AC2		organism:Danio rerio\|collection date:2021 11 24\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:48 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 48 AC2	webin reads 48 AC2					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 48 AC2	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	48AC2_S17_R1_001.fastq.gz	fastq	3205206588.0	32424632.0	webin reads 48 AC2	0:98.85	A:902438127;C:672433401;G:694813369;T:935445436;N:76255	98		902438127	672433401	694813369	935445436	76255	ERX13231602	ERS21098712	ERA30883343	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Hatching	Embryo	Eye	Sensory System
19101	19101	ERR13835004	ERX13237770	ERS21098725	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	58AC3 S30 R1 001.fastq.gz	58 AC3		organism:Danio rerio\|collection date:2021 12 02\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:58 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 58 AC3	webin reads 58 AC3					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 58 AC3	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	58AC3_S30_R1_001.fastq.gz	fastq	3782993133.0	38295959.0	webin reads 58 AC3	0:98.78	A:1080745150;C:779903026;G:803258485;T:1118994941;N:91531	98		1080745150	779903026	803258485	1118994941	91531	ERX13237770	ERS21098725	ERA30883697	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Hatching	Embryo	Eye	Sensory System
19102	19102	ERR13834868	ERX13237634	ERS21098716	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	48HC2 S21 R1 001.fastq.gz	SAMEA116100636	GIMM	ENA first public:2024 01 01\|INSDC center name:GIMM\|INSDC status:public\|Submitter Id:48 HC2\|collected by:Jaakko Lehtimaki\|collection date:2021 11 24\|common name:zebrafish\|dev stage:48 hpf location country and/or sea:Portugal\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|sample name:48 HC2\|scientific name:Danio rerio\|tissue type:retina									Raw reads: 48 HC2	webin reads 48 HC2					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 48 HC2	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	48HC2_S21_R1_001.fastq.gz	fastq	3424347865.0	34510204.0	webin reads 48 HC2	0:99.23	A:959488173;C:721171249;G:745705870;T:997922014;N:60559	99		959488173	721171249	745705870	997922014	60559	ERX13237634	ERS21098716	ERA30883434	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2024-01-01	Hatching	Embryo	Eye	Sensory System
19103	19103	ERR13822197	ERX13224949	ERS21098704	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	38HC1 S9 R1 001.fastq.gz	SAMEA116100624	GIMM	ENA first public:2024 01 01\|INSDC center name:GIMM\|INSDC status:public\|Submitter Id:38 HC1\|collected by:Jaakko Lehtimaki\|collection date:2021 11 30\|common name:zebrafish\|dev stage:38 hpf location country and/or sea:Portugal\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|sample name:38 HC1\|scientific name:Danio rerio\|tissue type:retina									Raw reads: 38 HC1	webin reads 38 HC1					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 38 HC1	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	38HC1_S9_R1_001.fastq.gz	fastq	3784641498.0	38331162.0	webin reads 38 HC1	0:98.74	A:1064199311;C:791310791;G:818910597;T:1110118632;N:102167	98		1064199311	791310791	818910597	1110118632	102167	ERX13224949	ERS21098704	ERA30879548	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2024-01-01	Pharyngula	Embryo	Eye	Sensory System
19104	19104	ERR13834880	ERX13237646	ERS21098718	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	48HC4 S23 R1 001.fastq.gz	48 HC4		organism:Danio rerio\|collection date:2021 11 24\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:48 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 48 HC4	webin reads 48 HC4					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 48 HC4	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	48HC4_S23_R1_001.fastq.gz	fastq	3660674315.0	36821474.0	webin reads 48 HC4	0:99.42	A:1035049987;C:763030378;G:788062167;T:1074303516;N:228267	99		1035049987	763030378	788062167	1074303516	228267	ERX13237646	ERS21098718	ERA30883470	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Hatching	Embryo	Eye	Sensory System
19105	19105	ERR13822867	ERX13225633	ERS21098709	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	48PR3 S14 R1 001.fastq.gz	48 PR3		organism:Danio rerio\|collection date:2021 11 24\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:48 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 48 PR3	webin reads 48 PR3					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 48 PR3	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	48PR3_S14_R1_001.fastq.gz	fastq	4232170464.0	42534853.0	webin reads 48 PR3	0:99.50	A:1195251409;C:889346003;G:917240118;T:1230272855;N:60079	99		1195251409	889346003	917240118	1230272855	60079	ERX13225633	ERS21098709	ERA30879704	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Hatching	Embryo	Eye	Sensory System
19106	19106	ERR13822131	ERX13224883	ERS21098700	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	38AC1 S5 R1 001.fastq.gz	SAMEA116100620	GIMM	ENA first public:2024 01 01\|INSDC center name:GIMM\|INSDC status:public\|Submitter Id:38 AC1\|collected by:Jaakko Lehtimaki\|collection date:2021 11 30\|common name:zebrafish\|dev stage:38 hpf location country and/or sea:Portugal\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|sample name:38 AC1\|scientific name:Danio rerio\|tissue type:retina									Raw reads: 38 AC1	webin reads 38 AC1					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 38 AC1	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	38AC1_S5_R1_001.fastq.gz	fastq	3836921113.0	38702139.0	webin reads 38 AC1	0:99.14	A:1066720805;C:818958589;G:843762182;T:1107403844;N:75693	99		1066720805	818958589	843762182	1107403844	75693	ERX13224883	ERS21098700	ERA30879356	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2024-01-01	Pharyngula	Embryo	Eye	Sensory System
19107	19107	ERR13822143	ERX13224895	ERS21098702	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	38AC3 S7 R1 001.fastq.gz	38 AC3		organism:Danio rerio\|collection date:2021 12 07\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:38 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 38 AC3	webin reads 38 AC3					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 38 AC3	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	38AC3_S7_R1_001.fastq.gz	fastq	3452707377.0	34902410.0	webin reads 38 AC3	0:98.92	A:970868997;C:726795179;G:750560378;T:1004408693;N:74130	98		970868997	726795179	750560378	1004408693	74130	ERX13224895	ERS21098702	ERA30879451	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Pharyngula	Embryo	Eye	Sensory System
19108	19108	ERR13828843	ERX13234350	ERS21098713	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	48AC3 S18 R1 001.fastq.gz	48 AC3		organism:Danio rerio\|collection date:2021 11 24\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:48 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 48 AC3	webin reads 48 AC3					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 48 AC3	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	48AC3_S18_R1_001.fastq.gz	fastq	3733628911.0	37779462.0	webin reads 48 AC3	0:98.83	A:1047204450;C:786943605;G:812327274;T:1086893109;N:260473	98		1047204450	786943605	812327274	1086893109	260473	ERX13234350	ERS21098713	ERA30883366	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Hatching	Embryo	Eye	Sensory System
19109	19109	ERR13822153	ERX13224905	ERS21098703	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	38AC4 S8 R1 001.fastq.gz	38 AC4		organism:Danio rerio\|collection date:2021 12 07\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:38 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 38 AC4	webin reads 38 AC4					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 38 AC4	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	38AC4_S8_R1_001.fastq.gz	fastq	4130629624.0	41794865.0	webin reads 38 AC4	0:98.83	A:1156746387;C:877063962;G:905379690;T:1191264308;N:175277	98		1156746387	877063962	905379690	1191264308	175277	ERX13224905	ERS21098703	ERA30879532	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Pharyngula	Embryo	Eye	Sensory System
19110	19110	ERR13822201	ERX13224953	ERS21098705	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	38HC2 S10 R1 001.fastq.gz	38 HC2		organism:Danio rerio\|collection date:2021 11 30\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:38 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 38 HC2	webin reads 38 HC2					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 38 HC2	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	38HC2_S10_R1_001.fastq.gz	fastq	4221340137.0	42584743.0	webin reads 38 HC2	0:99.13	A:1195817135;C:879958039;G:908085464;T:1237394738;N:84761	99		1195817135	879958039	908085464	1237394738	84761	ERX13224953	ERS21098705	ERA30879582	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Pharyngula	Embryo	Eye	Sensory System
19111	19111	ERR13822114	ERX13224866	ERS21098698	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	38PR3 S3 R1 001.fastq.gz	SAMEA116100618	GIMM	ENA first public:2024 01 01\|INSDC center name:GIMM\|INSDC status:public\|Submitter Id:38 PR3\|collected by:Jaakko Lehtimaki\|collection date:2021 12 07\|common name:zebrafish\|dev stage:38 hpf location country and/or sea:Portugal\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|sample name:38 PR3\|scientific name:Danio rerio\|tissue type:retina									Raw reads: 38 PR3	webin reads 38 PR3					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 38 PR3	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	38PR3_S3_R1_001.fastq.gz	fastq	3894010106.0	39196855.0	webin reads 38 PR3	0:99.34	A:1093221995;C:818047738;G:843661747;T:1138957138;N:121488	99		1093221995	818047738	843661747	1138957138	121488	ERX13224866	ERS21098698	ERA30879273	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2024-01-01	Pharyngula	Embryo	Eye	Sensory System
19112	19112	ERR13822135	ERX13224887	ERS21098701	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	38AC2 S6 R1 001.fastq.gz	38 AC2		organism:Danio rerio\|collection date:2021 11 30\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:38 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 38 AC2	webin reads 38 AC2					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 38 AC2	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	38AC2_S6_R1_001.fastq.gz	fastq	3913343007.0	39682834.0	webin reads 38 AC2	0:98.62	A:1089960083;C:827936673;G:855955684;T:1139372607;N:117960	98		1089960083	827936673	855955684	1139372607	117960	ERX13224887	ERS21098701	ERA30879382	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Pharyngula	Embryo	Eye	Sensory System
19113	19113	ERR13835032	ERX13237798	ERS21098730	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	58HC4 S35 R1 001.fastq.gz	58 HC4		organism:Danio rerio\|collection date:2021 12 02\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:58 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 58 HC4	webin reads 58 HC4					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 58 HC4	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	58HC4_S35_R1_001.fastq.gz	fastq	4418556015.0	44331835.0	webin reads 58 HC4	0:99.67	A:1255080581;C:916490847;G:946212615;T:1300735054;N:36918	99		1255080581	916490847	946212615	1300735054	36918	ERX13237798	ERS21098730	ERA30883773	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Hatching	Embryo	Eye	Sensory System
19114	19114	ERR13828829	ERX13231595	ERS21098711	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	48AC1 S16 R1 001.fastq.gz	48 AC1		organism:Danio rerio\|collection date:2021 11 24\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:48 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 48 AC1	webin reads 48 AC1					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 48 AC1	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	48AC1_S16_R1_001.fastq.gz	fastq	3933669121.0	39695406.0	webin reads 48 AC1	0:99.10	A:1105258159;C:824538054;G:854253688;T:1149538152;N:81068	99		1105258159	824538054	854253688	1149538152	81068	ERX13231595	ERS21098711	ERA30883326	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Hatching	Embryo	Eye	Sensory System
19115	19115	ERR13822099	ERX13224851	ERS21098696	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	38PR1 S1 R1 001.fastq.gz	38 PR1		organism:Danio rerio\|collection date:2021 11 30\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:38 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 38 PR1	webin reads 38 PR1					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 38 PR1	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	38PR1_S1_R1_001.fastq.gz	fastq	4256158288.0	42658127.0	webin reads 38 PR1	0:99.77	A:1193880575;C:899261652;G:926114030;T:1236860186;N:41845	99		1193880575	899261652	926114030	1236860186	41845	ERX13224851	ERS21098696	ERA30879152	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Pharyngula	Embryo	Eye	Sensory System
19116	19116	ERR13822119	ERX13224871	ERS21098699	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	38PR4 S4 R1 001.fastq.gz	38 PR4		organism:Danio rerio\|collection date:2021 12 07\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:38 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 38 PR4	webin reads 38 PR4					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 38 PR4	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	38PR4_S4_R1_001.fastq.gz	fastq	3726308046.0	37591038.0	webin reads 38 PR4	0:99.13	A:1043231302;C:789255840;G:812957881;T:1080801843;N:61180	99		1043231302	789255840	812957881	1080801843	61180	ERX13224871	ERS21098699	ERA30879302	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Pharyngula	Embryo	Eye	Sensory System
19117	19117	ERR13835025	ERX13237791	ERS21098729	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	58HC3 S34 R1 001.fastq.gz	58 HC3		organism:Danio rerio\|collection date:2021 12 02\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:58 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 58 HC3	webin reads 58 HC3					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 58 HC3	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	58HC3_S34_R1_001.fastq.gz	fastq	3523899212.0	35292613.0	webin reads 58 HC3	0:99.85	A:1012516999;C:723225071;G:745152410;T:1042976092;N:28640	99		1012516999	723225071	745152410	1042976092	28640	ERX13237791	ERS21098729	ERA30883757	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Hatching	Embryo	Eye	Sensory System
19118	19118	ERR13835014	ERX13237780	ERS21098727	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	58HC1 S32 R1 001.fastq.gz	58 HC1		organism:Danio rerio\|collection date:2021 12 02\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:58 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 58 HC1	webin reads 58 HC1					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 58 HC1	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	58HC1_S32_R1_001.fastq.gz	fastq	3436493821.0	34597887.0	webin reads 58 HC1	0:99.33	A:980894291;C:707196785;G:729948858;T:1018400124;N:53763	99		980894291	707196785	729948858	1018400124	53763	ERX13237780	ERS21098727	ERA30883731	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Hatching	Embryo	Eye	Sensory System
19119	19119	ERR13834987	ERX13237753	ERS21098722	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	58PR4 S27 R1 001.fastq.gz	58 PR4		organism:Danio rerio\|collection date:2021 12 02\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:58 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 58 PR4	webin reads 58 PR4					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 58 PR4	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	58PR4_S27_R1_001.fastq.gz	fastq	3069040814.0	30923422.0	webin reads 58 PR4	0:99.25	A:875776938;C:633951750;G:653308475;T:905949639;N:54012	99		875776938	633951750	653308475	905949639	54012	ERX13237753	ERS21098722	ERA30883641	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Hatching	Embryo	Eye	Sensory System
19120	19120	ERR13822788	ERX13225540	ERS21098707	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	38HC4 S12 R1 001.fastq.gz	38 HC4		organism:Danio rerio\|collection date:2021 12 07\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:38 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 38 HC4	webin reads 38 HC4					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 38 HC4	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	38HC4_S12_R1_001.fastq.gz	fastq	3353994440.0	33744828.0	webin reads 38 HC4	0:99.39	A:939537209;C:709367668;G:731849729;T:973193819;N:46015	99		939537209	709367668	731849729	973193819	46015	ERX13225540	ERS21098707	ERA30879650	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Pharyngula	Embryo	Eye	Sensory System
19121	19121	ERR13834997	ERX13237763	ERS21098724	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01		retinal neurons	58AC2 S29 R1 001.fastq.gz	58 AC2		organism:Danio rerio\|collection date:2021 12 02\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:58 hpf type:retina\|geographic location country and/or sea:Portugal									Raw reads: 58 AC2	webin reads 58 AC2					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 58 AC2	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	58AC2_S29_R1_001.fastq.gz	fastq	3872162091.0	38898173.0	webin reads 58 AC2	0:99.55	A:1111663794;C:793747086;G:817730996;T:1148980297;N:39918	99		1111663794	793747086	817730996	1148980297	39918	ERX13237763	ERS21098724	ERA30883678	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine												B		usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Hatching	Embryo	Eye	Sensory System
24927	24927	SRR25557778	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant XI	GSM7688794		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-XI_S7_L001_R1_001.fastq.gz	fastq	420092501.0	5668059.0	GSM7688794 r1	0:74.12	A:113006440;C:96725832;G:99320773;T:110915967;N:123489	74		113006440	96725832	99320773	110915967	123489	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94757		0.06229		0.72364		0.46676		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24928	24928	SRR25557779	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant XI	GSM7688794		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-XI_S7_L002_R1_001.fastq.gz	fastq	421869780.0	5690053.0	GSM7688794 r2	0:74.14	A:113530489;C:97144227;G:99697959;T:111388539;N:108566	74		113530489	97144227	99697959	111388539	108566	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94921		0.06226		0.72462		0.4738		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24929	24929	SRR25557780	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant XI	GSM7688794		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-XI_S7_L003_R1_001.fastq.gz	fastq	425064659.0	5734041.0	GSM7688794 r3	0:74.13	A:114342253;C:97873100;G:100532599;T:112196433;N:120274	74		114342253	97873100	100532599	112196433	120274	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94886		0.06112		0.72425		0.47055		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24930	24930	SRR25557781	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant XI	GSM7688794		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-XI_S7_L004_R1_001.fastq.gz	fastq	416990548.0	5624902.0	GSM7688794 r4	0:74.13	A:112153356;C:96009158;G:98613145;T:110097476;N:117413	74		112153356	96009158	98613145	110097476	117413	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94869		0.06229		0.72506		0.47222		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24931	24931	SRR25557782	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant X	GSM7688793		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-X_S6_L001_R1_001.fastq.gz	fastq	434485284.0	5881416.0	GSM7688793 r1	0:73.87	A:116640351;C:100176557;G:102659919;T:114799536;N:208921	73		116640351	100176557	102659919	114799536	208921	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94533		0.07176		0.72464		0.47632		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24932	24932	SRR25557783	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant X	GSM7688793		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-X_S6_L002_R1_001.fastq.gz	fastq	435203869.0	5886556.0	GSM7688793 r2	0:73.93	A:116869356;C:100363580;G:102830644;T:114973504;N:166785	73		116869356	100363580	102830644	114973504	166785	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94542		0.07203		0.72421		0.47733		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24933	24933	SRR25557784	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant X	GSM7688793		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-X_S6_L003_R1_001.fastq.gz	fastq	439897269.0	5951878.0	GSM7688793 r3	0:73.91	A:118101648;C:101426657;G:103990006;T:116184480;N:194478	73		118101648	101426657	103990006	116184480	194478	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94486		0.07224		0.72448		0.47915		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24934	24934	SRR25557785	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant X	GSM7688793		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-X_S6_L004_R1_001.fastq.gz	fastq	431385256.0	5836029.0	GSM7688793 r4	0:73.92	A:115804970;C:99459059;G:101962932;T:113975935;N:182360	73		115804970	99459059	101962932	113975935	182360	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94432		0.07229		0.7261		0.47463		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24935	24935	SRR25557786	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant IX	GSM7688792		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-IX_S16_L001_R1_001.fastq.gz	fastq	513309395.0	6929648.0	GSM7688792 r1	0:74.07	A:137428462;C:118688804;G:122019962;T:134991729;N:180438	74		137428462	118688804	122019962	134991729	180438	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94188		0.07029		0.73772		0.47692		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24936	24936	SRR25557787	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant IX	GSM7688792		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-IX_S16_L002_R1_001.fastq.gz	fastq	517356735.0	6982196.0	GSM7688792 r2	0:74.10	A:138524037;C:119650852;G:122965491;T:136056171;N:160184	74		138524037	119650852	122965491	136056171	160184	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94281		0.06967		0.73963		0.48142		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24937	24937	SRR25557788	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant IX	GSM7688792		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-IX_S16_L003_R1_001.fastq.gz	fastq	519422328.0	7010631.0	GSM7688792 r3	0:74.09	A:139040684;C:120128748;G:123529198;T:136551898;N:171800	74		139040684	120128748	123529198	136551898	171800	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94297		0.06942		0.73726		0.47499		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24938	24938	SRR25557789	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant IX	GSM7688792		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-IX_S16_L004_R1_001.fastq.gz	fastq	511640294.0	6905748.0	GSM7688792 r4	0:74.09	A:136914638;C:118302866;G:121704665;T:134543505;N:174620	74		136914638	118302866	121704665	134543505	174620	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94176		0.07029		0.73868		0.47987		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24939	24939	SRR25557790	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant VIII	GSM7688791		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-VIII_S14_L001_R1_001.fastq.gz	fastq	429446821.0	5803178.0	GSM7688791 r1	0:74.00	A:114793535;C:99506379;G:102226914;T:112748761;N:171232	74		114793535	99506379	102226914	112748761	171232	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94175		0.06669		0.73673		0.48179		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24940	24940	SRR25557791	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant VIII	GSM7688791		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-VIII_S14_L002_R1_001.fastq.gz	fastq	434629893.0	5870828.0	GSM7688791 r2	0:74.03	A:116216940;C:100703527;G:103463365;T:114092681;N:153380	74		116216940	100703527	103463365	114092681	153380	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94143		0.0676		0.73791		0.48091		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24941	24941	SRR25557792	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant VIII	GSM7688791		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-VIII_S14_L003_R1_001.fastq.gz	fastq	435879881.0	5888685.0	GSM7688791 r3	0:74.02	A:116548094;C:100971153;G:103794902;T:114400770;N:164962	74		116548094	100971153	103794902	114400770	164962	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94195		0.06686		0.73785		0.48044		73		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24942	24942	SRR25557793	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant VIII	GSM7688791		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-VIII_S14_L004_R1_001.fastq.gz	fastq	429478475.0	5801978.0	GSM7688791 r4	0:74.02	A:114799280;C:99474677;G:102302775;T:112737475;N:164268	74		114799280	99474677	102302775	112737475	164268	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94118		0.06706		0.73892		0.47732		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24943	24943	SRR25557794	SRX21286661	SRS18536774	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant VII	GSM7688790		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688790	GSM7688790: Morphant VII; Danio rerio; RNA Seq	GSM7688790 r1	GSM7688790	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-VII_S15_L001_R1_001.fastq.gz	fastq	459545188.0	6215897.0	GSM7688790 r1	0:73.93	A:121926568;C:107379723;G:110263606;T:119766429;N:208862	73		121926568	107379723	110263606	119766429	208862	SRX21286661	SRS18536774	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94273		0.06072		0.74582		0.47499		73		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24944	24944	SRR25557795	SRX21286661	SRS18536774	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant VII	GSM7688790		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688790	GSM7688790: Morphant VII; Danio rerio; RNA Seq	GSM7688790 r1	GSM7688790	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-VII_S15_L002_R1_001.fastq.gz	fastq	463143624.0	6261406.0	GSM7688790 r2	0:73.97	A:122917997;C:108229793;G:111099867;T:120713978;N:181989	73		122917997	108229793	111099867	120713978	181989	SRX21286661	SRS18536774	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94387		0.06093		0.74341		0.47351		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24945	24945	SRR25557796	SRX21286661	SRS18536774	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant VII	GSM7688790		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688790	GSM7688790: Morphant VII; Danio rerio; RNA Seq	GSM7688790 r1	GSM7688790	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-VII_S15_L003_R1_001.fastq.gz	fastq	465959664.0	6300929.0	GSM7688790 r3	0:73.95	A:123689364;C:108847593;G:111847868;T:121377463;N:197376	73		123689364	108847593	111847868	121377463	197376	SRX21286661	SRS18536774	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94322		0.06219		0.74357		0.47977		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24946	24946	SRR25557797	SRX21286661	SRS18536774	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant VII	GSM7688790		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688790	GSM7688790: Morphant VII; Danio rerio; RNA Seq	GSM7688790 r1	GSM7688790	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Morphant-VII_S15_L004_R1_001.fastq.gz	fastq	459075430.0	6207363.0	GSM7688790 r4	0:73.96	A:121797426;C:107221116;G:110209684;T:119657308;N:189896	73		121797426	107221116	110209684	119657308	189896	SRX21286661	SRS18536774	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94313		0.06211		0.74343		0.47801		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24947	24947	SRR25557798	SRX21286660	SRS18536773	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control XI	GSM7688787		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688787	GSM7688787: Control XI; Danio rerio; RNA Seq	GSM7688787 r1	GSM7688787	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-XI_S2_L001_R1_001.fastq.gz	fastq	439719566.0	5947052.0	GSM7688787 r1	0:73.94	A:117482073;C:102083665;G:104685444;T:115272860;N:195524	73		117482073	102083665	104685444	115272860	195524	SRX21286660	SRS18536773	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94829		0.06278		0.72525		0.46494		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24948	24948	SRR25557799	SRX21286660	SRS18536773	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control XI	GSM7688787		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688787	GSM7688787: Control XI; Danio rerio; RNA Seq	GSM7688787 r1	GSM7688787	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-XI_S2_L002_R1_001.fastq.gz	fastq	438533503.0	5927990.0	GSM7688787 r2	0:73.98	A:117199594;C:101810881;G:104402169;T:114946611;N:174248	73		117199594	101810881	104402169	114946611	174248	SRX21286660	SRS18536773	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94887		0.06387		0.72827		0.46616		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24949	24949	SRR25557800	SRX21286660	SRS18536773	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control XI	GSM7688787		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688787	GSM7688787: Control XI; Danio rerio; RNA Seq	GSM7688787 r1	GSM7688787	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-XI_S2_L003_R1_001.fastq.gz	fastq	443995554.0	6003540.0	GSM7688787 r3	0:73.96	A:118663936;C:103031716;G:105723574;T:116387834;N:188494	73		118663936	103031716	105723574	116387834	188494	SRX21286660	SRS18536773	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94788		0.06232		0.72693		0.46653		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24950	24950	SRR25557801	SRX21286660	SRS18536773	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control XI	GSM7688787		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688787	GSM7688787: Control XI; Danio rerio; RNA Seq	GSM7688787 r1	GSM7688787	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-XI_S2_L004_R1_001.fastq.gz	fastq	435088869.0	5882642.0	GSM7688787 r4	0:73.96	A:116261447;C:100986653;G:103615584;T:114042354;N:182831	73		116261447	100986653	103615584	114042354	182831	SRX21286660	SRS18536773	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94914		0.06241		0.72829		0.4546		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24951	24951	SRR25557802	SRX21286659	SRS18536772	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control X	GSM7688785		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688785	GSM7688785: Control X; Danio rerio; RNA Seq	GSM7688785 r1	GSM7688785	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-X_S1_L001_R1_001.fastq.gz	fastq	395130702.0	5338263.0	GSM7688785 r1	0:74.02	A:107005793;C:90183031;G:92316770;T:105476481;N:148627	74		107005793	90183031	92316770	105476481	148627	SRX21286659	SRS18536772	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94534		0.07625		0.73888		0.48135		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24952	24952	SRR25557803	SRX21286659	SRS18536772	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control X	GSM7688785		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688785	GSM7688785: Control X; Danio rerio; RNA Seq	GSM7688785 r1	GSM7688785	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-X_S1_L002_R1_001.fastq.gz	fastq	396764458.0	5358448.0	GSM7688785 r2	0:74.04	A:107513717;C:90540282;G:92658504;T:105917444;N:134511	74		107513717	90540282	92658504	105917444	134511	SRX21286659	SRS18536772	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94374		0.07709		0.73878		0.47615		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24953	24953	SRR25557804	SRX21286659	SRS18536772	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control X	GSM7688785		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688785	GSM7688785: Control X; Danio rerio; RNA Seq	GSM7688785 r1	GSM7688785	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-X_S1_L003_R1_001.fastq.gz	fastq	399623551.0	5397520.0	GSM7688785 r3	0:74.04	A:108230540;C:91192011;G:93388052;T:106665106;N:147842	74		108230540	91192011	93388052	106665106	147842	SRX21286659	SRS18536772	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94399		0.07657		0.73797		0.4794		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24954	24954	SRR25557805	SRX21286659	SRS18536772	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control X	GSM7688785		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688785	GSM7688785: Control X; Danio rerio; RNA Seq	GSM7688785 r1	GSM7688785	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-X_S1_L004_R1_001.fastq.gz	fastq	393298978.0	5312101.0	GSM7688785 r4	0:74.04	A:106518845;C:89734564;G:91901232;T:105004490;N:139847	74		106518845	89734564	91901232	105004490	139847	SRX21286659	SRS18536772	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94423		0.07599		0.73884		0.47905		71		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24955	24955	SRR25557806	SRX21286658	SRS18536771	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control IX	GSM7688783		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688783	GSM7688783: Control IX; Danio rerio; RNA Seq	GSM7688783 r1	GSM7688783	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-IX_S22_L001_R1_001.fastq.gz	fastq	366045799.0	4944832.0	GSM7688783 r1	0:74.03	A:98000119;C:84654222;G:86951226;T:96295351;N:144881	74		98000119	84654222	86951226	96295351	144881	SRX21286658	SRS18536771	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94303		0.07499		0.73085		0.47881		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24956	24956	SRR25557807	SRX21286658	SRS18536771	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control IX	GSM7688783		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688783	GSM7688783: Control IX; Danio rerio; RNA Seq	GSM7688783 r1	GSM7688783	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-IX_S22_L002_R1_001.fastq.gz	fastq	369429068.0	4988719.0	GSM7688783 r2	0:74.05	A:98907882;C:85446993;G:87729593;T:97216477;N:128123	74		98907882	85446993	87729593	97216477	128123	SRX21286658	SRS18536771	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94261		0.07335		0.72969		0.47867		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24957	24957	SRR25557808	SRX21286658	SRS18536771	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Control IX	GSM7688783		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688783	GSM7688783: Control IX; Danio rerio; RNA Seq	GSM7688783 r1	GSM7688783	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884		loader:fastq load.py	Control-IX_S22_L003_R1_001.fastq.gz	fastq	369967330.0	4996710.0	GSM7688783 r3	0:74.04	A:99035743;C:85549878;G:87926587;T:97310812;N:144310	74		99035743	85549878	87926587	97310812	144310	SRX21286658	SRS18536771	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94328		0.0743		0.73034		0.47133		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System

Advanced export

JSON shape: default, array, newline-delimited

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;