run_metadata
86 rows where devstage_curation_coarse = "Embryo" and experiment.library_strategy = "ncRNA-Seq"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 25277 | 25277 | SRR30160454 | SRX25627658 | SRS22272474 | SRP457111 | PRJNA1009808 | Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] | GSE241754 | Transcriptome Analysis | Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. | parent bioproject:PRJNA1009800 | pubmed:39402326 | WT bud 10 hpf charged tRNA seqrep 3 | GSM8441306 | tissue:10 hpf embryos|cell type:10 hpf embryos|geo loc name:missing|collection date:missing | WT bud 10 hpf charged tRNA seqrep 3 | Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions | 10 hpf embryos | Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform. | cell type:10 hpf embryos | GSM8441306 | GSM8441306: WT bud 10 hpf charged tRNA seqrep 3; Danio rerio; ncRNA Seq | GSM8441306 r1 | GSM8441306 | 1 | Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform. | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina NovaSeq 6000 | SRP457111 | 10hpf_aa_rep3.fastq.gz | fastq | 193965330.0 | 3367323.0 | GSM8441306 r1 | 0:57.60 | A:36799299;C:55100074;G:53758955;T:48306966;N:36 | 57 | 36799299 | 55100074 | 53758955 | 48306966 | 36 | SRX25627658 | SRS22272474 | SRA1941998 | Max Planck Institute of Biochemistry | Max Planck Institute of Biochemistry | 1 | 0.34405 | 0.05049 | 0.89471 | 0.46469 | 88 | B | usable mapping rate | illumina | novaseq_era | 5prime | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2024-08-05 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||
| 25278 | 25278 | SRR30160455 | SRX25627657 | SRS22272473 | SRP457111 | PRJNA1009808 | Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] | GSE241754 | Transcriptome Analysis | Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. | parent bioproject:PRJNA1009800 | pubmed:39402326 | WT bud 10 hpf charged tRNA seqrep 2 | GSM8441305 | tissue:10 hpf embryos|cell type:10 hpf embryos|geo loc name:missing|collection date:missing | WT bud 10 hpf charged tRNA seqrep 2 | Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions | 10 hpf embryos | Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform. | cell type:10 hpf embryos | GSM8441305 | GSM8441305: WT bud 10 hpf charged tRNA seqrep 2; Danio rerio; ncRNA Seq | GSM8441305 r1 | GSM8441305 | 1 | Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform. | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina NovaSeq 6000 | SRP457111 | 10hpf_aa_rep2.fastq.gz | fastq | 138524715.0 | 2369009.0 | GSM8441305 r1 | 0:58.47 | A:26396279;C:39139297;G:38459048;T:34530060;N:31 | 58 | 26396279 | 39139297 | 38459048 | 34530060 | 31 | SRX25627657 | SRS22272473 | SRA1941998 | Max Planck Institute of Biochemistry | Max Planck Institute of Biochemistry | 1 | 0.35458 | 0.05179 | 0.89424 | 0.46401 | 74 | B | usable mapping rate | illumina | novaseq_era | 5prime | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2024-08-05 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||
| 25279 | 25279 | SRR30160456 | SRX25627656 | SRS22272472 | SRP457111 | PRJNA1009808 | Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] | GSE241754 | Transcriptome Analysis | Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. | parent bioproject:PRJNA1009800 | pubmed:39402326 | WT bud 10 hpf charged tRNA seqrep 1 | GSM8441304 | tissue:10 hpf embryos|cell type:10 hpf embryos|geo loc name:missing|collection date:missing | WT bud 10 hpf charged tRNA seqrep 1 | Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions | 10 hpf embryos | Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform. | cell type:10 hpf embryos | GSM8441304 | GSM8441304: WT bud 10 hpf charged tRNA seqrep 1; Danio rerio; ncRNA Seq | GSM8441304 r1 | GSM8441304 | 1 | Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform. | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina NovaSeq 6000 | SRP457111 | 10hpf_aa_rep1.fastq.gz | fastq | 54473618.0 | 946419.0 | GSM8441304 r1 | 0:57.56 | A:10345022;C:15413782;G:15135500;T:13579304;N:10 | 57 | 10345022 | 15413782 | 15135500 | 13579304 | 10 | SRX25627656 | SRS22272472 | SRA1941998 | Max Planck Institute of Biochemistry | Max Planck Institute of Biochemistry | 1 | 0.36103 | 0.0515 | 0.89227 | 0.4748 | 81 | B | usable mapping rate | illumina | novaseq_era | 5prime | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2024-08-05 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||
| 25280 | 25280 | SRR30160457 | SRX25627655 | SRS22272471 | SRP457111 | PRJNA1009808 | Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] | GSE241754 | Transcriptome Analysis | Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. | parent bioproject:PRJNA1009800 | pubmed:39402326 | WT sphere 4 hpf charged tRNA seqrep 3 | GSM8441303 | tissue:4 hpf embryos|cell type:4 hpf embryos|geo loc name:missing|collection date:missing | WT sphere 4 hpf charged tRNA seqrep 3 | Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions | 4 hpf embryos | Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform. | cell type:4 hpf embryos | GSM8441303 | GSM8441303: WT sphere 4 hpf charged tRNA seqrep 3; Danio rerio; ncRNA Seq | GSM8441303 r1 | GSM8441303 | 1 | Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform. | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina NovaSeq 6000 | SRP457111 | 4hpf_aa_rep3.fastq.gz | fastq | 100810543.0 | 1747597.0 | GSM8441303 r1 | 0:57.69 | A:20466558;C:28054923;G:26849246;T:25439798;N:18 | 57 | 20466558 | 28054923 | 26849246 | 25439798 | 18 | SRX25627655 | SRS22272471 | SRA1941998 | Max Planck Institute of Biochemistry | Max Planck Institute of Biochemistry | 1 | 0.36374 | 0.06294 | 0.87316 | 0.54642 | 39 | B | usable mapping rate | illumina | novaseq_era | 5prime | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2024-08-05 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||
| 25281 | 25281 | SRR30160458 | SRX25627654 | SRS22272470 | SRP457111 | PRJNA1009808 | Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] | GSE241754 | Transcriptome Analysis | Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. | parent bioproject:PRJNA1009800 | pubmed:39402326 | WT sphere 4 hpf charged tRNA seqrep 2 | GSM8441302 | tissue:4 hpf embryos|cell type:4 hpf embryos|geo loc name:missing|collection date:missing | WT sphere 4 hpf charged tRNA seqrep 2 | Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions | 4 hpf embryos | Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform. | cell type:4 hpf embryos | GSM8441302 | GSM8441302: WT sphere 4 hpf charged tRNA seqrep 2; Danio rerio; ncRNA Seq | GSM8441302 r1 | GSM8441302 | 1 | Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform. | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina NovaSeq 6000 | SRP457111 | 4hpf_aa_rep2.fastq.gz | fastq | 121662759.0 | 2046536.0 | GSM8441302 r1 | 0:59.45 | A:24519095;C:33689156;G:32726095;T:30728382;N:31 | 59 | 24519095 | 33689156 | 32726095 | 30728382 | 31 | SRX25627654 | SRS22272470 | SRA1941998 | Max Planck Institute of Biochemistry | Max Planck Institute of Biochemistry | 1 | 0.3726 | 0.06263 | 0.87136 | 0.55584 | 31 | B | usable mapping rate | illumina | novaseq_era | 5prime | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2024-08-05 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||
| 25282 | 25282 | SRR30160459 | SRX25627653 | SRS22272469 | SRP457111 | PRJNA1009808 | Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] | GSE241754 | Transcriptome Analysis | Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. | parent bioproject:PRJNA1009800 | pubmed:39402326 | WT sphere 4 hpf charged tRNA seqrep 1 | GSM8441301 | tissue:4 hpf embryos|cell type:4 hpf embryos|geo loc name:missing|collection date:missing | WT sphere 4 hpf charged tRNA seqrep 1 | Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions | 4 hpf embryos | Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform. | cell type:4 hpf embryos | GSM8441301 | GSM8441301: WT sphere 4 hpf charged tRNA seqrep 1; Danio rerio; ncRNA Seq | GSM8441301 r1 | GSM8441301 | 1 | Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform. | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina NovaSeq 6000 | SRP457111 | 4hpf_aa_rep1.fastq.gz | fastq | 124990980.0 | 2116213.0 | GSM8441301 r1 | 0:59.06 | A:25487542;C:34621140;G:33284460;T:31597816;N:22 | 59 | 25487542 | 34621140 | 33284460 | 31597816 | 22 | SRX25627653 | SRS22272469 | SRA1941998 | Max Planck Institute of Biochemistry | Max Planck Institute of Biochemistry | 1 | 0.36013 | 0.05967 | 0.87387 | 0.55002 | 44 | B | usable mapping rate | illumina | novaseq_era | 5prime | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2024-08-05 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||
| 25283 | 25283 | SRR25764121 | SRX21486801 | SRS18719093 | SRP457111 | PRJNA1009808 | Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] | GSE241754 | Transcriptome Analysis | Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. | parent bioproject:PRJNA1009800 | pubmed:39402326 | WT bud 10 hpf tRNA seq rep2 | GSM7734782 | source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT|geo loc name:missing|collection date:missing | WT bud 10 hpf tRNA seq rep2 | Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts | Gastrula | unperturbed growth conditions in E3 medium for zebrafish embryos. | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. | strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT | GSM7734782 | GSM7734782: WT bud 10 hpf tRNA seq rep2; Danio rerio; ncRNA Seq | GSM7734782 r1 | GSM7734782 | 1 | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP457111 | WT_tRNA_bud_2.fastq.gz | fastq | 278145656.0 | 4215107.0 | GSM7734782 r1 | 0:65.99 | A:52499947;C:77161357;G:79314034;T:69169753;N:565 | 65 | 52499947 | 77161357 | 79314034 | 69169753 | 565 | SRX21486801 | SRS18719093 | SRA1700461 | Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry | Max Planck Institute of Biochemistry | 1 | 0.31888 | 0.01661 | 0.92348 | 0.40156 | 75 | B | usable mapping rate | illumina | nextseq | 5prime | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2023-08-28 | Gastrula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||
| 25284 | 25284 | SRR25764122 | SRX21486800 | SRS18719092 | SRP457111 | PRJNA1009808 | Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] | GSE241754 | Transcriptome Analysis | Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. | parent bioproject:PRJNA1009800 | pubmed:39402326 | WT bud 10 hpf tRNA seq rep1 | GSM7734781 | source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT|geo loc name:missing|collection date:missing | WT bud 10 hpf tRNA seq rep1 | Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts | Gastrula | unperturbed growth conditions in E3 medium for zebrafish embryos. | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. | strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT | GSM7734781 | GSM7734781: WT bud 10 hpf tRNA seq rep1; Danio rerio; ncRNA Seq | GSM7734781 r1 | GSM7734781 | 1 | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP457111 | WT_tRNA_bud_1.fastq.gz | fastq | 385514625.0 | 5770392.0 | GSM7734781 r1 | 0:66.81 | A:73305393;C:107155246;G:109793285;T:95259823;N:878 | 66 | 73305393 | 107155246 | 109793285 | 95259823 | 878 | SRX21486800 | SRS18719092 | SRA1700461 | Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry | Max Planck Institute of Biochemistry | 1 | 0.33213 | 0.01782 | 0.92354 | 0.42724 | 39 | B | usable mapping rate | illumina | nextseq | 5prime | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2023-08-28 | Gastrula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||
| 25285 | 25285 | SRR25764123 | SRX21486799 | SRS18719098 | SRP457111 | PRJNA1009808 | Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] | GSE241754 | Transcriptome Analysis | Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. | parent bioproject:PRJNA1009800 | pubmed:39402326 | WT shield 6 hpf tRNA seq rep2 | GSM7734780 | source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Shield 6 hpf|genotype:WT|geo loc name:missing|collection date:missing | WT shield 6 hpf tRNA seq rep2 | Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts | Gastrula | unperturbed growth conditions in E3 medium for zebrafish embryos. | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. | strain:TLAB strain|tissue:Gastrula|developmental stage:Shield 6 hpf|genotype:WT | GSM7734780 | GSM7734780: WT shield 6 hpf tRNA seq rep2; Danio rerio; ncRNA Seq | GSM7734780 r1 | GSM7734780 | 1 | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP457111 | WT_tRNA_shield_2.fastq.gz | fastq | 469031736.0 | 7421688.0 | GSM7734780 r1 | 0:63.20 | A:90257219;C:130440728;G:130549302;T:117783411;N:1076 | 63 | 90257219 | 130440728 | 130549302 | 117783411 | 1076 | SRX21486799 | SRS18719098 | SRA1700461 | Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry | Max Planck Institute of Biochemistry | 1 | 0.29535 | 0.02113 | 0.91528 | 0.43824 | 37 | B | usable mapping rate | illumina | nextseq | 5prime | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2023-08-28 | Gastrula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||
| 25286 | 25286 | SRR25764124 | SRX21486798 | SRS18719100 | SRP457111 | PRJNA1009808 | Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] | GSE241754 | Transcriptome Analysis | Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. | parent bioproject:PRJNA1009800 | pubmed:39402326 | WT shield 6 hpf tRNA seq rep1 | GSM7734779 | source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Shield 6 hpf|genotype:WT|geo loc name:missing|collection date:missing | WT shield 6 hpf tRNA seq rep1 | Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts | Gastrula | unperturbed growth conditions in E3 medium for zebrafish embryos. | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. | strain:TLAB strain|tissue:Gastrula|developmental stage:Shield 6 hpf|genotype:WT | GSM7734779 | GSM7734779: WT shield 6 hpf tRNA seq rep1; Danio rerio; ncRNA Seq | GSM7734779 r1 | GSM7734779 | 1 | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP457111 | WT_tRNA_shield_1.fastq.gz | fastq | 487207771.0 | 7521930.0 | GSM7734779 r1 | 0:64.77 | A:94654510;C:134893975;G:135716906;T:121941280;N:1100 | 64 | 94654510 | 134893975 | 135716906 | 121941280 | 1100 | SRX21486798 | SRS18719100 | SRA1700461 | Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry | Max Planck Institute of Biochemistry | 1 | 0.30664 | 0.02274 | 0.91297 | 0.46012 | 79 | B | usable mapping rate | illumina | nextseq | 5prime | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2023-08-28 | Gastrula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||
| 25287 | 25287 | SRR25764125 | SRX21486797 | SRS18719094 | SRP457111 | PRJNA1009808 | Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] | GSE241754 | Transcriptome Analysis | Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. | parent bioproject:PRJNA1009800 | pubmed:39402326 | WT sphere 4 hpf tRNA seq rep2 | GSM7734778 | source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT|geo loc name:missing|collection date:missing | WT sphere 4 hpf tRNA seq rep2 | Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts | Blastula | unperturbed growth conditions in E3 medium for zebrafish embryos. | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. | strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT | GSM7734778 | GSM7734778: WT sphere 4 hpf tRNA seq rep2; Danio rerio; ncRNA Seq | GSM7734778 r1 | GSM7734778 | 1 | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP457111 | WT_tRNA_sphere_2.fastq.gz | fastq | 196089572.0 | 2998867.0 | GSM7734778 r1 | 0:65.39 | A:39134451;C:53803100;G:53602781;T:49548779;N:461 | 65 | 39134451 | 53803100 | 53602781 | 49548779 | 461 | SRX21486797 | SRS18719094 | SRA1700461 | Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry | Max Planck Institute of Biochemistry | 1 | 0.28808 | 0.01959 | 0.91553 | 0.47742 | 78 | B | usable mapping rate | illumina | nextseq | 5prime | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2023-08-28 | Blastula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||
| 25288 | 25288 | SRR25764126 | SRX21486796 | SRS18719096 | SRP457111 | PRJNA1009808 | Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] | GSE241754 | Transcriptome Analysis | Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. | parent bioproject:PRJNA1009800 | pubmed:39402326 | WT sphere 4 hpf tRNA seq rep1 | GSM7734777 | source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT|geo loc name:missing|collection date:missing | WT sphere 4 hpf tRNA seq rep1 | Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts | Blastula | unperturbed growth conditions in E3 medium for zebrafish embryos. | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. | strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT | GSM7734777 | GSM7734777: WT sphere 4 hpf tRNA seq rep1; Danio rerio; ncRNA Seq | GSM7734777 r1 | GSM7734777 | 1 | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP457111 | WT_tRNA_sphere_1.fastq.gz | fastq | 273027894.0 | 4080366.0 | GSM7734777 r1 | 0:66.91 | A:54678043;C:74713512;G:74872888;T:68762883;N:568 | 66 | 54678043 | 74713512 | 74872888 | 68762883 | 568 | SRX21486796 | SRS18719096 | SRA1700461 | Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry | Max Planck Institute of Biochemistry | 1 | 0.30124 | 0.01877 | 0.9163 | 0.49987 | 79 | B | usable mapping rate | illumina | nextseq | 5prime | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2023-08-28 | Blastula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||
| 25289 | 25289 | SRR25764127 | SRX21486795 | SRS18719097 | SRP457111 | PRJNA1009808 | Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] | GSE241754 | Transcriptome Analysis | Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. | parent bioproject:PRJNA1009800 | pubmed:39402326 | WT 1000 cell 3 hpf tRNA seq rep2 | GSM7734776 | source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:1000 cell 3 hpf|genotype:WT|geo loc name:missing|collection date:missing | WT 1000 cell 3 hpf tRNA seq rep2 | Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts | Blastula | unperturbed growth conditions in E3 medium for zebrafish embryos. | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. | strain:TLAB strain|tissue:Blastula|developmental stage:1000 cell 3 hpf|genotype:WT | GSM7734776 | GSM7734776: WT 1000 cell 3 hpf tRNA seq rep2; Danio rerio; ncRNA Seq | GSM7734776 r1 | GSM7734776 | 1 | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP457111 | WT_tRNA_1Kcell_2.fastq.gz | fastq | 240973473.0 | 3918764.0 | GSM7734776 r1 | 0:61.49 | A:48091658;C:66684510;G:65183534;T:61013184;N:587 | 61 | 48091658 | 66684510 | 65183534 | 61013184 | 587 | SRX21486795 | SRS18719097 | SRA1700461 | Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry | Max Planck Institute of Biochemistry | 1 | 0.26629 | 0.02297 | 0.92305 | 0.48525 | 79 | B | usable mapping rate | illumina | nextseq | 5prime | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2023-08-28 | Blastula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||
| 25290 | 25290 | SRR25764128 | SRX21486794 | SRS18719095 | SRP457111 | PRJNA1009808 | Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] | GSE241754 | Transcriptome Analysis | Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. | parent bioproject:PRJNA1009800 | pubmed:39402326 | WT 1000 cell 3 hpf tRNA seq rep1 | GSM7734775 | source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:1000 cell 3 hpf|genotype:WT|geo loc name:missing|collection date:missing | WT 1000 cell 3 hpf tRNA seq rep1 | Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts | Blastula | unperturbed growth conditions in E3 medium for zebrafish embryos. | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. | strain:TLAB strain|tissue:Blastula|developmental stage:1000 cell 3 hpf|genotype:WT | GSM7734775 | GSM7734775: WT 1000 cell 3 hpf tRNA seq rep1; Danio rerio; ncRNA Seq | GSM7734775 r1 | GSM7734775 | 1 | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP457111 | WT_tRNA_1Kcell_1.fastq.gz | fastq | 153597915.0 | 2445091.0 | GSM7734775 r1 | 0:62.82 | A:30905842;C:42377268;G:41639937;T:38674503;N:365 | 62 | 30905842 | 42377268 | 41639937 | 38674503 | 365 | SRX21486794 | SRS18719095 | SRA1700461 | Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry | Max Planck Institute of Biochemistry | 1 | 0.27317 | 0.02516 | 0.92454 | 0.49385 | 77 | B | usable mapping rate | illumina | nextseq | 5prime | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2023-08-28 | Blastula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||
| 25291 | 25291 | SRR25764129 | SRX21486793 | SRS18719091 | SRP457111 | PRJNA1009808 | Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] | GSE241754 | Transcriptome Analysis | Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. | parent bioproject:PRJNA1009800 | pubmed:39402326 | WT 256 cell 2.5 hpf tRNA seq rep2 | GSM7734774 | source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:256 cell 2.5 hpf|genotype:WT|geo loc name:missing|collection date:missing | WT 256 cell 2.5 hpf tRNA seq rep2 | Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts | Blastula | unperturbed growth conditions in E3 medium for zebrafish embryos. | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. | strain:TLAB strain|tissue:Blastula|developmental stage:256 cell 2.5 hpf|genotype:WT | GSM7734774 | GSM7734774: WT 256 cell 2.5 hpf tRNA seq rep2; Danio rerio; ncRNA Seq | GSM7734774 r1 | GSM7734774 | 1 | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP457111 | WT_tRNA_256cell_2.fastq.gz | fastq | 844659062.0 | 13660310.0 | GSM7734774 r1 | 0:61.83 | A:165996817;C:234451560;G:230230791;T:213977958;N:1936 | 61 | 165996817 | 234451560 | 230230791 | 213977958 | 1936 | SRX21486793 | SRS18719091 | SRA1700461 | Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry | Max Planck Institute of Biochemistry | 1 | 0.26001 | 0.01993 | 0.92594 | 0.45714 | 61 | B | usable mapping rate | illumina | nextseq | 5prime | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2023-08-28 | Blastula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||
| 25292 | 25292 | SRR25764130 | SRX21486792 | SRS18719088 | SRP457111 | PRJNA1009808 | Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] | GSE241754 | Transcriptome Analysis | Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. | parent bioproject:PRJNA1009800 | pubmed:39402326 | WT 256 cell 2.5 hpf tRNA seq rep1 | GSM7734773 | source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:256 cell 2.5 hpf|genotype:WT|geo loc name:missing|collection date:missing | WT 256 cell 2.5 hpf tRNA seq rep1 | Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts | Blastula | unperturbed growth conditions in E3 medium for zebrafish embryos. | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. | strain:TLAB strain|tissue:Blastula|developmental stage:256 cell 2.5 hpf|genotype:WT | GSM7734773 | GSM7734773: WT 256 cell 2.5 hpf tRNA seq rep1; Danio rerio; ncRNA Seq | GSM7734773 r1 | GSM7734773 | 1 | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP457111 | WT_tRNA_256cell_1.fastq.gz | fastq | 215968508.0 | 3436266.0 | GSM7734773 r1 | 0:62.85 | A:43791388;C:59547637;G:58130851;T:54498124;N:508 | 62 | 43791388 | 59547637 | 58130851 | 54498124 | 508 | SRX21486792 | SRS18719088 | SRA1700461 | Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry | Max Planck Institute of Biochemistry | 1 | 0.27383 | 0.02205 | 0.92748 | 0.46217 | 71 | B | usable mapping rate | illumina | nextseq | 5prime | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2023-08-28 | Blastula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||
| 25293 | 25293 | SRR25764131 | SRX21486791 | SRS18719090 | SRP457111 | PRJNA1009808 | Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] | GSE241754 | Transcriptome Analysis | Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. | parent bioproject:PRJNA1009800 | pubmed:39402326 | WT egg 0 hpf tRNA seq rep2 | GSM7734772 | source name:Unfertilized egg|strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT|geo loc name:missing|collection date:missing | WT egg 0 hpf tRNA seq rep2 | Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts | Unfertilized egg | unperturbed growth conditions in E3 medium for zebrafish embryos. | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. | strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT | GSM7734772 | GSM7734772: WT egg 0 hpf tRNA seq rep2; Danio rerio; ncRNA Seq | GSM7734772 r1 | GSM7734772 | 1 | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP457111 | WT_tRNA_egg_2.fastq.gz | fastq | 206374994.0 | 3181706.0 | GSM7734772 r1 | 0:64.86 | A:41195250;C:56578032;G:56479855;T:52121365;N:492 | 64 | 41195250 | 56578032 | 56479855 | 52121365 | 492 | SRX21486791 | SRS18719090 | SRA1700461 | Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry | Max Planck Institute of Biochemistry | 1 | 0.28659 | 0.02017 | 0.9207 | 0.48536 | 78 | B | usable mapping rate | illumina | nextseq | 5prime | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2023-08-28 | Zygote | Embryo | Oocyte | Reproductive System | ||||||||||||||||
| 25294 | 25294 | SRR25764132 | SRX21486790 | SRS18719089 | SRP457111 | PRJNA1009808 | Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] | GSE241754 | Transcriptome Analysis | Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. | parent bioproject:PRJNA1009800 | pubmed:39402326 | WT egg 0 hpf tRNA seq rep1 | GSM7734771 | source name:Unfertilized egg|strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT|geo loc name:missing|collection date:missing | WT egg 0 hpf tRNA seq rep1 | Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts | Unfertilized egg | unperturbed growth conditions in E3 medium for zebrafish embryos. | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle. | strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT | GSM7734771 | GSM7734771: WT egg 0 hpf tRNA seq rep1; Danio rerio; ncRNA Seq | GSM7734771 r1 | GSM7734771 | 1 | 50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP457111 | WT_tRNA_egg_1.fastq.gz | fastq | 86021968.0 | 1304769.0 | GSM7734771 r1 | 0:65.93 | A:17511521;C:23474625;G:23300759;T:21734864;N:199 | 65 | 17511521 | 23474625 | 23300759 | 21734864 | 199 | SRX21486790 | SRS18719089 | SRA1700461 | Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry | Max Planck Institute of Biochemistry | 1 | 0.29829 | 0.02027 | 0.92245 | 0.48877 | 74 | B | usable mapping rate | illumina | nextseq | 5prime | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2023-08-28 | Zygote | Embryo | Oocyte | Reproductive System | ||||||||||||||||
| 28985 | 28985 | SRR26936267 | SRX22630108 | SRS19628590 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | La 6 | GSM7916507 | tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing | La 6 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:Low2 | GSM7916507 | GSM7916507: La 6; Danio rerio; ncRNA Seq | GSM7916507 r1 | GSM7916507 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X32_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz | fastq | 810705967.0 | 27544418.0 | GSM7916507 r1 | 0:29.43 | A:141437993;C:173890211;G:258408531;T:236922660;N:46572 | 29 | 141437993 | 173890211 | 258408531 | 236922660 | 46572 | SRX22630108 | SRS19628590 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.86832 | 0.1884 | 0.84735 | 0.64657 | 21 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 28986 | 28986 | SRR26936231 | SRX22630107 | SRS19628589 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | La 5 | GSM7916506 | tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing | La 5 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:Low1 | GSM7916506 | GSM7916506: La 5; Danio rerio; ncRNA Seq | GSM7916506 r1 | GSM7916506 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X31_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz | fastq | 1237906972.0 | 45149037.0 | GSM7916506 r1 | 0:27.42 | A:273044213;C:252818121;G:368519115;T:343444331;N:81192 | 27 | 273044213 | 252818121 | 368519115 | 343444331 | 81192 | SRX22630107 | SRS19628589 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.86015 | 0.25463 | 0.83798 | 0.67166 | 25 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 28987 | 28987 | SRR26936232 | SRX22630106 | SRS19628588 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Hb 2 | GSM7916505 | tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing | Hb 2 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:High2 | GSM7916505 | GSM7916505: Hb 2; Danio rerio; ncRNA Seq | GSM7916505 r1 | GSM7916505 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X30_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz | fastq | 214730387.0 | 7217086.0 | GSM7916505 r1 | 0:29.75 | A:42819722;C:48080032;G:67677978;T:56140049;N:12606 | 29 | 42819722 | 48080032 | 67677978 | 56140049 | 12606 | SRX22630106 | SRS19628588 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.85212 | 0.1617 | 0.86856 | 0.69163 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 28988 | 28988 | SRR26936233 | SRX22630105 | SRS19628587 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Hb 1 | GSM7916504 | tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing | Hb 1 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:High2 | GSM7916504 | GSM7916504: Hb 1; Danio rerio; ncRNA Seq | GSM7916504 r1 | GSM7916504 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X29_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz | fastq | 595989272.0 | 21399963.0 | GSM7916504 r1 | 0:27.85 | A:128259525;C:125823294;G:181746588;T:160121380;N:38485 | 27 | 128259525 | 125823294 | 181746588 | 160121380 | 38485 | SRX22630105 | SRS19628587 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.85218 | 0.22941 | 0.83595 | 0.6151 | 30 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 28989 | 28989 | SRR26936234 | SRX22630104 | SRS19628586 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Lb 6 | GSM7916503 | tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing | Lb 6 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:Low2 | GSM7916503 | GSM7916503: Lb 6; Danio rerio; ncRNA Seq | GSM7916503 r1 | GSM7916503 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X28_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz | fastq | 969307398.0 | 35511411.0 | GSM7916503 r1 | 0:27.30 | A:205174189;C:203840471;G:285952255;T:274278193;N:62290 | 27 | 205174189 | 203840471 | 285952255 | 274278193 | 62290 | SRX22630104 | SRS19628586 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.85414 | 0.22608 | 0.8505 | 0.62202 | 33 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 28990 | 28990 | SRR26936235 | SRX22630103 | SRS19628585 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Ha 6 | GSM7916502 | tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing | Ha 6 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:High1 | GSM7916502 | GSM7916502: Ha 6; Danio rerio; ncRNA Seq | GSM7916502 r1 | GSM7916502 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X27_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz | fastq | 1326612630.0 | 47094729.0 | GSM7916502 r1 | 0:28.17 | A:303455697;C:273680466;G:382978796;T:366416311;N:81360 | 28 | 303455697 | 273680466 | 382978796 | 366416311 | 81360 | SRX22630103 | SRS19628585 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.84786 | 0.24696 | 0.82946 | 0.68975 | 37 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 28991 | 28991 | SRR26936236 | SRX22630102 | SRS19628584 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Ha 5 | GSM7916501 | tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing | Ha 5 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:High1 | GSM7916501 | GSM7916501: Ha 5; Danio rerio; ncRNA Seq | GSM7916501 r1 | GSM7916501 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X26_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz | fastq | 471823428.0 | 16704799.0 | GSM7916501 r1 | 0:28.24 | A:103178860;C:100561292;G:155557190;T:112495106;N:30980 | 28 | 103178860 | 100561292 | 155557190 | 112495106 | 30980 | SRX22630102 | SRS19628584 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.61628 | 0.14433 | 0.91275 | 0.6543 | 28 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 28992 | 28992 | SRR26936237 | SRX22630101 | SRS19628583 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | La 4 | GSM7916500 | tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing | La 4 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:Low1 | GSM7916500 | GSM7916500: La 4; Danio rerio; ncRNA Seq | GSM7916500 r1 | GSM7916500 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X25_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz | fastq | 713371286.0 | 25212566.0 | GSM7916500 r1 | 0:28.29 | A:155201946;C:151864186;G:207971547;T:198288220;N:45387 | 28 | 155201946 | 151864186 | 207971547 | 198288220 | 45387 | SRX22630101 | SRS19628583 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.8507 | 0.2078 | 0.83031 | 0.62739 | 22 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 28993 | 28993 | SRR26936238 | SRX22630100 | SRS19628582 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Hb 5 | GSM7916499 | tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing | Hb 5 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:High2 | GSM7916499 | GSM7916499: Hb 5; Danio rerio; ncRNA Seq | GSM7916499 r1 | GSM7916499 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X24_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz | fastq | 1043060550.0 | 35761504.0 | GSM7916499 r1 | 0:29.17 | A:217942105;C:216398395;G:316456102;T:292217159;N:46789 | 29 | 217942105 | 216398395 | 316456102 | 292217159 | 46789 | SRX22630100 | SRS19628582 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.82114 | 0.20881 | 0.85622 | 0.68486 | 19 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 28994 | 28994 | SRR26936239 | SRX22630099 | SRS19628581 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Hb 4 | GSM7916498 | tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing | Hb 4 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:High2 | GSM7916498 | GSM7916498: Hb 4; Danio rerio; ncRNA Seq | GSM7916498 r1 | GSM7916498 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X23_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz | fastq | 1357956641.0 | 47869361.0 | GSM7916498 r1 | 0:28.37 | A:293740473;C:276333777;G:404639503;T:383181225;N:61663 | 28 | 293740473 | 276333777 | 404639503 | 383181225 | 61663 | SRX22630099 | SRS19628581 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.79885 | 0.22306 | 0.8425 | 0.6656 | 26 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 28995 | 28995 | SRR26936240 | SRX22630098 | SRS19628580 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Lb 5 | GSM7916497 | tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing | Lb 5 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:Low2 | GSM7916497 | GSM7916497: Lb 5; Danio rerio; ncRNA Seq | GSM7916497 r1 | GSM7916497 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X22_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz | fastq | 669771811.0 | 23848259.0 | GSM7916497 r1 | 0:28.08 | A:132916986;C:135594797;G:198730347;T:202498953;N:30728 | 28 | 132916986 | 135594797 | 198730347 | 202498953 | 30728 | SRX22630098 | SRS19628580 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.80999 | 0.24188 | 0.84658 | 0.68339 | 20 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 28996 | 28996 | SRR26936241 | SRX22630097 | SRS19628579 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Ha 4 | GSM7916496 | tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing | Ha 4 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:High1 | GSM7916496 | GSM7916496: Ha 4; Danio rerio; ncRNA Seq | GSM7916496 r1 | GSM7916496 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X21_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz | fastq | 853803123.0 | 28538725.0 | GSM7916496 r1 | 0:29.92 | A:158220512;C:186146914;G:264519321;T:244878221;N:38155 | 29 | 158220512 | 186146914 | 264519321 | 244878221 | 38155 | SRX22630097 | SRS19628579 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.828 | 0.18458 | 0.85851 | 0.6483 | 32 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 28997 | 28997 | SRR26936242 | SRX22630096 | SRS19628578 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Ha 3 | GSM7916495 | tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing | Ha 3 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:High1 | GSM7916495 | GSM7916495: Ha 3; Danio rerio; ncRNA Seq | GSM7916495 r1 | GSM7916495 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X20_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz | fastq | 629106097.0 | 21383957.0 | GSM7916495 r1 | 0:29.42 | A:117216944;C:131994022;G:192623524;T:187243523;N:28084 | 29 | 117216944 | 131994022 | 192623524 | 187243523 | 28084 | SRX22630096 | SRS19628578 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.8166 | 0.20457 | 0.84112 | 0.65357 | 22 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 28998 | 28998 | SRR26936243 | SRX22630095 | SRS19628577 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | La 1 | GSM7916494 | tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing | La 1 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:Low1 | GSM7916494 | GSM7916494: La 1; Danio rerio; ncRNA Seq | GSM7916494 r1 | GSM7916494 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X19_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz | fastq | 21178378.0 | 739280.0 | GSM7916494 r1 | 0:28.65 | A:4323144;C:4478932;G:6303136;T:6072190;N:976 | 28 | 4323144 | 4478932 | 6303136 | 6072190 | 976 | SRX22630095 | SRS19628577 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.85277 | 0.21158 | 0.87434 | 0.62601 | 26 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 28999 | 28999 | SRR26936244 | SRX22630094 | SRS19628576 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Lb 4 | GSM7916493 | tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing | Lb 4 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:Low2 | GSM7916493 | GSM7916493: Lb 4; Danio rerio; ncRNA Seq | GSM7916493 r1 | GSM7916493 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X18_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz | fastq | 959247745.0 | 33043430.0 | GSM7916493 r1 | 0:29.03 | A:225208425;C:212535680;G:284062577;T:237397072;N:43991 | 29 | 225208425 | 212535680 | 284062577 | 237397072 | 43991 | SRX22630094 | SRS19628576 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.82232 | 0.22592 | 0.87073 | 0.6135 | 22 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 29000 | 29000 | SRR26936245 | SRX22630093 | SRS19628575 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Lb 3 | GSM7916492 | tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing | Lb 3 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:Low1 | GSM7916492 | GSM7916492: Lb 3; Danio rerio; ncRNA Seq | GSM7916492 r1 | GSM7916492 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X17_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz | fastq | 900287704.0 | 31947371.0 | GSM7916492 r1 | 0:28.18 | A:224093089;C:188919051;G:262824615;T:224407166;N:43783 | 28 | 224093089 | 188919051 | 262824615 | 224407166 | 43783 | SRX22630093 | SRS19628575 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.67003 | 0.17024 | 0.87095 | 0.6869 | 19 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 29001 | 29001 | SRR26936246 | SRX22630092 | SRS19628574 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Hb 3 | GSM7916491 | tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing | Hb 3 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:Low2 | GSM7916491 | GSM7916491: Hb 3; Danio rerio; ncRNA Seq | GSM7916491 r1 | GSM7916491 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X16_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz | fastq | 80986783.0 | 3427704.0 | GSM7916491 r1 | 0:23.63 | A:18164838;C:19014879;G:24153410;T:19641723;N:11933 | 23 | 18164838 | 19014879 | 24153410 | 19641723 | 11933 | SRX22630092 | SRS19628574 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.83312 | 0.24402 | 0.88749 | 0.63345 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 29002 | 29002 | SRR26936247 | SRX22630091 | SRS19628573 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | La 3 | GSM7916490 | tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing | La 3 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:High2 | GSM7916490 | GSM7916490: La 3; Danio rerio; ncRNA Seq | GSM7916490 r1 | GSM7916490 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X15_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz | fastq | 148933985.0 | 6314805.0 | GSM7916490 r1 | 0:23.58 | A:39058546;C:30363738;G:44242466;T:35240575;N:28660 | 23 | 39058546 | 30363738 | 44242466 | 35240575 | 28660 | SRX22630091 | SRS19628573 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.41302 | 0.13369 | 0.89802 | 0.57553 | 22 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 29003 | 29003 | SRR26936248 | SRX22630090 | SRS19628572 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | La 2 | GSM7916489 | tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing | La 2 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:Low1 | GSM7916489 | GSM7916489: La 2; Danio rerio; ncRNA Seq | GSM7916489 r1 | GSM7916489 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X14_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz | fastq | 538382421.0 | 23079847.0 | GSM7916489 r1 | 0:23.33 | A:119659971;C:112896468;G:162693210;T:143063074;N:69698 | 23 | 119659971 | 112896468 | 162693210 | 143063074 | 69698 | SRX22630090 | SRS19628572 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.81532 | 0.23945 | 0.8758 | 0.62425 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 29004 | 29004 | SRR26936249 | SRX22630089 | SRS19628571 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Ha 1 | GSM7916488 | tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing | Ha 1 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:High1 | GSM7916488 | GSM7916488: Ha 1; Danio rerio; ncRNA Seq | GSM7916488 r1 | GSM7916488 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X13_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz | fastq | 761541737.0 | 32310434.0 | GSM7916488 r1 | 0:23.57 | A:182485471;C:173949932;G:214306916;T:190683160;N:116258 | 23 | 182485471 | 173949932 | 214306916 | 190683160 | 116258 | SRX22630089 | SRS19628571 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.82936 | 0.23022 | 0.85098 | 0.59571 | 19 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 29005 | 29005 | SRR26936250 | SRX22630088 | SRS19628570 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Lb 2 | GSM7916487 | tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing | Lb 2 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:Low2 | GSM7916487 | GSM7916487: Lb 2; Danio rerio; ncRNA Seq | GSM7916487 r1 | GSM7916487 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X12_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz | fastq | 559417322.0 | 23757934.0 | GSM7916487 r1 | 0:23.55 | A:126286771;C:106333997;G:170445137;T:156287131;N:64286 | 23 | 126286771 | 106333997 | 170445137 | 156287131 | 64286 | SRX22630088 | SRS19628570 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.85098 | 0.26224 | 0.8608 | 0.59344 | 22 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 29006 | 29006 | SRR26936251 | SRX22630087 | SRS19628569 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Lb 1 | GSM7916486 | tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing | Lb 1 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:High2 | GSM7916486 | GSM7916486: Lb 1; Danio rerio; ncRNA Seq | GSM7916486 r1 | GSM7916486 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X11_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz | fastq | 498695572.0 | 21269833.0 | GSM7916486 r1 | 0:23.45 | A:122716879;C:84997892;G:144626268;T:146292630;N:61903 | 23 | 122716879 | 84997892 | 144626268 | 146292630 | 61903 | SRX22630087 | SRS19628569 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.84251 | 0.1958 | 0.8591 | 0.61008 | 24 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 29007 | 29007 | SRR26936252 | SRX22630086 | SRS19628568 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Hb 10 | GSM7916485 | tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing | Hb 10 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:Low1 | GSM7916485 | GSM7916485: Hb 10; Danio rerio; ncRNA Seq | GSM7916485 r1 | GSM7916485 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X10_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz | fastq | 686865211.0 | 29320389.0 | GSM7916485 r1 | 0:23.43 | A:156131568;C:132162427;G:201526230;T:196961742;N:83244 | 23 | 156131568 | 132162427 | 201526230 | 196961742 | 83244 | SRX22630086 | SRS19628568 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.85707 | 0.27856 | 0.85648 | 0.59717 | 28 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 29008 | 29008 | SRR26936253 | SRX22630085 | SRS19628567 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | La 9 | GSM7916484 | tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing | La 9 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:High1 | GSM7916484 | GSM7916484: La 9; Danio rerio; ncRNA Seq | GSM7916484 r1 | GSM7916484 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X9_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz | fastq | 561289514.0 | 23860643.0 | GSM7916484 r1 | 0:23.52 | A:140848879;C:98838555;G:161520871;T:160013845;N:67364 | 23 | 140848879 | 98838555 | 161520871 | 160013845 | 67364 | SRX22630085 | SRS19628567 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.85507 | 0.17768 | 0.86969 | 0.64792 | 22 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 29009 | 29009 | SRR26936254 | SRX22630084 | SRS19628566 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | La 8 | GSM7916483 | tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing | La 8 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:Low2 | GSM7916483 | GSM7916483: La 8; Danio rerio; ncRNA Seq | GSM7916483 r1 | GSM7916483 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X8_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz | fastq | 458491681.0 | 16224249.0 | GSM7916483 r1 | 0:28.26 | A:99631677;C:90884289;G:139467457;T:128470855;N:37403 | 28 | 99631677 | 90884289 | 139467457 | 128470855 | 37403 | SRX22630084 | SRS19628566 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.81704 | 0.21909 | 0.84762 | 0.6293 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 29010 | 29010 | SRR26936255 | SRX22630083 | SRS19628565 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Ha 9 | GSM7916482 | tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing | Ha 9 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:Low1 | GSM7916482 | GSM7916482: Ha 9; Danio rerio; ncRNA Seq | GSM7916482 r1 | GSM7916482 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X7_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz | fastq | 574511047.0 | 20295283.0 | GSM7916482 r1 | 0:28.31 | A:134481373;C:122719422;G:169313406;T:147944946;N:51900 | 28 | 134481373 | 122719422 | 169313406 | 147944946 | 51900 | SRX22630083 | SRS19628565 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.81932 | 0.19984 | 0.85987 | 0.58268 | 23 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 29011 | 29011 | SRR26936256 | SRX22630082 | SRS19628564 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Lb 8 | GSM7916481 | tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing | Lb 8 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:Low2 | GSM7916481 | GSM7916481: Lb 8; Danio rerio; ncRNA Seq | GSM7916481 r1 | GSM7916481 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X6_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz | fastq | 1086899780.0 | 37486748.0 | GSM7916481 r1 | 0:28.99 | A:219996636;C:232899819;G:335644980;T:298269921;N:88424 | 28 | 219996636 | 232899819 | 335644980 | 298269921 | 88424 | SRX22630082 | SRS19628564 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.86943 | 0.2105 | 0.84461 | 0.67703 | 44 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 29012 | 29012 | SRR26936257 | SRX22630081 | SRS19628563 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Hb 9 | GSM7916480 | tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing | Hb 9 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:High2 | GSM7916480 | GSM7916480: Hb 9; Danio rerio; ncRNA Seq | GSM7916480 r1 | GSM7916480 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X5_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz | fastq | 1144093618.0 | 39048750.0 | GSM7916480 r1 | 0:29.30 | A:223769668;C:238953593;G:358148504;T:323130325;N:91528 | 29 | 223769668 | 238953593 | 358148504 | 323130325 | 91528 | SRX22630081 | SRS19628563 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.87445 | 0.1906 | 0.87237 | 0.70919 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 29013 | 29013 | SRR26936258 | SRX22630080 | SRS19628562 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Hb 7 | GSM7916515 | tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing | Hb 7 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:High2 | GSM7916515 | GSM7916515: Hb 7; Danio rerio; ncRNA Seq | GSM7916515 r1 | GSM7916515 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X40_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz | fastq | 263782568.0 | 9802454.0 | GSM7916515 r1 | 0:26.91 | A:59378855;C:53589034;G:83219251;T:67574216;N:21212 | 26 | 59378855 | 53589034 | 83219251 | 67574216 | 21212 | SRX22630080 | SRS19628562 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.80146 | 0.31524 | 0.81008 | 0.47305 | 30 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 29014 | 29014 | SRR26936260 | SRX22630079 | SRS19628561 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Ha 8 | GSM7916514 | tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing | Ha 8 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:High1 | GSM7916514 | GSM7916514: Ha 8; Danio rerio; ncRNA Seq | GSM7916514 r1 | GSM7916514 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X39_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz | fastq | 252119227.0 | 9309447.0 | GSM7916514 r1 | 0:27.08 | A:53293803;C:51577689;G:79148986;T:68078043;N:20706 | 27 | 53293803 | 51577689 | 79148986 | 68078043 | 20706 | SRX22630079 | SRS19628561 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.75593 | 0.29042 | 0.83412 | 0.59657 | 21 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 29015 | 29015 | SRR26936261 | SRX22630078 | SRS19628560 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Hb 6 | GSM7916513 | tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing | Hb 6 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:High2 | GSM7916513 | GSM7916513: Hb 6; Danio rerio; ncRNA Seq | GSM7916513 r1 | GSM7916513 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X38_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz | fastq | 516408240.0 | 19719085.0 | GSM7916513 r1 | 0:26.19 | A:112791146;C:102652986;G:160354602;T:140566375;N:43131 | 26 | 112791146 | 102652986 | 160354602 | 140566375 | 43131 | SRX22630078 | SRS19628560 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.80401 | 0.31982 | 0.83765 | 0.57755 | 22 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 29016 | 29016 | SRR26936262 | SRX22630077 | SRS19628559 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Ha 7 | GSM7916512 | tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing | Ha 7 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:High1 | GSM7916512 | GSM7916512: Ha 7; Danio rerio; ncRNA Seq | GSM7916512 r1 | GSM7916512 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X37_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz | fastq | 554171558.0 | 20779285.0 | GSM7916512 r1 | 0:26.67 | A:125256371;C:111354628;G:172197000;T:145317427;N:46132 | 26 | 125256371 | 111354628 | 172197000 | 145317427 | 46132 | SRX22630077 | SRS19628559 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.81035 | 0.28326 | 0.82933 | 0.62525 | 35 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 29017 | 29017 | SRR26936263 | SRX22630076 | SRS19628558 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Lb 10 | GSM7916511 | tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing | Lb 10 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:Low2 | GSM7916511 | GSM7916511: Lb 10; Danio rerio; ncRNA Seq | GSM7916511 r1 | GSM7916511 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X36_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz | fastq | 983846643.0 | 32513493.0 | GSM7916511 r1 | 0:30.26 | A:181840038;C:211101778;G:320659770;T:270174775;N:70282 | 30 | 181840038 | 211101778 | 320659770 | 270174775 | 70282 | SRX22630076 | SRS19628558 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.88133 | 0.15829 | 0.86324 | 0.67761 | 37 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 29018 | 29018 | SRR26936264 | SRX22630075 | SRS19628557 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Lb 9 | GSM7916510 | tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing | Lb 9 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:Low2 | GSM7916510 | GSM7916510: Lb 9; Danio rerio; ncRNA Seq | GSM7916510 r1 | GSM7916510 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X35_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz | fastq | 1077131964.0 | 37869598.0 | GSM7916510 r1 | 0:28.44 | A:210508796;C:220304812;G:327237157;T:319001223;N:79976 | 28 | 210508796 | 220304812 | 327237157 | 319001223 | 79976 | SRX22630075 | SRS19628557 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.84871 | 0.22867 | 0.83968 | 0.66027 | 35 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 29019 | 29019 | SRR26936265 | SRX22630074 | SRS19628556 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Lb 7 | GSM7916509 | tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing | Lb 7 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:Low1 | GSM7916509 | GSM7916509: Lb 7; Danio rerio; ncRNA Seq | GSM7916509 r1 | GSM7916509 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X34_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz | fastq | 1203153474.0 | 42565421.0 | GSM7916509 r1 | 0:28.27 | A:269760359;C:263088083;G:348288367;T:321910116;N:106549 | 28 | 269760359 | 263088083 | 348288367 | 321910116 | 106549 | SRX22630074 | SRS19628556 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.82319 | 0.21661 | 0.82432 | 0.65954 | 33 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 29020 | 29020 | SRR26936266 | SRX22630073 | SRS19628555 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | La 7 | GSM7916508 | tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing | La 7 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:Low1 | GSM7916508 | GSM7916508: La 7; Danio rerio; ncRNA Seq | GSM7916508 r1 | GSM7916508 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X33_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz | fastq | 1137464666.0 | 42434385.0 | GSM7916508 r1 | 0:26.81 | A:240256314;C:218420241;G:336730784;T:341968066;N:89261 | 26 | 240256314 | 218420241 | 336730784 | 341968066 | 89261 | SRX22630073 | SRS19628555 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.84647 | 0.26357 | 0.85313 | 0.67665 | 22 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 29021 | 29021 | SRR26936259 | SRX22630072 | SRS19628554 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Hb 8 | GSM7916479 | tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing | Hb 8 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:High2 | GSM7916479 | GSM7916479: Hb 8; Danio rerio; ncRNA Seq | GSM7916479 r1 | GSM7916479 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X4_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz | fastq | 1014850001.0 | 36540733.0 | GSM7916479 r1 | 0:27.77 | A:205870762;C:199482442;G:294628769;T:314783528;N:84500 | 27 | 205870762 | 199482442 | 294628769 | 314783528 | 84500 | SRX22630072 | SRS19628554 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.84303 | 0.28884 | 0.81692 | 0.66059 | 26 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 29022 | 29022 | SRR26936268 | SRX22630071 | SRS19628553 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | La 10 | GSM7916478 | tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing | La 10 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:Low1 | GSM7916478 | GSM7916478: La 10; Danio rerio; ncRNA Seq | GSM7916478 r1 | GSM7916478 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X3_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz | fastq | 916186556.0 | 32659639.0 | GSM7916478 r1 | 0:28.05 | A:216314501;C:191651870;G:267047552;T:241092719;N:79914 | 28 | 216314501 | 191651870 | 267047552 | 241092719 | 79914 | SRX22630071 | SRS19628553 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.84312 | 0.23836 | 0.83132 | 0.57754 | 33 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 29023 | 29023 | SRR26936269 | SRX22630070 | SRS19628552 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Ha 10 | GSM7916477 | tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing | Ha 10 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:High1 | GSM7916477 | GSM7916477: Ha 10; Danio rerio; ncRNA Seq | GSM7916477 r1 | GSM7916477 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X2_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz | fastq | 858990742.0 | 30463457.0 | GSM7916477 r1 | 0:28.20 | A:182799146;C:179417249;G:265490509;T:231201694;N:82144 | 28 | 182799146 | 179417249 | 265490509 | 231201694 | 82144 | SRX22630070 | SRS19628552 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.67221 | 0.19137 | 0.87986 | 0.67831 | 33 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 29024 | 29024 | SRR26936270 | SRX22630069 | SRS19628551 | SRP473892 | PRJNA1044439 | Social stress in fathers affects sperm small RNA and offspring transcriptome profiles | GSE248535 | Transcriptome Analysis | Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing. | pubmed:40121340 | Ha 2 | GSM7916476 | tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing | Ha 2 | Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. | sperm | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | cell line:sperm|genotype:WT|treatment:High1 | GSM7916476 | GSM7916476: Ha 2; Danio rerio; ncRNA Seq | GSM7916476 r1 | GSM7916476 | 1 | Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP473892 | 12235X1_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz | fastq | 262855265.0 | 9317037.0 | GSM7916476 r1 | 0:28.21 | A:59555006;C:56655912;G:79385169;T:67236972;N:22206 | 28 | 59555006 | 56655912 | 79385169 | 67236972 | 22206 | SRX22630069 | SRS19628551 | SRA1756943 | University of East Anglia | University of East Anglia | 1 | 0.85088 | 0.21543 | 0.84102 | 0.63415 | 28 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | United Kingdom | 2023-11-23 | Undetermined | Embryo | Cell Line | Cell Line | |||||||||||||||||||
| 36266 | 36266 | SRR953577 | SRX336218 | SRS471213 | SRP028895 | PRJNA138095 | Transcriptome wide analysis of small RNA expression in early zebrafish development | GSE27722 | Transcriptome Analysis | During early vertebrate development a large number of noncoding RNAs are maternally inherited or expressed upon activation of zygotic transcription. The exact identity expression levels and function during early vertebrate development for most of these noncoding RNAs remains largely unknown. miRNAs microRNAs and piRNAs piwi interacting RNAs are two classes of small non coding RNAs that play important roles in gene regulation during early embryonic development. Here we utilized Illumina next generation sequencing technology to determine temporal expression patterns for both miRNAs and piRNAs during four distinct stages of early vertebrate development using zebrafish as a model system. For miRNAs the expression patterns for 192 known miRNAs and 12 novel miRNAs within 123 different miRNA families were determined. Significant sequence variation was observed at the five prime' and three prime' ends of miRNAs with a large number of extra nucleotides added in a non template directed manner. We also identified a large and diverse set of piRNAs expressed during early development far beyond that expected if piRNA expression is restricted to germ cells. Our analyses represent the deepest investigation to date of small RNA expression during early vertebrate development and suggest important novel functions for small RNAs during embryogenesis. Overall design: Identify the expression of small RNAs in zebrafish embryos of four different developmental stages using high through put sequencing | pubmed:22408181 | embryo 1dpf rep1 | GSM686385 | source name:the whole embryo|strain:AB*WT|developmental stage:1dpf|tissue:the whole embryos | embryo 1dpf rep1 | fasta: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. All the sequence with N inside was removed as well. The unique sequences were retained with the counts indicating thier abundance. The header of each sequence is composed of a unique sequence ID followed by a " x" and the reads counts. e.g. unique ID x counts. alignment: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. Small RNAs with perfect matches to the zebrafish genome Zv8 from Ensembl http://www.ensembl.org were retrieved using megaBLAST http://www.ncbi.nlm.nih.gov/blast/megablast.shtml and Bowtie http://bowtie bio.sourceforge.net/tutorial.shtml. To identify piRNAs consensus sequences from zebrafish repetitive elements were retrieved from Repbase http://www.girinst.org/repbase/index.html and Repeat Maskers using the UCSC genome browser http://genome.ucsc.edu. Small RNAs perfectly mapping to these consensus sequences and their genomic flanking regions were sorted into piRNA libraries with up to 3 genomic mapping positions for each unique RNA sequence. fasta files description: small RNA 15 30 nt alignment file description: piRNA map to repetitive elements | the whole embryo | Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. | Embryos were raised at 28°C in egg water 0.03% Instant Ocean marine salt mix for the initial several hours of development | strain:AB*WT|developmental stage:1dpf|tissue:the whole embryos | GSM686385 | GSM686385: embryo 1dpf rep1; Danio rerio; ncRNA Seq | GSM686385 | 1 | Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. | GEO Accession:GSM686385 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer II | SRP028895 | GSM686385_1dpf_Raw.txt | fastq | 293700240.0 | 8158340.0 | GSM686385 r1 | 0:36 | A:74642033;C:62153879;G:83836688;T:69542606;N:3525034 | 36 | 74642033 | 62153879 | 83836688 | 69542606 | 3525034 | SRX336218 | SRS471213 | SRA098146 | GEO | Lee Lab, Molecular Biology, Mass General Hospital | 1 | 0.00386 | 0.00274 | 0.99758 | 0.53623 | 36 | T | under 1.2% mapping rate | illumina | early_illumina | 5prime | size_fractionation | unknown | bulk | unknown | unknown | United States | 2011-03-07 | Pharyngula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 36267 | 36267 | SRR953576 | SRX336217 | SRS471211 | SRP028895 | PRJNA138095 | Transcriptome wide analysis of small RNA expression in early zebrafish development | GSE27722 | Transcriptome Analysis | During early vertebrate development a large number of noncoding RNAs are maternally inherited or expressed upon activation of zygotic transcription. The exact identity expression levels and function during early vertebrate development for most of these noncoding RNAs remains largely unknown. miRNAs microRNAs and piRNAs piwi interacting RNAs are two classes of small non coding RNAs that play important roles in gene regulation during early embryonic development. Here we utilized Illumina next generation sequencing technology to determine temporal expression patterns for both miRNAs and piRNAs during four distinct stages of early vertebrate development using zebrafish as a model system. For miRNAs the expression patterns for 192 known miRNAs and 12 novel miRNAs within 123 different miRNA families were determined. Significant sequence variation was observed at the five prime' and three prime' ends of miRNAs with a large number of extra nucleotides added in a non template directed manner. We also identified a large and diverse set of piRNAs expressed during early development far beyond that expected if piRNA expression is restricted to germ cells. Our analyses represent the deepest investigation to date of small RNA expression during early vertebrate development and suggest important novel functions for small RNAs during embryogenesis. Overall design: Identify the expression of small RNAs in zebrafish embryos of four different developmental stages using high through put sequencing | pubmed:22408181 | embryo Shield rep1 | GSM686384 | source name:the whole embryo|strain:AB*WT|developmental stage:Shield|tissue:the whole embryos | embryo Shield rep1 | fasta: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. All the sequence with N inside was removed as well. The unique sequences were retained with the counts indicating thier abundance. The header of each sequence is composed of a unique sequence ID followed by a " x" and the reads counts. e.g. unique ID x counts. alignment: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. Small RNAs with perfect matches to the zebrafish genome Zv8 from Ensembl http://www.ensembl.org were retrieved using megaBLAST http://www.ncbi.nlm.nih.gov/blast/megablast.shtml and Bowtie http://bowtie bio.sourceforge.net/tutorial.shtml. To identify piRNAs consensus sequences from zebrafish repetitive elements were retrieved from Repbase http://www.girinst.org/repbase/index.html and Repeat Maskers using the UCSC genome browser http://genome.ucsc.edu. Small RNAs perfectly mapping to these consensus sequences and their genomic flanking regions were sorted into piRNA libraries with up to 3 genomic mapping positions for each unique RNA sequence. fasta files description: small RNA 15 30 nt alignment file description: piRNA map to repetitive elements | the whole embryo | Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. | Embryos were raised at 28°C in egg water 0.03% Instant Ocean marine salt mix for the initial several hours of development | strain:AB*WT|developmental stage:Shield|tissue:the whole embryos | GSM686384 | GSM686384: embryo Shield rep1; Danio rerio; ncRNA Seq | GSM686384 | 1 | Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. | GEO Accession:GSM686384 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer II | SRP028895 | GSM686384_Shield_Raw.txt | fastq | 115067916.0 | 3196331.0 | GSM686384 r1 | 0:36 | A:28435718;C:21893278;G:31779352;T:26635839;N:6323729 | 36 | 28435718 | 21893278 | 31779352 | 26635839 | 6323729 | SRX336217 | SRS471211 | SRA098146 | GEO | Lee Lab, Molecular Biology, Mass General Hospital | 1 | 0.00278 | 0.00217 | 0.99933 | 0.60606 | 36 | T | under 1.2% mapping rate | illumina | early_illumina | 5prime | size_fractionation | unknown | bulk | unknown | unknown | United States | 2011-03-07 | Gastrula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 36268 | 36268 | SRR953575 | SRX336216 | SRS471212 | SRP028895 | PRJNA138095 | Transcriptome wide analysis of small RNA expression in early zebrafish development | GSE27722 | Transcriptome Analysis | During early vertebrate development a large number of noncoding RNAs are maternally inherited or expressed upon activation of zygotic transcription. The exact identity expression levels and function during early vertebrate development for most of these noncoding RNAs remains largely unknown. miRNAs microRNAs and piRNAs piwi interacting RNAs are two classes of small non coding RNAs that play important roles in gene regulation during early embryonic development. Here we utilized Illumina next generation sequencing technology to determine temporal expression patterns for both miRNAs and piRNAs during four distinct stages of early vertebrate development using zebrafish as a model system. For miRNAs the expression patterns for 192 known miRNAs and 12 novel miRNAs within 123 different miRNA families were determined. Significant sequence variation was observed at the five prime' and three prime' ends of miRNAs with a large number of extra nucleotides added in a non template directed manner. We also identified a large and diverse set of piRNAs expressed during early development far beyond that expected if piRNA expression is restricted to germ cells. Our analyses represent the deepest investigation to date of small RNA expression during early vertebrate development and suggest important novel functions for small RNAs during embryogenesis. Overall design: Identify the expression of small RNAs in zebrafish embryos of four different developmental stages using high through put sequencing | pubmed:22408181 | embryo sphere rep2 | GSM686383 | source name:the whole embryo|strain:AB*WT|developmental stage:sphere|tissue:the whole embryos | embryo sphere rep2 | fasta: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. All the sequence with N inside was removed as well. The unique sequences were retained with the counts indicating thier abundance. The header of each sequence is composed of a unique sequence ID followed by a " x" and the reads counts. e.g. unique ID x counts. alignment: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. Small RNAs with perfect matches to the zebrafish genome Zv8 from Ensembl http://www.ensembl.org were retrieved using megaBLAST http://www.ncbi.nlm.nih.gov/blast/megablast.shtml and Bowtie http://bowtie bio.sourceforge.net/tutorial.shtml. To identify piRNAs consensus sequences from zebrafish repetitive elements were retrieved from Repbase http://www.girinst.org/repbase/index.html and Repeat Maskers using the UCSC genome browser http://genome.ucsc.edu. Small RNAs perfectly mapping to these consensus sequences and their genomic flanking regions were sorted into piRNA libraries with up to 3 genomic mapping positions for each unique RNA sequence. fasta files description: small RNA 15 30 nt alignment file description: piRNA map to repetitive elements | the whole embryo | Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. | Embryos were raised at 28°C in egg water 0.03% Instant Ocean marine salt mix for the initial several hours of development | strain:AB*WT|developmental stage:sphere|tissue:the whole embryos | GSM686383 | GSM686383: embryo sphere rep2; Danio rerio; ncRNA Seq | GSM686383 | 1 | Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. | GEO Accession:GSM686383 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer II | SRP028895 | GSM686383_Sphere_2_Raw.txt | fastq | 369741456.0 | 10270596.0 | GSM686383 r1 | 0:36 | A:89854472;C:70044086;G:109552597;T:100266590;N:23711 | 36 | 89854472 | 70044086 | 109552597 | 100266590 | 23711 | SRX336216 | SRS471212 | SRA098146 | GEO | Lee Lab, Molecular Biology, Mass General Hospital | 1 | 0.00421 | 0.00367 | 0.99924 | 0.51111 | 36 | T | under 1.2% mapping rate | illumina | early_illumina | 5prime | size_fractionation | unknown | bulk | unknown | unknown | United States | 2011-03-07 | Blastula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 36269 | 36269 | SRR953574 | SRX336215 | SRS471209 | SRP028895 | PRJNA138095 | Transcriptome wide analysis of small RNA expression in early zebrafish development | GSE27722 | Transcriptome Analysis | During early vertebrate development a large number of noncoding RNAs are maternally inherited or expressed upon activation of zygotic transcription. The exact identity expression levels and function during early vertebrate development for most of these noncoding RNAs remains largely unknown. miRNAs microRNAs and piRNAs piwi interacting RNAs are two classes of small non coding RNAs that play important roles in gene regulation during early embryonic development. Here we utilized Illumina next generation sequencing technology to determine temporal expression patterns for both miRNAs and piRNAs during four distinct stages of early vertebrate development using zebrafish as a model system. For miRNAs the expression patterns for 192 known miRNAs and 12 novel miRNAs within 123 different miRNA families were determined. Significant sequence variation was observed at the five prime' and three prime' ends of miRNAs with a large number of extra nucleotides added in a non template directed manner. We also identified a large and diverse set of piRNAs expressed during early development far beyond that expected if piRNA expression is restricted to germ cells. Our analyses represent the deepest investigation to date of small RNA expression during early vertebrate development and suggest important novel functions for small RNAs during embryogenesis. Overall design: Identify the expression of small RNAs in zebrafish embryos of four different developmental stages using high through put sequencing | pubmed:22408181 | embryo sphere rep1 | GSM686382 | source name:the whole embryo|strain:AB*WT|developmental stage:sphere|tissue:the whole embryos | embryo sphere rep1 | fasta: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. All the sequence with N inside was removed as well. The unique sequences were retained with the counts indicating thier abundance. The header of each sequence is composed of a unique sequence ID followed by a " x" and the reads counts. e.g. unique ID x counts. alignment: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. Small RNAs with perfect matches to the zebrafish genome Zv8 from Ensembl http://www.ensembl.org were retrieved using megaBLAST http://www.ncbi.nlm.nih.gov/blast/megablast.shtml and Bowtie http://bowtie bio.sourceforge.net/tutorial.shtml. To identify piRNAs consensus sequences from zebrafish repetitive elements were retrieved from Repbase http://www.girinst.org/repbase/index.html and Repeat Maskers using the UCSC genome browser http://genome.ucsc.edu. Small RNAs perfectly mapping to these consensus sequences and their genomic flanking regions were sorted into piRNA libraries with up to 3 genomic mapping positions for each unique RNA sequence. fasta files description: small RNA 15 30 nt alignment file description: piRNA map to repetitive elements | the whole embryo | Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. | Embryos were raised at 28°C in egg water 0.03% Instant Ocean marine salt mix for the initial several hours of development | strain:AB*WT|developmental stage:sphere|tissue:the whole embryos | GSM686382 | GSM686382: embryo sphere rep1; Danio rerio; ncRNA Seq | GSM686382 | 1 | Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. | GEO Accession:GSM686382 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer II | SRP028895 | GSM686382_Sphere_1_Raw.txt | fastq | 492502284.0 | 13680619.0 | GSM686382 r1 | 0:36 | A:114418890;C:99502519;G:142841794;T:135061742;N:677339 | 36 | 114418890 | 99502519 | 142841794 | 135061742 | 677339 | SRX336215 | SRS471209 | SRA098146 | GEO | Lee Lab, Molecular Biology, Mass General Hospital | 1 | 0.00828 | 0.00636 | 0.9964 | 0.54822 | 36 | T | under 1.2% mapping rate | illumina | early_illumina | 5prime | size_fractionation | unknown | bulk | unknown | unknown | United States | 2011-03-07 | Blastula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 36270 | 36270 | SRR953573 | SRX336214 | SRS471210 | SRP028895 | PRJNA138095 | Transcriptome wide analysis of small RNA expression in early zebrafish development | GSE27722 | Transcriptome Analysis | During early vertebrate development a large number of noncoding RNAs are maternally inherited or expressed upon activation of zygotic transcription. The exact identity expression levels and function during early vertebrate development for most of these noncoding RNAs remains largely unknown. miRNAs microRNAs and piRNAs piwi interacting RNAs are two classes of small non coding RNAs that play important roles in gene regulation during early embryonic development. Here we utilized Illumina next generation sequencing technology to determine temporal expression patterns for both miRNAs and piRNAs during four distinct stages of early vertebrate development using zebrafish as a model system. For miRNAs the expression patterns for 192 known miRNAs and 12 novel miRNAs within 123 different miRNA families were determined. Significant sequence variation was observed at the five prime' and three prime' ends of miRNAs with a large number of extra nucleotides added in a non template directed manner. We also identified a large and diverse set of piRNAs expressed during early development far beyond that expected if piRNA expression is restricted to germ cells. Our analyses represent the deepest investigation to date of small RNA expression during early vertebrate development and suggest important novel functions for small RNAs during embryogenesis. Overall design: Identify the expression of small RNAs in zebrafish embryos of four different developmental stages using high through put sequencing | pubmed:22408181 | embryo 256 cell rep1 | GSM686381 | source name:the whole embryo|strain:AB* WT|developmental stage:256 cell|tissue:the whole embryos | embryo 256 cell rep1 | fasta: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. All the sequence with N inside was removed as well. The unique sequences were retained with the counts indicating thier abundance. The header of each sequence is composed of a unique sequence ID followed by a " x" and the reads counts. e.g. unique ID x counts. alignment: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. Small RNAs with perfect matches to the zebrafish genome Zv8 from Ensembl http://www.ensembl.org were retrieved using megaBLAST http://www.ncbi.nlm.nih.gov/blast/megablast.shtml and Bowtie http://bowtie bio.sourceforge.net/tutorial.shtml. To identify piRNAs consensus sequences from zebrafish repetitive elements were retrieved from Repbase http://www.girinst.org/repbase/index.html and Repeat Maskers using the UCSC genome browser http://genome.ucsc.edu. Small RNAs perfectly mapping to these consensus sequences and their genomic flanking regions were sorted into piRNA libraries with up to 3 genomic mapping positions for each unique RNA sequence. fasta files description: small RNA 15 30 nt alignment file description: piRNA map to repetitive elements | the whole embryo | Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. | Embryos were raised at 28°C in egg water 0.03% Instant Ocean marine salt mix for the initial several hours of development | strain:AB* WT|developmental stage:256 cell|tissue:the whole embryos | GSM686381 | GSM686381: embryo 256 cell rep1; Danio rerio; ncRNA Seq | GSM686381 | 1 | Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform. | GEO Accession:GSM686381 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer II | SRP028895 | GSM686381_256-cell_Raw.txt | fastq | 177430716.0 | 4928631.0 | GSM686381 r1 | 0:36 | A:46047586;C:39494059;G:46591098;T:42305117;N:2992856 | 36 | 46047586 | 39494059 | 46591098 | 42305117 | 2992856 | SRX336214 | SRS471210 | SRA098146 | GEO | Lee Lab, Molecular Biology, Mass General Hospital | 1 | 0.01914 | 0.01515 | 0.99164 | 0.52579 | 36 | B | usable mapping rate | illumina | early_illumina | 5prime | size_fractionation | unknown | bulk | unknown | unknown | United States | 2011-03-07 | Blastula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 44969 | 44969 | SRR6345658 | SRX3442974 | SRS2733632 | SRP126106 | PRJNA421016 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] | GSE107682 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. | parent bioproject:PRJNA315403 | pubmed:30086300 | smRNA seq library of late oocytes from tdrd6a hett fish | GSM2875717 | source name:late oocytes from tdrd6a hett fish|tissue:late oocytes|genotype:tdrd6a heterozygous | smRNA seq library of late oocytes from tdrd6a hett fish | 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks. | late oocytes from tdrd6a hett fish | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | tissue:late oocytes|genotype:tdrd6a heterozygous | GSM2875717 | GSM2875717: smRNA seq library of late oocytes from tdrd6a hett fish; Danio rerio; ncRNA Seq | GSM2875717 | 1 | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | GEO Accession:GSM2875717 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP126106 | tdrd6a-het_oocytes-late-input.fastq.gz | fastq | 1884769630.0 | 28130890.0 | GSM2875717 r1 | 0:67 | A:519051884;C:437635381;G:510738306;T:417295309;N:48750 | 67 | 519051884 | 437635381 | 510738306 | 417295309 | 48750 | SRX3442974 | SRS2733632 | SRA636010 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.17778 | 0.06655 | 0.95931 | 0.91529 | 67 | B | usable mapping rate | illumina | hiseq_era | 5prime | size_fractionation | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2017-12-04 | Zygote | Embryo | Oocyte | Reproductive System | ||||||||||||||||||
| 44970 | 44970 | SRR6345657 | SRX3442973 | SRS2733634 | SRP126106 | PRJNA421016 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] | GSE107682 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. | parent bioproject:PRJNA315403 | pubmed:30086300 | smRNA seq library of early oocytes from tdrd6a mut fish | GSM2875716 | source name:early oocytes from tdrd6a mut fish|tissue:early oocytes|genotype:tdrd6a mutant | smRNA seq library of early oocytes from tdrd6a mut fish | 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks. | early oocytes from tdrd6a mut fish | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | tissue:early oocytes|genotype:tdrd6a mutant | GSM2875716 | GSM2875716: smRNA seq library of early oocytes from tdrd6a mut fish; Danio rerio; ncRNA Seq | GSM2875716 | 1 | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | GEO Accession:GSM2875716 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP126106 | tdrd6a-mut_oocytes-early-input.fastq.gz | fastq | 2102216723.0 | 31376369.0 | GSM2875716 r1 | 0:67 | A:592618102;C:472348913;G:550028898;T:487165955;N:54855 | 67 | 592618102 | 472348913 | 550028898 | 487165955 | 54855 | SRX3442973 | SRS2733634 | SRA636010 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.08293 | 0.04595 | 0.96193 | 0.77321 | 67 | B | usable mapping rate | illumina | hiseq_era | 5prime | size_fractionation | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2017-12-04 | Zygote | Embryo | Oocyte | Reproductive System | ||||||||||||||||||
| 44971 | 44971 | SRR6345656 | SRX3442972 | SRS2733635 | SRP126106 | PRJNA421016 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] | GSE107682 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. | parent bioproject:PRJNA315403 | pubmed:30086300 | smRNA seq library of late oocytes from tdrd6a mut fish | GSM2875715 | source name:late oocytes from tdrd6a mut fish|tissue:late oocytes|genotype:tdrd6a mutant | smRNA seq library of late oocytes from tdrd6a mut fish | 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks. | late oocytes from tdrd6a mut fish | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | tissue:late oocytes|genotype:tdrd6a mutant | GSM2875715 | GSM2875715: smRNA seq library of late oocytes from tdrd6a mut fish; Danio rerio; ncRNA Seq | GSM2875715 | 1 | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | GEO Accession:GSM2875715 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP126106 | tdrd6a-mut_oocytes-late-input.fastq.gz | fastq | 2110760295.0 | 31503885.0 | GSM2875715 r1 | 0:67 | A:582021495;C:486821539;G:582933348;T:458929133;N:54780 | 67 | 582021495 | 486821539 | 582933348 | 458929133 | 54780 | SRX3442972 | SRS2733635 | SRA636010 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.17064 | 0.06728 | 0.96173 | 0.9114 | 67 | B | usable mapping rate | illumina | hiseq_era | 5prime | size_fractionation | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2017-12-04 | Zygote | Embryo | Oocyte | Reproductive System | ||||||||||||||||||
| 44972 | 44972 | SRR6345655 | SRX3442971 | SRS2733633 | SRP126106 | PRJNA421016 | Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] | GSE107682 | Transcriptome Analysis | Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. | parent bioproject:PRJNA315403 | pubmed:30086300 | smRNA seq library of early oocytes from tdrd6a het fish | GSM2875714 | source name:early oocytes from tdrd6a het fish|tissue:Early oocytes|genotype:tdrd6a heterozygous | smRNA seq library of early oocytes from tdrd6a het fish | 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks. | early oocytes from tdrd6a het fish | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | tissue:Early oocytes|genotype:tdrd6a heterozygous | GSM2875714 | GSM2875714: smRNA seq library of early oocytes from tdrd6a het fish; Danio rerio; ncRNA Seq | GSM2875714 | 1 | RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation | GEO Accession:GSM2875714 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP126106 | tdrd6a-het_oocytes-early-input.fastq.gz | fastq | 2243425655.0 | 33483965.0 | GSM2875714 r1 | 0:67 | A:633468129;C:503239215;G:592089295;T:514571679;N:57337 | 67 | 633468129 | 503239215 | 592089295 | 514571679 | 57337 | SRX3442971 | SRS2733633 | SRA636010 | GEO | Rene Ketting, RNA silencing, IMB | 1 | 0.06641 | 0.04254 | 0.96806 | 0.58509 | 67 | B | usable mapping rate | illumina | hiseq_era | 5prime | size_fractionation | unknown | sc_generic | single_cell_generic | generic-scrnaseq-only | Germany | 2017-12-04 | Zygote | Embryo | Oocyte | Reproductive System | ||||||||||||||||||
| 49333 | 49333 | SRR7888760 | SRX4726389 | SRS3810122 | SRP162319 | PRJNA492406 | Profiles analysis reveals circRNAs involving zebrafish physiological development | GSE120289 | Transcriptome Analysis | Recent studies have found that known functions of circRNAs include sequestration of microRNAs or proteins modulation of transcription and interference with splicing and even translation to produce poly peptides. The zebrafish model is also demonstrably similar to humans in many studies. In order to explore the changes in circRNAs during embryonic development further to research the mechanism of action of circRNAs in development related diseases. Zebrafish embryos at blastula period gastrula period segmentation period throat stage and incubation period were collected. Illumina deep sequencing technology and CIRI algorithm were used to detecting circRNAs. Totally we identified 1028 circRNAs junction reads = 5 and p < 0.05. Considering that circRNAs function is related to host genes then bioinformatics analysis revealed these differentially expressed host genes are involved in NOTCH signaling pathways cardiovascular system development retinal ganglion cell axon guidance and so on. Moreover circRNAs can participate in biological regulation through miRNA sponges function. TargetScan and miRanda were used to predict 73 miRNAs binding to circRNAs such as miR 19b miR 124 and so on some miRNAs play important roles in embryogenesis. The peak expression of circRNAs is distributed at different time points suggesting that it may be involved in embryogenesis at different stages. Our study provides a foundation for understanding the dynamic regulation of circRNA transcriptomes during embryogenesis and identifies novel key circRNAs that might control embryonic development in zebrafish model. Overall design: circRNAs of five periods blastula gastrula segmentation throat and incubation in zebrafish were detected by deep sequencing using Illumina HiSeq 2500. | 48h | GSM3397728 | source name:Embryo|tissue:Embryo|age:48 hpf|developmental stage:throat|strain:Tubingenz|genotype:WT | 48h | Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to z10 whole genome using bwa 0.7.5a r405 with parameters "mem T 19". CircRNA prediction of sequencing results by CIRI algorithm v1.1. SRPBM Spliced Reads per Billion Mapped Reads=number of circular reads/number of mapped reads units in billion/read length used to normalize the expression of circRNAs. For differential expression analysis of circRNAs raw counts of reads that spanned a particular head to tail junction were analyzed using edgeR package version 3.12.1 with TMM normalization in generalized linear model. The Trimmed Mean of M values TMM normalization method was used to remove the size basis of sequencing libraries between samples. The following criteria were used to screen out significantly differentially expressed circRNAs: Fold change FC ≥2 and p< 0.05. Genome build: z10 Supplementary files format and content: tab delimited text files include SRPBM values and junction reads for each Sample. | Embryo | Zebrafish were reared at 28±1℃ in a water circulatory system that osmotic pressure stability UV disinfects and aerates the recycled water.The embryos were obtained post spontaneous mating from sexually mature wild type WT adult fish and cultivated at 28.5±0.5℃. Morphological features were used to judge the stage of embryonic development. | Total RNA was isolated using the standard TRIzol Invitrogen protocol Genomic DNA was removed by DNase treatment. Then the total RNA were subject to ribosomal RNA depletion according to the manufacturer’s protocol of RiboMinus kit Life Technology. The quality of the RNA and lack of contaminating ribosomal RNA were confirmed using the Agilent 2100 Bio analyzer. Strand specific libraries were constructed by following the manufacturer’s instructions Illumina | tissue:Embryo|age:48 hpf|developmental stage:throat|strain:Tubingenz|genotype:WT | GSM3397728 | GSM3397728: 48h; Danio rerio; ncRNA Seq | GSM3397728 | 1 | Total RNA was isolated using the standard TRIzol Invitrogen protocol Genomic DNA was removed by DNase treatment. Then the total RNA were subject to ribosomal RNA depletion according to the manufacturer's protocol of RiboMinus kit Life Technology. The quality of the RNA and lack of contaminating ribosomal RNA were confirmed using the Agilent 2100 Bio analyzer. Strand specific libraries were constructed by following the manufacturer's instructions Illumina | GEO Accession:GSM3397728 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP162319 | 48h_2.fq.gz 48h_1.fq.gz | fastq fastq | 13525174500.0 | 45083915.0 | GSM3397728 r1 | 0:150 1:150 | A:2352542664;C:4312268007;G:4256218842;T:2601416951;N:2728036 | 150 | 150 | 2352542664 | 4312268007 | 4256218842 | 2601416951 | 2728036 | SRX4726389 | SRS3810122 | SRA781248 | GEO | Department of Pediatrics, Nanjing Maternity and Child Health Care Hospital | 2 | 0.91614 | 0.91412 | 0.12891 | 0.12218 | 0.76751 | 0.77948 | 0.71008 | 0.73648 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | unknown | unknown | China | 2018-09-21 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||
| 49334 | 49334 | SRR7888759 | SRX4726388 | SRS3810120 | SRP162319 | PRJNA492406 | Profiles analysis reveals circRNAs involving zebrafish physiological development | GSE120289 | Transcriptome Analysis | Recent studies have found that known functions of circRNAs include sequestration of microRNAs or proteins modulation of transcription and interference with splicing and even translation to produce poly peptides. The zebrafish model is also demonstrably similar to humans in many studies. In order to explore the changes in circRNAs during embryonic development further to research the mechanism of action of circRNAs in development related diseases. Zebrafish embryos at blastula period gastrula period segmentation period throat stage and incubation period were collected. Illumina deep sequencing technology and CIRI algorithm were used to detecting circRNAs. Totally we identified 1028 circRNAs junction reads = 5 and p < 0.05. Considering that circRNAs function is related to host genes then bioinformatics analysis revealed these differentially expressed host genes are involved in NOTCH signaling pathways cardiovascular system development retinal ganglion cell axon guidance and so on. Moreover circRNAs can participate in biological regulation through miRNA sponges function. TargetScan and miRanda were used to predict 73 miRNAs binding to circRNAs such as miR 19b miR 124 and so on some miRNAs play important roles in embryogenesis. The peak expression of circRNAs is distributed at different time points suggesting that it may be involved in embryogenesis at different stages. Our study provides a foundation for understanding the dynamic regulation of circRNA transcriptomes during embryogenesis and identifies novel key circRNAs that might control embryonic development in zebrafish model. Overall design: circRNAs of five periods blastula gastrula segmentation throat and incubation in zebrafish were detected by deep sequencing using Illumina HiSeq 2500. | 24h | GSM3397727 | source name:Embryo|tissue:Embryo|age:24 hpf|developmental stage:segmentation|strain:Tubingenz|genotype:WT | 24h | Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to z10 whole genome using bwa 0.7.5a r405 with parameters "mem T 19". CircRNA prediction of sequencing results by CIRI algorithm v1.1. SRPBM Spliced Reads per Billion Mapped Reads=number of circular reads/number of mapped reads units in billion/read length used to normalize the expression of circRNAs. For differential expression analysis of circRNAs raw counts of reads that spanned a particular head to tail junction were analyzed using edgeR package version 3.12.1 with TMM normalization in generalized linear model. The Trimmed Mean of M values TMM normalization method was used to remove the size basis of sequencing libraries between samples. The following criteria were used to screen out significantly differentially expressed circRNAs: Fold change FC ≥2 and p< 0.05. Genome build: z10 Supplementary files format and content: tab delimited text files include SRPBM values and junction reads for each Sample. | Embryo | Zebrafish were reared at 28±1℃ in a water circulatory system that osmotic pressure stability UV disinfects and aerates the recycled water.The embryos were obtained post spontaneous mating from sexually mature wild type WT adult fish and cultivated at 28.5±0.5℃. Morphological features were used to judge the stage of embryonic development. | Total RNA was isolated using the standard TRIzol Invitrogen protocol Genomic DNA was removed by DNase treatment. Then the total RNA were subject to ribosomal RNA depletion according to the manufacturer’s protocol of RiboMinus kit Life Technology. The quality of the RNA and lack of contaminating ribosomal RNA were confirmed using the Agilent 2100 Bio analyzer. Strand specific libraries were constructed by following the manufacturer’s instructions Illumina | tissue:Embryo|age:24 hpf|developmental stage:segmentation|strain:Tubingenz|genotype:WT | GSM3397727 | GSM3397727: 24h; Danio rerio; ncRNA Seq | GSM3397727 | 1 | Total RNA was isolated using the standard TRIzol Invitrogen protocol Genomic DNA was removed by DNase treatment. Then the total RNA were subject to ribosomal RNA depletion according to the manufacturer's protocol of RiboMinus kit Life Technology. The quality of the RNA and lack of contaminating ribosomal RNA were confirmed using the Agilent 2100 Bio analyzer. Strand specific libraries were constructed by following the manufacturer's instructions Illumina | GEO Accession:GSM3397727 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP162319 | 24h_1.fq.gz 24h_2.fq.gz | fastq fastq | 14333175000.0 | 47777250.0 | GSM3397727 r1 | 0:150 1:150 | A:2728754113;C:4276840070;G:4344116037;T:2980570245;N:2894535 | 150 | 150 | 2728754113 | 4276840070 | 4344116037 | 2980570245 | 2894535 | SRX4726388 | SRS3810120 | SRA781248 | GEO | Department of Pediatrics, Nanjing Maternity and Child Health Care Hospital | 2 | 0.89719 | 0.89478 | 0.18044 | 0.18119 | 0.76942 | 0.7876 | 0.75758 | 0.75366 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | unknown | unknown | China | 2018-09-21 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||
| 49335 | 49335 | SRR7888758 | SRX4726387 | SRS3810121 | SRP162319 | PRJNA492406 | Profiles analysis reveals circRNAs involving zebrafish physiological development | GSE120289 | Transcriptome Analysis | Recent studies have found that known functions of circRNAs include sequestration of microRNAs or proteins modulation of transcription and interference with splicing and even translation to produce poly peptides. The zebrafish model is also demonstrably similar to humans in many studies. In order to explore the changes in circRNAs during embryonic development further to research the mechanism of action of circRNAs in development related diseases. Zebrafish embryos at blastula period gastrula period segmentation period throat stage and incubation period were collected. Illumina deep sequencing technology and CIRI algorithm were used to detecting circRNAs. Totally we identified 1028 circRNAs junction reads = 5 and p < 0.05. Considering that circRNAs function is related to host genes then bioinformatics analysis revealed these differentially expressed host genes are involved in NOTCH signaling pathways cardiovascular system development retinal ganglion cell axon guidance and so on. Moreover circRNAs can participate in biological regulation through miRNA sponges function. TargetScan and miRanda were used to predict 73 miRNAs binding to circRNAs such as miR 19b miR 124 and so on some miRNAs play important roles in embryogenesis. The peak expression of circRNAs is distributed at different time points suggesting that it may be involved in embryogenesis at different stages. Our study provides a foundation for understanding the dynamic regulation of circRNA transcriptomes during embryogenesis and identifies novel key circRNAs that might control embryonic development in zebrafish model. Overall design: circRNAs of five periods blastula gastrula segmentation throat and incubation in zebrafish were detected by deep sequencing using Illumina HiSeq 2500. | 8h | GSM3397726 | source name:Embryo|tissue:Embryo|age:8 hpf|developmental stage:gastrula|strain:Tubingenz|genotype:WT | 8h | Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to z10 whole genome using bwa 0.7.5a r405 with parameters "mem T 19". CircRNA prediction of sequencing results by CIRI algorithm v1.1. SRPBM Spliced Reads per Billion Mapped Reads=number of circular reads/number of mapped reads units in billion/read length used to normalize the expression of circRNAs. For differential expression analysis of circRNAs raw counts of reads that spanned a particular head to tail junction were analyzed using edgeR package version 3.12.1 with TMM normalization in generalized linear model. The Trimmed Mean of M values TMM normalization method was used to remove the size basis of sequencing libraries between samples. The following criteria were used to screen out significantly differentially expressed circRNAs: Fold change FC ≥2 and p< 0.05. Genome build: z10 Supplementary files format and content: tab delimited text files include SRPBM values and junction reads for each Sample. | Embryo | Zebrafish were reared at 28±1℃ in a water circulatory system that osmotic pressure stability UV disinfects and aerates the recycled water.The embryos were obtained post spontaneous mating from sexually mature wild type WT adult fish and cultivated at 28.5±0.5℃. Morphological features were used to judge the stage of embryonic development. | Total RNA was isolated using the standard TRIzol Invitrogen protocol Genomic DNA was removed by DNase treatment. Then the total RNA were subject to ribosomal RNA depletion according to the manufacturer’s protocol of RiboMinus kit Life Technology. The quality of the RNA and lack of contaminating ribosomal RNA were confirmed using the Agilent 2100 Bio analyzer. Strand specific libraries were constructed by following the manufacturer’s instructions Illumina | tissue:Embryo|age:8 hpf|developmental stage:gastrula|strain:Tubingenz|genotype:WT | GSM3397726 | GSM3397726: 8h; Danio rerio; ncRNA Seq | GSM3397726 | 1 | Total RNA was isolated using the standard TRIzol Invitrogen protocol Genomic DNA was removed by DNase treatment. Then the total RNA were subject to ribosomal RNA depletion according to the manufacturer's protocol of RiboMinus kit Life Technology. The quality of the RNA and lack of contaminating ribosomal RNA were confirmed using the Agilent 2100 Bio analyzer. Strand specific libraries were constructed by following the manufacturer's instructions Illumina | GEO Accession:GSM3397726 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP162319 | 8h_2.fq.gz 8h_1.fq.gz | fastq fastq | 15434085600.0 | 51446952.0 | GSM3397726 r1 | 0:150 1:150 | A:2318158791;C:5134519748;G:5292209580;T:2686084369;N:3113112 | 150 | 150 | 2318158791 | 5134519748 | 5292209580 | 2686084369 | 3113112 | SRX4726387 | SRS3810121 | SRA781248 | GEO | Department of Pediatrics, Nanjing Maternity and Child Health Care Hospital | 2 | 0.95788 | 0.95584 | 0.07233 | 0.07686 | 0.81889 | 0.82946 | 0.81383 | 0.80143 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | unknown | unknown | China | 2018-09-21 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||
| 49336 | 49336 | SRR7888757 | SRX4726386 | SRS3810119 | SRP162319 | PRJNA492406 | Profiles analysis reveals circRNAs involving zebrafish physiological development | GSE120289 | Transcriptome Analysis | Recent studies have found that known functions of circRNAs include sequestration of microRNAs or proteins modulation of transcription and interference with splicing and even translation to produce poly peptides. The zebrafish model is also demonstrably similar to humans in many studies. In order to explore the changes in circRNAs during embryonic development further to research the mechanism of action of circRNAs in development related diseases. Zebrafish embryos at blastula period gastrula period segmentation period throat stage and incubation period were collected. Illumina deep sequencing technology and CIRI algorithm were used to detecting circRNAs. Totally we identified 1028 circRNAs junction reads = 5 and p < 0.05. Considering that circRNAs function is related to host genes then bioinformatics analysis revealed these differentially expressed host genes are involved in NOTCH signaling pathways cardiovascular system development retinal ganglion cell axon guidance and so on. Moreover circRNAs can participate in biological regulation through miRNA sponges function. TargetScan and miRanda were used to predict 73 miRNAs binding to circRNAs such as miR 19b miR 124 and so on some miRNAs play important roles in embryogenesis. The peak expression of circRNAs is distributed at different time points suggesting that it may be involved in embryogenesis at different stages. Our study provides a foundation for understanding the dynamic regulation of circRNA transcriptomes during embryogenesis and identifies novel key circRNAs that might control embryonic development in zebrafish model. Overall design: circRNAs of five periods blastula gastrula segmentation throat and incubation in zebrafish were detected by deep sequencing using Illumina HiSeq 2500. | 4.5h | GSM3397725 | source name:Embryo|tissue:Embryo|age:4.5 hpf|developmental stage:blastula|strain:Tubingenz|genotype:WT | 4.5h | Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to z10 whole genome using bwa 0.7.5a r405 with parameters "mem T 19". CircRNA prediction of sequencing results by CIRI algorithm v1.1. SRPBM Spliced Reads per Billion Mapped Reads=number of circular reads/number of mapped reads units in billion/read length used to normalize the expression of circRNAs. For differential expression analysis of circRNAs raw counts of reads that spanned a particular head to tail junction were analyzed using edgeR package version 3.12.1 with TMM normalization in generalized linear model. The Trimmed Mean of M values TMM normalization method was used to remove the size basis of sequencing libraries between samples. The following criteria were used to screen out significantly differentially expressed circRNAs: Fold change FC ≥2 and p< 0.05. Genome build: z10 Supplementary files format and content: tab delimited text files include SRPBM values and junction reads for each Sample. | Embryo | Zebrafish were reared at 28±1℃ in a water circulatory system that osmotic pressure stability UV disinfects and aerates the recycled water.The embryos were obtained post spontaneous mating from sexually mature wild type WT adult fish and cultivated at 28.5±0.5℃. Morphological features were used to judge the stage of embryonic development. | Total RNA was isolated using the standard TRIzol Invitrogen protocol Genomic DNA was removed by DNase treatment. Then the total RNA were subject to ribosomal RNA depletion according to the manufacturer’s protocol of RiboMinus kit Life Technology. The quality of the RNA and lack of contaminating ribosomal RNA were confirmed using the Agilent 2100 Bio analyzer. Strand specific libraries were constructed by following the manufacturer’s instructions Illumina | tissue:Embryo|age:4.5 hpf|developmental stage:blastula|strain:Tubingenz|genotype:WT | GSM3397725 | GSM3397725: 4.5h; Danio rerio; ncRNA Seq | GSM3397725 | 1 | Total RNA was isolated using the standard TRIzol Invitrogen protocol Genomic DNA was removed by DNase treatment. Then the total RNA were subject to ribosomal RNA depletion according to the manufacturer's protocol of RiboMinus kit Life Technology. The quality of the RNA and lack of contaminating ribosomal RNA were confirmed using the Agilent 2100 Bio analyzer. Strand specific libraries were constructed by following the manufacturer's instructions Illumina | GEO Accession:GSM3397725 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP162319 | 4_5h_2.fq.gz 4_5h_1.fq.gz | fastq fastq | 12988242600.0 | 43294142.0 | GSM3397725 r1 | 0:150 1:150 | A:2232301074;C:3998769528;G:4233380689;T:2521224783;N:2566526 | 150 | 150 | 2232301074 | 3998769528 | 4233380689 | 2521224783 | 2566526 | SRX4726386 | SRS3810119 | SRA781248 | GEO | Department of Pediatrics, Nanjing Maternity and Child Health Care Hospital | 2 | 0.96961 | 0.96817 | 0.05627 | 0.05463 | 0.77068 | 0.78198 | 0.74899 | 0.75759 | 150 | 150 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | unknown | unknown | China | 2018-09-21 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||
| 55851 | 55851 | SRR10863004 | SRX7533076 | SRS5972269 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt PGCs 2dpf rep1 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:2dpf|dev stage:Long pec stage|sex:not applicable|tissue:germline|biological replicate:replicate 1|BioSampleModel:Model organism or animal | small RNA of Zebrafish: PGCs 2dpf | imb ketting 2018 03 redl smRNA 04 07 2dpf PGCs rep1 S4.R1 | imb ketting 2018 03 redl smRNA 04 07 2dpf PGCs rep1 S4.R1 | Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified. | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_03_redl_smRNA_04_07_2dpf_PGCs_rep1_S4.R1.fastq.gz | fastq | 3376468872.0 | 40196058.0 | imb ketting 2018 03 redl smRNA 04 07 2dpf PGCs rep1 S4.R1.fastq.gz | 0:84 1:0 | A:844908938;C:858861843;G:817445857;T:855220450;N:31784 | 84 | 0 | 844908938 | 858861843 | 817445857 | 855220450 | 31784 | SRX7533076 | SRS5972269 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 1 | 0.0005 | 3e-05 | 0.99922 | 0.65853 | 84 | T | under 1.2% mapping rate | illumina | nextseq | unknown | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2020-01-10 | Hatching | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||||
| 55862 | 55862 | SRR10863003 | SRX7533065 | SRS5972268 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt PGCs 1dpf rep3 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:1dpf|dev stage:Pharyngula period|sex:not applicable|tissue:germline|biological replicate:replicate 3|BioSampleModel:Model organism or animal | small RNA of Zebrafish: PGCs 1dpf | imb ketting 2018 03 redl smRNA 03 20 1dpf PGCs rep3 S3.R1 | imb ketting 2018 03 redl smRNA 03 20 1dpf PGCs rep3 S3.R1 | Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified. | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_03_redl_smRNA_03_20_1dpf_PGCs_rep3_S3.R1.fastq.gz | fastq | 3136475328.0 | 37338992.0 | imb ketting 2018 03 redl smRNA 03 20 1dpf PGCs rep3 S3.R1.fastq.gz | 0:84 1:0 | A:743596563;C:770089055;G:796526363;T:826235723;N:27624 | 84 | 0 | 743596563 | 770089055 | 796526363 | 826235723 | 27624 | SRX7533065 | SRS5972268 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 1 | 0.00094 | 2e-05 | 0.999 | 0.69871 | 84 | T | under 1.2% mapping rate | illumina | nextseq | unknown | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2020-01-10 | Pharyngula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||||
| 55872 | 55872 | SRR10863015 | SRX7533055 | SRS5972267 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt PGCs 1dpf rep2 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:1dpf|dev stage:Pharyngula period|sex:not applicable|tissue:germline|biological replicate:replicate 2|BioSampleModel:Model organism or animal | small RNA of Zebrafish: PGCs 1dpf | imb ketting 2018 03 redl smRNA 02 30 1dpf PGCs rep2 S2.R1 | imb ketting 2018 03 redl smRNA 02 30 1dpf PGCs rep2 S2.R1 | Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified. | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_03_redl_smRNA_02_30_1dpf_PGCs_rep2_S2.R1.fastq.gz | fastq | 3186833832.0 | 37938498.0 | imb ketting 2018 03 redl smRNA 02 30 1dpf PGCs rep2 S2.R1.fastq.gz | 0:84 1:0 | A:772047868;C:764764928;G:803857310;T:846133704;N:30022 | 84 | 0 | 772047868 | 764764928 | 803857310 | 846133704 | 30022 | SRX7533055 | SRS5972267 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 1 | 0.00072 | 1e-05 | 0.99922 | 0.65573 | 84 | T | under 1.2% mapping rate | illumina | nextseq | unknown | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2020-01-10 | Pharyngula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||||
| 55883 | 55883 | SRR10863025 | SRX7533044 | SRS5972254 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt zygote 0hpf rep2 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:0hpf|dev stage:zygote|sex:not applicable|tissue:whole embryo|biological replicate:replicate 2|BioSampleModel:Model organism or animal | small RNA of Zebrafish: zygotes 0hpf | imb ketting 2018 19 redl smRNA 07 0hpf zygotes rep2 S30.R1 | imb ketting 2018 19 redl smRNA 07 0hpf zygotes rep2 S30.R1 | Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified. | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_19_redl_smRNA-07_0hpf_zygotes_rep2_S30.R1.fastq.gz | fastq | 1083028275.0 | 14440377.0 | imb ketting 2018 19 redl smRNA 07 0hpf zygotes rep2 S30.R1.fastq.gz | 0:75 1:0 | A:261596209;C:277009311;G:258733780;T:285678456;N:10519 | 75 | 0 | 261596209 | 277009311 | 258733780 | 285678456 | 10519 | SRX7533044 | SRS5972254 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 1 | 0.00065 | 8e-05 | 0.99906 | 0.73076 | 75 | T | under 1.2% mapping rate | illumina | nextseq | unknown | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2020-01-10 | Zygote | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||||
| 55884 | 55884 | SRR10863026 | SRX7533043 | SRS5972253 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt zygote 0hpf rep1 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:0hpf|dev stage:zygote|sex:not applicable|tissue:whole embryo|biological replicate:replicate 1|BioSampleModel:Model organism or animal | small RNA of Zebrafish: zygotes 0hpf | imb ketting 2018 19 redl smRNA 06 0hpf zygotes rep1 S29.R1 | imb ketting 2018 19 redl smRNA 06 0hpf zygotes rep1 S29.R1 | Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified. | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_19_redl_smRNA-06_0hpf_zygotes_rep1_S29.R1.fastq.gz | fastq | 1094583075.0 | 14594441.0 | imb ketting 2018 19 redl smRNA 06 0hpf zygotes rep1 S29.R1.fastq.gz | 0:75 1:0 | A:272231426;C:272258006;G:282795391;T:267287656;N:10596 | 75 | 0 | 272231426 | 272258006 | 282795391 | 267287656 | 10596 | SRX7533043 | SRS5972253 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 1 | 0.00035 | 7e-05 | 0.99935 | 0.63043 | 75 | T | under 1.2% mapping rate | illumina | nextseq | unknown | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2020-01-10 | Zygote | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||||
| 55887 | 55887 | SRR10863028 | SRX7533040 | SRS5972265 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt PGCs 1dpf rep1 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:1dpf|dev stage:Pharyngula period|sex:not applicable|tissue:germline|biological replicate:replicate 1|BioSampleModel:Model organism or animal | small RNA of Zebrafish: PGCs 1dpf | imb ketting 2018 03 redl smRNA 01 24 1dpf PGCs rep1 S1.R1 | imb ketting 2018 03 redl smRNA 01 24 1dpf PGCs rep1 S1.R1 | Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified. | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_03_redl_smRNA_01_24_1dpf_PGCs_rep1_S1.R1.fastq.gz | fastq | 2999534160.0 | 35708740.0 | imb ketting 2018 03 redl smRNA 01 24 1dpf PGCs rep1 S1.R1.fastq.gz | 0:84 1:0 | A:763136061;C:754741465;G:717861943;T:763766703;N:27988 | 84 | 0 | 763136061 | 754741465 | 717861943 | 763766703 | 27988 | SRX7533040 | SRS5972265 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 1 | 0.00031 | 0.0 | 0.99945 | 0.59259 | 84 | T | under 1.2% mapping rate | illumina | nextseq | unknown | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2020-01-10 | Pharyngula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||||
| 55898 | 55898 | SRR10863039 | SRX7533029 | SRS5972255 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt zygote 0hpf rep3 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:0hpf|dev stage:zygote|sex:not applicable|tissue:whole embryo|biological replicate:replicate 3|BioSampleModel:Model organism or animal | small RNA of Zebrafish: zygotes 0hpf | imb ketting 2018 19 redl smRNA 08 0hpf zygotes rep3 S31.R1 | imb ketting 2018 19 redl smRNA 08 0hpf zygotes rep3 S31.R1 | Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified. | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_19_redl_smRNA-08_0hpf_zygotes_rep3_S31.R1.fastq.gz | fastq | 1174146225.0 | 15655283.0 | imb ketting 2018 19 redl smRNA 08 0hpf zygotes rep3 S31.R1.fastq.gz | 0:75 1:0 | A:275690402;C:320014688;G:295706949;T:282722725;N:11461 | 75 | 0 | 275690402 | 320014688 | 295706949 | 282722725 | 11461 | SRX7533029 | SRS5972255 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 1 | 0.00017 | 2e-05 | 0.99977 | 0.26315 | 75 | T | under 1.2% mapping rate | illumina | nextseq | unknown | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2020-01-10 | Zygote | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||||
| 55909 | 55909 | SRR10863051 | SRX7533018 | SRS5972252 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt PGCs 2dpf rep3 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:2dpf|dev stage:Long pec stage|sex:not applicable|tissue:germline|biological replicate:replicate 3|BioSampleModel:Model organism or animal | small RNA of Zebrafish: PGCs 2dpf | imb ketting 2018 03 redl smRNA 06 61 2dpf PGCs rep3 S6.R1 | imb ketting 2018 03 redl smRNA 06 61 2dpf PGCs rep3 S6.R1 | Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified. | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_03_redl_smRNA_06_61_2dpf_PGCs_rep3_S6.R1.fastq.gz | fastq | 3454014564.0 | 41119221.0 | imb ketting 2018 03 redl smRNA 06 61 2dpf PGCs rep3 S6.R1.fastq.gz | 0:84 1:0 | A:806393586;C:867601464;G:910506431;T:869481915;N:31168 | 84 | 0 | 806393586 | 867601464 | 910506431 | 869481915 | 31168 | SRX7533018 | SRS5972252 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 1 | 0.00017 | 1e-05 | 0.99961 | 0.65384 | 84 | T | under 1.2% mapping rate | illumina | nextseq | unknown | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2020-01-10 | Hatching | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||||
| 55917 | 55917 | SRR10863059 | SRX7533010 | SRS5972244 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt PGCs 2dpf rep2 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:2dpf|dev stage:Long pec stage|sex:not applicable|tissue:germline|biological replicate:replicate 2|BioSampleModel:Model organism or animal | small RNA of Zebrafish: PGCs 2dpf | imb ketting 2018 03 redl smRNA 05 22 2dpf PGCs rep2 S5.R1 | imb ketting 2018 03 redl smRNA 05 22 2dpf PGCs rep2 S5.R1 | Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified. | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_03_redl_smRNA_05_22_2dpf_PGCs_rep2_S5.R1.fastq.gz | fastq | 3308645424.0 | 39388636.0 | imb ketting 2018 03 redl smRNA 05 22 2dpf PGCs rep2 S5.R1.fastq.gz | 0:84 1:0 | A:854995750;C:785730518;G:836451916;T:831436561;N:30679 | 84 | 0 | 854995750 | 785730518 | 836451916 | 831436561 | 30679 | SRX7533010 | SRS5972244 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 1 | 0.0004 | 2e-05 | 0.99939 | 0.73846 | 84 | T | under 1.2% mapping rate | illumina | nextseq | unknown | size_fractionation | unknown | bulk | unknown | unknown | Germany | 2020-01-10 | Hatching | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||||
| 58542 | 58542 | SRR13652355 | SRX10049118 | SRS8212347 | SRP253438 | PRJNA613601 | five prime half of specific tRNAs feeds back to promote corresponding tRNA gene transcription in vertebrate embryos [small RNA Seq ssDRIP seq] | GSE147253 | Other | five primetRFls are small tRNA fragments derived from five prime half of mature tRNAs. However it is unknown whether five primetRFls could feed back to regulate tRNA biogenesis. Here we show that five primetRFlGly/GCC and five primetRFlGlu/CTC function to promote transcription of corresponding tRNA genes and are essential for vertebrate early embryogenesis. During zebrafish embryogenesis dynamics of five primetRFlGly/GCC and five primetRFlGlu/CTC levels correlates with that of tRNAGly/GCC and tRNAGlu/CTC levels. Morpholino mediated knockdown of five primetRFlGly/GCC or five primetRFlGlu/CTC down regulates tRNAGly/GCC or tRNAGlu/CTC levels respectively and causes embryonic lethality that is efficiently rescued by co injection of properly refolded corresponding tRNA. In zebrafish embryos tRNA:DNA and five primetRFl:DNA hybrids commonly exist on the template strand of tRNA genes. Mechanistically unstable five primetRFl:DNA hybrid may prevent the formation of transcriptionally inhibitory stable tRNA:DNA hybrids on the same tRNA loci so as to facilitate tRNA genes transcription. The uncovered mechanism may be implicated in other physiological and pathological processes. Overall design: For small RNA sequencing total RNA were extracted respectively from wildtype zebrafish embryos Tübingen Strain of 6 chosen stages and then subjected to small RNA library preparation individually. To investigate the distribution and stability of R loop on genome we performed ssDRIP seq with S9.6 antibody which specifically recognize RNA:DNA hybrid. Two replicates from wildtype embryos of 256c sphere and shield stage were collected to perform ssDRIPseq. RNaseH pre treated genome DNA was used as negative control which was also performed the standard ssDRIP seq procedure. Genomic DNA extracted from these samples were fragmentated by restriction enzymes and then immunoprecipitated by S9.6 antibody.The ssDNA strands in RNA:DNA hybrids were purified and subjected to library preparation. | parent bioproject:PRJNA753013 | pubmed:34797706 | 24hpf ncRNA seq | GSM5069285 | tissue:embryo|strain:Tubingen|developmental stage:24 hpf stage|treatement:no | 24hpf ncRNA seq | For data processing reads were quality checked by FastQCVersion 0.11.8 and adaptors were cut off by Cutadapt Version 1.16 and only reads that lay between 18 40 nt were kept. The reads of each sample were first aligned to different database by using Bowtie2 Version 2.3.4.1 count table was generated by featureCounts. Genome build: GRCz11 genome and cDNA tRNA database GtRNAdb GRCz11 | embryo | For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 μl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4℃ the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80℃ until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37℃ then purified by phenol: chloroform extraction. The aim of this step is removing the 2 3’ cyclic phosphate group from the 3’end of 5’tRFls and add phosphate group to the 5’end of 3’tRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 μg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol. | strain:Tubingen|developmental stage:24 hpf stage|treatement:no | GSM5069285 | GSM5069285: 24hpf ncRNA seq; Danio rerio; ncRNA Seq | GSM5069285 | 1 | For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 μl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4℃ the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80℃ until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37℃ then purified by phenol: chloroform extraction. The aim of this step is removing the 2 three prime cyclic phosphate group from the three primeend of five primetRFls and add phosphate group to the five primeend of three primetRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 μg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol. | GEO Accession:GSM5069285 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina NovaSeq 6000 | SRP253438 | 24hpf-RNA_seq.fq.gz | fastq | 4887202650.0 | 32581351.0 | GSM5069285 r1 | 0:150 1:0 | A:821306307;C:893949781;G:2431277343;T:739975843;N:693376 | 150 | 0 | 821306307 | 893949781 | 2431277343 | 739975843 | 693376 | SRX10049118 | SRS8212347 | SRA1056877 | GEO | Anming Meng Lab, School of Life Science, Tsinghua University | 1 | 0.60067 | 0.12422 | 0.81132 | 0.45351 | 150 | B | usable mapping rate | illumina | novaseq_era | 5prime | size_fractionation | nebnext | bulk | unknown | unknown | China | 2021-02-08 | Pharyngula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 58543 | 58543 | SRR13652354 | SRX10049117 | SRS8212344 | SRP253438 | PRJNA613601 | five prime half of specific tRNAs feeds back to promote corresponding tRNA gene transcription in vertebrate embryos [small RNA Seq ssDRIP seq] | GSE147253 | Other | five primetRFls are small tRNA fragments derived from five prime half of mature tRNAs. However it is unknown whether five primetRFls could feed back to regulate tRNA biogenesis. Here we show that five primetRFlGly/GCC and five primetRFlGlu/CTC function to promote transcription of corresponding tRNA genes and are essential for vertebrate early embryogenesis. During zebrafish embryogenesis dynamics of five primetRFlGly/GCC and five primetRFlGlu/CTC levels correlates with that of tRNAGly/GCC and tRNAGlu/CTC levels. Morpholino mediated knockdown of five primetRFlGly/GCC or five primetRFlGlu/CTC down regulates tRNAGly/GCC or tRNAGlu/CTC levels respectively and causes embryonic lethality that is efficiently rescued by co injection of properly refolded corresponding tRNA. In zebrafish embryos tRNA:DNA and five primetRFl:DNA hybrids commonly exist on the template strand of tRNA genes. Mechanistically unstable five primetRFl:DNA hybrid may prevent the formation of transcriptionally inhibitory stable tRNA:DNA hybrids on the same tRNA loci so as to facilitate tRNA genes transcription. The uncovered mechanism may be implicated in other physiological and pathological processes. Overall design: For small RNA sequencing total RNA were extracted respectively from wildtype zebrafish embryos Tübingen Strain of 6 chosen stages and then subjected to small RNA library preparation individually. To investigate the distribution and stability of R loop on genome we performed ssDRIP seq with S9.6 antibody which specifically recognize RNA:DNA hybrid. Two replicates from wildtype embryos of 256c sphere and shield stage were collected to perform ssDRIPseq. RNaseH pre treated genome DNA was used as negative control which was also performed the standard ssDRIP seq procedure. Genomic DNA extracted from these samples were fragmentated by restriction enzymes and then immunoprecipitated by S9.6 antibody.The ssDNA strands in RNA:DNA hybrids were purified and subjected to library preparation. | parent bioproject:PRJNA753013 | pubmed:34797706 | Shield ncRNA seq | GSM5069284 | tissue:embryo|strain:Tubingen|developmental stage:Shield stage|treatement:no | Shield ncRNA seq | For data processing reads were quality checked by FastQCVersion 0.11.8 and adaptors were cut off by Cutadapt Version 1.16 and only reads that lay between 18 40 nt were kept. The reads of each sample were first aligned to different database by using Bowtie2 Version 2.3.4.1 count table was generated by featureCounts. Genome build: GRCz11 genome and cDNA tRNA database GtRNAdb GRCz11 | embryo | For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 μl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4℃ the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80℃ until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37℃ then purified by phenol: chloroform extraction. The aim of this step is removing the 2 3’ cyclic phosphate group from the 3’end of 5’tRFls and add phosphate group to the 5’end of 3’tRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 μg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol. | strain:Tubingen|developmental stage:Shield stage|treatement:no | GSM5069284 | GSM5069284: Shield ncRNA seq; Danio rerio; ncRNA Seq | GSM5069284 | 1 | For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 μl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4℃ the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80℃ until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37℃ then purified by phenol: chloroform extraction. The aim of this step is removing the 2 three prime cyclic phosphate group from the three primeend of five primetRFls and add phosphate group to the five primeend of three primetRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 μg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol. | GEO Accession:GSM5069284 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina NovaSeq 6000 | SRP253438 | Shield-RNA_seq.fq.gz | fastq | 3889055700.0 | 25927038.0 | GSM5069284 r1 | 0:150 1:0 | A:663037737;C:674378775;G:1956188054;T:594901111;N:550023 | 150 | 0 | 663037737 | 674378775 | 1956188054 | 594901111 | 550023 | SRX10049117 | SRS8212344 | SRA1056877 | GEO | Anming Meng Lab, School of Life Science, Tsinghua University | 1 | 0.64541 | 0.17034 | 0.79174 | 0.59714 | 150 | B | usable mapping rate | illumina | novaseq_era | 5prime | size_fractionation | nebnext | bulk | unknown | unknown | China | 2021-02-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 58544 | 58544 | SRR13652353 | SRX10049116 | SRS8212345 | SRP253438 | PRJNA613601 | five prime half of specific tRNAs feeds back to promote corresponding tRNA gene transcription in vertebrate embryos [small RNA Seq ssDRIP seq] | GSE147253 | Other | five primetRFls are small tRNA fragments derived from five prime half of mature tRNAs. However it is unknown whether five primetRFls could feed back to regulate tRNA biogenesis. Here we show that five primetRFlGly/GCC and five primetRFlGlu/CTC function to promote transcription of corresponding tRNA genes and are essential for vertebrate early embryogenesis. During zebrafish embryogenesis dynamics of five primetRFlGly/GCC and five primetRFlGlu/CTC levels correlates with that of tRNAGly/GCC and tRNAGlu/CTC levels. Morpholino mediated knockdown of five primetRFlGly/GCC or five primetRFlGlu/CTC down regulates tRNAGly/GCC or tRNAGlu/CTC levels respectively and causes embryonic lethality that is efficiently rescued by co injection of properly refolded corresponding tRNA. In zebrafish embryos tRNA:DNA and five primetRFl:DNA hybrids commonly exist on the template strand of tRNA genes. Mechanistically unstable five primetRFl:DNA hybrid may prevent the formation of transcriptionally inhibitory stable tRNA:DNA hybrids on the same tRNA loci so as to facilitate tRNA genes transcription. The uncovered mechanism may be implicated in other physiological and pathological processes. Overall design: For small RNA sequencing total RNA were extracted respectively from wildtype zebrafish embryos Tübingen Strain of 6 chosen stages and then subjected to small RNA library preparation individually. To investigate the distribution and stability of R loop on genome we performed ssDRIP seq with S9.6 antibody which specifically recognize RNA:DNA hybrid. Two replicates from wildtype embryos of 256c sphere and shield stage were collected to perform ssDRIPseq. RNaseH pre treated genome DNA was used as negative control which was also performed the standard ssDRIP seq procedure. Genomic DNA extracted from these samples were fragmentated by restriction enzymes and then immunoprecipitated by S9.6 antibody.The ssDNA strands in RNA:DNA hybrids were purified and subjected to library preparation. | parent bioproject:PRJNA753013 | pubmed:34797706 | Sphere ncRNA seq | GSM5069283 | tissue:embryo|strain:Tubingen|developmental stage:Sphere stage|treatement:no | Sphere ncRNA seq | For data processing reads were quality checked by FastQCVersion 0.11.8 and adaptors were cut off by Cutadapt Version 1.16 and only reads that lay between 18 40 nt were kept. The reads of each sample were first aligned to different database by using Bowtie2 Version 2.3.4.1 count table was generated by featureCounts. Genome build: GRCz11 genome and cDNA tRNA database GtRNAdb GRCz11 | embryo | For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 μl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4℃ the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80℃ until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37℃ then purified by phenol: chloroform extraction. The aim of this step is removing the 2 3’ cyclic phosphate group from the 3’end of 5’tRFls and add phosphate group to the 5’end of 3’tRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 μg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol. | strain:Tubingen|developmental stage:Sphere stage|treatement:no | GSM5069283 | GSM5069283: Sphere ncRNA seq; Danio rerio; ncRNA Seq | GSM5069283 | 1 | For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 μl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4℃ the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80℃ until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37℃ then purified by phenol: chloroform extraction. The aim of this step is removing the 2 three prime cyclic phosphate group from the three primeend of five primetRFls and add phosphate group to the five primeend of three primetRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 μg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol. | GEO Accession:GSM5069283 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina NovaSeq 6000 | SRP253438 | Sphere-RNA_seq.fq.gz | fastq | 3717222600.0 | 24781484.0 | GSM5069283 r1 | 0:150 1:0 | A:624971961;C:648134651;G:1883560788;T:560027159;N:528041 | 150 | 0 | 624971961 | 648134651 | 1883560788 | 560027159 | 528041 | SRX10049116 | SRS8212345 | SRA1056877 | GEO | Anming Meng Lab, School of Life Science, Tsinghua University | 1 | 0.66566 | 0.17271 | 0.77378 | 0.58824 | 150 | B | usable mapping rate | illumina | novaseq_era | 5prime | size_fractionation | nebnext | bulk | unknown | unknown | China | 2021-02-08 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 58545 | 58545 | SRR13652352 | SRX10049115 | SRS8212343 | SRP253438 | PRJNA613601 | five prime half of specific tRNAs feeds back to promote corresponding tRNA gene transcription in vertebrate embryos [small RNA Seq ssDRIP seq] | GSE147253 | Other | five primetRFls are small tRNA fragments derived from five prime half of mature tRNAs. However it is unknown whether five primetRFls could feed back to regulate tRNA biogenesis. Here we show that five primetRFlGly/GCC and five primetRFlGlu/CTC function to promote transcription of corresponding tRNA genes and are essential for vertebrate early embryogenesis. During zebrafish embryogenesis dynamics of five primetRFlGly/GCC and five primetRFlGlu/CTC levels correlates with that of tRNAGly/GCC and tRNAGlu/CTC levels. Morpholino mediated knockdown of five primetRFlGly/GCC or five primetRFlGlu/CTC down regulates tRNAGly/GCC or tRNAGlu/CTC levels respectively and causes embryonic lethality that is efficiently rescued by co injection of properly refolded corresponding tRNA. In zebrafish embryos tRNA:DNA and five primetRFl:DNA hybrids commonly exist on the template strand of tRNA genes. Mechanistically unstable five primetRFl:DNA hybrid may prevent the formation of transcriptionally inhibitory stable tRNA:DNA hybrids on the same tRNA loci so as to facilitate tRNA genes transcription. The uncovered mechanism may be implicated in other physiological and pathological processes. Overall design: For small RNA sequencing total RNA were extracted respectively from wildtype zebrafish embryos Tübingen Strain of 6 chosen stages and then subjected to small RNA library preparation individually. To investigate the distribution and stability of R loop on genome we performed ssDRIP seq with S9.6 antibody which specifically recognize RNA:DNA hybrid. Two replicates from wildtype embryos of 256c sphere and shield stage were collected to perform ssDRIPseq. RNaseH pre treated genome DNA was used as negative control which was also performed the standard ssDRIP seq procedure. Genomic DNA extracted from these samples were fragmentated by restriction enzymes and then immunoprecipitated by S9.6 antibody.The ssDNA strands in RNA:DNA hybrids were purified and subjected to library preparation. | parent bioproject:PRJNA753013 | pubmed:34797706 | 256c ncRNA seq | GSM5069282 | tissue:embryo|strain:Tubingen|developmental stage:256c stage|treatement:no | 256c ncRNA seq | For data processing reads were quality checked by FastQCVersion 0.11.8 and adaptors were cut off by Cutadapt Version 1.16 and only reads that lay between 18 40 nt were kept. The reads of each sample were first aligned to different database by using Bowtie2 Version 2.3.4.1 count table was generated by featureCounts. Genome build: GRCz11 genome and cDNA tRNA database GtRNAdb GRCz11 | embryo | For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 μl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4℃ the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80℃ until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37℃ then purified by phenol: chloroform extraction. The aim of this step is removing the 2 3’ cyclic phosphate group from the 3’end of 5’tRFls and add phosphate group to the 5’end of 3’tRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 μg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol. | strain:Tubingen|developmental stage:256c stage|treatement:no | GSM5069282 | GSM5069282: 256c ncRNA seq; Danio rerio; ncRNA Seq | GSM5069282 | 1 | For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 μl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4℃ the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80℃ until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37℃ then purified by phenol: chloroform extraction. The aim of this step is removing the 2 three prime cyclic phosphate group from the three primeend of five primetRFls and add phosphate group to the five primeend of three primetRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 μg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol. | GEO Accession:GSM5069282 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina NovaSeq 6000 | SRP253438 | 256c-RNA_seq.fq.gz | fastq | 4634985600.0 | 30899904.0 | GSM5069282 r1 | 0:150 1:0 | A:815670917;C:820280105;G:2237895473;T:760861465;N:277640 | 150 | 0 | 815670917 | 820280105 | 2237895473 | 760861465 | 277640 | SRX10049115 | SRS8212343 | SRA1056877 | GEO | Anming Meng Lab, School of Life Science, Tsinghua University | 1 | 0.67611 | 0.16429 | 0.8076 | 0.58827 | 150 | B | usable mapping rate | illumina | novaseq_era | 5prime | size_fractionation | nebnext | bulk | unknown | unknown | China | 2021-02-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 58546 | 58546 | SRR13652351 | SRX10049114 | SRS8212341 | SRP253438 | PRJNA613601 | five prime half of specific tRNAs feeds back to promote corresponding tRNA gene transcription in vertebrate embryos [small RNA Seq ssDRIP seq] | GSE147253 | Other | five primetRFls are small tRNA fragments derived from five prime half of mature tRNAs. However it is unknown whether five primetRFls could feed back to regulate tRNA biogenesis. Here we show that five primetRFlGly/GCC and five primetRFlGlu/CTC function to promote transcription of corresponding tRNA genes and are essential for vertebrate early embryogenesis. During zebrafish embryogenesis dynamics of five primetRFlGly/GCC and five primetRFlGlu/CTC levels correlates with that of tRNAGly/GCC and tRNAGlu/CTC levels. Morpholino mediated knockdown of five primetRFlGly/GCC or five primetRFlGlu/CTC down regulates tRNAGly/GCC or tRNAGlu/CTC levels respectively and causes embryonic lethality that is efficiently rescued by co injection of properly refolded corresponding tRNA. In zebrafish embryos tRNA:DNA and five primetRFl:DNA hybrids commonly exist on the template strand of tRNA genes. Mechanistically unstable five primetRFl:DNA hybrid may prevent the formation of transcriptionally inhibitory stable tRNA:DNA hybrids on the same tRNA loci so as to facilitate tRNA genes transcription. The uncovered mechanism may be implicated in other physiological and pathological processes. Overall design: For small RNA sequencing total RNA were extracted respectively from wildtype zebrafish embryos Tübingen Strain of 6 chosen stages and then subjected to small RNA library preparation individually. To investigate the distribution and stability of R loop on genome we performed ssDRIP seq with S9.6 antibody which specifically recognize RNA:DNA hybrid. Two replicates from wildtype embryos of 256c sphere and shield stage were collected to perform ssDRIPseq. RNaseH pre treated genome DNA was used as negative control which was also performed the standard ssDRIP seq procedure. Genomic DNA extracted from these samples were fragmentated by restriction enzymes and then immunoprecipitated by S9.6 antibody.The ssDNA strands in RNA:DNA hybrids were purified and subjected to library preparation. | parent bioproject:PRJNA753013 | pubmed:34797706 | 1cell ncRNA seq | GSM5069281 | tissue:embryo|strain:Tubingen|developmental stage:1cell stage|treatement:no | 1cell ncRNA seq | For data processing reads were quality checked by FastQCVersion 0.11.8 and adaptors were cut off by Cutadapt Version 1.16 and only reads that lay between 18 40 nt were kept. The reads of each sample were first aligned to different database by using Bowtie2 Version 2.3.4.1 count table was generated by featureCounts. Genome build: GRCz11 genome and cDNA tRNA database GtRNAdb GRCz11 | embryo | For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 μl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4℃ the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80℃ until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37℃ then purified by phenol: chloroform extraction. The aim of this step is removing the 2 3’ cyclic phosphate group from the 3’end of 5’tRFls and add phosphate group to the 5’end of 3’tRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 μg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol. | strain:Tubingen|developmental stage:1cell stage|treatement:no | GSM5069281 | GSM5069281: 1cell ncRNA seq; Danio rerio; ncRNA Seq | GSM5069281 | 1 | For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 μl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4℃ the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80℃ until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37℃ then purified by phenol: chloroform extraction. The aim of this step is removing the 2 three prime cyclic phosphate group from the three primeend of five primetRFls and add phosphate group to the five primeend of three primetRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 μg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol. | GEO Accession:GSM5069281 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina NovaSeq 6000 | SRP253438 | 1cell-RNA_seq.fq.gz | fastq | 4393191750.0 | 29287945.0 | GSM5069281 r1 | 0:150 1:0 | A:767598671;C:783490468;G:2110419912;T:731062034;N:620665 | 150 | 0 | 767598671 | 783490468 | 2110419912 | 731062034 | 620665 | SRX10049114 | SRS8212341 | SRA1056877 | GEO | Anming Meng Lab, School of Life Science, Tsinghua University | 1 | 0.68353 | 0.17141 | 0.80338 | 0.63249 | 150 | B | usable mapping rate | illumina | novaseq_era | 5prime | size_fractionation | nebnext | bulk | unknown | unknown | China | 2021-02-08 | Zygote | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 58547 | 58547 | SRR13652350 | SRX10049113 | SRS8212340 | SRP253438 | PRJNA613601 | five prime half of specific tRNAs feeds back to promote corresponding tRNA gene transcription in vertebrate embryos [small RNA Seq ssDRIP seq] | GSE147253 | Other | five primetRFls are small tRNA fragments derived from five prime half of mature tRNAs. However it is unknown whether five primetRFls could feed back to regulate tRNA biogenesis. Here we show that five primetRFlGly/GCC and five primetRFlGlu/CTC function to promote transcription of corresponding tRNA genes and are essential for vertebrate early embryogenesis. During zebrafish embryogenesis dynamics of five primetRFlGly/GCC and five primetRFlGlu/CTC levels correlates with that of tRNAGly/GCC and tRNAGlu/CTC levels. Morpholino mediated knockdown of five primetRFlGly/GCC or five primetRFlGlu/CTC down regulates tRNAGly/GCC or tRNAGlu/CTC levels respectively and causes embryonic lethality that is efficiently rescued by co injection of properly refolded corresponding tRNA. In zebrafish embryos tRNA:DNA and five primetRFl:DNA hybrids commonly exist on the template strand of tRNA genes. Mechanistically unstable five primetRFl:DNA hybrid may prevent the formation of transcriptionally inhibitory stable tRNA:DNA hybrids on the same tRNA loci so as to facilitate tRNA genes transcription. The uncovered mechanism may be implicated in other physiological and pathological processes. Overall design: For small RNA sequencing total RNA were extracted respectively from wildtype zebrafish embryos Tübingen Strain of 6 chosen stages and then subjected to small RNA library preparation individually. To investigate the distribution and stability of R loop on genome we performed ssDRIP seq with S9.6 antibody which specifically recognize RNA:DNA hybrid. Two replicates from wildtype embryos of 256c sphere and shield stage were collected to perform ssDRIPseq. RNaseH pre treated genome DNA was used as negative control which was also performed the standard ssDRIP seq procedure. Genomic DNA extracted from these samples were fragmentated by restriction enzymes and then immunoprecipitated by S9.6 antibody.The ssDNA strands in RNA:DNA hybrids were purified and subjected to library preparation. | parent bioproject:PRJNA753013 | pubmed:34797706 | Egg ncRNA seq | GSM5069280 | tissue:mature oocyte|strain:Tubingen|developmental stage:Mature Oocyte|treatement:no | Egg ncRNA seq | For data processing reads were quality checked by FastQCVersion 0.11.8 and adaptors were cut off by Cutadapt Version 1.16 and only reads that lay between 18 40 nt were kept. The reads of each sample were first aligned to different database by using Bowtie2 Version 2.3.4.1 count table was generated by featureCounts. Genome build: GRCz11 genome and cDNA tRNA database GtRNAdb GRCz11 | mature oocyte | For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 μl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4℃ the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80℃ until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37℃ then purified by phenol: chloroform extraction. The aim of this step is removing the 2 3’ cyclic phosphate group from the 3’end of 5’tRFls and add phosphate group to the 5’end of 3’tRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 μg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol. | strain:Tubingen|developmental stage:Mature Oocyte|treatement:no | GSM5069280 | GSM5069280: Egg ncRNA seq; Danio rerio; ncRNA Seq | GSM5069280 | 1 | For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 μl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4℃ the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80℃ until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37℃ then purified by phenol: chloroform extraction. The aim of this step is removing the 2 three prime cyclic phosphate group from the three primeend of five primetRFls and add phosphate group to the five primeend of three primetRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 μg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol. | GEO Accession:GSM5069280 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina NovaSeq 6000 | SRP253438 | Egg-RNA_seq.fq.gz | fastq | 4328292000.0 | 28855280.0 | GSM5069280 r1 | 0:150 1:0 | A:757944111;C:789419055;G:2112325298;T:668359520;N:244016 | 150 | 0 | 757944111 | 789419055 | 2112325298 | 668359520 | 244016 | SRX10049113 | SRS8212340 | SRA1056877 | GEO | Anming Meng Lab, School of Life Science, Tsinghua University | 1 | 0.74704 | 0.18839 | 0.83197 | 0.55802 | 150 | B | usable mapping rate | illumina | novaseq_era | 5prime | size_fractionation | nebnext | bulk | unknown | unknown | China | 2021-02-08 | Zygote | Embryo | Oocyte | Reproductive System |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;