RNAquarium Metadata Server
Institute Website Terms of Use Privacy Policy

run_metadata

137 rows where devstage_curation = "Undetermined" and tissue_curation_coarse = "Hematopoietic System"

✎ View and edit SQL

This data as json, CSV (advanced)

technology 7

tissue_curation 4

experiment.library_selection 4

devstage_curation_coarse 4

experiment.platform 2

experiment.library_strategy 2

experiment.library_source 2

experiment.library_layout 2

tissue_curation_coarse 1

  • Hematopoietic System · 137 ✖

devstage_curation 1

  • Undetermined · 137 ✖
Link rowid ▼ run.accession experiment.accession sample.accession study.accession bioproject study.title study.alias study.type study.abstract study.attributes study.PMIDs sample.description sample.title sample.alias sample.centername sample.attributes GEOsample.title GEOsample.dataprocessing GEOsample.source GEOsample.treatmentprotocol GEOsample.extractprotocol GEOsample.growthprotocol GEOsample.characteristics GEOsample.accession experiment.title experiment.alias experiment.library_name experiment.design_description experiment.library_construction_protocol experiment.attributes experiment.library_strategy experiment.library_source experiment.library_selection experiment.library_layout experiment.platform experiment.instrument_model experiment.spot_descriptor experiment.study_ref run.title run.attributes run.filename run.semantic_name run.total_bases run.total_spots run.alias run.read_lengths run.base_counts run.r1_length run.r2_length run.r3_length run.r4_length run.Acount run.Ccount run.Gcount run.Tcount run.Ncount run.experiment run.pool_member submission.accession submission.srasource submission.bioprojectsource seqdetective.n_mates seqdetective.mapping_rate.mate1 seqdetective.mapping_rate.mate2 seqdetective.nofeature_rate.mate1 seqdetective.nofeature_rate.mate2 seqdetective.sparsity.mate1 seqdetective.sparsity.mate2 seqdetective.pos_strand_rate.mate1 seqdetective.pos_strand_rate.mate2 seqdetective.readlen.mate1 seqdetective.readlen.mate2 seqdetective.judgement.mate1 seqdetective.judgement.mate2 seqdetective.judgement.reason platform_family instrument_generation read_bias selection_class prep_kit sc_or_bulk tech_class technology tech_variant submission.bioprojectsource.country earliest_date devstage_curation devstage_curation_coarse tissue_curation tissue_curation_coarse
8092 8092 ERR2402432 ERX2443286 ERS2295360 ERP107516 PRJEB25583 The transcriptome of Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos ena-STUDY-DPSQ-14-03-2018-19:09:10:340-151 Other The zebrafish gene trap line qmc551 carries a gene trap transposon in intron 1 of the gene gfi1aa which a encodes a transcriptional repressor. The presence of the transposon interferes with the transcription of the gfi1aa gene during haematopoiesis. Despite the lack of Gfi1aa expression primitive red blood cell development appears to be normal due to functional redundancy with a second gene called gfi1b. Loss of Gfi1aa and Gfi1b protein expression in embryos that are homozygous for qmc551 and injected with gfi1b morpholinos leads to maturation defects in primitive red blood cells. Here we performed an RNA sequencing experiment to study the early programming of Gfi1aa and/or Gfi1b depleted primitive red blood cells. For this purpose we made use of the gene trap's gfp reporter gene expression in the primitive red blood cells to isolate these cells by fluorescence activated cell sorting from either qmc551 heterozygous or homozygous 20 hpf embryos that were or were not injected with the gfi1b morpholinos at the one cell stage. Batches of 200 embryos were dissociated in a Liberase Blendzyme solution. GFP positive primitive red blood cells were isolated by fluorescence activated cell sorting. 3 samples of between 1700 and 4000 cells were collected per batch. Total RNA was isolated from the cells of each of the 4 x 3 samples Het1 3 HetMO1 3 Hom1 3 and HomMO1 3 and used to generate full length cDNA of polyadenylated transcripts. Following cDNA amplification and library preparation paired end 75 bp reads were generated on the Illumina NextSeq500 sequencing platform. ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 03 14   Hom MO rep3 Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos SAMEA104693977 DPSQ ENA FIRST PUBLIC:2018 10 12T17:03:15Z|ENA LAST UPDATE:2018 03 14T19:09:14Z|External Id:SAMEA104693977|INSDC center name:DPSQ|INSDC first public:2018 10 12T17:03:15Z|INSDC last update:2018 03 14T19:09:14Z|INSDC status:public|Submitter Id:CM12|common name:zebrafish|sample name:CM12|scientific name:Danio rerio                 NextSeq 500 paired end sequencing ena EXPERIMENT DPSQ 14 03 2018 19:09:09:420 12 unspecified 1     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA NextSeq 500   ERP107516 NextSeq 500 paired end sequencing ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 11 16 CM12.trimmed.read_1.fastq.gz CM12.trimmed.read_2.fastq.gz fastq fastq 5384061477.0 38388598.0 ena RUN DPSQ 14 03 2018 19:09:09:420 12 0:70.70 1:69.55 A:1490429493;C:1197976503;G:1220014984;T:1475615043;N:25454 70 69     1490429493 1197976503 1220014984 1475615043 25454 ERX2443286 ERS2295360 ERA1246315 European Nucleotide Archive Deep Seq department, Centre for Genetics and Genomics, The University of Nottingham, United Kingdom 2 0.92285 0.9206 0.06862 0.0688 0.73983 0.74566 0.4752 0.49125 76 75 B B biological fallback assumption illumina nextseq full_length poly_a unknown bulk unknown unknown   United Kingdom 2018-03-14 Undetermined Embryo Blood Hematopoietic System
8093 8093 ERR2402431 ERX2443285 ERS2295359 ERP107516 PRJEB25583 The transcriptome of Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos ena-STUDY-DPSQ-14-03-2018-19:09:10:340-151 Other The zebrafish gene trap line qmc551 carries a gene trap transposon in intron 1 of the gene gfi1aa which a encodes a transcriptional repressor. The presence of the transposon interferes with the transcription of the gfi1aa gene during haematopoiesis. Despite the lack of Gfi1aa expression primitive red blood cell development appears to be normal due to functional redundancy with a second gene called gfi1b. Loss of Gfi1aa and Gfi1b protein expression in embryos that are homozygous for qmc551 and injected with gfi1b morpholinos leads to maturation defects in primitive red blood cells. Here we performed an RNA sequencing experiment to study the early programming of Gfi1aa and/or Gfi1b depleted primitive red blood cells. For this purpose we made use of the gene trap's gfp reporter gene expression in the primitive red blood cells to isolate these cells by fluorescence activated cell sorting from either qmc551 heterozygous or homozygous 20 hpf embryos that were or were not injected with the gfi1b morpholinos at the one cell stage. Batches of 200 embryos were dissociated in a Liberase Blendzyme solution. GFP positive primitive red blood cells were isolated by fluorescence activated cell sorting. 3 samples of between 1700 and 4000 cells were collected per batch. Total RNA was isolated from the cells of each of the 4 x 3 samples Het1 3 HetMO1 3 Hom1 3 and HomMO1 3 and used to generate full length cDNA of polyadenylated transcripts. Following cDNA amplification and library preparation paired end 75 bp reads were generated on the Illumina NextSeq500 sequencing platform. ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 03 14   Hom MO rep2 Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos SAMEA104693976 DPSQ ENA FIRST PUBLIC:2018 10 12T17:03:15Z|ENA LAST UPDATE:2018 03 14T19:09:14Z|External Id:SAMEA104693976|INSDC center name:DPSQ|INSDC first public:2018 10 12T17:03:15Z|INSDC last update:2018 03 14T19:09:14Z|INSDC status:public|Submitter Id:CM11|common name:zebrafish|sample name:CM11|scientific name:Danio rerio                 NextSeq 500 paired end sequencing ena EXPERIMENT DPSQ 14 03 2018 19:09:09:420 11 unspecified 1     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA NextSeq 500   ERP107516 NextSeq 500 paired end sequencing ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 11 16 CM11.trimmed.read_1.fastq.gz CM11.trimmed.read_2.fastq.gz fastq fastq 5472085589.0 38860681.0 ena RUN DPSQ 14 03 2018 19:09:09:420 11 0:70.98 1:69.83 A:1514986213;C:1217661004;G:1240412104;T:1499000816;N:25452 70 69     1514986213 1217661004 1240412104 1499000816 25452 ERX2443285 ERS2295359 ERA1246315 European Nucleotide Archive Deep Seq department, Centre for Genetics and Genomics, The University of Nottingham, United Kingdom 2 0.91987 0.91874 0.0693 0.07042 0.74042 0.74629 0.48229 0.49144 76 76 B B biological fallback assumption illumina nextseq full_length poly_a unknown bulk unknown unknown   United Kingdom 2018-03-14 Undetermined Embryo Blood Hematopoietic System
8094 8094 ERR2402430 ERX2443284 ERS2295358 ERP107516 PRJEB25583 The transcriptome of Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos ena-STUDY-DPSQ-14-03-2018-19:09:10:340-151 Other The zebrafish gene trap line qmc551 carries a gene trap transposon in intron 1 of the gene gfi1aa which a encodes a transcriptional repressor. The presence of the transposon interferes with the transcription of the gfi1aa gene during haematopoiesis. Despite the lack of Gfi1aa expression primitive red blood cell development appears to be normal due to functional redundancy with a second gene called gfi1b. Loss of Gfi1aa and Gfi1b protein expression in embryos that are homozygous for qmc551 and injected with gfi1b morpholinos leads to maturation defects in primitive red blood cells. Here we performed an RNA sequencing experiment to study the early programming of Gfi1aa and/or Gfi1b depleted primitive red blood cells. For this purpose we made use of the gene trap's gfp reporter gene expression in the primitive red blood cells to isolate these cells by fluorescence activated cell sorting from either qmc551 heterozygous or homozygous 20 hpf embryos that were or were not injected with the gfi1b morpholinos at the one cell stage. Batches of 200 embryos were dissociated in a Liberase Blendzyme solution. GFP positive primitive red blood cells were isolated by fluorescence activated cell sorting. 3 samples of between 1700 and 4000 cells were collected per batch. Total RNA was isolated from the cells of each of the 4 x 3 samples Het1 3 HetMO1 3 Hom1 3 and HomMO1 3 and used to generate full length cDNA of polyadenylated transcripts. Following cDNA amplification and library preparation paired end 75 bp reads were generated on the Illumina NextSeq500 sequencing platform. ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 03 14   Hom MO rep1 Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos SAMEA104693975 DPSQ ENA FIRST PUBLIC:2018 10 12T17:03:15Z|ENA LAST UPDATE:2018 03 14T19:09:14Z|External Id:SAMEA104693975|INSDC center name:DPSQ|INSDC first public:2018 10 12T17:03:15Z|INSDC last update:2018 03 14T19:09:14Z|INSDC status:public|Submitter Id:CM10|common name:zebrafish|sample name:CM10|scientific name:Danio rerio                 NextSeq 500 paired end sequencing ena EXPERIMENT DPSQ 14 03 2018 19:09:09:420 10 unspecified 1     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA NextSeq 500   ERP107516 NextSeq 500 paired end sequencing ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 11 16 CM10.trimmed.read_1.fastq.gz CM10.trimmed.read_2.fastq.gz fastq fastq 6091085806.0 43064771.0 ena RUN DPSQ 14 03 2018 19:09:09:420 10 0:71.33 1:70.11 A:1692450462;C:1348639943;G:1375433963;T:1674532019;N:29419 71 70     1692450462 1348639943 1375433963 1674532019 29419 ERX2443284 ERS2295358 ERA1246315 European Nucleotide Archive Deep Seq department, Centre for Genetics and Genomics, The University of Nottingham, United Kingdom 2 0.92184 0.92064 0.0699 0.0704 0.74286 0.74874 0.48978 0.48997 75 73 B B biological fallback assumption illumina nextseq full_length poly_a unknown bulk unknown unknown   United Kingdom 2018-03-14 Undetermined Embryo Blood Hematopoietic System
8095 8095 ERR2402429 ERX2443283 ERS2295357 ERP107516 PRJEB25583 The transcriptome of Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos ena-STUDY-DPSQ-14-03-2018-19:09:10:340-151 Other The zebrafish gene trap line qmc551 carries a gene trap transposon in intron 1 of the gene gfi1aa which a encodes a transcriptional repressor. The presence of the transposon interferes with the transcription of the gfi1aa gene during haematopoiesis. Despite the lack of Gfi1aa expression primitive red blood cell development appears to be normal due to functional redundancy with a second gene called gfi1b. Loss of Gfi1aa and Gfi1b protein expression in embryos that are homozygous for qmc551 and injected with gfi1b morpholinos leads to maturation defects in primitive red blood cells. Here we performed an RNA sequencing experiment to study the early programming of Gfi1aa and/or Gfi1b depleted primitive red blood cells. For this purpose we made use of the gene trap's gfp reporter gene expression in the primitive red blood cells to isolate these cells by fluorescence activated cell sorting from either qmc551 heterozygous or homozygous 20 hpf embryos that were or were not injected with the gfi1b morpholinos at the one cell stage. Batches of 200 embryos were dissociated in a Liberase Blendzyme solution. GFP positive primitive red blood cells were isolated by fluorescence activated cell sorting. 3 samples of between 1700 and 4000 cells were collected per batch. Total RNA was isolated from the cells of each of the 4 x 3 samples Het1 3 HetMO1 3 Hom1 3 and HomMO1 3 and used to generate full length cDNA of polyadenylated transcripts. Following cDNA amplification and library preparation paired end 75 bp reads were generated on the Illumina NextSeq500 sequencing platform. ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 03 14   Hom uninj rep3 Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos SAMEA104693974 DPSQ ENA FIRST PUBLIC:2018 10 12T17:03:15Z|ENA LAST UPDATE:2018 03 14T19:09:14Z|External Id:SAMEA104693974|INSDC center name:DPSQ|INSDC first public:2018 10 12T17:03:15Z|INSDC last update:2018 03 14T19:09:14Z|INSDC status:public|Submitter Id:CM9|common name:zebrafish|sample name:CM9|scientific name:Danio rerio                 NextSeq 500 paired end sequencing ena EXPERIMENT DPSQ 14 03 2018 19:09:09:420 9 unspecified 1     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA NextSeq 500   ERP107516 NextSeq 500 paired end sequencing ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 11 16 CM9.trimmed.read_1.fastq.gz CM9.trimmed.read_2.fastq.gz fastq fastq 6329252570.0 45070159.0 ena RUN DPSQ 14 03 2018 19:09:09:420 9 0:70.79 1:69.64 A:1753489708;C:1407193617;G:1433449502;T:1735090181;N:29562 70 69     1753489708 1407193617 1433449502 1735090181 29562 ERX2443283 ERS2295357 ERA1246315 European Nucleotide Archive Deep Seq department, Centre for Genetics and Genomics, The University of Nottingham, United Kingdom 2 0.91683 0.91616 0.06775 0.06825 0.75158 0.75737 0.49386 0.49199 76 75 B B biological fallback assumption illumina nextseq full_length poly_a unknown bulk unknown unknown   United Kingdom 2018-03-14 Undetermined Embryo Blood Hematopoietic System
8096 8096 ERR2402428 ERX2443282 ERS2295356 ERP107516 PRJEB25583 The transcriptome of Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos ena-STUDY-DPSQ-14-03-2018-19:09:10:340-151 Other The zebrafish gene trap line qmc551 carries a gene trap transposon in intron 1 of the gene gfi1aa which a encodes a transcriptional repressor. The presence of the transposon interferes with the transcription of the gfi1aa gene during haematopoiesis. Despite the lack of Gfi1aa expression primitive red blood cell development appears to be normal due to functional redundancy with a second gene called gfi1b. Loss of Gfi1aa and Gfi1b protein expression in embryos that are homozygous for qmc551 and injected with gfi1b morpholinos leads to maturation defects in primitive red blood cells. Here we performed an RNA sequencing experiment to study the early programming of Gfi1aa and/or Gfi1b depleted primitive red blood cells. For this purpose we made use of the gene trap's gfp reporter gene expression in the primitive red blood cells to isolate these cells by fluorescence activated cell sorting from either qmc551 heterozygous or homozygous 20 hpf embryos that were or were not injected with the gfi1b morpholinos at the one cell stage. Batches of 200 embryos were dissociated in a Liberase Blendzyme solution. GFP positive primitive red blood cells were isolated by fluorescence activated cell sorting. 3 samples of between 1700 and 4000 cells were collected per batch. Total RNA was isolated from the cells of each of the 4 x 3 samples Het1 3 HetMO1 3 Hom1 3 and HomMO1 3 and used to generate full length cDNA of polyadenylated transcripts. Following cDNA amplification and library preparation paired end 75 bp reads were generated on the Illumina NextSeq500 sequencing platform. ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 03 14   Hom uninj rep2 Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos SAMEA104693973 DPSQ ENA FIRST PUBLIC:2018 10 12T17:03:15Z|ENA LAST UPDATE:2018 03 14T19:09:14Z|External Id:SAMEA104693973|INSDC center name:DPSQ|INSDC first public:2018 10 12T17:03:15Z|INSDC last update:2018 03 14T19:09:14Z|INSDC status:public|Submitter Id:CM8|common name:zebrafish|sample name:CM8|scientific name:Danio rerio                 NextSeq 500 paired end sequencing ena EXPERIMENT DPSQ 14 03 2018 19:09:09:420 8 unspecified 1     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA NextSeq 500   ERP107516 NextSeq 500 paired end sequencing ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 11 16 CM8.trimmed.read_1.fastq.gz CM8.trimmed.read_2.fastq.gz fastq fastq 5405185494.0 38637007.0 ena RUN DPSQ 14 03 2018 19:09:09:420 8 0:70.45 1:69.44 A:1491577735;C:1206599147;G:1229354248;T:1477628006;N:26358 70 69     1491577735 1206599147 1229354248 1477628006 26358 ERX2443282 ERS2295356 ERA1246315 European Nucleotide Archive Deep Seq department, Centre for Genetics and Genomics, The University of Nottingham, United Kingdom 2 0.91776 0.91567 0.07134 0.07241 0.7517 0.75716 0.47952 0.48745 73 73 B B biological fallback assumption illumina nextseq full_length poly_a unknown bulk unknown unknown   United Kingdom 2018-03-14 Undetermined Embryo Blood Hematopoietic System
8097 8097 ERR2402427 ERX2443281 ERS2295355 ERP107516 PRJEB25583 The transcriptome of Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos ena-STUDY-DPSQ-14-03-2018-19:09:10:340-151 Other The zebrafish gene trap line qmc551 carries a gene trap transposon in intron 1 of the gene gfi1aa which a encodes a transcriptional repressor. The presence of the transposon interferes with the transcription of the gfi1aa gene during haematopoiesis. Despite the lack of Gfi1aa expression primitive red blood cell development appears to be normal due to functional redundancy with a second gene called gfi1b. Loss of Gfi1aa and Gfi1b protein expression in embryos that are homozygous for qmc551 and injected with gfi1b morpholinos leads to maturation defects in primitive red blood cells. Here we performed an RNA sequencing experiment to study the early programming of Gfi1aa and/or Gfi1b depleted primitive red blood cells. For this purpose we made use of the gene trap's gfp reporter gene expression in the primitive red blood cells to isolate these cells by fluorescence activated cell sorting from either qmc551 heterozygous or homozygous 20 hpf embryos that were or were not injected with the gfi1b morpholinos at the one cell stage. Batches of 200 embryos were dissociated in a Liberase Blendzyme solution. GFP positive primitive red blood cells were isolated by fluorescence activated cell sorting. 3 samples of between 1700 and 4000 cells were collected per batch. Total RNA was isolated from the cells of each of the 4 x 3 samples Het1 3 HetMO1 3 Hom1 3 and HomMO1 3 and used to generate full length cDNA of polyadenylated transcripts. Following cDNA amplification and library preparation paired end 75 bp reads were generated on the Illumina NextSeq500 sequencing platform. ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 03 14   Hom uninj rep1 Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos SAMEA104693972 DPSQ ENA FIRST PUBLIC:2018 10 12T17:03:15Z|ENA LAST UPDATE:2018 03 14T19:09:14Z|External Id:SAMEA104693972|INSDC center name:DPSQ|INSDC first public:2018 10 12T17:03:15Z|INSDC last update:2018 03 14T19:09:14Z|INSDC status:public|Submitter Id:CM7|common name:zebrafish|sample name:CM7|scientific name:Danio rerio                 NextSeq 500 paired end sequencing ena EXPERIMENT DPSQ 14 03 2018 19:09:09:420 7 unspecified 1     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA NextSeq 500   ERP107516 NextSeq 500 paired end sequencing ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 11 16 CM7.trimmed.read_1.fastq.gz CM7.trimmed.read_2.fastq.gz fastq fastq 6262947202.0 44863127.0 ena RUN DPSQ 14 03 2018 19:09:09:420 7 0:70.28 1:69.32 A:1732018658;C:1394742098;G:1420957611;T:1715198292;N:30543 70 69     1732018658 1394742098 1420957611 1715198292 30543 ERX2443281 ERS2295355 ERA1246315 European Nucleotide Archive Deep Seq department, Centre for Genetics and Genomics, The University of Nottingham, United Kingdom 2 0.91622 0.9144 0.0754 0.07588 0.74886 0.75371 0.48672 0.48471 76 76 B B biological fallback assumption illumina nextseq full_length poly_a unknown bulk unknown unknown   United Kingdom 2018-03-14 Undetermined Embryo Blood Hematopoietic System
8098 8098 ERR2402426 ERX2443280 ERS2295354 ERP107516 PRJEB25583 The transcriptome of Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos ena-STUDY-DPSQ-14-03-2018-19:09:10:340-151 Other The zebrafish gene trap line qmc551 carries a gene trap transposon in intron 1 of the gene gfi1aa which a encodes a transcriptional repressor. The presence of the transposon interferes with the transcription of the gfi1aa gene during haematopoiesis. Despite the lack of Gfi1aa expression primitive red blood cell development appears to be normal due to functional redundancy with a second gene called gfi1b. Loss of Gfi1aa and Gfi1b protein expression in embryos that are homozygous for qmc551 and injected with gfi1b morpholinos leads to maturation defects in primitive red blood cells. Here we performed an RNA sequencing experiment to study the early programming of Gfi1aa and/or Gfi1b depleted primitive red blood cells. For this purpose we made use of the gene trap's gfp reporter gene expression in the primitive red blood cells to isolate these cells by fluorescence activated cell sorting from either qmc551 heterozygous or homozygous 20 hpf embryos that were or were not injected with the gfi1b morpholinos at the one cell stage. Batches of 200 embryos were dissociated in a Liberase Blendzyme solution. GFP positive primitive red blood cells were isolated by fluorescence activated cell sorting. 3 samples of between 1700 and 4000 cells were collected per batch. Total RNA was isolated from the cells of each of the 4 x 3 samples Het1 3 HetMO1 3 Hom1 3 and HomMO1 3 and used to generate full length cDNA of polyadenylated transcripts. Following cDNA amplification and library preparation paired end 75 bp reads were generated on the Illumina NextSeq500 sequencing platform. ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 03 14   Het MO rep3 Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos SAMEA104693971 DPSQ ENA FIRST PUBLIC:2018 10 12T17:03:15Z|ENA LAST UPDATE:2018 03 14T19:09:14Z|External Id:SAMEA104693971|INSDC center name:DPSQ|INSDC first public:2018 10 12T17:03:15Z|INSDC last update:2018 03 14T19:09:14Z|INSDC status:public|Submitter Id:CM6|common name:zebrafish|sample name:CM6|scientific name:Danio rerio                 NextSeq 500 paired end sequencing ena EXPERIMENT DPSQ 14 03 2018 19:09:09:420 6 unspecified 1     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA NextSeq 500   ERP107516 NextSeq 500 paired end sequencing ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 11 16 CM6.trimmed.read_1.fastq.gz CM6.trimmed.read_2.fastq.gz fastq fastq 5819615834.0 41591499.0 ena RUN DPSQ 14 03 2018 19:09:09:420 6 0:70.47 1:69.45 A:1594833553;C:1309877713;G:1335153588;T:1579722744;N:28236 70 69     1594833553 1309877713 1335153588 1579722744 28236 ERX2443280 ERS2295354 ERA1246315 European Nucleotide Archive Deep Seq department, Centre for Genetics and Genomics, The University of Nottingham, United Kingdom 2 0.92 0.9183 0.0573 0.05793 0.77362 0.778 0.47792 0.46987 76 75 B B biological fallback assumption illumina nextseq full_length poly_a unknown bulk unknown unknown   United Kingdom 2018-03-14 Undetermined Embryo Blood Hematopoietic System
8099 8099 ERR2402425 ERX2443279 ERS2295353 ERP107516 PRJEB25583 The transcriptome of Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos ena-STUDY-DPSQ-14-03-2018-19:09:10:340-151 Other The zebrafish gene trap line qmc551 carries a gene trap transposon in intron 1 of the gene gfi1aa which a encodes a transcriptional repressor. The presence of the transposon interferes with the transcription of the gfi1aa gene during haematopoiesis. Despite the lack of Gfi1aa expression primitive red blood cell development appears to be normal due to functional redundancy with a second gene called gfi1b. Loss of Gfi1aa and Gfi1b protein expression in embryos that are homozygous for qmc551 and injected with gfi1b morpholinos leads to maturation defects in primitive red blood cells. Here we performed an RNA sequencing experiment to study the early programming of Gfi1aa and/or Gfi1b depleted primitive red blood cells. For this purpose we made use of the gene trap's gfp reporter gene expression in the primitive red blood cells to isolate these cells by fluorescence activated cell sorting from either qmc551 heterozygous or homozygous 20 hpf embryos that were or were not injected with the gfi1b morpholinos at the one cell stage. Batches of 200 embryos were dissociated in a Liberase Blendzyme solution. GFP positive primitive red blood cells were isolated by fluorescence activated cell sorting. 3 samples of between 1700 and 4000 cells were collected per batch. Total RNA was isolated from the cells of each of the 4 x 3 samples Het1 3 HetMO1 3 Hom1 3 and HomMO1 3 and used to generate full length cDNA of polyadenylated transcripts. Following cDNA amplification and library preparation paired end 75 bp reads were generated on the Illumina NextSeq500 sequencing platform. ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 03 14   Het MO rep2 Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos SAMEA104693970 DPSQ ENA FIRST PUBLIC:2018 10 12T17:03:15Z|ENA LAST UPDATE:2018 03 14T19:09:14Z|External Id:SAMEA104693970|INSDC center name:DPSQ|INSDC first public:2018 10 12T17:03:15Z|INSDC last update:2018 03 14T19:09:14Z|INSDC status:public|Submitter Id:CM5|common name:zebrafish|sample name:CM5|scientific name:Danio rerio                 NextSeq 500 paired end sequencing ena EXPERIMENT DPSQ 14 03 2018 19:09:09:420 5 unspecified 1     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA NextSeq 500   ERP107516 NextSeq 500 paired end sequencing ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 11 16 CM5.trimmed.read_1.fastq.gz CM5.trimmed.read_2.fastq.gz fastq fastq 5573895202.0 39518227.0 ena RUN DPSQ 14 03 2018 19:09:09:420 5 0:71.02 1:70.03 A:1530297250;C:1251775796;G:1276506882;T:1515288256;N:27018 71 70     1530297250 1251775796 1276506882 1515288256 27018 ERX2443279 ERS2295353 ERA1246315 European Nucleotide Archive Deep Seq department, Centre for Genetics and Genomics, The University of Nottingham, United Kingdom 2 0.92217 0.92081 0.06807 0.06843 0.76926 0.77441 0.45543 0.48098 76 75 B B biological fallback assumption illumina nextseq full_length poly_a unknown bulk unknown unknown   United Kingdom 2018-03-14 Undetermined Embryo Blood Hematopoietic System
8100 8100 ERR2402424 ERX2443278 ERS2295352 ERP107516 PRJEB25583 The transcriptome of Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos ena-STUDY-DPSQ-14-03-2018-19:09:10:340-151 Other The zebrafish gene trap line qmc551 carries a gene trap transposon in intron 1 of the gene gfi1aa which a encodes a transcriptional repressor. The presence of the transposon interferes with the transcription of the gfi1aa gene during haematopoiesis. Despite the lack of Gfi1aa expression primitive red blood cell development appears to be normal due to functional redundancy with a second gene called gfi1b. Loss of Gfi1aa and Gfi1b protein expression in embryos that are homozygous for qmc551 and injected with gfi1b morpholinos leads to maturation defects in primitive red blood cells. Here we performed an RNA sequencing experiment to study the early programming of Gfi1aa and/or Gfi1b depleted primitive red blood cells. For this purpose we made use of the gene trap's gfp reporter gene expression in the primitive red blood cells to isolate these cells by fluorescence activated cell sorting from either qmc551 heterozygous or homozygous 20 hpf embryos that were or were not injected with the gfi1b morpholinos at the one cell stage. Batches of 200 embryos were dissociated in a Liberase Blendzyme solution. GFP positive primitive red blood cells were isolated by fluorescence activated cell sorting. 3 samples of between 1700 and 4000 cells were collected per batch. Total RNA was isolated from the cells of each of the 4 x 3 samples Het1 3 HetMO1 3 Hom1 3 and HomMO1 3 and used to generate full length cDNA of polyadenylated transcripts. Following cDNA amplification and library preparation paired end 75 bp reads were generated on the Illumina NextSeq500 sequencing platform. ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 03 14   Het MO rep1 Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos SAMEA104693969 DPSQ ENA FIRST PUBLIC:2018 10 12T17:03:15Z|ENA LAST UPDATE:2018 03 14T19:09:14Z|External Id:SAMEA104693969|INSDC center name:DPSQ|INSDC first public:2018 10 12T17:03:15Z|INSDC last update:2018 03 14T19:09:14Z|INSDC status:public|Submitter Id:CM4|common name:zebrafish|sample name:CM4|scientific name:Danio rerio                 NextSeq 500 paired end sequencing ena EXPERIMENT DPSQ 14 03 2018 19:09:09:420 4 unspecified 1     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA NextSeq 500   ERP107516 NextSeq 500 paired end sequencing ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 11 16 CM4.trimmed.read_1.fastq.gz CM4.trimmed.read_2.fastq.gz fastq fastq 5803404091.0 41335851.0 ena RUN DPSQ 14 03 2018 19:09:09:420 4 0:70.72 1:69.67 A:1590577583;C:1305683925;G:1331895549;T:1575219146;N:27888 70 69     1590577583 1305683925 1331895549 1575219146 27888 ERX2443278 ERS2295352 ERA1246315 European Nucleotide Archive Deep Seq department, Centre for Genetics and Genomics, The University of Nottingham, United Kingdom 2 0.9216 0.91971 0.05719 0.05738 0.77333 0.77761 0.47789 0.47244 76 74 B B biological fallback assumption illumina nextseq full_length poly_a unknown bulk unknown unknown   United Kingdom 2018-03-14 Undetermined Embryo Blood Hematopoietic System
8101 8101 ERR2402423 ERX2443277 ERS2295351 ERP107516 PRJEB25583 The transcriptome of Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos ena-STUDY-DPSQ-14-03-2018-19:09:10:340-151 Other The zebrafish gene trap line qmc551 carries a gene trap transposon in intron 1 of the gene gfi1aa which a encodes a transcriptional repressor. The presence of the transposon interferes with the transcription of the gfi1aa gene during haematopoiesis. Despite the lack of Gfi1aa expression primitive red blood cell development appears to be normal due to functional redundancy with a second gene called gfi1b. Loss of Gfi1aa and Gfi1b protein expression in embryos that are homozygous for qmc551 and injected with gfi1b morpholinos leads to maturation defects in primitive red blood cells. Here we performed an RNA sequencing experiment to study the early programming of Gfi1aa and/or Gfi1b depleted primitive red blood cells. For this purpose we made use of the gene trap's gfp reporter gene expression in the primitive red blood cells to isolate these cells by fluorescence activated cell sorting from either qmc551 heterozygous or homozygous 20 hpf embryos that were or were not injected with the gfi1b morpholinos at the one cell stage. Batches of 200 embryos were dissociated in a Liberase Blendzyme solution. GFP positive primitive red blood cells were isolated by fluorescence activated cell sorting. 3 samples of between 1700 and 4000 cells were collected per batch. Total RNA was isolated from the cells of each of the 4 x 3 samples Het1 3 HetMO1 3 Hom1 3 and HomMO1 3 and used to generate full length cDNA of polyadenylated transcripts. Following cDNA amplification and library preparation paired end 75 bp reads were generated on the Illumina NextSeq500 sequencing platform. ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 03 14   Het uninj rep3 Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos SAMEA104693968 DPSQ ENA FIRST PUBLIC:2018 10 12T17:03:15Z|ENA LAST UPDATE:2018 03 14T19:09:14Z|External Id:SAMEA104693968|INSDC center name:DPSQ|INSDC first public:2018 10 12T17:03:15Z|INSDC last update:2018 03 14T19:09:14Z|INSDC status:public|Submitter Id:CM3|common name:zebrafish|sample name:CM3|scientific name:Danio rerio                 NextSeq 500 paired end sequencing ena EXPERIMENT DPSQ 14 03 2018 19:09:09:420 3 unspecified 1     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA NextSeq 500   ERP107516 NextSeq 500 paired end sequencing ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 11 16 CM3.trimmed.read_1.fastq.gz CM3.trimmed.read_2.fastq.gz fastq fastq 5992797058.0 42390223.0 ena RUN DPSQ 14 03 2018 19:09:09:420 3 0:71.26 1:70.11 A:1639390320;C:1352082344;G:1378624207;T:1622672043;N:28144 71 70     1639390320 1352082344 1378624207 1622672043 28144 ERX2443277 ERS2295351 ERA1246315 European Nucleotide Archive Deep Seq department, Centre for Genetics and Genomics, The University of Nottingham, United Kingdom 2 0.92104 0.92006 0.07044 0.07056 0.77506 0.78137 0.48154 0.46497 75 75 B B biological fallback assumption illumina nextseq full_length poly_a unknown bulk unknown unknown   United Kingdom 2018-03-14 Undetermined Embryo Blood Hematopoietic System
8102 8102 ERR2402422 ERX2443276 ERS2295350 ERP107516 PRJEB25583 The transcriptome of Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos ena-STUDY-DPSQ-14-03-2018-19:09:10:340-151 Other The zebrafish gene trap line qmc551 carries a gene trap transposon in intron 1 of the gene gfi1aa which a encodes a transcriptional repressor. The presence of the transposon interferes with the transcription of the gfi1aa gene during haematopoiesis. Despite the lack of Gfi1aa expression primitive red blood cell development appears to be normal due to functional redundancy with a second gene called gfi1b. Loss of Gfi1aa and Gfi1b protein expression in embryos that are homozygous for qmc551 and injected with gfi1b morpholinos leads to maturation defects in primitive red blood cells. Here we performed an RNA sequencing experiment to study the early programming of Gfi1aa and/or Gfi1b depleted primitive red blood cells. For this purpose we made use of the gene trap's gfp reporter gene expression in the primitive red blood cells to isolate these cells by fluorescence activated cell sorting from either qmc551 heterozygous or homozygous 20 hpf embryos that were or were not injected with the gfi1b morpholinos at the one cell stage. Batches of 200 embryos were dissociated in a Liberase Blendzyme solution. GFP positive primitive red blood cells were isolated by fluorescence activated cell sorting. 3 samples of between 1700 and 4000 cells were collected per batch. Total RNA was isolated from the cells of each of the 4 x 3 samples Het1 3 HetMO1 3 Hom1 3 and HomMO1 3 and used to generate full length cDNA of polyadenylated transcripts. Following cDNA amplification and library preparation paired end 75 bp reads were generated on the Illumina NextSeq500 sequencing platform. ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 03 14   Het uninj rep2 Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos SAMEA104693967 DPSQ ENA FIRST PUBLIC:2018 10 12T17:03:15Z|ENA LAST UPDATE:2018 03 14T19:09:14Z|External Id:SAMEA104693967|INSDC center name:DPSQ|INSDC first public:2018 10 12T17:03:15Z|INSDC last update:2018 03 14T19:09:14Z|INSDC status:public|Submitter Id:CM2|common name:zebrafish|sample name:CM2|scientific name:Danio rerio                 NextSeq 500 paired end sequencing ena EXPERIMENT DPSQ 14 03 2018 19:09:09:420 2 unspecified 1     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA NextSeq 500   ERP107516 NextSeq 500 paired end sequencing ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 11 16 CM2.trimmed.read_2.fastq.gz CM2.trimmed.read_1.fastq.gz fastq fastq 5611396868.0 39759688.0 ena RUN DPSQ 14 03 2018 19:09:09:420 2 0:71.11 1:70.02 A:1537234166;C:1262883447;G:1288444384;T:1522807333;N:27538 71 70     1537234166 1262883447 1288444384 1522807333 27538 ERX2443276 ERS2295350 ERA1246315 European Nucleotide Archive Deep Seq department, Centre for Genetics and Genomics, The University of Nottingham, United Kingdom 2 0.91881 0.91733 0.06861 0.06958 0.77238 0.77883 0.48415 0.47367 76 73 B B biological fallback assumption illumina nextseq full_length poly_a unknown bulk unknown unknown   United Kingdom 2018-03-14 Undetermined Embryo Blood Hematopoietic System
8103 8103 ERR2402421 ERX2443275 ERS2295349 ERP107516 PRJEB25583 The transcriptome of Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos ena-STUDY-DPSQ-14-03-2018-19:09:10:340-151 Other The zebrafish gene trap line qmc551 carries a gene trap transposon in intron 1 of the gene gfi1aa which a encodes a transcriptional repressor. The presence of the transposon interferes with the transcription of the gfi1aa gene during haematopoiesis. Despite the lack of Gfi1aa expression primitive red blood cell development appears to be normal due to functional redundancy with a second gene called gfi1b. Loss of Gfi1aa and Gfi1b protein expression in embryos that are homozygous for qmc551 and injected with gfi1b morpholinos leads to maturation defects in primitive red blood cells. Here we performed an RNA sequencing experiment to study the early programming of Gfi1aa and/or Gfi1b depleted primitive red blood cells. For this purpose we made use of the gene trap's gfp reporter gene expression in the primitive red blood cells to isolate these cells by fluorescence activated cell sorting from either qmc551 heterozygous or homozygous 20 hpf embryos that were or were not injected with the gfi1b morpholinos at the one cell stage. Batches of 200 embryos were dissociated in a Liberase Blendzyme solution. GFP positive primitive red blood cells were isolated by fluorescence activated cell sorting. 3 samples of between 1700 and 4000 cells were collected per batch. Total RNA was isolated from the cells of each of the 4 x 3 samples Het1 3 HetMO1 3 Hom1 3 and HomMO1 3 and used to generate full length cDNA of polyadenylated transcripts. Following cDNA amplification and library preparation paired end 75 bp reads were generated on the Illumina NextSeq500 sequencing platform. ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 03 14   Het uninj rep1 Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos SAMEA104693966 DPSQ ENA FIRST PUBLIC:2018 10 12T17:03:15Z|ENA LAST UPDATE:2018 03 14T19:09:14Z|External Id:SAMEA104693966|INSDC center name:DPSQ|INSDC first public:2018 10 12T17:03:15Z|INSDC last update:2018 03 14T19:09:14Z|INSDC status:public|Submitter Id:CM1|common name:zebrafish|sample name:CM1|scientific name:Danio rerio                 NextSeq 500 paired end sequencing ena EXPERIMENT DPSQ 14 03 2018 19:09:09:420 1 unspecified 1     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA NextSeq 500   ERP107516 NextSeq 500 paired end sequencing ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 11 16 CM1.trimmed.read_1.fastq.gz CM1.trimmed.read_2.fastq.gz fastq fastq 6229432533.0 44233290.0 ena RUN DPSQ 14 03 2018 19:09:09:420 1 0:70.98 1:69.85 A:1712806281;C:1395764700;G:1423415860;T:1697416127;N:29565 70 69     1712806281 1395764700 1423415860 1697416127 29565 ERX2443275 ERS2295349 ERA1246315 European Nucleotide Archive Deep Seq department, Centre for Genetics and Genomics, The University of Nottingham, United Kingdom 2 0.91818 0.9169 0.07104 0.07095 0.77585 0.78066 0.47896 0.46653 56 56 B B biological fallback assumption illumina nextseq full_length poly_a unknown bulk unknown unknown   United Kingdom 2018-03-14 Undetermined Embryo Blood Hematopoietic System
33158 33158 SRR29791088 SRX25290435 SRS21969151 SRP519440 PRJNA1134759 Developmental trajectory and evolutionary origin of thymic mimetic cells [dataset 2] GSE272064 Transcriptome Analysis The generation of self tolerant repertoires of T cells depends on the expression of peripheral self antigens in the thymic epithelium and the presence of small populations of cells mimicking the diverse phenotypes of peripheral tissues. Whereas the molecular underpinnings of self antigen expression have been extensively studied the developmental origins and differentiation pathways of thymic mimetic cells remain to be identified. Moreover the histological identification of myoid and other peripheral cell types as components of the thymic microenvironment of many vertebrate species raises questions as to the evolutionary origin of this unique tolerance mechanism. Here we show that during mouse development mimetic cells appear in the microenvironment in two successive waves. Cells exhibiting transcriptional signatures characteristic of muscle ionocyte goblet and ciliated cells emerge before birth whereas others for instance those mimicking enterohepatic cells and skin keratinocytes appear postnatally. These two groups also respond differently to modulations of TEC progenitor pools caused by deletions of Foxn1 and Ascl1 expression of a hypomorphic Foxn1 transcription factor and overexpression of Bmp4 and Fgf7 signalling molecules. Differences in mimetic cell populations were also observed in thymic microenvironments reconstructed by replacement of mouse Foxn1 with evolutionarily ancient Foxn1/4 gene family members including the Foxn4 gene of the cephalochordate amphioxus and the Foxn4 and Foxn1 genes of a cartilaginous fish. Whereas some cell types such as ciliated cells develop in the thymus in the absence of Foxn1 mimetic cells appearing postnatally such as enterohepatic cells require the activity of the vertebrate specific transcription factor Foxn1. The thymus of cartilaginous fishes and the thymoid of lampreys a representative of jawless vertebrates that exhibit an alternative adaptive immune system also harbour cells expressing genes encoding peripheral tissue components such as the liver …       Dr thymus foxn1 / rep3 GSM8392364   source name:thymus|tissue:thymus|cell type:thymus cells|genotype:foxn1 / |geo loc name:missing|collection date:missing Dr thymus foxn1 / rep3 Transcriptomes were analyzed on the Galaxy platform. Adapters were trimmed with TrimGalore! version 0.4.3.1. Reads were aligned to the reference genome with Hisat2 version 2.1.0. Counts were generated with featureCounts version 1.6.1.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files containing raw counts for each sample thymus   Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.   tissue:thymus|cell type:thymus cells|genotype:foxn1 / GSM8392364 GSM8392364: Dr thymus foxn1 / rep3; Danio rerio; RNA Seq GSM8392364 r1 GSM8392364 1 Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP519440     BK6_R1.fastq.gz BK6_R2.fastq.gz fastq fastq 40416715568.0 133830184.0 GSM8392364 r1 0:151 1:151 A:11536946706;C:8490306261;G:9295609599;T:11092005423;N:1847579 151 151     11536946706 8490306261 9295609599 11092005423 1847579 SRX25290435 SRS21969151 SRA1922343 Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics 2 0.89276 0.89283 0.11419 0.11482 0.73306 0.73409 0.46305 0.46571 151 151 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk bulk bulk   Germany 2024-07-11 Undetermined Undetermined Thymus Hematopoietic System
33159 33159 SRR29791089 SRX25290434 SRS21969152 SRP519440 PRJNA1134759 Developmental trajectory and evolutionary origin of thymic mimetic cells [dataset 2] GSE272064 Transcriptome Analysis The generation of self tolerant repertoires of T cells depends on the expression of peripheral self antigens in the thymic epithelium and the presence of small populations of cells mimicking the diverse phenotypes of peripheral tissues. Whereas the molecular underpinnings of self antigen expression have been extensively studied the developmental origins and differentiation pathways of thymic mimetic cells remain to be identified. Moreover the histological identification of myoid and other peripheral cell types as components of the thymic microenvironment of many vertebrate species raises questions as to the evolutionary origin of this unique tolerance mechanism. Here we show that during mouse development mimetic cells appear in the microenvironment in two successive waves. Cells exhibiting transcriptional signatures characteristic of muscle ionocyte goblet and ciliated cells emerge before birth whereas others for instance those mimicking enterohepatic cells and skin keratinocytes appear postnatally. These two groups also respond differently to modulations of TEC progenitor pools caused by deletions of Foxn1 and Ascl1 expression of a hypomorphic Foxn1 transcription factor and overexpression of Bmp4 and Fgf7 signalling molecules. Differences in mimetic cell populations were also observed in thymic microenvironments reconstructed by replacement of mouse Foxn1 with evolutionarily ancient Foxn1/4 gene family members including the Foxn4 gene of the cephalochordate amphioxus and the Foxn4 and Foxn1 genes of a cartilaginous fish. Whereas some cell types such as ciliated cells develop in the thymus in the absence of Foxn1 mimetic cells appearing postnatally such as enterohepatic cells require the activity of the vertebrate specific transcription factor Foxn1. The thymus of cartilaginous fishes and the thymoid of lampreys a representative of jawless vertebrates that exhibit an alternative adaptive immune system also harbour cells expressing genes encoding peripheral tissue components such as the liver …       Dr thymus foxn1 / rep2 GSM8392363   source name:thymus|tissue:thymus|cell type:thymus cells|genotype:foxn1 / |geo loc name:missing|collection date:missing Dr thymus foxn1 / rep2 Transcriptomes were analyzed on the Galaxy platform. Adapters were trimmed with TrimGalore! version 0.4.3.1. Reads were aligned to the reference genome with Hisat2 version 2.1.0. Counts were generated with featureCounts version 1.6.1.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files containing raw counts for each sample thymus   Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.   tissue:thymus|cell type:thymus cells|genotype:foxn1 / GSM8392363 GSM8392363: Dr thymus foxn1 / rep2; Danio rerio; RNA Seq GSM8392363 r1 GSM8392363 1 Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP519440     BK5_R1.fastq.gz BK5_R2.fastq.gz fastq fastq 41734368446.0 138193273.0 GSM8392363 r1 0:151 1:151 A:12015023285;C:8850050726;G:9485443497;T:11381944831;N:1906107 151 151     12015023285 8850050726 9485443497 11381944831 1906107 SRX25290434 SRS21969152 SRA1922343 Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics 2 0.88856 0.88918 0.11978 0.11946 0.73003 0.732 0.44244 0.43125 151 151 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk bulk bulk   Germany 2024-07-11 Undetermined Undetermined Thymus Hematopoietic System
33160 33160 SRR29791090 SRX25290433 SRS21969150 SRP519440 PRJNA1134759 Developmental trajectory and evolutionary origin of thymic mimetic cells [dataset 2] GSE272064 Transcriptome Analysis The generation of self tolerant repertoires of T cells depends on the expression of peripheral self antigens in the thymic epithelium and the presence of small populations of cells mimicking the diverse phenotypes of peripheral tissues. Whereas the molecular underpinnings of self antigen expression have been extensively studied the developmental origins and differentiation pathways of thymic mimetic cells remain to be identified. Moreover the histological identification of myoid and other peripheral cell types as components of the thymic microenvironment of many vertebrate species raises questions as to the evolutionary origin of this unique tolerance mechanism. Here we show that during mouse development mimetic cells appear in the microenvironment in two successive waves. Cells exhibiting transcriptional signatures characteristic of muscle ionocyte goblet and ciliated cells emerge before birth whereas others for instance those mimicking enterohepatic cells and skin keratinocytes appear postnatally. These two groups also respond differently to modulations of TEC progenitor pools caused by deletions of Foxn1 and Ascl1 expression of a hypomorphic Foxn1 transcription factor and overexpression of Bmp4 and Fgf7 signalling molecules. Differences in mimetic cell populations were also observed in thymic microenvironments reconstructed by replacement of mouse Foxn1 with evolutionarily ancient Foxn1/4 gene family members including the Foxn4 gene of the cephalochordate amphioxus and the Foxn4 and Foxn1 genes of a cartilaginous fish. Whereas some cell types such as ciliated cells develop in the thymus in the absence of Foxn1 mimetic cells appearing postnatally such as enterohepatic cells require the activity of the vertebrate specific transcription factor Foxn1. The thymus of cartilaginous fishes and the thymoid of lampreys a representative of jawless vertebrates that exhibit an alternative adaptive immune system also harbour cells expressing genes encoding peripheral tissue components such as the liver …       Dr thymus foxn1 / rep1 GSM8392362   source name:thymus|tissue:thymus|cell type:thymus cells|genotype:foxn1 / |geo loc name:missing|collection date:missing Dr thymus foxn1 / rep1 Transcriptomes were analyzed on the Galaxy platform. Adapters were trimmed with TrimGalore! version 0.4.3.1. Reads were aligned to the reference genome with Hisat2 version 2.1.0. Counts were generated with featureCounts version 1.6.1.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files containing raw counts for each sample thymus   Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.   tissue:thymus|cell type:thymus cells|genotype:foxn1 / GSM8392362 GSM8392362: Dr thymus foxn1 / rep1; Danio rerio; RNA Seq GSM8392362 r1 GSM8392362 1 Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP519440     BK4_R2.fastq.gz BK4_R1.fastq.gz fastq fastq 39302001858.0 130139079.0 GSM8392362 r1 0:151 1:151 A:11220466966;C:8305776940;G:9105878447;T:10668104948;N:1774557 151 151     11220466966 8305776940 9105878447 10668104948 1774557 SRX25290433 SRS21969150 SRA1922343 Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics 2 0.89299 0.89318 0.11306 0.1139 0.74123 0.74345 0.45102 0.46093 151 151 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk bulk bulk   Germany 2024-07-11 Undetermined Undetermined Thymus Hematopoietic System
33161 33161 SRR29791091 SRX25290432 SRS21969149 SRP519440 PRJNA1134759 Developmental trajectory and evolutionary origin of thymic mimetic cells [dataset 2] GSE272064 Transcriptome Analysis The generation of self tolerant repertoires of T cells depends on the expression of peripheral self antigens in the thymic epithelium and the presence of small populations of cells mimicking the diverse phenotypes of peripheral tissues. Whereas the molecular underpinnings of self antigen expression have been extensively studied the developmental origins and differentiation pathways of thymic mimetic cells remain to be identified. Moreover the histological identification of myoid and other peripheral cell types as components of the thymic microenvironment of many vertebrate species raises questions as to the evolutionary origin of this unique tolerance mechanism. Here we show that during mouse development mimetic cells appear in the microenvironment in two successive waves. Cells exhibiting transcriptional signatures characteristic of muscle ionocyte goblet and ciliated cells emerge before birth whereas others for instance those mimicking enterohepatic cells and skin keratinocytes appear postnatally. These two groups also respond differently to modulations of TEC progenitor pools caused by deletions of Foxn1 and Ascl1 expression of a hypomorphic Foxn1 transcription factor and overexpression of Bmp4 and Fgf7 signalling molecules. Differences in mimetic cell populations were also observed in thymic microenvironments reconstructed by replacement of mouse Foxn1 with evolutionarily ancient Foxn1/4 gene family members including the Foxn4 gene of the cephalochordate amphioxus and the Foxn4 and Foxn1 genes of a cartilaginous fish. Whereas some cell types such as ciliated cells develop in the thymus in the absence of Foxn1 mimetic cells appearing postnatally such as enterohepatic cells require the activity of the vertebrate specific transcription factor Foxn1. The thymus of cartilaginous fishes and the thymoid of lampreys a representative of jawless vertebrates that exhibit an alternative adaptive immune system also harbour cells expressing genes encoding peripheral tissue components such as the liver …       Dr thymus foxn1+/+ rep3 GSM8392361   source name:thymus|tissue:thymus|cell type:thymus cells|genotype:foxn1+/+|geo loc name:missing|collection date:missing Dr thymus foxn1+/+ rep3 Transcriptomes were analyzed on the Galaxy platform. Adapters were trimmed with TrimGalore! version 0.4.3.1. Reads were aligned to the reference genome with Hisat2 version 2.1.0. Counts were generated with featureCounts version 1.6.1.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files containing raw counts for each sample thymus   Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.   tissue:thymus|cell type:thymus cells|genotype:foxn1+/+ GSM8392361 GSM8392361: Dr thymus foxn1+/+ rep3; Danio rerio; RNA Seq GSM8392361 r1 GSM8392361 1 Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP519440     BK3_R1.fastq.gz BK3_R2.fastq.gz fastq fastq 37243022634.0 123321267.0 GSM8392361 r1 0:151 1:151 A:10858514997;C:7805630226;G:8359994769;T:10217208022;N:1674620 151 151     10858514997 7805630226 8359994769 10217208022 1674620 SRX25290432 SRS21969149 SRA1922343 Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics 2 0.87732 0.87686 0.20353 0.20336 0.73261 0.7343 0.49192 0.4924 151 151 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk bulk bulk   Germany 2024-07-11 Undetermined Undetermined Thymus Hematopoietic System
33162 33162 SRR29791092 SRX25290431 SRS21969148 SRP519440 PRJNA1134759 Developmental trajectory and evolutionary origin of thymic mimetic cells [dataset 2] GSE272064 Transcriptome Analysis The generation of self tolerant repertoires of T cells depends on the expression of peripheral self antigens in the thymic epithelium and the presence of small populations of cells mimicking the diverse phenotypes of peripheral tissues. Whereas the molecular underpinnings of self antigen expression have been extensively studied the developmental origins and differentiation pathways of thymic mimetic cells remain to be identified. Moreover the histological identification of myoid and other peripheral cell types as components of the thymic microenvironment of many vertebrate species raises questions as to the evolutionary origin of this unique tolerance mechanism. Here we show that during mouse development mimetic cells appear in the microenvironment in two successive waves. Cells exhibiting transcriptional signatures characteristic of muscle ionocyte goblet and ciliated cells emerge before birth whereas others for instance those mimicking enterohepatic cells and skin keratinocytes appear postnatally. These two groups also respond differently to modulations of TEC progenitor pools caused by deletions of Foxn1 and Ascl1 expression of a hypomorphic Foxn1 transcription factor and overexpression of Bmp4 and Fgf7 signalling molecules. Differences in mimetic cell populations were also observed in thymic microenvironments reconstructed by replacement of mouse Foxn1 with evolutionarily ancient Foxn1/4 gene family members including the Foxn4 gene of the cephalochordate amphioxus and the Foxn4 and Foxn1 genes of a cartilaginous fish. Whereas some cell types such as ciliated cells develop in the thymus in the absence of Foxn1 mimetic cells appearing postnatally such as enterohepatic cells require the activity of the vertebrate specific transcription factor Foxn1. The thymus of cartilaginous fishes and the thymoid of lampreys a representative of jawless vertebrates that exhibit an alternative adaptive immune system also harbour cells expressing genes encoding peripheral tissue components such as the liver …       Dr thymus foxn1+/+ rep2 GSM8392360   source name:thymus|tissue:thymus|cell type:thymus cells|genotype:foxn1+/+|geo loc name:missing|collection date:missing Dr thymus foxn1+/+ rep2 Transcriptomes were analyzed on the Galaxy platform. Adapters were trimmed with TrimGalore! version 0.4.3.1. Reads were aligned to the reference genome with Hisat2 version 2.1.0. Counts were generated with featureCounts version 1.6.1.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files containing raw counts for each sample thymus   Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.   tissue:thymus|cell type:thymus cells|genotype:foxn1+/+ GSM8392360 GSM8392360: Dr thymus foxn1+/+ rep2; Danio rerio; RNA Seq GSM8392360 r1 GSM8392360 1 Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP519440     BK2_R1.fastq.gz BK2_R2.fastq.gz fastq fastq 34154139756.0 113093178.0 GSM8392360 r1 0:151 1:151 A:9754575779;C:7198913431;G:7834944597;T:9364172876;N:1533073 151 151     9754575779 7198913431 7834944597 9364172876 1533073 SRX25290431 SRS21969148 SRA1922343 Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics 2 0.87955 0.88145 0.18817 0.18856 0.72707 0.72839 0.49921 0.49737 151 151 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk bulk bulk   Germany 2024-07-11 Undetermined Undetermined Thymus Hematopoietic System
33163 33163 SRR29791093 SRX25290430 SRS21969147 SRP519440 PRJNA1134759 Developmental trajectory and evolutionary origin of thymic mimetic cells [dataset 2] GSE272064 Transcriptome Analysis The generation of self tolerant repertoires of T cells depends on the expression of peripheral self antigens in the thymic epithelium and the presence of small populations of cells mimicking the diverse phenotypes of peripheral tissues. Whereas the molecular underpinnings of self antigen expression have been extensively studied the developmental origins and differentiation pathways of thymic mimetic cells remain to be identified. Moreover the histological identification of myoid and other peripheral cell types as components of the thymic microenvironment of many vertebrate species raises questions as to the evolutionary origin of this unique tolerance mechanism. Here we show that during mouse development mimetic cells appear in the microenvironment in two successive waves. Cells exhibiting transcriptional signatures characteristic of muscle ionocyte goblet and ciliated cells emerge before birth whereas others for instance those mimicking enterohepatic cells and skin keratinocytes appear postnatally. These two groups also respond differently to modulations of TEC progenitor pools caused by deletions of Foxn1 and Ascl1 expression of a hypomorphic Foxn1 transcription factor and overexpression of Bmp4 and Fgf7 signalling molecules. Differences in mimetic cell populations were also observed in thymic microenvironments reconstructed by replacement of mouse Foxn1 with evolutionarily ancient Foxn1/4 gene family members including the Foxn4 gene of the cephalochordate amphioxus and the Foxn4 and Foxn1 genes of a cartilaginous fish. Whereas some cell types such as ciliated cells develop in the thymus in the absence of Foxn1 mimetic cells appearing postnatally such as enterohepatic cells require the activity of the vertebrate specific transcription factor Foxn1. The thymus of cartilaginous fishes and the thymoid of lampreys a representative of jawless vertebrates that exhibit an alternative adaptive immune system also harbour cells expressing genes encoding peripheral tissue components such as the liver …       Dr thymus foxn1+/+ rep1 GSM8392359   source name:thymus|tissue:thymus|cell type:thymus cells|genotype:foxn1+/+|geo loc name:missing|collection date:missing Dr thymus foxn1+/+ rep1 Transcriptomes were analyzed on the Galaxy platform. Adapters were trimmed with TrimGalore! version 0.4.3.1. Reads were aligned to the reference genome with Hisat2 version 2.1.0. Counts were generated with featureCounts version 1.6.1.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files containing raw counts for each sample thymus   Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.   tissue:thymus|cell type:thymus cells|genotype:foxn1+/+ GSM8392359 GSM8392359: Dr thymus foxn1+/+ rep1; Danio rerio; RNA Seq GSM8392359 r1 GSM8392359 1 Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP519440     BK1_R2.fastq.gz BK1_R1.fastq.gz fastq fastq 48045652026.0 159091563.0 GSM8392359 r1 0:151 1:151 A:13986882382;C:9969611893;G:10712447624;T:13374538759;N:2171368 151 151     13986882382 9969611893 10712447624 13374538759 2171368 SRX25290430 SRS21969147 SRA1922343 Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics 2 0.87379 0.87656 0.21786 0.2191 0.73815 0.73975 0.49869 0.49808 151 151 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk bulk bulk   Germany 2024-07-11 Undetermined Undetermined Thymus Hematopoietic System
38293 38293 SRR1647684 SRX756919 SRS742121 SRP049663 PRJNA266803 Spring Varaemia of Carp Virus SVCV infection of adult zebrafish GSE63133 Transcriptome Analysis During viral infection a large number of immune response signaling molecules including the interferon regulatory IRF family and type I interferon IFN transcribe. The exact identity and expression levels of fish IRFs and type I IFNs during viral infection remains largely unknown. Here we utilized Illumina sequencing technology to determine differential expression patterns for both zebrafish IRFs and type I IFNs during two stages of SVCV infection i.e. 6h and 24h post infection. For 12 zebrafish IRFs we identified DrIRF1 mRNA as one of the most abundant in normal tissues and also in SVCV infected tissues but DrIRF11 had a very weak basal expression and was almost not induced by SVCV infection. We also identified the highly basal expression of DrIRF7 which together with DrIRF3 was highly induced by SVCV infection. For type I IFNs zebrafish has four IFN genes three of which IFN1/2/3 particularly IFN 1 and IFN 3 were significantly transcribed under the same conditions. Overall design: 12 adult healthy male and female 1:1 zebrafish were infected by intraperitoneal inoculation with approximately 50 µL SVCV 10 8TCID50/mL. 6 infected fish male:female=1:1 were sacrificed at 6h post injection and 6 male:female=1:1 were sacrificed at 24h post injection for head kidney 6K and 24K and spleen 6S and 24S. Head kidney and spleen 0K and 0S from the 6 control adult zebrafish male:female=1:1 were collected as negative control.   pubmed:25535281   24S GSM1541908   source name:spleen|tissue:spleen|disease state:24h post SVCV infection 24S Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to mm8 whole genome using bowtie v0.12.2 with parameters q p 4 e 100 y a m 10 best strata Reads Per Kilobase of exon per Megabase of library size RPKM were calculated using a protocol from Chepelev et al. Nucleic Acids Research 2009. In short exons from all isoforms of a gene were merged to create one meta transcript. The number of reads falling in the exons of this meta transcript were counted and normalized by the size of the meta transcript and by the size of the library. Genome build: mm8 Supplementary files format and content: tab delimited text files include RPKM values for each Sample ... spleen   Total RNA was extracted using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 5 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols   tissue:spleen|disease state:24h post SVCV infection GSM1541908 GSM1541908: 24S; Danio rerio; RNA Seq GSM1541908   1 Total RNA was extracted using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 5 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM1541908 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP049663     24S_ATGTCA_L003_R1.fastq fastq 1207014756.0 23666956.0 GSM1541908 r1 0:51 A:316359100;C:290453604;G:283305513;T:316815698;N:80841 51       316359100 290453604 283305513 316815698 80841 SRX756919 SRS742121 SRA200717 GEO Institute of Hydrobiology, Chinese Academy of Sciences 1 0.91158   0.09021   0.70867   0.46907   51   B   usable mapping rate illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2014-11-10 Undetermined Adult Spleen Hematopoietic System
38294 38294 SRR1647683 SRX756918 SRS742119 SRP049663 PRJNA266803 Spring Varaemia of Carp Virus SVCV infection of adult zebrafish GSE63133 Transcriptome Analysis During viral infection a large number of immune response signaling molecules including the interferon regulatory IRF family and type I interferon IFN transcribe. The exact identity and expression levels of fish IRFs and type I IFNs during viral infection remains largely unknown. Here we utilized Illumina sequencing technology to determine differential expression patterns for both zebrafish IRFs and type I IFNs during two stages of SVCV infection i.e. 6h and 24h post infection. For 12 zebrafish IRFs we identified DrIRF1 mRNA as one of the most abundant in normal tissues and also in SVCV infected tissues but DrIRF11 had a very weak basal expression and was almost not induced by SVCV infection. We also identified the highly basal expression of DrIRF7 which together with DrIRF3 was highly induced by SVCV infection. For type I IFNs zebrafish has four IFN genes three of which IFN1/2/3 particularly IFN 1 and IFN 3 were significantly transcribed under the same conditions. Overall design: 12 adult healthy male and female 1:1 zebrafish were infected by intraperitoneal inoculation with approximately 50 µL SVCV 10 8TCID50/mL. 6 infected fish male:female=1:1 were sacrificed at 6h post injection and 6 male:female=1:1 were sacrificed at 24h post injection for head kidney 6K and 24K and spleen 6S and 24S. Head kidney and spleen 0K and 0S from the 6 control adult zebrafish male:female=1:1 were collected as negative control.   pubmed:25535281   6S GSM1541907   source name:spleen|tissue:spleen|disease state:6h post SVCV infection 6S Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to mm8 whole genome using bowtie v0.12.2 with parameters q p 4 e 100 y a m 10 best strata Reads Per Kilobase of exon per Megabase of library size RPKM were calculated using a protocol from Chepelev et al. Nucleic Acids Research 2009. In short exons from all isoforms of a gene were merged to create one meta transcript. The number of reads falling in the exons of this meta transcript were counted and normalized by the size of the meta transcript and by the size of the library. Genome build: mm8 Supplementary files format and content: tab delimited text files include RPKM values for each Sample ... spleen   Total RNA was extracted using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 5 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols   tissue:spleen|disease state:6h post SVCV infection GSM1541907 GSM1541907: 6S; Danio rerio; RNA Seq GSM1541907   1 Total RNA was extracted using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 5 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM1541907 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP049663     6S_AGTTCC_L003_R1.fastq fastq 1251006540.0 24529540.0 GSM1541907 r1 0:51 A:323805792;C:303846999;G:297418642;T:325862442;N:72665 51       323805792 303846999 297418642 325862442 72665 SRX756918 SRS742119 SRA200717 GEO Institute of Hydrobiology, Chinese Academy of Sciences 1 0.92105   0.09005   0.71273   0.46937   51   B   usable mapping rate illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2014-11-10 Undetermined Adult Spleen Hematopoietic System
38295 38295 SRR1647682 SRX756917 SRS742118 SRP049663 PRJNA266803 Spring Varaemia of Carp Virus SVCV infection of adult zebrafish GSE63133 Transcriptome Analysis During viral infection a large number of immune response signaling molecules including the interferon regulatory IRF family and type I interferon IFN transcribe. The exact identity and expression levels of fish IRFs and type I IFNs during viral infection remains largely unknown. Here we utilized Illumina sequencing technology to determine differential expression patterns for both zebrafish IRFs and type I IFNs during two stages of SVCV infection i.e. 6h and 24h post infection. For 12 zebrafish IRFs we identified DrIRF1 mRNA as one of the most abundant in normal tissues and also in SVCV infected tissues but DrIRF11 had a very weak basal expression and was almost not induced by SVCV infection. We also identified the highly basal expression of DrIRF7 which together with DrIRF3 was highly induced by SVCV infection. For type I IFNs zebrafish has four IFN genes three of which IFN1/2/3 particularly IFN 1 and IFN 3 were significantly transcribed under the same conditions. Overall design: 12 adult healthy male and female 1:1 zebrafish were infected by intraperitoneal inoculation with approximately 50 µL SVCV 10 8TCID50/mL. 6 infected fish male:female=1:1 were sacrificed at 6h post injection and 6 male:female=1:1 were sacrificed at 24h post injection for head kidney 6K and 24K and spleen 6S and 24S. Head kidney and spleen 0K and 0S from the 6 control adult zebrafish male:female=1:1 were collected as negative control.   pubmed:25535281   0S GSM1541906   source name:spleen|tissue:spleen|disease state:un infected 0S Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to mm8 whole genome using bowtie v0.12.2 with parameters q p 4 e 100 y a m 10 best strata Reads Per Kilobase of exon per Megabase of library size RPKM were calculated using a protocol from Chepelev et al. Nucleic Acids Research 2009. In short exons from all isoforms of a gene were merged to create one meta transcript. The number of reads falling in the exons of this meta transcript were counted and normalized by the size of the meta transcript and by the size of the library. Genome build: mm8 Supplementary files format and content: tab delimited text files include RPKM values for each Sample ... spleen   Total RNA was extracted using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 5 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols   tissue:spleen|disease state:un infected GSM1541906 GSM1541906: 0S; Danio rerio; RNA Seq GSM1541906   1 Total RNA was extracted using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 5 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM1541906 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP049663     0S_AGTCAA_L003_R1.fastq fastq 1155087372.0 22648772.0 GSM1541906 r1 0:51 A:301183546;C:279328135;G:272663981;T:301834798;N:76912 51       301183546 279328135 272663981 301834798 76912 SRX756917 SRS742118 SRA200717 GEO Institute of Hydrobiology, Chinese Academy of Sciences 1 0.91841   0.09679   0.70546   0.47624   51   B   usable mapping rate illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2014-11-10 Undetermined Adult Spleen Hematopoietic System
47869 47869 SRR6908743 SRX3856808 SRS3100400 SRP136633 PRJNA446034 Cell type purification by single cell transcriptome trained sorting GSE112438 Other Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID a computational method that combines single cell transcriptomics for unbiased cell type identification with FACS index sorting to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.   pubmed:31585086   WKM9 eosinophils GSM3070146   tissue:WKM9 eosinophils|FISHid:WKM9|cell type:whole kidney marrow single cells|cell subtype:eosinophils WKM9 eosinophils In transcriptome libraries first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9 ensemble 74 extended with ERCC92 Supplementary files format and content: Tabular separated files with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz 1st column represents index of the cell specific barcode and the second column is the barcode WKM9 eosinophils   post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters   FISHid:WKM9|cell type:whole kidney marrow single cells|cell subtype:eosinophils GSM3070146 GSM3070146: WKM9 eosinophils; Danio rerio; RNA Seq GSM3070146   1 post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters GEO Accession:GSM3070146 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP136633     WKM9_eosinophils_L001_R1_001.fastq.gz WKM9_eosinophils_L001_R2_001.fastq.gz fastq fastq 1378279915.0 9133302.0 GSM3070146 r1 0:75.43 1:75.48 A:398409215;C:214050926;G:243007260;T:522806293;N:6221 75 75     398409215 214050926 243007260 522806293 6221 SRX3856808 SRS3100400 SRA675960 GEO Hubrecht Institute 2 0.32967 0.72245 0.27664 0.49284 0.96217 0.88688 0.44743 0.5676 76 73 T B mate1 technical by mapping diff illumina nextseq unknown random_priming trueseq sc single_cell_plate celseq   Netherlands 2018-03-28 Undetermined Undetermined Blood Hematopoietic System
47870 47870 SRR6908744 SRX3856808 SRS3100400 SRP136633 PRJNA446034 Cell type purification by single cell transcriptome trained sorting GSE112438 Other Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID a computational method that combines single cell transcriptomics for unbiased cell type identification with FACS index sorting to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.   pubmed:31585086   WKM9 eosinophils GSM3070146   tissue:WKM9 eosinophils|FISHid:WKM9|cell type:whole kidney marrow single cells|cell subtype:eosinophils WKM9 eosinophils In transcriptome libraries first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9 ensemble 74 extended with ERCC92 Supplementary files format and content: Tabular separated files with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz 1st column represents index of the cell specific barcode and the second column is the barcode WKM9 eosinophils   post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters   FISHid:WKM9|cell type:whole kidney marrow single cells|cell subtype:eosinophils GSM3070146 GSM3070146: WKM9 eosinophils; Danio rerio; RNA Seq GSM3070146   1 post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters GEO Accession:GSM3070146 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP136633     WKM9_eosinophils_L002_R1_001.fastq.gz WKM9_eosinophils_L002_R2_001.fastq.gz fastq fastq 1347027331.0 8926023.0 GSM3070146 r2 0:75.43 1:75.48 A:386373331;C:208319487;G:242442973;T:509887930;N:3610 75 75     386373331 208319487 242442973 509887930 3610 SRX3856808 SRS3100400 SRA675960 GEO Hubrecht Institute 2 0.32008 0.72405 0.26859 0.48848 0.96512 0.88791 0.46692 0.55937 76 76 T B mate1 technical by mapping diff illumina nextseq unknown random_priming trueseq sc single_cell_plate celseq   Netherlands 2018-03-28 Undetermined Undetermined Blood Hematopoietic System
47871 47871 SRR6908745 SRX3856808 SRS3100400 SRP136633 PRJNA446034 Cell type purification by single cell transcriptome trained sorting GSE112438 Other Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID a computational method that combines single cell transcriptomics for unbiased cell type identification with FACS index sorting to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.   pubmed:31585086   WKM9 eosinophils GSM3070146   tissue:WKM9 eosinophils|FISHid:WKM9|cell type:whole kidney marrow single cells|cell subtype:eosinophils WKM9 eosinophils In transcriptome libraries first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9 ensemble 74 extended with ERCC92 Supplementary files format and content: Tabular separated files with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz 1st column represents index of the cell specific barcode and the second column is the barcode WKM9 eosinophils   post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters   FISHid:WKM9|cell type:whole kidney marrow single cells|cell subtype:eosinophils GSM3070146 GSM3070146: WKM9 eosinophils; Danio rerio; RNA Seq GSM3070146   1 post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters GEO Accession:GSM3070146 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP136633     WKM9_eosinophils_L003_R1_001.fastq.gz WKM9_eosinophils_L003_R2_001.fastq.gz fastq fastq 1241011911.0 8223327.0 GSM3070146 r3 0:75.44 1:75.48 A:356514159;C:192418351;G:221034567;T:471023588;N:21246 75 75     356514159 192418351 221034567 471023588 21246 SRX3856808 SRS3100400 SRA675960 GEO Hubrecht Institute 2 0.31504 0.71934 0.26517 0.48722 0.96932 0.89499 0.47715 0.56814 76 75 T B mate1 technical by mapping diff illumina nextseq unknown random_priming trueseq sc single_cell_plate celseq   Netherlands 2018-03-28 Undetermined Undetermined Blood Hematopoietic System
47872 47872 SRR6908746 SRX3856808 SRS3100400 SRP136633 PRJNA446034 Cell type purification by single cell transcriptome trained sorting GSE112438 Other Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID a computational method that combines single cell transcriptomics for unbiased cell type identification with FACS index sorting to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.   pubmed:31585086   WKM9 eosinophils GSM3070146   tissue:WKM9 eosinophils|FISHid:WKM9|cell type:whole kidney marrow single cells|cell subtype:eosinophils WKM9 eosinophils In transcriptome libraries first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9 ensemble 74 extended with ERCC92 Supplementary files format and content: Tabular separated files with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz 1st column represents index of the cell specific barcode and the second column is the barcode WKM9 eosinophils   post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters   FISHid:WKM9|cell type:whole kidney marrow single cells|cell subtype:eosinophils GSM3070146 GSM3070146: WKM9 eosinophils; Danio rerio; RNA Seq GSM3070146   1 post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters GEO Accession:GSM3070146 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP136633     WKM9_eosinophils_L004_R1_001.fastq.gz WKM9_eosinophils_L004_R2_001.fastq.gz fastq fastq 1199788386.0 7950347.0 GSM3070146 r4 0:75.44 1:75.47 A:343966384;C:184985849;G:216629920;T:454187010;N:19223 75 75     343966384 184985849 216629920 454187010 19223 SRX3856808 SRS3100400 SRA675960 GEO Hubrecht Institute 2 0.32136 0.71802 0.27107 0.48741 0.97098 0.90057 0.4616 0.56009 76 76 T B mate1 technical by mapping diff illumina nextseq unknown random_priming trueseq sc single_cell_plate celseq   Netherlands 2018-03-28 Undetermined Undetermined Blood Hematopoietic System
47917 47917 SRR6908693 SRX3856796 SRS3100388 SRP136633 PRJNA446034 Cell type purification by single cell transcriptome trained sorting GSE112438 Other Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID a computational method that combines single cell transcriptomics for unbiased cell type identification with FACS index sorting to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.   pubmed:31585086   WKM4 eosinophils GSM3070134   tissue:WKM4 eosinophils|FISHid:WKM4|cell type:whole kidney marrow single cells|cell subtype:eosinophils WKM4 eosinophils In transcriptome libraries first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9 ensemble 74 extended with ERCC92 Supplementary files format and content: Tabular separated files with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz 1st column represents index of the cell specific barcode and the second column is the barcode WKM4 eosinophils   post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters   FISHid:WKM4|cell type:whole kidney marrow single cells|cell subtype:eosinophils GSM3070134 GSM3070134: WKM4 eosinophils; Danio rerio; RNA Seq GSM3070134   1 post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters GEO Accession:GSM3070134 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP136633     WKM4_eosinophils_L001_R1_001.fastq.gz WKM4_eosinophils_L001_R2_001.fastq.gz fastq fastq 1044383799.0 6918578.0 GSM3070134 r1 0:75.49 1:75.46 A:293266328;C:159927306;G:179144897;T:412003143;N:42125 75 75     293266328 159927306 179144897 412003143 42125 SRX3856796 SRS3100388 SRA675960 GEO Hubrecht Institute 2 0.38953 0.76677 0.33438 0.55076 0.94775 0.83664 0.47684 0.51667 75 75 T B mate1 technical by mapping diff illumina nextseq unknown random_priming trueseq sc single_cell_plate celseq   Netherlands 2018-03-28 Undetermined Undetermined Blood Hematopoietic System
47918 47918 SRR6908694 SRX3856796 SRS3100388 SRP136633 PRJNA446034 Cell type purification by single cell transcriptome trained sorting GSE112438 Other Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID a computational method that combines single cell transcriptomics for unbiased cell type identification with FACS index sorting to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.   pubmed:31585086   WKM4 eosinophils GSM3070134   tissue:WKM4 eosinophils|FISHid:WKM4|cell type:whole kidney marrow single cells|cell subtype:eosinophils WKM4 eosinophils In transcriptome libraries first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9 ensemble 74 extended with ERCC92 Supplementary files format and content: Tabular separated files with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz 1st column represents index of the cell specific barcode and the second column is the barcode WKM4 eosinophils   post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters   FISHid:WKM4|cell type:whole kidney marrow single cells|cell subtype:eosinophils GSM3070134 GSM3070134: WKM4 eosinophils; Danio rerio; RNA Seq GSM3070134   1 post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters GEO Accession:GSM3070134 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP136633     WKM4_eosinophils_L002_R1_001.fastq.gz WKM4_eosinophils_L002_R2_001.fastq.gz fastq fastq 1065518294.0 7059081.0 GSM3070134 r2 0:75.49 1:75.45 A:299578147;C:162208243;G:185866185;T:417812882;N:52837 75 75     299578147 162208243 185866185 417812882 52837 SRX3856796 SRS3100388 SRA675960 GEO Hubrecht Institute 2 0.36825 0.75817 0.3148 0.55624 0.95061 0.84794 0.47713 0.52081 76 75 T B mate1 technical by mapping diff illumina nextseq unknown random_priming trueseq sc single_cell_plate celseq   Netherlands 2018-03-28 Undetermined Undetermined Blood Hematopoietic System
47919 47919 SRR6908695 SRX3856796 SRS3100388 SRP136633 PRJNA446034 Cell type purification by single cell transcriptome trained sorting GSE112438 Other Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID a computational method that combines single cell transcriptomics for unbiased cell type identification with FACS index sorting to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.   pubmed:31585086   WKM4 eosinophils GSM3070134   tissue:WKM4 eosinophils|FISHid:WKM4|cell type:whole kidney marrow single cells|cell subtype:eosinophils WKM4 eosinophils In transcriptome libraries first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9 ensemble 74 extended with ERCC92 Supplementary files format and content: Tabular separated files with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz 1st column represents index of the cell specific barcode and the second column is the barcode WKM4 eosinophils   post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters   FISHid:WKM4|cell type:whole kidney marrow single cells|cell subtype:eosinophils GSM3070134 GSM3070134: WKM4 eosinophils; Danio rerio; RNA Seq GSM3070134   1 post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters GEO Accession:GSM3070134 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP136633     WKM4_eosinophils_L003_R1_001.fastq.gz WKM4_eosinophils_L003_R2_001.fastq.gz fastq fastq 1020526841.0 6760661.0 GSM3070134 r3 0:75.50 1:75.45 A:287644655;C:155831653;G:174910820;T:402133481;N:6232 75 75     287644655 155831653 174910820 402133481 6232 SRX3856796 SRS3100388 SRA675960 GEO Hubrecht Institute 2 0.38266 0.76495 0.32861 0.55487 0.94909 0.84502 0.47881 0.50844 76 75 T B mate1 technical by mapping diff illumina nextseq unknown random_priming trueseq sc single_cell_plate celseq   Netherlands 2018-03-28 Undetermined Undetermined Blood Hematopoietic System
47920 47920 SRR6908696 SRX3856796 SRS3100388 SRP136633 PRJNA446034 Cell type purification by single cell transcriptome trained sorting GSE112438 Other Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID a computational method that combines single cell transcriptomics for unbiased cell type identification with FACS index sorting to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.   pubmed:31585086   WKM4 eosinophils GSM3070134   tissue:WKM4 eosinophils|FISHid:WKM4|cell type:whole kidney marrow single cells|cell subtype:eosinophils WKM4 eosinophils In transcriptome libraries first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9 ensemble 74 extended with ERCC92 Supplementary files format and content: Tabular separated files with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz 1st column represents index of the cell specific barcode and the second column is the barcode WKM4 eosinophils   post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters   FISHid:WKM4|cell type:whole kidney marrow single cells|cell subtype:eosinophils GSM3070134 GSM3070134: WKM4 eosinophils; Danio rerio; RNA Seq GSM3070134   1 post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters GEO Accession:GSM3070134 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP136633     WKM4_eosinophils_L004_R2_001.fastq.gz WKM4_eosinophils_L004_R1_001.fastq.gz fastq fastq 1036249497.0 6864317.0 GSM3070134 r4 0:75.50 1:75.46 A:290241796;C:157806083;G:180760457;T:407436042;N:5119 75 75     290241796 157806083 180760457 407436042 5119 SRX3856796 SRS3100388 SRA675960 GEO Hubrecht Institute 2 0.38456 0.76284 0.32829 0.54843 0.9497 0.84668 0.48302 0.51789 76 75 T B mate1 technical by mapping diff illumina nextseq unknown random_priming trueseq sc single_cell_plate celseq   Netherlands 2018-03-28 Undetermined Undetermined Blood Hematopoietic System
47925 47925 SRR6908685 SRX3856794 SRS3100386 SRP136633 PRJNA446034 Cell type purification by single cell transcriptome trained sorting GSE112438 Other Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID a computational method that combines single cell transcriptomics for unbiased cell type identification with FACS index sorting to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.   pubmed:31585086   WKM3 eosinophils GSM3070132   tissue:WKM3 eosinophils|FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:eosinophils WKM3 eosinophils In transcriptome libraries first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9 ensemble 74 extended with ERCC92 Supplementary files format and content: Tabular separated files with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz 1st column represents index of the cell specific barcode and the second column is the barcode WKM3 eosinophils   post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters   FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:eosinophils GSM3070132 GSM3070132: WKM3 eosinophils; Danio rerio; RNA Seq GSM3070132   1 post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters GEO Accession:GSM3070132 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP136633     WKM3_eosinophils_L001_R1_001.fastq.gz WKM3_eosinophils_L001_R2_001.fastq.gz fastq fastq 1288630538.0 8538558.0 GSM3070132 r1 0:75.44 1:75.48 A:384649233;C:189860338;G:186795029;T:527108032;N:217906 75 75     384649233 189860338 186795029 527108032 217906 SRX3856794 SRS3100386 SRA675960 GEO Hubrecht Institute 2 0.38213 0.80648 0.32 0.39443 0.96749 0.92997 0.49763 0.55351 75 75 T B mate1 technical by mapping diff illumina nextseq unknown random_priming trueseq sc single_cell_plate celseq   Netherlands 2018-03-28 Undetermined Undetermined Blood Hematopoietic System
47926 47926 SRR6908686 SRX3856794 SRS3100386 SRP136633 PRJNA446034 Cell type purification by single cell transcriptome trained sorting GSE112438 Other Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID a computational method that combines single cell transcriptomics for unbiased cell type identification with FACS index sorting to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.   pubmed:31585086   WKM3 eosinophils GSM3070132   tissue:WKM3 eosinophils|FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:eosinophils WKM3 eosinophils In transcriptome libraries first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9 ensemble 74 extended with ERCC92 Supplementary files format and content: Tabular separated files with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz 1st column represents index of the cell specific barcode and the second column is the barcode WKM3 eosinophils   post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters   FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:eosinophils GSM3070132 GSM3070132: WKM3 eosinophils; Danio rerio; RNA Seq GSM3070132   1 post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters GEO Accession:GSM3070132 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP136633     WKM3_eosinophils_L002_R1_001.fastq.gz WKM3_eosinophils_L002_R2_001.fastq.gz fastq fastq 1176806695.0 7797829.0 GSM3070132 r2 0:75.44 1:75.48 A:349406324;C:172751257;G:173925861;T:480558924;N:164329 75 75     349406324 172751257 173925861 480558924 164329 SRX3856794 SRS3100386 SRA675960 GEO Hubrecht Institute 2 0.3792 0.81293 0.31911 0.39312 0.96834 0.93176 0.52878 0.54431 75 76 T B mate1 technical by mapping diff illumina nextseq unknown random_priming trueseq sc single_cell_plate celseq   Netherlands 2018-03-28 Undetermined Undetermined Blood Hematopoietic System
47927 47927 SRR6908687 SRX3856794 SRS3100386 SRP136633 PRJNA446034 Cell type purification by single cell transcriptome trained sorting GSE112438 Other Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID a computational method that combines single cell transcriptomics for unbiased cell type identification with FACS index sorting to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.   pubmed:31585086   WKM3 eosinophils GSM3070132   tissue:WKM3 eosinophils|FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:eosinophils WKM3 eosinophils In transcriptome libraries first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9 ensemble 74 extended with ERCC92 Supplementary files format and content: Tabular separated files with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz 1st column represents index of the cell specific barcode and the second column is the barcode WKM3 eosinophils   post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters   FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:eosinophils GSM3070132 GSM3070132: WKM3 eosinophils; Danio rerio; RNA Seq GSM3070132   1 post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters GEO Accession:GSM3070132 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP136633     WKM3_eosinophils_L003_R1_001.fastq.gz WKM3_eosinophils_L003_R2_001.fastq.gz fastq fastq 1341470236.0 8888024.0 GSM3070132 r3 0:75.45 1:75.48 A:395746232;C:196893713;G:196590339;T:552105050;N:134902 75 75     395746232 196893713 196590339 552105050 134902 SRX3856794 SRS3100386 SRA675960 GEO Hubrecht Institute 2 0.38231 0.81774 0.3205 0.39891 0.97279 0.92817 0.47656 0.53862 75 74 T B mate1 technical by mapping diff illumina nextseq unknown random_priming trueseq sc single_cell_plate celseq   Netherlands 2018-03-28 Undetermined Undetermined Blood Hematopoietic System
47928 47928 SRR6908688 SRX3856794 SRS3100386 SRP136633 PRJNA446034 Cell type purification by single cell transcriptome trained sorting GSE112438 Other Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID a computational method that combines single cell transcriptomics for unbiased cell type identification with FACS index sorting to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.   pubmed:31585086   WKM3 eosinophils GSM3070132   tissue:WKM3 eosinophils|FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:eosinophils WKM3 eosinophils In transcriptome libraries first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9 ensemble 74 extended with ERCC92 Supplementary files format and content: Tabular separated files with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz 1st column represents index of the cell specific barcode and the second column is the barcode WKM3 eosinophils   post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters   FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:eosinophils GSM3070132 GSM3070132: WKM3 eosinophils; Danio rerio; RNA Seq GSM3070132   1 post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters GEO Accession:GSM3070132 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP136633     WKM3_eosinophils_L004_R1_001.fastq.gz WKM3_eosinophils_L004_R2_001.fastq.gz fastq fastq 1280409546.0 8484656.0 GSM3070132 r4 0:75.44 1:75.47 A:378449241;C:186686350;G:189951619;T:525218711;N:103625 75 75     378449241 186686350 189951619 525218711 103625 SRX3856794 SRS3100386 SRA675960 GEO Hubrecht Institute 2 0.36531 0.80793 0.30661 0.38147 0.97492 0.94401 0.47223 0.55437 76 76 T B mate1 technical by mapping diff illumina nextseq unknown random_priming trueseq sc single_cell_plate celseq   Netherlands 2018-03-28 Undetermined Undetermined Blood Hematopoietic System
47929 47929 SRR6908681 SRX3856793 SRS3100385 SRP136633 PRJNA446034 Cell type purification by single cell transcriptome trained sorting GSE112438 Other Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID a computational method that combines single cell transcriptomics for unbiased cell type identification with FACS index sorting to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.   pubmed:31585086   WKM3 classicalgate eosinophils GSM3070131   tissue:WKM3 classicalgate eosinophils|FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils WKM3 classicalgate eosinophils In transcriptome libraries first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9 ensemble 74 extended with ERCC92 Supplementary files format and content: Tabular separated files with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz 1st column represents index of the cell specific barcode and the second column is the barcode WKM3 classicalgate eosinophils   post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters   FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils GSM3070131 GSM3070131: WKM3 classicalgate eosinophils; Danio rerio; RNA Seq GSM3070131   1 post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters GEO Accession:GSM3070131 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP136633     WKM3_classicalgate-eosinophils_L001_R1_001.fastq.gz WKM3_classicalgate-eosinophils_L001_R2_001.fastq.gz fastq fastq 1462702668.0 9694435.0 GSM3070131 r1 0:75.42 1:75.46 A:445709472;C:205316750;G:205641600;T:605784979;N:249867 75 75     445709472 205316750 205641600 605784979 249867 SRX3856793 SRS3100385 SRA675960 GEO Hubrecht Institute 2 0.39724 0.82292 0.32577 0.36062 0.9713 0.9301 0.46129 0.54716 75 75 T B mate1 technical by mapping diff illumina nextseq unknown random_priming trueseq sc single_cell_plate celseq   Netherlands 2018-03-28 Undetermined Undetermined Blood Hematopoietic System
47930 47930 SRR6908682 SRX3856793 SRS3100385 SRP136633 PRJNA446034 Cell type purification by single cell transcriptome trained sorting GSE112438 Other Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID a computational method that combines single cell transcriptomics for unbiased cell type identification with FACS index sorting to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.   pubmed:31585086   WKM3 classicalgate eosinophils GSM3070131   tissue:WKM3 classicalgate eosinophils|FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils WKM3 classicalgate eosinophils In transcriptome libraries first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9 ensemble 74 extended with ERCC92 Supplementary files format and content: Tabular separated files with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz 1st column represents index of the cell specific barcode and the second column is the barcode WKM3 classicalgate eosinophils   post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters   FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils GSM3070131 GSM3070131: WKM3 classicalgate eosinophils; Danio rerio; RNA Seq GSM3070131   1 post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters GEO Accession:GSM3070131 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP136633     WKM3_classicalgate-eosinophils_L002_R2_001.fastq.gz WKM3_classicalgate-eosinophils_L002_R1_001.fastq.gz fastq fastq 1331127146.0 8822708.0 GSM3070131 r2 0:75.42 1:75.45 A:403738285;C:185977311;G:190160316;T:551055048;N:196186 75 75     403738285 185977311 190160316 551055048 196186 SRX3856793 SRS3100385 SRA675960 GEO Hubrecht Institute 2 0.39004 0.81794 0.32291 0.35472 0.97228 0.93626 0.48683 0.54607 76 75 T B mate1 technical by mapping diff illumina nextseq unknown random_priming trueseq sc single_cell_plate celseq   Netherlands 2018-03-28 Undetermined Undetermined Blood Hematopoietic System
47931 47931 SRR6908683 SRX3856793 SRS3100385 SRP136633 PRJNA446034 Cell type purification by single cell transcriptome trained sorting GSE112438 Other Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID a computational method that combines single cell transcriptomics for unbiased cell type identification with FACS index sorting to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.   pubmed:31585086   WKM3 classicalgate eosinophils GSM3070131   tissue:WKM3 classicalgate eosinophils|FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils WKM3 classicalgate eosinophils In transcriptome libraries first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9 ensemble 74 extended with ERCC92 Supplementary files format and content: Tabular separated files with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz 1st column represents index of the cell specific barcode and the second column is the barcode WKM3 classicalgate eosinophils   post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters   FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils GSM3070131 GSM3070131: WKM3 classicalgate eosinophils; Danio rerio; RNA Seq GSM3070131   1 post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters GEO Accession:GSM3070131 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP136633     WKM3_classicalgate-eosinophils_L003_R2_001.fastq.gz WKM3_classicalgate-eosinophils_L003_R1_001.fastq.gz fastq fastq 1530092022.0 10140266.0 GSM3070131 r3 0:75.43 1:75.46 A:460384140;C:214158501;G:217473146;T:637914633;N:161602 75 75     460384140 214158501 217473146 637914633 161602 SRX3856793 SRS3100385 SRA675960 GEO Hubrecht Institute 2 0.39487 0.82643 0.32278 0.35403 0.97555 0.92989 0.49836 0.55498 75 75 T B mate1 technical by mapping diff illumina nextseq unknown random_priming trueseq sc single_cell_plate celseq   Netherlands 2018-03-28 Undetermined Undetermined Blood Hematopoietic System
47932 47932 SRR6908684 SRX3856793 SRS3100385 SRP136633 PRJNA446034 Cell type purification by single cell transcriptome trained sorting GSE112438 Other Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID a computational method that combines single cell transcriptomics for unbiased cell type identification with FACS index sorting to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.   pubmed:31585086   WKM3 classicalgate eosinophils GSM3070131   tissue:WKM3 classicalgate eosinophils|FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils WKM3 classicalgate eosinophils In transcriptome libraries first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9 ensemble 74 extended with ERCC92 Supplementary files format and content: Tabular separated files with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz 1st column represents index of the cell specific barcode and the second column is the barcode WKM3 classicalgate eosinophils   post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters   FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils GSM3070131 GSM3070131: WKM3 classicalgate eosinophils; Danio rerio; RNA Seq GSM3070131   1 post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters GEO Accession:GSM3070131 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP136633     WKM3_classicalgate-eosinophils_L004_R1_001.fastq.gz WKM3_classicalgate-eosinophils_L004_R2_001.fastq.gz fastq fastq 1434145773.0 9505626.0 GSM3070131 r4 0:75.43 1:75.45 A:431807112;C:200115802;G:205473991;T:596630601;N:118267 75 75     431807112 200115802 205473991 596630601 118267 SRX3856793 SRS3100385 SRA675960 GEO Hubrecht Institute 2 0.38268 0.82073 0.31346 0.34043 0.97678 0.94172 0.45791 0.5661 75 75 T B mate1 technical by mapping diff illumina nextseq unknown random_priming trueseq sc single_cell_plate celseq   Netherlands 2018-03-28 Undetermined Undetermined Blood Hematopoietic System
47937 47937 SRR6908673 SRX3856790 SRS3100384 SRP136633 PRJNA446034 Cell type purification by single cell transcriptome trained sorting GSE112438 Other Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID a computational method that combines single cell transcriptomics for unbiased cell type identification with FACS index sorting to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.   pubmed:31585086   WKM2 eosinophils GSM3070129   tissue:WKM2 eosinophils|FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:eosinophils WKM2 eosinophils In transcriptome libraries first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9 ensemble 74 extended with ERCC92 Supplementary files format and content: Tabular separated files with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz 1st column represents index of the cell specific barcode and the second column is the barcode WKM2 eosinophils   post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters   FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:eosinophils GSM3070129 GSM3070129: WKM2 eosinophils; Danio rerio; RNA Seq GSM3070129   1 post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters GEO Accession:GSM3070129 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP136633     WKM2_eosinophils_L001_R1_001.fastq.gz WKM2_eosinophils_L001_R2_001.fastq.gz fastq fastq 1444176720.0 9566997.0 GSM3070129 r1 0:75.46 1:75.50 A:432764637;C:224282941;G:222436448;T:564444426;N:248268 75 75     432764637 224282941 222436448 564444426 248268 SRX3856790 SRS3100384 SRA675960 GEO Hubrecht Institute 2 0.37168 0.75194 0.32262 0.52753 0.95915 0.94073 0.51621 0.55453 76 76 T B mate1 technical by mapping diff illumina nextseq unknown random_priming trueseq sc single_cell_plate celseq   Netherlands 2018-03-28 Undetermined Undetermined Blood Hematopoietic System
47938 47938 SRR6908674 SRX3856790 SRS3100384 SRP136633 PRJNA446034 Cell type purification by single cell transcriptome trained sorting GSE112438 Other Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID a computational method that combines single cell transcriptomics for unbiased cell type identification with FACS index sorting to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.   pubmed:31585086   WKM2 eosinophils GSM3070129   tissue:WKM2 eosinophils|FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:eosinophils WKM2 eosinophils In transcriptome libraries first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9 ensemble 74 extended with ERCC92 Supplementary files format and content: Tabular separated files with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz 1st column represents index of the cell specific barcode and the second column is the barcode WKM2 eosinophils   post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters   FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:eosinophils GSM3070129 GSM3070129: WKM2 eosinophils; Danio rerio; RNA Seq GSM3070129   1 post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters GEO Accession:GSM3070129 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP136633     WKM2_eosinophils_L002_R1_001.fastq.gz WKM2_eosinophils_L002_R2_001.fastq.gz fastq fastq 1320784826.0 8749678.0 GSM3070129 r2 0:75.45 1:75.50 A:392835077;C:204358703;G:208201633;T:515202839;N:186574 75 75     392835077 204358703 208201633 515202839 186574 SRX3856790 SRS3100384 SRA675960 GEO Hubrecht Institute 2 0.36921 0.73955 0.32271 0.52168 0.96047 0.94643 0.49733 0.53116 76 76 T B mate1 technical by mapping diff illumina nextseq unknown random_priming trueseq sc single_cell_plate celseq   Netherlands 2018-03-28 Undetermined Undetermined Blood Hematopoietic System
47939 47939 SRR6908675 SRX3856790 SRS3100384 SRP136633 PRJNA446034 Cell type purification by single cell transcriptome trained sorting GSE112438 Other Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID a computational method that combines single cell transcriptomics for unbiased cell type identification with FACS index sorting to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.   pubmed:31585086   WKM2 eosinophils GSM3070129   tissue:WKM2 eosinophils|FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:eosinophils WKM2 eosinophils In transcriptome libraries first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9 ensemble 74 extended with ERCC92 Supplementary files format and content: Tabular separated files with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz 1st column represents index of the cell specific barcode and the second column is the barcode WKM2 eosinophils   post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters   FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:eosinophils GSM3070129 GSM3070129: WKM2 eosinophils; Danio rerio; RNA Seq GSM3070129   1 post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters GEO Accession:GSM3070129 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP136633     WKM2_eosinophils_L003_R2_001.fastq.gz WKM2_eosinophils_L003_R1_001.fastq.gz fastq fastq 1500143635.0 9937133.0 GSM3070129 r3 0:75.46 1:75.50 A:445152171;C:231621688;G:233127317;T:590090278;N:152181 75 75     445152171 231621688 233127317 590090278 152181 SRX3856790 SRS3100384 SRA675960 GEO Hubrecht Institute 2 0.36533 0.75138 0.31769 0.52682 0.96731 0.94209 0.50569 0.54346 76 75 T B mate1 technical by mapping diff illumina nextseq unknown random_priming trueseq sc single_cell_plate celseq   Netherlands 2018-03-28 Undetermined Undetermined Blood Hematopoietic System
47940 47940 SRR6908676 SRX3856790 SRS3100384 SRP136633 PRJNA446034 Cell type purification by single cell transcriptome trained sorting GSE112438 Other Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID a computational method that combines single cell transcriptomics for unbiased cell type identification with FACS index sorting to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.   pubmed:31585086   WKM2 eosinophils GSM3070129   tissue:WKM2 eosinophils|FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:eosinophils WKM2 eosinophils In transcriptome libraries first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9 ensemble 74 extended with ERCC92 Supplementary files format and content: Tabular separated files with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz 1st column represents index of the cell specific barcode and the second column is the barcode WKM2 eosinophils   post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters   FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:eosinophils GSM3070129 GSM3070129: WKM2 eosinophils; Danio rerio; RNA Seq GSM3070129   1 post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters GEO Accession:GSM3070129 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP136633     WKM2_eosinophils_L004_R1_001.fastq.gz WKM2_eosinophils_L004_R2_001.fastq.gz fastq fastq 1428668507.0 9464755.0 GSM3070129 r4 0:75.46 1:75.49 A:423108347;C:219338398;G:226517917;T:559587502;N:116343 75 75     423108347 219338398 226517917 559587502 116343 SRX3856790 SRS3100384 SRA675960 GEO Hubrecht Institute 2 0.35962 0.7405 0.31464 0.51805 0.96962 0.95747 0.48862 0.53364 76 76 T B mate1 technical by mapping diff illumina nextseq unknown random_priming trueseq sc single_cell_plate celseq   Netherlands 2018-03-28 Undetermined Undetermined Blood Hematopoietic System
47941 47941 SRR6908669 SRX3856789 SRS3100381 SRP136633 PRJNA446034 Cell type purification by single cell transcriptome trained sorting GSE112438 Other Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID a computational method that combines single cell transcriptomics for unbiased cell type identification with FACS index sorting to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.   pubmed:31585086   WKM2 classicalgate eosinophils GSM3070128   tissue:WKM2 classicalgate eosinophils|FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils WKM2 classicalgate eosinophils In transcriptome libraries first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9 ensemble 74 extended with ERCC92 Supplementary files format and content: Tabular separated files with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz 1st column represents index of the cell specific barcode and the second column is the barcode WKM2 classicalgate eosinophils   post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters   FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils GSM3070128 GSM3070128: WKM2 classicalgate eosinophils; Danio rerio; RNA Seq GSM3070128   1 post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters GEO Accession:GSM3070128 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP136633     WKM2_classicalgate-eosinophils_L001_R2_001.fastq.gz WKM2_classicalgate-eosinophils_L001_R1_001.fastq.gz fastq fastq 880478792.0 5834816.0 GSM3070128 r1 0:75.43 1:75.47 A:267072322;C:127440559;G:126304290;T:359512123;N:149498 75 75     267072322 127440559 126304290 359512123 149498 SRX3856789 SRS3100381 SRA675960 GEO Hubrecht Institute 2 0.3788 0.812 0.28918 0.38972 0.96595 0.92904 0.5376 0.55651 75 75 T B mate1 technical by mapping diff illumina nextseq unknown random_priming trueseq sc single_cell_plate celseq   Netherlands 2018-03-28 Undetermined Undetermined Blood Hematopoietic System
47942 47942 SRR6908670 SRX3856789 SRS3100381 SRP136633 PRJNA446034 Cell type purification by single cell transcriptome trained sorting GSE112438 Other Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID a computational method that combines single cell transcriptomics for unbiased cell type identification with FACS index sorting to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.   pubmed:31585086   WKM2 classicalgate eosinophils GSM3070128   tissue:WKM2 classicalgate eosinophils|FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils WKM2 classicalgate eosinophils In transcriptome libraries first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9 ensemble 74 extended with ERCC92 Supplementary files format and content: Tabular separated files with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz 1st column represents index of the cell specific barcode and the second column is the barcode WKM2 classicalgate eosinophils   post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters   FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils GSM3070128 GSM3070128: WKM2 classicalgate eosinophils; Danio rerio; RNA Seq GSM3070128   1 post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters GEO Accession:GSM3070128 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP136633     WKM2_classicalgate-eosinophils_L002_R1_001.fastq.gz WKM2_classicalgate-eosinophils_L002_R2_001.fastq.gz fastq fastq 806110283.0 5342262.0 GSM3070128 r2 0:75.42 1:75.47 A:243426891;C:116100169;G:117840212;T:328625621;N:117390 75 75     243426891 116100169 117840212 328625621 117390 SRX3856789 SRS3100381 SRA675960 GEO Hubrecht Institute 2 0.38141 0.80952 0.29221 0.37995 0.96546 0.93381 0.54149 0.55378 75 76 T B mate1 technical by mapping diff illumina nextseq unknown random_priming trueseq sc single_cell_plate celseq   Netherlands 2018-03-28 Undetermined Undetermined Blood Hematopoietic System
47943 47943 SRR6908671 SRX3856789 SRS3100381 SRP136633 PRJNA446034 Cell type purification by single cell transcriptome trained sorting GSE112438 Other Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID a computational method that combines single cell transcriptomics for unbiased cell type identification with FACS index sorting to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.   pubmed:31585086   WKM2 classicalgate eosinophils GSM3070128   tissue:WKM2 classicalgate eosinophils|FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils WKM2 classicalgate eosinophils In transcriptome libraries first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9 ensemble 74 extended with ERCC92 Supplementary files format and content: Tabular separated files with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz 1st column represents index of the cell specific barcode and the second column is the barcode WKM2 classicalgate eosinophils   post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters   FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils GSM3070128 GSM3070128: WKM2 classicalgate eosinophils; Danio rerio; RNA Seq GSM3070128   1 post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters GEO Accession:GSM3070128 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP136633     WKM2_classicalgate-eosinophils_L003_R1_001.fastq.gz WKM2_classicalgate-eosinophils_L003_R2_001.fastq.gz fastq fastq 924045470.0 6123105.0 GSM3070128 r3 0:75.44 1:75.47 A:276824263;C:133108077;G:134012420;T:380008370;N:92340 75 75     276824263 133108077 134012420 380008370 92340 SRX3856789 SRS3100381 SRA675960 GEO Hubrecht Institute 2 0.3819 0.81801 0.29161 0.38224 0.97124 0.92809 0.53982 0.54629 76 76 T B mate1 technical by mapping diff illumina nextseq unknown random_priming trueseq sc single_cell_plate celseq   Netherlands 2018-03-28 Undetermined Undetermined Blood Hematopoietic System
47944 47944 SRR6908672 SRX3856789 SRS3100381 SRP136633 PRJNA446034 Cell type purification by single cell transcriptome trained sorting GSE112438 Other Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID a computational method that combines single cell transcriptomics for unbiased cell type identification with FACS index sorting to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.   pubmed:31585086   WKM2 classicalgate eosinophils GSM3070128   tissue:WKM2 classicalgate eosinophils|FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils WKM2 classicalgate eosinophils In transcriptome libraries first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9 ensemble 74 extended with ERCC92 Supplementary files format and content: Tabular separated files with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz 1st column represents index of the cell specific barcode and the second column is the barcode WKM2 classicalgate eosinophils   post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters   FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils GSM3070128 GSM3070128: WKM2 classicalgate eosinophils; Danio rerio; RNA Seq GSM3070128   1 post organ isolation live single cells are sorted into 384 well plates containing mineral oil uniquely barcoded cell specific primers for mRNA detection Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters GEO Accession:GSM3070128 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP136633     WKM2_classicalgate-eosinophils_L004_R1_001.fastq.gz WKM2_classicalgate-eosinophils_L004_R2_001.fastq.gz fastq fastq 867397884.0 5748519.0 GSM3070128 r4 0:75.43 1:75.46 A:260294749;C:124376674;G:127341359;T:355314902;N:70200 75 75     260294749 124376674 127341359 355314902 70200 SRX3856789 SRS3100381 SRA675960 GEO Hubrecht Institute 2 0.37148 0.80708 0.28632 0.3846 0.97299 0.94474 0.5375 0.54419 76 76 T B mate1 technical by mapping diff illumina nextseq unknown random_priming trueseq sc single_cell_plate celseq   Netherlands 2018-03-28 Undetermined Undetermined Blood Hematopoietic System
52175 52175 SRR10902872 SRX7571042 SRS6006643 SRP194254 PRJNA540466 Characterization of the zebrafish cell landscape at single cell resolution GSE130487 Transcriptome Analysis Zebrafish have been found to be a premier model organism in biological and regeneration research. However the comprehensive cell compositions and molecular dynamics during tissue regeneration in zebrafish remain poorly understood. Here we utilized Microwell seq to analyze more than 250 000 single cells covering major zebrafish cell types and constructed a systematic zebrafish cell landscape. We revealed single cell compositions for 18 zebrafish tissue types covering both embryo and adult stages. Single cell mapping of caudal fin regeneration revealed a unique characteristic of blastema population and key genetic regulation involved in zebrafish tissue repair. Overall our single cell datasets demonstrate the utility of zebrafish cell landscape resources in various fields of biological research. Overall design: Expression profiling by high throughput sequencing of major zebrafish organ types. Please note that 19 samples were added and 9 samples were deleted on Mar 1 2022.   pubmed:34660600   Blood 2 GSM4274618   source name:blood|strain:Tubingen|tissue:blood|genotype:wild type Blood 2 Base calls were performed with Illumina bcl2fastq Sequenced reads were trimmed for adaptor sequence.Then reads in bam files were tagged with the cell and molecular UMI barcode sequences using Drop seq tools 1.12.The cell barcodes are tagged as XC in the bam file and the UMI is tagged as XM in the bam file. The reads quality under 10 were removed. ScRNA seq reads were aligned to the Danio rerio GRCz10 genome assembly using STAR version 2.5.2a with default configurations. Next merge the STAR alignment tagged bam SAM to recover cell /molecular barcodes and the reads are annotated with exon tags. Last we demultiplexed all cell barcodes taken into consideration for the analysis from the exon tagged bam files to get a digital expression matrix based on UMI counts. Genome build: Danio rerio GRCz10 Supplementary files format and content: tab delimited text files of digital expression matrix dge based on raw UMI counts columns are cells and rows are genes. blood   Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol   strain:Tubingen|tissue:blood|genotype:wild type GSM4274618 GSM4274618: Blood 2; Danio rerio; RNA Seq GSM4274618   1 Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol GEO Accession:GSM4274618 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA HiSeq X Ten   SRP194254   assembly:GRCz10|intentional duplicate Blood2.bam bam 31418773850.0 104035675.0 GSM4274618 r1 0:151 1:151 A:8027580943;C:5644210831;G:5587896051;T:12151089233;N:7996792 151 151     8027580943 5644210831 5587896051 12151089233 7996792 SRX7571042 SRS6006643 SRA880843 GEO Zhejiang University 2 8e-05 0.56276 0.0 0.04786 0.99991 0.88363 0.75 0.53078 151 151 T B mate1 technical by mapping diff illumina hiseq_era unknown cdna_unspecified unknown sc single_cell_plate microwellseq   China 2020-01-16 Undetermined Multi-stage Blood Hematopoietic System
52176 52176 SRR10902871 SRX7571041 SRS6006642 SRP194254 PRJNA540466 Characterization of the zebrafish cell landscape at single cell resolution GSE130487 Transcriptome Analysis Zebrafish have been found to be a premier model organism in biological and regeneration research. However the comprehensive cell compositions and molecular dynamics during tissue regeneration in zebrafish remain poorly understood. Here we utilized Microwell seq to analyze more than 250 000 single cells covering major zebrafish cell types and constructed a systematic zebrafish cell landscape. We revealed single cell compositions for 18 zebrafish tissue types covering both embryo and adult stages. Single cell mapping of caudal fin regeneration revealed a unique characteristic of blastema population and key genetic regulation involved in zebrafish tissue repair. Overall our single cell datasets demonstrate the utility of zebrafish cell landscape resources in various fields of biological research. Overall design: Expression profiling by high throughput sequencing of major zebrafish organ types. Please note that 19 samples were added and 9 samples were deleted on Mar 1 2022.   pubmed:34660600   Blood 1 GSM4274617   source name:blood|strain:Tubingen|tissue:blood|genotype:wild type Blood 1 Base calls were performed with Illumina bcl2fastq Sequenced reads were trimmed for adaptor sequence.Then reads in bam files were tagged with the cell and molecular UMI barcode sequences using Drop seq tools 1.12.The cell barcodes are tagged as XC in the bam file and the UMI is tagged as XM in the bam file. The reads quality under 10 were removed. ScRNA seq reads were aligned to the Danio rerio GRCz10 genome assembly using STAR version 2.5.2a with default configurations. Next merge the STAR alignment tagged bam SAM to recover cell /molecular barcodes and the reads are annotated with exon tags. Last we demultiplexed all cell barcodes taken into consideration for the analysis from the exon tagged bam files to get a digital expression matrix based on UMI counts. Genome build: Danio rerio GRCz10 Supplementary files format and content: tab delimited text files of digital expression matrix dge based on raw UMI counts columns are cells and rows are genes. blood   Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol   strain:Tubingen|tissue:blood|genotype:wild type GSM4274617 GSM4274617: Blood 1; Danio rerio; RNA Seq GSM4274617   1 Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol GEO Accession:GSM4274617 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA HiSeq X Ten   SRP194254   assembly:GRCz10|intentional duplicate Blood1.bam bam 14970178354.0 49570127.0 GSM4274617 r1 0:151 1:151 A:3767585238;C:2725333545;G:2707312228;T:5766389198;N:3558145 151 151     3767585238 2725333545 2707312228 5766389198 3558145 SRX7571041 SRS6006642 SRA880843 GEO Zhejiang University 2 0.0 0.58542 0.0 0.0298 1.0 0.89033   0.53826 151 151 T B mate1 technical by mapping diff illumina hiseq_era unknown cdna_unspecified unknown sc single_cell_plate microwellseq   China 2020-01-16 Undetermined Multi-stage Blood Hematopoietic System
52200 52200 SRR8991406 SRX5770474 SRS4704583 SRP194254 PRJNA540466 Characterization of the zebrafish cell landscape at single cell resolution GSE130487 Transcriptome Analysis Zebrafish have been found to be a premier model organism in biological and regeneration research. However the comprehensive cell compositions and molecular dynamics during tissue regeneration in zebrafish remain poorly understood. Here we utilized Microwell seq to analyze more than 250 000 single cells covering major zebrafish cell types and constructed a systematic zebrafish cell landscape. We revealed single cell compositions for 18 zebrafish tissue types covering both embryo and adult stages. Single cell mapping of caudal fin regeneration revealed a unique characteristic of blastema population and key genetic regulation involved in zebrafish tissue repair. Overall our single cell datasets demonstrate the utility of zebrafish cell landscape resources in various fields of biological research. Overall design: Expression profiling by high throughput sequencing of major zebrafish organ types. Please note that 19 samples were added and 9 samples were deleted on Mar 1 2022.   pubmed:34660600   Spleen3 GSM3740959   source name:spleen|strain:Tubingen|genotype:wild type|tissue:spleen Spleen3 The drop seq core computational tool was used for preprocessing of the Microwell seq data. The implementation is described in the Drop seq computational cookbook http://mccarrolllab.org/dropseq/. Base calls were performed with Illumina bcl2fastq Sequenced reads were trimmed for adaptor sequence.Then reads in bam files were tagged with the cell and molecular UMI barcode sequences using Drop seq tools 1.12.The cell barcodes are tagged as XC in the bam file and the UMI is tagged as XM in the bam file. The reads quality under 10 were removed. ScRNA seq reads were aligned to the Danio rerio GRCz10 genome assembly using STAR version 2.5.2a with default configurations. Next merge the STAR alignment tagged bam SAM to recover cell /molecular barcodes and the reads are annotated with exon tags. Last we demultiplexed all cell barcodes taken into consideration for the analysis from the exon tagged bam files to get a digital expression matrix based on UMI counts. Genome build: http://dec2017.archive.ensembl.org/Danio rerio/Info/Index Supplementary files format and content: tab delimited text files of digital expression matrix dge based on raw UMI counts columns are cells and rows are genes. spleen   Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol   strain:Tubingen|genotype:wild type|tissue:spleen GSM3740959 GSM3740959: Spleen3; Danio rerio; RNA Seq GSM3740959   1 Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol GEO Accession:GSM3740959 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq X Ten   SRP194254   assembly:Danio rerio GRCz10 Spleen3.bam bam 29617062386.0 98069743.0 GSM3740959 r1 0:151 1:151 A:7464139749;C:4972084318;G:5132144813;T:11970808438;N:77885068 151 151     7464139749 4972084318 5132144813 11970808438 77885068 SRX5770474 SRS4704583 SRA880843 GEO Zhejiang University 2 0.0 0.7261 0.0 0.03774 1.0 0.86275   0.5339 151 151 T B mate1 technical by mapping diff illumina hiseq_era unknown cdna_unspecified unknown sc single_cell_plate microwellseq   China 2019-04-30 Undetermined Multi-stage Spleen Hematopoietic System
59515 59515 SRR11926689 SRX8472335 SRS6772936 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   WT5 GSM4591370   tissue:Healthy sorted thymus|cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab WT5 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts Healthy sorted thymus   Truseq stranded mRNA library prep illumina #20020594   cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab GSM4591370 GSM4591370: WT5; Danio rerio; RNA Seq GSM4591370   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591370 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 3000   SRP265974     FWTsample_5.fastq.gz FWTsample_5_R2.fastq.gz fastq fastq 4633582858.0 22938529.0 GSM4591370 r1 0:101 1:101 A:1263929939;C:1047240206;G:1052800791;T:1263574247;N:6037675 101 101     1263929939 1047240206 1052800791 1263574247 6037675 SRX8472335 SRS6772936 SRA1083220 GEO Center for Medical Genetics, Ghent University 2 0.91347 0.91728 0.27187 0.27409 0.76585 0.76859 0.45662 0.48071 101 101 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Thymus Hematopoietic System
59516 59516 SRR11926688 SRX8472334 SRS6772935 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   WT4 GSM4591369   tissue:Healthy sorted thymus|cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab WT4 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts Healthy sorted thymus   Truseq stranded mRNA library prep illumina #20020594   cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab GSM4591369 GSM4591369: WT4; Danio rerio; RNA Seq GSM4591369   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591369 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 3000   SRP265974     FWTsample_4.fastq.gz FWTsample_4_R2.fastq.gz fastq fastq 4113149600.0 20565748.0 GSM4591369 r1 0:100 1:100 A:1084628064;C:963840734;G:985823964;T:1078691018;N:165820 100 100     1084628064 963840734 985823964 1078691018 165820 SRX8472334 SRS6772935 SRA1083220 GEO Center for Medical Genetics, Ghent University 2 0.9336 0.93539 0.11919 0.11989 0.76368 0.76757 0.4904 0.47498 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Thymus Hematopoietic System
59517 59517 SRR11926687 SRX8472333 SRS6772934 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   WT3 GSM4591368   tissue:Healthy sorted thymus|cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab WT3 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts Healthy sorted thymus   Truseq stranded mRNA library prep illumina #20020594   cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab GSM4591368 GSM4591368: WT3; Danio rerio; RNA Seq GSM4591368   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591368 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 3000   SRP265974     FWTsample_3_R2.fastq.gz FWTsample_3.fastq.gz fastq fastq 3966667200.0 19833336.0 GSM4591368 r1 0:100 1:100 A:1125938234;C:857622800;G:856236104;T:1122434590;N:4435472 100 100     1125938234 857622800 856236104 1122434590 4435472 SRX8472333 SRS6772934 SRA1083220 GEO Center for Medical Genetics, Ghent University 2 0.93918 0.92495 0.16292 0.15907 0.75866 0.76883 0.51794 0.51278 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Thymus Hematopoietic System
59518 59518 SRR11926686 SRX8472332 SRS6772933 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   WT2 GSM4591367   tissue:Healthy sorted thymus|cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab WT2 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts Healthy sorted thymus   Truseq stranded mRNA library prep illumina #20020594   cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab GSM4591367 GSM4591367: WT2; Danio rerio; RNA Seq GSM4591367   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591367 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 3000   SRP265974     FWTsample_2_R2.fastq.gz FWTsample_2.fastq.gz fastq fastq 3598961400.0 17994807.0 GSM4591367 r1 0:100 1:100 A:982353707;C:818188790;G:810911943;T:983465623;N:4041337 100 100     982353707 818188790 810911943 983465623 4041337 SRX8472332 SRS6772933 SRA1083220 GEO Center for Medical Genetics, Ghent University 2 0.93426 0.9195 0.12591 0.12501 0.76763 0.77621 0.49491 0.50063 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Thymus Hematopoietic System
59519 59519 SRR11926685 SRX8472331 SRS6772932 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   WT1 GSM4591366   tissue:Healthy sorted thymus|cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab WT1 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts Healthy sorted thymus   Truseq stranded mRNA library prep illumina #20020594   cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab GSM4591366 GSM4591366: WT1; Danio rerio; RNA Seq GSM4591366   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591366 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 3000   SRP265974     FWTsample_1_R2.fastq.gz FWTsample_1.fastq.gz fastq fastq 3686706000.0 18433530.0 GSM4591366 r1 0:100 1:100 A:1004954280;C:838347690;G:833756041;T:1005493425;N:4154564 100 100     1004954280 838347690 833756041 1005493425 4154564 SRX8472331 SRS6772932 SRA1083220 GEO Center for Medical Genetics, Ghent University 2 0.93171 0.91783 0.13677 0.13606 0.76723 0.7752 0.51062 0.50949 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Thymus Hematopoietic System
59520 59520 SRR11926684 SRX8472330 SRS6772931 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   SPL002 GSM4591365   tissue:shrek preleukemic thymocytes|cell type:thymocytes|genotype:shrek;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab SPL002 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts shrek preleukemic thymocytes   Truseq stranded mRNA library prep illumina #20020594   cell type:thymocytes|genotype:shrek;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab GSM4591365 GSM4591365: SPL002; Danio rerio; RNA Seq GSM4591365   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591365 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 3000   SRP265974     Fsample_48.fastq.gz Fsample_48_R2.fastq.gz fastq fastq 23525993582.0 77900641.0 GSM4591365 r1 0:151 1:151 A:6365057472;C:5454588670;G:5620997543;T:6082859005;N:2490892 151 151     6365057472 5454588670 5620997543 6082859005 2490892 SRX8472330 SRS6772931 SRA1083220 GEO Center for Medical Genetics, Ghent University 2 0.96011 0.96113 0.23076 0.22681 0.80858 0.81221 0.52577 0.51928 151 151 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Thymus Hematopoietic System
59521 59521 SRR11926683 SRX8472329 SRS6772930 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   SPL001 GSM4591364   tissue:shrek preleukemic thymocytes|cell type:thymocytes|genotype:shrek;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab SPL001 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts shrek preleukemic thymocytes   Truseq stranded mRNA library prep illumina #20020594   cell type:thymocytes|genotype:shrek;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab GSM4591364 GSM4591364: SPL001; Danio rerio; RNA Seq GSM4591364   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591364 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 3000   SRP265974     Fsample_47.fastq.gz Fsample_47_R2.fastq.gz fastq fastq 26795594770.0 88727135.0 GSM4591364 r1 0:151 1:151 A:7305822132;C:6082789601;G:6442162847;T:6961938191;N:2881999 151 151     7305822132 6082789601 6442162847 6961938191 2881999 SRX8472329 SRS6772930 SRA1083220 GEO Center for Medical Genetics, Ghent University 2 0.96139 0.96343 0.22215 0.2185 0.81296 0.81647 0.50868 0.51446 151 151 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Thymus Hematopoietic System
59532 59532 SRR11926672 SRX8472318 SRS6772919 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   OPL4 GSM4591353   tissue:otg preleukemic thymocytes|cell type:thymocytes|genotype:otg;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab OPL4 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts otg preleukemic thymocytes   Truseq stranded mRNA library prep illumina #20020594   cell type:thymocytes|genotype:otg;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab GSM4591353 GSM4591353: OPL4; Danio rerio; RNA Seq GSM4591353   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591353 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 3000   SRP265974     Fsample_36.fastq.gz Fsample_36_R2.fastq.gz fastq fastq 4686865610.0 23202305.0 GSM4591353 r1 0:101 1:101 A:1290395271;C:1046629683;G:1049444449;T:1294288823;N:6107384 101 101     1290395271 1046629683 1049444449 1294288823 6107384 SRX8472318 SRS6772919 SRA1083220 GEO Center for Medical Genetics, Ghent University 2 0.92236 0.92454 0.31359 0.31617 0.76625 0.76779 0.48273 0.47205 101 101 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Thymus Hematopoietic System
59533 59533 SRR11926671 SRX8472317 SRS6772918 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   OPL3 GSM4591352   tissue:otg preleukemic thymocytes|cell type:thymocytes|genotype:otg;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab OPL3 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts otg preleukemic thymocytes   Truseq stranded mRNA library prep illumina #20020594   cell type:thymocytes|genotype:otg;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab GSM4591352 GSM4591352: OPL3; Danio rerio; RNA Seq GSM4591352   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591352 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 3000   SRP265974     Fsample_35_R2.fastq.gz Fsample_35.fastq.gz fastq fastq 6253893538.0 30959869.0 GSM4591352 r1 0:101 1:101 A:1720308233;C:1397371474;G:1404797248;T:1723210472;N:8206111 101 101     1720308233 1397371474 1404797248 1723210472 8206111 SRX8472317 SRS6772918 SRA1083220 GEO Center for Medical Genetics, Ghent University 2 0.93192 0.93318 0.35833 0.3632 0.78518 0.78788 0.48278 0.48009 101 101 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Thymus Hematopoietic System
59534 59534 SRR11926670 SRX8472316 SRS6772917 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   OPL2 GSM4591351   tissue:otg preleukemic thymocytes|cell type:thymocytes|genotype:otg;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab OPL2 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts otg preleukemic thymocytes   Truseq stranded mRNA library prep illumina #20020594   cell type:thymocytes|genotype:otg;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab GSM4591351 GSM4591351: OPL2; Danio rerio; RNA Seq GSM4591351   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591351 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 3000   SRP265974     Fsample_34_R2.fastq.gz Fsample_34.fastq.gz fastq fastq 5351903948.0 26494574.0 GSM4591351 r1 0:101 1:101 A:1442793834;C:1227325750;G:1233975738;T:1440891564;N:6917062 101 101     1442793834 1227325750 1233975738 1440891564 6917062 SRX8472316 SRS6772917 SRA1083220 GEO Center for Medical Genetics, Ghent University 2 0.92964 0.93101 0.21706 0.2185 0.76497 0.76848 0.47634 0.48247 101 101 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Thymus Hematopoietic System
59535 59535 SRR11926669 SRX8472315 SRS6772916 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   OPL1 GSM4591350   tissue:otg preleukemic thymocytes|cell type:thymocytes|genotype:otg;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab OPL1 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts otg preleukemic thymocytes   Truseq stranded mRNA library prep illumina #20020594   cell type:thymocytes|genotype:otg;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab GSM4591350 GSM4591350: OPL1; Danio rerio; RNA Seq GSM4591350   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591350 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 3000   SRP265974     Fsample_33.fastq.gz Fsample_33_R2.fastq.gz fastq fastq 5499039536.0 27222968.0 GSM4591350 r1 0:101 1:101 A:1515036859;C:1226882670;G:1229198085;T:1520688016;N:7233906 101 101     1515036859 1226882670 1229198085 1520688016 7233906 SRX8472315 SRS6772916 SRA1083220 GEO Center for Medical Genetics, Ghent University 2 0.92637 0.92762 0.31857 0.32243 0.76769 0.77116 0.46456 0.46584 101 101 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Thymus Hematopoietic System
59546 59546 SRR11926658 SRX8472304 SRS6772905 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   MPL3 GSM4591339   tissue:hMYC preleukemic thymocytes|cell type:thymocytes|genotype:Tgrag2:hMYC Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab MPL3 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts hMYC preleukemic thymocytes   Truseq stranded mRNA library prep illumina #20020594   cell type:thymocytes|genotype:Tgrag2:hMYC Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab GSM4591339 GSM4591339: MPL3; Danio rerio; RNA Seq GSM4591339   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591339 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 3000   SRP265974     Fsample_21.fastq.gz Fsample_21_R2.fastq.gz fastq fastq 8876009218.0 29390759.0 GSM4591339 r1 0:151 1:151 A:2397445782;C:2052027740;G:2018874313;T:2405562242;N:2099141 151 151     2397445782 2052027740 2018874313 2405562242 2099141 SRX8472304 SRS6772905 SRA1083220 GEO Center for Medical Genetics, Ghent University 2 0.92414 0.9227 0.2461 0.23997 0.78841 0.79506 0.50203 0.5018 151 151 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Thymus Hematopoietic System
59547 59547 SRR11926657 SRX8472303 SRS6772904 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   MPL2 GSM4591338   tissue:hMYC preleukemic thymocytes|cell type:thymocytes|genotype:Tgrag2:hMYC Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab MPL2 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts hMYC preleukemic thymocytes   Truseq stranded mRNA library prep illumina #20020594   cell type:thymocytes|genotype:Tgrag2:hMYC Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab GSM4591338 GSM4591338: MPL2; Danio rerio; RNA Seq GSM4591338   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591338 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 3000   SRP265974     Fsample_20.fastq.gz Fsample_20_R2.fastq.gz fastq fastq 8942441970.0 29610735.0 GSM4591338 r1 0:151 1:151 A:2434196467;C:2047066969;G:2021293350;T:2437752994;N:2132190 151 151     2434196467 2047066969 2021293350 2437752994 2132190 SRX8472303 SRS6772904 SRA1083220 GEO Center for Medical Genetics, Ghent University 2 0.9147 0.91499 0.22028 0.2117 0.77713 0.78334 0.50243 0.49838 151 151 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Thymus Hematopoietic System
59548 59548 SRR11926656 SRX8472302 SRS6772903 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   MPL1 GSM4591337   tissue:hMYC preleukemic thymocytes|cell type:thymocytes|genotype:Tgrag2:hMYC Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab MPL1 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts hMYC preleukemic thymocytes   Truseq stranded mRNA library prep illumina #20020594   cell type:thymocytes|genotype:Tgrag2:hMYC Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab GSM4591337 GSM4591337: MPL1; Danio rerio; RNA Seq GSM4591337   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591337 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 3000   SRP265974     Fsample_19.fastq.gz Fsample_19_R2.fastq.gz fastq fastq 9778540144.0 32379272.0 GSM4591337 r1 0:151 1:151 A:2676504038;C:2223347787;G:2177506547;T:2698864055;N:2317717 151 151     2676504038 2223347787 2177506547 2698864055 2317717 SRX8472302 SRS6772903 SRA1083220 GEO Center for Medical Genetics, Ghent University 2 0.91346 0.91413 0.29555 0.28893 0.79078 0.79825 0.49875 0.50518 151 151 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Thymus Hematopoietic System
59549 59549 SRR11926655 SRX8472301 SRS6772902 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   HPL3 GSM4591336   tissue:hulk mutant preleukemic thymocytes|cell type:thymocytes|genotype:hulk;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab HPL3 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts hulk mutant preleukemic thymocytes   Truseq stranded mRNA library prep illumina #20020594   cell type:thymocytes|genotype:hulk;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab GSM4591336 GSM4591336: HPL3; Danio rerio; RNA Seq GSM4591336   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591336 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 3000   SRP265974     Fsample_12.fastq.gz Fsample_12_R2.fastq.gz fastq fastq 3378760800.0 16893804.0 GSM4591336 r1 0:100 1:100 A:869653801;C:820588210;G:823025653;T:861750769;N:3742367 100 100     869653801 820588210 823025653 861750769 3742367 SRX8472301 SRS6772902 SRA1083220 GEO Center for Medical Genetics, Ghent University 2 0.93754 0.92151 0.17513 0.16969 0.79922 0.8071 0.63894 0.61913 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Thymus Hematopoietic System
59550 59550 SRR11926654 SRX8472300 SRS6772901 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   HPL2 GSM4591335   tissue:hulk mutant preleukemic thymocytes|cell type:thymocytes|genotype:hulk;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab HPL2 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts hulk mutant preleukemic thymocytes   Truseq stranded mRNA library prep illumina #20020594   cell type:thymocytes|genotype:hulk;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab GSM4591335 GSM4591335: HPL2; Danio rerio; RNA Seq GSM4591335   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591335 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 3000   SRP265974     Fsample_11.fastq.gz Fsample_11_R2.fastq.gz fastq fastq 3276290400.0 16381452.0 GSM4591335 r1 0:100 1:100 A:909076954;C:730010076;G:728583319;T:904911154;N:3708897 100 100     909076954 730010076 728583319 904911154 3708897 SRX8472300 SRS6772901 SRA1083220 GEO Center for Medical Genetics, Ghent University 2 0.93409 0.92023 0.18134 0.18141 0.78108 0.78981 0.53659 0.52431 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Thymus Hematopoietic System
59551 59551 SRR11926653 SRX8472299 SRS6772900 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   HPL1 GSM4591334   tissue:hulk mutant preleukemic thymocytes|cell type:thymocytes|genotype:hulk;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab HPL1 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts hulk mutant preleukemic thymocytes   Truseq stranded mRNA library prep illumina #20020594   cell type:thymocytes|genotype:hulk;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab GSM4591334 GSM4591334: HPL1; Danio rerio; RNA Seq GSM4591334   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591334 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 3000   SRP265974     Fsample_10.fastq.gz Fsample_10_R2.fastq.gz fastq fastq 3700727800.0 18503639.0 GSM4591334 r1 0:100 1:100 A:1028412839;C:821049620;G:815741395;T:1031399520;N:4124426 100 100     1028412839 821049620 815741395 1031399520 4124426 SRX8472299 SRS6772900 SRA1083220 GEO Center for Medical Genetics, Ghent University 2 0.93381 0.92058 0.22321 0.22223 0.73655 0.74732 0.4822 0.48829 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Thymus Hematopoietic System
59579 59579 SRR11926625 SRX8472271 SRS6772872 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   AB thymus 9 GSM4591306   tissue:Healthy dissected thymus|cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab AB thymus 9 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts Healthy dissected thymus   Truseq stranded mRNA library prep illumina #20020594   cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab GSM4591306 GSM4591306: AB thymus 9; Danio rerio; RNA Seq GSM4591306   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591306 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP265974     sample_6.fastq.gz fastq 2786385619.0 36888152.0 GSM4591306 r1 0:75.54 1:0 A:663089588;C:692060734;G:651825670;T:779197417;N:212210 75 0     663089588 692060734 651825670 779197417 212210 SRX8472271 SRS6772872 SRA1083220 GEO Center for Medical Genetics, Ghent University 1 0.94942   0.05717   0.73018   0.49009   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Thymus Hematopoietic System
59580 59580 SRR11926624 SRX8472270 SRS6772871 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   AB thymus 8 GSM4591305   tissue:Healthy dissected thymus|cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab AB thymus 8 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts Healthy dissected thymus   Truseq stranded mRNA library prep illumina #20020594   cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab GSM4591305 GSM4591305: AB thymus 8; Danio rerio; RNA Seq GSM4591305   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591305 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP265974     sample_5.fastq.gz fastq 2456067469.0 32519095.0 GSM4591305 r1 0:75.53 1:0 A:606304745;C:594426559;G:556316196;T:698842180;N:177789 75 0     606304745 594426559 556316196 698842180 177789 SRX8472270 SRS6772871 SRA1083220 GEO Center for Medical Genetics, Ghent University 1 0.94282   0.08874   0.70851   0.49253   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Thymus Hematopoietic System
59581 59581 SRR11926623 SRX8472269 SRS6772870 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   AB thymus 7 GSM4591304   tissue:Healthy dissected thymus|cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab AB thymus 7 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts Healthy dissected thymus   Truseq stranded mRNA library prep illumina #20020594   cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab GSM4591304 GSM4591304: AB thymus 7; Danio rerio; RNA Seq GSM4591304   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591304 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP265974     sample_4.fastq.gz fastq 2889915115.0 38259114.0 GSM4591304 r1 0:75.54 1:0 A:694082728;C:713330573;G:669832103;T:812454853;N:214858 75 0     694082728 713330573 669832103 812454853 214858 SRX8472269 SRS6772870 SRA1083220 GEO Center for Medical Genetics, Ghent University 1 0.94794   0.06446   0.72697   0.49962   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Thymus Hematopoietic System
59582 59582 SRR11926622 SRX8472268 SRS6772869 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   AB thymus 2 3 5 6 GSM4591303   tissue:Healthy dissected thymus|cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab AB thymus 2 3 5 6 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts Healthy dissected thymus   Truseq stranded mRNA library prep illumina #20020594   cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab GSM4591303 GSM4591303: AB thymus 2 3 5 6; Danio rerio; RNA Seq GSM4591303   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591303 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP265974     sample_3.fastq.gz fastq 2338535479.0 30955998.0 GSM4591303 r1 0:75.54 1:0 A:540165709;C:595429439;G:553807340;T:648952381;N:180610 75 0     540165709 595429439 553807340 648952381 180610 SRX8472268 SRS6772869 SRA1083220 GEO Center for Medical Genetics, Ghent University 1 0.94992   0.04962   0.73032   0.4837   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Thymus Hematopoietic System
59583 59583 SRR11926621 SRX8472267 SRS6772868 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   AB thymus 11 GSM4591302   tissue:Healthy dissected thymus|cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab AB thymus 11 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts Healthy dissected thymus   Truseq stranded mRNA library prep illumina #20020594   cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab GSM4591302 GSM4591302: AB thymus 11; Danio rerio; RNA Seq GSM4591302   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591302 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP265974     sample_2.fastq.gz fastq 2942053849.0 38949737.0 GSM4591302 r1 0:75.53 1:0 A:688398915;C:734856328;G:694653408;T:823920342;N:224856 75 0     688398915 734856328 694653408 823920342 224856 SRX8472267 SRS6772868 SRA1083220 GEO Center for Medical Genetics, Ghent University 1 0.94862   0.06975   0.72224   0.49305   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Thymus Hematopoietic System
59584 59584 SRR11926620 SRX8472266 SRS6772867 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   AB thymus 10 GSM4591301   tissue:Healthy dissected thymus|cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab AB thymus 10 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts Healthy dissected thymus   Truseq stranded mRNA library prep illumina #20020594   cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab GSM4591301 GSM4591301: AB thymus 10; Danio rerio; RNA Seq GSM4591301   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591301 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP265974     sample_1.fastq.gz fastq 2923525817.0 38707354.0 GSM4591301 r1 0:75.53 1:0 A:697204107;C:721945575;G:689048693;T:815100976;N:226466 75 0     697204107 721945575 689048693 815100976 226466 SRX8472266 SRS6772867 SRA1083220 GEO Center for Medical Genetics, Ghent University 1 0.94964   0.05377   0.71904   0.4902   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Thymus Hematopoietic System
63895 63895 SRR14213371 SRX10579916 SRS8684384 SRP314470 PRJNA721381 RNA Seq from zebrafish adult tissues GSE171906 Transcriptome Analysis The goal of this study was to profile transcript expression levels across zebrafish adult tissues. Overall design: Transcriptome profiles of nine zebrafish adult tissues. Every tissue contains triplicates.   pubmed:34556579   Spleen3 GSM5237140   source name:zebrafish spleen|genotype:wild type|tissue:spleen|strain:TLAB Spleen3 Libraries were sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0 using the Ensembl transcriptome release 102. The following parameters were used: hisat2 q dta rna strandness R k 12 no unal Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing TPM zebrafish spleen   Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle genotype:wild type|tissue:spleen|strain:TLAB GSM5237140 GSM5237140: Spleen3; Danio rerio; RNA Seq GSM5237140   1 Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina GEO Accession:GSM5237140 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP314470     Spleen3.fastq fastq 2469245600.0 24692456.0 GSM5237140 r1 0:100 A:595265067;C:649103304;G:625399353;T:599383209;N:94667 100       595265067 649103304 625399353 599383209 94667 SRX10579916 SRS8684384 SRA1217576 GEO Pauli lab, Research Institute of Molecular Pathology 1 0.9388   0.16508   0.75205   0.59719   100   B   usable mapping rate illumina hiseq_era unknown poly_a nebnext bulk unknown unknown   Austria 2021-04-12 Undetermined Undetermined Spleen Hematopoietic System
63896 63896 SRR14213370 SRX10579915 SRS8684383 SRP314470 PRJNA721381 RNA Seq from zebrafish adult tissues GSE171906 Transcriptome Analysis The goal of this study was to profile transcript expression levels across zebrafish adult tissues. Overall design: Transcriptome profiles of nine zebrafish adult tissues. Every tissue contains triplicates.   pubmed:34556579   Spleen2 GSM5237139   source name:zebrafish spleen|genotype:wild type|tissue:spleen|strain:TLAB Spleen2 Libraries were sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0 using the Ensembl transcriptome release 102. The following parameters were used: hisat2 q dta rna strandness R k 12 no unal Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing TPM zebrafish spleen   Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle genotype:wild type|tissue:spleen|strain:TLAB GSM5237139 GSM5237139: Spleen2; Danio rerio; RNA Seq GSM5237139   1 Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina GEO Accession:GSM5237139 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP314470     Spleen2.fastq fastq 1372663100.0 13726631.0 GSM5237139 r1 0:100 A:303080845;C:392345861;G:369765807;T:307418421;N:52166 100       303080845 392345861 369765807 307418421 52166 SRX10579915 SRS8684383 SRA1217576 GEO Pauli lab, Research Institute of Molecular Pathology 1 0.96541   0.18478   0.78565   0.60522   100   B   usable mapping rate illumina hiseq_era unknown poly_a nebnext bulk unknown unknown   Austria 2021-04-12 Undetermined Undetermined Spleen Hematopoietic System
63897 63897 SRR14213369 SRX10579914 SRS8684382 SRP314470 PRJNA721381 RNA Seq from zebrafish adult tissues GSE171906 Transcriptome Analysis The goal of this study was to profile transcript expression levels across zebrafish adult tissues. Overall design: Transcriptome profiles of nine zebrafish adult tissues. Every tissue contains triplicates.   pubmed:34556579   Spleen1 GSM5237138   source name:zebrafish spleen|genotype:wild type|tissue:spleen|strain:TLAB Spleen1 Libraries were sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0 using the Ensembl transcriptome release 102. The following parameters were used: hisat2 q dta rna strandness R k 12 no unal Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing TPM zebrafish spleen   Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle genotype:wild type|tissue:spleen|strain:TLAB GSM5237138 GSM5237138: Spleen1; Danio rerio; RNA Seq GSM5237138   1 Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina GEO Accession:GSM5237138 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP314470     Spleen1.fastq fastq 2268815600.0 22688156.0 GSM5237138 r1 0:100 A:570901318;C:562128594;G:552921437;T:582778510;N:85741 100       570901318 562128594 552921437 582778510 85741 SRX10579914 SRS8684382 SRA1217576 GEO Pauli lab, Research Institute of Molecular Pathology 1 0.93633   0.14981   0.72825   0.52073   100   B   usable mapping rate illumina hiseq_era unknown poly_a nebnext bulk unknown unknown   Austria 2021-04-12 Undetermined Undetermined Spleen Hematopoietic System
67018 67018 SRR16973884 SRX13164748 SRS11095951 SRP346708 PRJNA781453 WGBS and RNA seq of Danio rerio in HSPC generation GSE189072 Other In this study we interrogated the role of DNA methylation in HSPC generation by taking advantage of dnmt1 knockout/knockdown embryos in zebrafish. First we generated a comprehensive DNA methylation landscape of EHT which revealed gradually hypermethylated regions associated with vasculogenesis. Taking advantage of dnmt1 deficient embryos we showed that the decreased DNA methylation blocked HSPC emergence. Mechanistically we demonstrated that the decreased DNA methylation increased the expression of arterial genes and Notch signaling thus contributing to defects in the EHT in dnmt1 deficient embryos. Herein we identified that DNA methylation as epigenetic regulator participates in the negative modulation of Notch signaling through inhibiting transcription during HSPC generation in zebrafish. Overall design: WGBS and RNA seq of Danio rerio in EC HE and HSPC.   pubmed:35502759   HSC mut rep3 RNA GSM5694258   tissue:hematopoietic stem cells|developmental stage:HSC|genotype:dnmt1 mutant|region:AGM HSC mut rep3 RNA Basecalls perfomed using CASAVA2.19 WGBS and RNA seq raw sequencing reads were first trimmed for adapter and low quality sequences. Then mapped to GRCz11 using BS Seeker2v2.1.8 and hisat2v2.2.1 with parameters " t Y m 0.04 bt2 end to end" and " known splicesite infile p 30 k 10 dta t" separately. Student's T test was used to perform DMR analysis for WGBS data. Gene expression level was quantified by HTSeqv0.12.4 and differentially expressed genesDEGs were determined by DESeq2v1.30.1 Genome build: GRCz11 Supplementary files format and content: RNA seq raw count matrix Supplementary files format and content: raw count.txt raw counts Supplementary files format and content: EC sib.bed DMRs of EC sibling compared with HE sibling and HSC sibling Supplementary files format and content: HE sib.bed DMRs of HE sibling compared with EC sibling and HSC sibling Supplementary files format and content: HSC sib.bed DMRs of HSC sibling compared with EC sibling and HE sibling Supplementary files format and content: EC HE sib.bed DMRs of EC and HE sibling Supplementary files format and content: HE HSC sib.bed DMRs of HE and HSC sibling Supplementary files format and content: EC sib mut.bed DMRs of EC sibling and EC mutant Supplementary files format and content: HE sib mut.bed DMRs of HE sibling and HE mutant Supplementary files format and content: HSC sib mut.bed DMRs of HSC sibling and HSC mutant hematopoietic stem cells   Zebrafish embryos were harvested and dissected for single cell suspension. Single cell was sorted in lysis buffer by fluorescence activated cell sorting. The RNA seq library preparation and sequencing were performed based on the 3′ biased single cell tagged reverse transcription sequencing STRT seq.The DNA libraries conduction were performed according to the scBS seq with some modification   developmental stage:HSC|genotype:dnmt1 mutant|region:AGM GSM5694258 GSM5694258: HSC mut rep3 RNA; Danio rerio; RNA Seq GSM5694258   1 Zebrafish embryos were harvested and dissected for single cell suspension. Single cell was sorted in lysis buffer by fluorescence activated cell sorting. The RNA seq library preparation and sequencing were performed based on the 3′ biased single cell tagged reverse transcription sequencing STRT seq.The DNA libraries conduction were performed according to the scBS seq with some modification GEO Accession:GSM5694258 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP346708   loader:fastq load.py HSC_sib_3_1_RNA.fq.gz HSC_sib_3_2_RNA.fq.gz fastq fastq 8212205400.0 27374018.0 GSM5694258 r1 0:150 1:150 A:2309633599;C:1667340979;G:1773247570;T:2461956533;N:26719 150 150     2309633599 1667340979 1773247570 2461956533 26719 SRX13164748 SRS11095951 SRA1331007 GEO Institute of Hematology and Blood Diseases Hospital 2 0.9402 0.93297 0.16899 0.16784 0.73089 0.73665 0.49638 0.49263 150 150 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified unknown sc single_cell_plate strtseq   China 2021-11-18 Undetermined Embryo Blood Hematopoietic System
67019 67019 SRR16973883 SRX13164747 SRS11095950 SRP346708 PRJNA781453 WGBS and RNA seq of Danio rerio in HSPC generation GSE189072 Other In this study we interrogated the role of DNA methylation in HSPC generation by taking advantage of dnmt1 knockout/knockdown embryos in zebrafish. First we generated a comprehensive DNA methylation landscape of EHT which revealed gradually hypermethylated regions associated with vasculogenesis. Taking advantage of dnmt1 deficient embryos we showed that the decreased DNA methylation blocked HSPC emergence. Mechanistically we demonstrated that the decreased DNA methylation increased the expression of arterial genes and Notch signaling thus contributing to defects in the EHT in dnmt1 deficient embryos. Herein we identified that DNA methylation as epigenetic regulator participates in the negative modulation of Notch signaling through inhibiting transcription during HSPC generation in zebrafish. Overall design: WGBS and RNA seq of Danio rerio in EC HE and HSPC.   pubmed:35502759   HSC mut rep2 RNA GSM5694257   tissue:hematopoietic stem cells|developmental stage:HSC|genotype:dnmt1 mutant|region:AGM HSC mut rep2 RNA Basecalls perfomed using CASAVA2.19 WGBS and RNA seq raw sequencing reads were first trimmed for adapter and low quality sequences. Then mapped to GRCz11 using BS Seeker2v2.1.8 and hisat2v2.2.1 with parameters " t Y m 0.04 bt2 end to end" and " known splicesite infile p 30 k 10 dta t" separately. Student's T test was used to perform DMR analysis for WGBS data. Gene expression level was quantified by HTSeqv0.12.4 and differentially expressed genesDEGs were determined by DESeq2v1.30.1 Genome build: GRCz11 Supplementary files format and content: RNA seq raw count matrix Supplementary files format and content: raw count.txt raw counts Supplementary files format and content: EC sib.bed DMRs of EC sibling compared with HE sibling and HSC sibling Supplementary files format and content: HE sib.bed DMRs of HE sibling compared with EC sibling and HSC sibling Supplementary files format and content: HSC sib.bed DMRs of HSC sibling compared with EC sibling and HE sibling Supplementary files format and content: EC HE sib.bed DMRs of EC and HE sibling Supplementary files format and content: HE HSC sib.bed DMRs of HE and HSC sibling Supplementary files format and content: EC sib mut.bed DMRs of EC sibling and EC mutant Supplementary files format and content: HE sib mut.bed DMRs of HE sibling and HE mutant Supplementary files format and content: HSC sib mut.bed DMRs of HSC sibling and HSC mutant hematopoietic stem cells   Zebrafish embryos were harvested and dissected for single cell suspension. Single cell was sorted in lysis buffer by fluorescence activated cell sorting. The RNA seq library preparation and sequencing were performed based on the 3′ biased single cell tagged reverse transcription sequencing STRT seq.The DNA libraries conduction were performed according to the scBS seq with some modification   developmental stage:HSC|genotype:dnmt1 mutant|region:AGM GSM5694257 GSM5694257: HSC mut rep2 RNA; Danio rerio; RNA Seq GSM5694257   1 Zebrafish embryos were harvested and dissected for single cell suspension. Single cell was sorted in lysis buffer by fluorescence activated cell sorting. The RNA seq library preparation and sequencing were performed based on the 3′ biased single cell tagged reverse transcription sequencing STRT seq.The DNA libraries conduction were performed according to the scBS seq with some modification GEO Accession:GSM5694257 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP346708     HSC_sib_2_1_RNA.fq.gz HSC_sib_2_2_RNA.fq.gz fastq fastq 3426398100.0 11421327.0 GSM5694257 r1 0:150 1:150 A:946653601;C:712946549;G:748099225;T:1018648813;N:49912 150 150     946653601 712946549 748099225 1018648813 49912 SRX13164747 SRS11095950 SRA1331007 GEO Institute of Hematology and Blood Diseases Hospital 2 0.94198 0.95128 0.10797 0.10975 0.78366 0.78892 0.46218 0.45981 150 150 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified unknown sc single_cell_plate strtseq   China 2021-11-18 Undetermined Embryo Blood Hematopoietic System
67020 67020 SRR16973881 SRX13164745 SRS11095948 SRP346708 PRJNA781453 WGBS and RNA seq of Danio rerio in HSPC generation GSE189072 Other In this study we interrogated the role of DNA methylation in HSPC generation by taking advantage of dnmt1 knockout/knockdown embryos in zebrafish. First we generated a comprehensive DNA methylation landscape of EHT which revealed gradually hypermethylated regions associated with vasculogenesis. Taking advantage of dnmt1 deficient embryos we showed that the decreased DNA methylation blocked HSPC emergence. Mechanistically we demonstrated that the decreased DNA methylation increased the expression of arterial genes and Notch signaling thus contributing to defects in the EHT in dnmt1 deficient embryos. Herein we identified that DNA methylation as epigenetic regulator participates in the negative modulation of Notch signaling through inhibiting transcription during HSPC generation in zebrafish. Overall design: WGBS and RNA seq of Danio rerio in EC HE and HSPC.   pubmed:35502759   HSC sib rep3 RNA GSM5694255   tissue:hematopoietic stem cells|developmental stage:HSC|genotype:sibling|region:AGM HSC sib rep3 RNA Basecalls perfomed using CASAVA2.19 WGBS and RNA seq raw sequencing reads were first trimmed for adapter and low quality sequences. Then mapped to GRCz11 using BS Seeker2v2.1.8 and hisat2v2.2.1 with parameters " t Y m 0.04 bt2 end to end" and " known splicesite infile p 30 k 10 dta t" separately. Student's T test was used to perform DMR analysis for WGBS data. Gene expression level was quantified by HTSeqv0.12.4 and differentially expressed genesDEGs were determined by DESeq2v1.30.1 Genome build: GRCz11 Supplementary files format and content: RNA seq raw count matrix Supplementary files format and content: raw count.txt raw counts Supplementary files format and content: EC sib.bed DMRs of EC sibling compared with HE sibling and HSC sibling Supplementary files format and content: HE sib.bed DMRs of HE sibling compared with EC sibling and HSC sibling Supplementary files format and content: HSC sib.bed DMRs of HSC sibling compared with EC sibling and HE sibling Supplementary files format and content: EC HE sib.bed DMRs of EC and HE sibling Supplementary files format and content: HE HSC sib.bed DMRs of HE and HSC sibling Supplementary files format and content: EC sib mut.bed DMRs of EC sibling and EC mutant Supplementary files format and content: HE sib mut.bed DMRs of HE sibling and HE mutant Supplementary files format and content: HSC sib mut.bed DMRs of HSC sibling and HSC mutant hematopoietic stem cells   Zebrafish embryos were harvested and dissected for single cell suspension. Single cell was sorted in lysis buffer by fluorescence activated cell sorting. The RNA seq library preparation and sequencing were performed based on the 3′ biased single cell tagged reverse transcription sequencing STRT seq.The DNA libraries conduction were performed according to the scBS seq with some modification   developmental stage:HSC|genotype:sibling|region:AGM GSM5694255 GSM5694255: HSC sib rep3 RNA; Danio rerio; RNA Seq GSM5694255   1 Zebrafish embryos were harvested and dissected for single cell suspension. Single cell was sorted in lysis buffer by fluorescence activated cell sorting. The RNA seq library preparation and sequencing were performed based on the 3′ biased single cell tagged reverse transcription sequencing STRT seq.The DNA libraries conduction were performed according to the scBS seq with some modification GEO Accession:GSM5694255 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP346708   loader:fastq load.py HSC_mut_3_1_RNA.fq.gz HSC_mut_3_2_RNA.fq.gz fastq fastq 9049492800.0 30164976.0 GSM5694255 r1 0:150 1:150 A:2539831836;C:1839829118;G:1955216925;T:2714585195;N:29726 150 150     2539831836 1839829118 1955216925 2714585195 29726 SRX13164745 SRS11095948 SRA1331007 GEO Institute of Hematology and Blood Diseases Hospital 2 0.94274 0.93556 0.16188 0.1602 0.73046 0.73308 0.49974 0.49435 150 150 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified unknown sc single_cell_plate strtseq   China 2021-11-18 Undetermined Embryo Blood Hematopoietic System
67021 67021 SRR16973880 SRX13164744 SRS11095947 SRP346708 PRJNA781453 WGBS and RNA seq of Danio rerio in HSPC generation GSE189072 Other In this study we interrogated the role of DNA methylation in HSPC generation by taking advantage of dnmt1 knockout/knockdown embryos in zebrafish. First we generated a comprehensive DNA methylation landscape of EHT which revealed gradually hypermethylated regions associated with vasculogenesis. Taking advantage of dnmt1 deficient embryos we showed that the decreased DNA methylation blocked HSPC emergence. Mechanistically we demonstrated that the decreased DNA methylation increased the expression of arterial genes and Notch signaling thus contributing to defects in the EHT in dnmt1 deficient embryos. Herein we identified that DNA methylation as epigenetic regulator participates in the negative modulation of Notch signaling through inhibiting transcription during HSPC generation in zebrafish. Overall design: WGBS and RNA seq of Danio rerio in EC HE and HSPC.   pubmed:35502759   HSC sib rep2 RNA GSM5694254   tissue:hematopoietic stem cells|developmental stage:HSC|genotype:sibling|region:AGM HSC sib rep2 RNA Basecalls perfomed using CASAVA2.19 WGBS and RNA seq raw sequencing reads were first trimmed for adapter and low quality sequences. Then mapped to GRCz11 using BS Seeker2v2.1.8 and hisat2v2.2.1 with parameters " t Y m 0.04 bt2 end to end" and " known splicesite infile p 30 k 10 dta t" separately. Student's T test was used to perform DMR analysis for WGBS data. Gene expression level was quantified by HTSeqv0.12.4 and differentially expressed genesDEGs were determined by DESeq2v1.30.1 Genome build: GRCz11 Supplementary files format and content: RNA seq raw count matrix Supplementary files format and content: raw count.txt raw counts Supplementary files format and content: EC sib.bed DMRs of EC sibling compared with HE sibling and HSC sibling Supplementary files format and content: HE sib.bed DMRs of HE sibling compared with EC sibling and HSC sibling Supplementary files format and content: HSC sib.bed DMRs of HSC sibling compared with EC sibling and HE sibling Supplementary files format and content: EC HE sib.bed DMRs of EC and HE sibling Supplementary files format and content: HE HSC sib.bed DMRs of HE and HSC sibling Supplementary files format and content: EC sib mut.bed DMRs of EC sibling and EC mutant Supplementary files format and content: HE sib mut.bed DMRs of HE sibling and HE mutant Supplementary files format and content: HSC sib mut.bed DMRs of HSC sibling and HSC mutant hematopoietic stem cells   Zebrafish embryos were harvested and dissected for single cell suspension. Single cell was sorted in lysis buffer by fluorescence activated cell sorting. The RNA seq library preparation and sequencing were performed based on the 3′ biased single cell tagged reverse transcription sequencing STRT seq.The DNA libraries conduction were performed according to the scBS seq with some modification   developmental stage:HSC|genotype:sibling|region:AGM GSM5694254 GSM5694254: HSC sib rep2 RNA; Danio rerio; RNA Seq GSM5694254   1 Zebrafish embryos were harvested and dissected for single cell suspension. Single cell was sorted in lysis buffer by fluorescence activated cell sorting. The RNA seq library preparation and sequencing were performed based on the 3′ biased single cell tagged reverse transcription sequencing STRT seq.The DNA libraries conduction were performed according to the scBS seq with some modification GEO Accession:GSM5694254 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP346708     HSC_mut_2_1_RNA.fq.gz HSC_mut_2_2_RNA.fq.gz fastq fastq 3488203500.0 11627345.0 GSM5694254 r1 0:150 1:150 A:993927631;C:700449875;G:737230481;T:1056544435;N:51078 150 150     993927631 700449875 737230481 1056544435 51078 SRX13164744 SRS11095947 SRA1331007 GEO Institute of Hematology and Blood Diseases Hospital 2 0.93176 0.93765 0.14294 0.14478 0.75302 0.7582 0.49038 0.48496 150 150 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified unknown sc single_cell_plate strtseq   China 2021-11-18 Undetermined Embryo Blood Hematopoietic System
67908 67908 SRR017341 SRX003632 SRS002067 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish N                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishN Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true N_fish.tar fastq 40231384.0 173756.0 Zebrafish IgH cDNA FishN 0:4 1:227.54 A:10436935;C:8800020;G:9512025;T:11471941;N:10463 4 227     10436935 8800020 9512025 11471941 10463 SRX003632 SRS002067 SRA008134 Stanford University|Quake Stanford University 1 0.26487   0.0663   0.99304   0.01389   229   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67909 67909 SRR017340 SRX003631 SRS002066 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish M                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishM Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true M_fish.tar fastq 37492198.0 161639.0 Zebrafish IgH cDNA FishM 0:4 1:227.95 A:9527141;C:8129088;G:9025760;T:10804127;N:6082 4 227     9527141 8129088 9025760 10804127 6082 SRX003631 SRS002066 SRA008134 Stanford University|Quake Stanford University 1 0.31521   0.11394   0.99823   0.00291   208   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67910 67910 SRR017339 SRX003630 SRS002065 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish L                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishL Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true L_fish.tar fastq 37971443.0 163701.0 Zebrafish IgH cDNA FishL 0:4 1:227.96 A:9544875;C:8363123;G:9094601;T:10963684;N:5160 4 227     9544875 8363123 9094601 10963684 5160 SRX003630 SRS002065 SRA008134 Stanford University|Quake Stanford University 1 0.29057   0.07862   0.99636   0.00534   245   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67911 67911 SRR017338 SRX003629 SRS002064 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish K                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishK Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true K_fish.tar fastq 54201403.0 234266.0 Zebrafish IgH cDNA FishK 0:4 1:227.37 A:13608677;C:11652239;G:12945164;T:15975205;N:20118 4 227     13608677 11652239 12945164 15975205 20118 SRX003629 SRS002064 SRA008134 Stanford University|Quake Stanford University 1 0.27218   0.07987   0.99275   0.01242   244   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67912 67912 SRR017337 SRX003628 SRS002063 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish J                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishJ Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true J_fish.tar fastq 51915342.0 224027.0 Zebrafish IgH cDNA FishJ 0:4 1:227.74 A:12664582;C:12040983;G:12609762;T:14589770;N:10245 4 227     12664582 12040983 12609762 14589770 10245 SRX003628 SRS002063 SRA008134 Stanford University|Quake Stanford University 1 0.29028   0.10039   0.9964   0.00625   97   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67913 67913 SRR017336 SRX003627 SRS002062 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish I                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishI Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true I_fish.tar fastq 23436268.0 100120.0 Zebrafish IgH cDNA FishI 0:4 1:230.08 A:5801823;C:5246438;G:5587169;T:6797624;N:3214 4 230     5801823 5246438 5587169 6797624 3214 SRX003627 SRS002062 SRA008134 Stanford University|Quake Stanford University 1 0.34362   0.0757   0.99241   0.02647   232   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67914 67914 SRR017335 SRX003626 SRS002061 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish H                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishH Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true H_fish.tar fastq 48443452.0 213531.0 Zebrafish IgH cDNA FishH 0:4 1:222.87 A:12720681;C:10490855;G:11923926;T:13303989;N:4001 4 222     12720681 10490855 11923926 13303989 4001 SRX003626 SRS002061 SRA008134 Stanford University|Quake Stanford University 1 0.45847   0.04709   0.98754   0.0161   56   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67915 67915 SRR017334 SRX003625 SRS002060 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish G                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishG Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true G_fish.tar fastq 50095821.0 217866.0 Zebrafish IgH cDNA FishG 0:4 1:225.94 A:13182103;C:11299206;G:11909574;T:13700817;N:4121 4 225     13182103 11299206 11909574 13700817 4121 SRX003625 SRS002060 SRA008134 Stanford University|Quake Stanford University 1 0.37294   0.09947   0.99034   0.02245   230   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67916 67916 SRR017333 SRX003624 SRS002059 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish F                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishF Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true F_fish.tar fastq 16577798.0 83387.0 Zebrafish IgH cDNA FishF 0:4 1:194.81 A:4215316;C:3618457;G:4002690;T:4736893;N:4442 4 194     4215316 3618457 4002690 4736893 4442 SRX003624 SRS002059 SRA008134 Stanford University|Quake Stanford University 1 0.57361   0.0727   0.99965   0.00026   62   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67917 67917 SRR017332 SRX003623 SRS002058 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish E                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishE Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true E_fish.tar fastq 29705006.0 131553.0 Zebrafish IgH cDNA FishE 0:4 1:221.80 A:7474430;C:6417563;G:7115572;T:8693543;N:3898 4 221     7474430 6417563 7115572 8693543 3898 SRX003623 SRS002058 SRA008134 Stanford University|Quake Stanford University 1 0.3099   0.09802   0.99904   0.00099   45   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67918 67918 SRR017331 SRX003622 SRS002057 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish D                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishD Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true D_fish.tar fastq 27611909.0 123468.0 Zebrafish IgH cDNA FishD 0:4 1:219.64 A:6809564;C:6219469;G:6636933;T:7943112;N:2831 4 219     6809564 6219469 6636933 7943112 2831 SRX003622 SRS002057 SRA008134 Stanford University|Quake Stanford University 1 0.45962   0.09396   0.99941   0.00026   218   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67919 67919 SRR017330 SRX003621 SRS002056 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish C                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishC Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true C_fish.tar fastq 21845405.0 95733.0 Zebrafish IgH cDNA FishC 0:4 1:224.19 A:5735195;C:4746747;G:5266352;T:6095066;N:2045 4 224     5735195 4746747 5266352 6095066 2045 SRX003621 SRS002056 SRA008134 Stanford University|Quake Stanford University 1 0.38908   0.20497   0.99967   0.00047   145   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67920 67920 SRR017329 SRX003620 SRS002055 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish B                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishB Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true B_fish.tar fastq 26680294.0 118385.0 Zebrafish IgH cDNA FishB 0:4 1:221.37 A:6380496;C:6168810;G:6541530;T:7587018;N:2440 4 221     6380496 6168810 6541530 7587018 2440 SRX003620 SRS002055 SRA008134 Stanford University|Quake Stanford University 1 0.35498   0.14675   0.99906   0.00098   228   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67921 67921 SRR017328 SRX003619 SRS002054 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish A                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishA Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true A_fish.tar fastq 13497752.0 61111.0 Zebrafish IgH cDNA FishA 0:4 1:216.87 A:3287411;C:3078068;G:3224467;T:3906026;N:1780 4 216     3287411 3078068 3224467 3906026 1780 SRX003619 SRS002054 SRA008134 Stanford University|Quake Stanford University 1 0.32333   0.14098   0.99937   0.00169   52   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
68889 68889 SRR18218067 SRX14364507 SRS12177802 SRP362416 PRJNA812715 Mutant IL7R collaborates with MYC to induce T cell Acute Lymphoblastic Leukemia PRJNA812715 Other T cell acute lymphoblastic leukemia T ALL is an aggressive pediatric cancer. Amongst the wide array of driver mutations 10% of T ALL patients display gain of function mutations in the IL 7 receptor alpha chain IL 7Ralpha encoded by IL7R which occur in different molecular subtypes of this disease. However it is still unclear whether IL 7R mutational activation is sufficient to transform T cell precursors. Also which genes cooperate with IL7R to drive leukemogenesis remain poorly defined. Here we demonstrate that mutant IL7R alone is capable of inducing T ALL with long latency in stable transgenic zebrafish and transformation is associated with MYC transcriptional activation. Additionally we find that mutant IL7R collaborates with Myc to induce early onset T ALL in transgenic zebrafish. T ALLs co expressing mutant IL7R and Myc show activation of STAT5 and AKT pathways harbor reduced numbers of apoptotic cells and remake tumors in transplanted zebrafish faster than T ALLs expressing Myc alone. Moreover limiting dilution cell transplantation experiments reveal that activated IL 7R signaling increases the overall frequency of leukemia propagating cells. Our work highlights a synergy between mutant IL7R and Myc in inducing T ALL and demonstrates that mutant IL7R enriches for leukemia propagating potential.         Thy rag2 RFP 6   strain:Tu/AB|age:not collected|sex:not collected|tissue:thymus|birth date: |death date:02 07 2019|genotype:rag2:RFP|biological replicate:Thy rag2 RFP biological replicate 4|BioSampleModel:Model organism or animal                 RNA seq of Danio rerio thymus Tu/AB Thy rag2 RFP 6 Thy rag2 RFP 6 Tu/AB WT zebrafish were sacrificed to harvest the thymus visible through RFP staining for further analysis. The RNA was extracted from sorted thymic cells using the RNeasy Mini Kit according to the manufacturers instructions Qiagen. mRNA was enriched using magnetic beads with Oligo dT fragmented and converted to cDNA size selected and PCR amplified generating paired end 100 bp sequences using a Illumina NovaSeq 6000.     RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP362416     FCHT5GHDSXX_L1_HKRDZEBmfpEAAPRABPEI-P86H2_1.fq.gz FCHT5GHDSXX_L1_HKRDZEBmfpEAAPRABPEI-P86H2_2.fq.gz fastq fastq 18061636200.0 60205454.0 FCHT5GHDSXX L1 HKRDZEBmfpEAAPRABPEI P86H2 1.fq.gz 0:150 1:150 A:4749806271;C:4292116510;G:4365562558;T:4654124713;N:26148 150 150     4749806271 4292116510 4365562558 4654124713 26148 SRX14364507 SRS12177802 SRA1380603 Instituto de Medicina Molecular Joao Lobo Antunes|JBarata lab Instituto de Medicina Molecular Joao Lobo Antunes 2 0.9283 0.92884 0.11636 0.1154 0.77642 0.77697 0.48938 0.49117 150 150 B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk unknown unknown   Portugal 2022-03-04 Undetermined Undetermined Thymus Hematopoietic System
68890 68890 SRR18218069 SRX14364506 SRS12177801 SRP362416 PRJNA812715 Mutant IL7R collaborates with MYC to induce T cell Acute Lymphoblastic Leukemia PRJNA812715 Other T cell acute lymphoblastic leukemia T ALL is an aggressive pediatric cancer. Amongst the wide array of driver mutations 10% of T ALL patients display gain of function mutations in the IL 7 receptor alpha chain IL 7Ralpha encoded by IL7R which occur in different molecular subtypes of this disease. However it is still unclear whether IL 7R mutational activation is sufficient to transform T cell precursors. Also which genes cooperate with IL7R to drive leukemogenesis remain poorly defined. Here we demonstrate that mutant IL7R alone is capable of inducing T ALL with long latency in stable transgenic zebrafish and transformation is associated with MYC transcriptional activation. Additionally we find that mutant IL7R collaborates with Myc to induce early onset T ALL in transgenic zebrafish. T ALLs co expressing mutant IL7R and Myc show activation of STAT5 and AKT pathways harbor reduced numbers of apoptotic cells and remake tumors in transplanted zebrafish faster than T ALLs expressing Myc alone. Moreover limiting dilution cell transplantation experiments reveal that activated IL 7R signaling increases the overall frequency of leukemia propagating cells. Our work highlights a synergy between mutant IL7R and Myc in inducing T ALL and demonstrates that mutant IL7R enriches for leukemia propagating potential.         Thy rag2 RFP 5   strain:Tu/AB|age:not collected|sex:not collected|tissue:thymus|birth date: |death date:02 07 2019|genotype:rag2:RFP|biological replicate:Thy rag2 RFP biological replicate 3|BioSampleModel:Model organism or animal                 RNA seq of Danio rerio thymus Tu/AB Thy rag2 RFP 5 Thy rag2 RFP 5 Tu/AB WT zebrafish were sacrificed to harvest the thymus visible through RFP staining for further analysis. The RNA was extracted from sorted thymic cells using the RNeasy Mini Kit according to the manufacturers instructions Qiagen. mRNA was enriched using magnetic beads with Oligo dT fragmented and converted to cDNA size selected and PCR amplified generating paired end 100 bp sequences using a Illumina NovaSeq 6000.     RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP362416     FCHT5GHDSXX_L1_HKRDZEBmfpEAAORAAPEI-P74G2_1.fq.gz FCHT5GHDSXX_L1_HKRDZEBmfpEAAORAAPEI-P74G2_2.fq.gz fastq fastq 16916167800.0 56387226.0 FCHT5GHDSXX L1 HKRDZEBmfpEAAORAAPEI P74G2 1.fq.gz 0:150 1:150 A:4469149097;C:4004191756;G:4070955203;T:4371847041;N:24703 150 150     4469149097 4004191756 4070955203 4371847041 24703 SRX14364506 SRS12177801 SRA1380603 Instituto de Medicina Molecular Joao Lobo Antunes|JBarata lab Instituto de Medicina Molecular Joao Lobo Antunes 2 0.92644 0.92786 0.13071 0.13011 0.77833 0.77792 0.47942 0.4816 150 150 B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk unknown unknown   Portugal 2022-03-04 Undetermined Undetermined Thymus Hematopoietic System
68891 68891 SRR18218070 SRX14364505 SRS12177800 SRP362416 PRJNA812715 Mutant IL7R collaborates with MYC to induce T cell Acute Lymphoblastic Leukemia PRJNA812715 Other T cell acute lymphoblastic leukemia T ALL is an aggressive pediatric cancer. Amongst the wide array of driver mutations 10% of T ALL patients display gain of function mutations in the IL 7 receptor alpha chain IL 7Ralpha encoded by IL7R which occur in different molecular subtypes of this disease. However it is still unclear whether IL 7R mutational activation is sufficient to transform T cell precursors. Also which genes cooperate with IL7R to drive leukemogenesis remain poorly defined. Here we demonstrate that mutant IL7R alone is capable of inducing T ALL with long latency in stable transgenic zebrafish and transformation is associated with MYC transcriptional activation. Additionally we find that mutant IL7R collaborates with Myc to induce early onset T ALL in transgenic zebrafish. T ALLs co expressing mutant IL7R and Myc show activation of STAT5 and AKT pathways harbor reduced numbers of apoptotic cells and remake tumors in transplanted zebrafish faster than T ALLs expressing Myc alone. Moreover limiting dilution cell transplantation experiments reveal that activated IL 7R signaling increases the overall frequency of leukemia propagating cells. Our work highlights a synergy between mutant IL7R and Myc in inducing T ALL and demonstrates that mutant IL7R enriches for leukemia propagating potential.         Thy rag2 RFP 4   strain:Tu/AB|age:not collected|sex:not collected|tissue:thymus|birth date: |death date:02 07 2019|genotype:rag2:RFP|biological replicate:Thy rag2 RFP biological replicate 2|BioSampleModel:Model organism or animal                 RNA seq of Danio rerio thymus Tu/AB Thy rag2 RFP 4 Thy rag2 RFP 4 Tu/AB WT zebrafish were sacrificed to harvest the thymus visible through RFP staining for further analysis. The RNA was extracted from sorted thymic cells using the RNeasy Mini Kit according to the manufacturers instructions Qiagen. mRNA was enriched using magnetic beads with Oligo dT fragmented and converted to cDNA size selected and PCR amplified generating paired end 100 bp sequences using a Illumina NovaSeq 6000.     RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP362416     FCHT5GHDSXX_L1_HKRDZEBmfpEAANRABPEI-P62F2_1.fq.gz FCHT5GHDSXX_L1_HKRDZEBmfpEAANRABPEI-P62F2_2.fq.gz fastq fastq 17996947500.0 59989825.0 FCHT5GHDSXX L1 HKRDZEBmfpEAANRABPEI P62F2 1.fq.gz 0:150 1:150 A:4882125302;C:4136332786;G:4194970590;T:4783492952;N:25870 150 150     4882125302 4136332786 4194970590 4783492952 25870 SRX14364505 SRS12177800 SRA1380603 Instituto de Medicina Molecular Joao Lobo Antunes|JBarata lab Instituto de Medicina Molecular Joao Lobo Antunes 2 0.86095 0.86165 0.25113 0.2504 0.80204 0.80188 0.48309 0.48627 150 150 B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk unknown unknown   Portugal 2022-03-04 Undetermined Undetermined Thymus Hematopoietic System
68892 68892 SRR18218071 SRX14364504 SRS12177799 SRP362416 PRJNA812715 Mutant IL7R collaborates with MYC to induce T cell Acute Lymphoblastic Leukemia PRJNA812715 Other T cell acute lymphoblastic leukemia T ALL is an aggressive pediatric cancer. Amongst the wide array of driver mutations 10% of T ALL patients display gain of function mutations in the IL 7 receptor alpha chain IL 7Ralpha encoded by IL7R which occur in different molecular subtypes of this disease. However it is still unclear whether IL 7R mutational activation is sufficient to transform T cell precursors. Also which genes cooperate with IL7R to drive leukemogenesis remain poorly defined. Here we demonstrate that mutant IL7R alone is capable of inducing T ALL with long latency in stable transgenic zebrafish and transformation is associated with MYC transcriptional activation. Additionally we find that mutant IL7R collaborates with Myc to induce early onset T ALL in transgenic zebrafish. T ALLs co expressing mutant IL7R and Myc show activation of STAT5 and AKT pathways harbor reduced numbers of apoptotic cells and remake tumors in transplanted zebrafish faster than T ALLs expressing Myc alone. Moreover limiting dilution cell transplantation experiments reveal that activated IL 7R signaling increases the overall frequency of leukemia propagating cells. Our work highlights a synergy between mutant IL7R and Myc in inducing T ALL and demonstrates that mutant IL7R enriches for leukemia propagating potential.         Thy rag2 RFP 3   strain:Tu/AB|age:not collected|sex:not collected|tissue:thymus|birth date: |death date:02 07 2019|genotype:rag2:RFP|biological replicate:Thy rag2 RFP biological replicate 1|BioSampleModel:Model organism or animal                 RNA seq of Danio rerio thymus Tu/AB Thy rag2 RFP 3 Thy rag2 RFP 3 Tu/AB WT zebrafish were sacrificed to harvest the thymus visible through RFP staining for further analysis. The RNA was extracted from sorted thymic cells using the RNeasy Mini Kit according to the manufacturers instructions Qiagen. mRNA was enriched using magnetic beads with Oligo dT fragmented and converted to cDNA size selected and PCR amplified generating paired end 100 bp sequences using a Illumina NovaSeq 6000.     RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP362416     FCHT5GHDSXX_L1_HKRDZEBmfpEAAMRABPEI-P50E2_1.fq.gz FCHT5GHDSXX_L1_HKRDZEBmfpEAAMRABPEI-P50E2_2.fq.gz fastq fastq 18041602200.0 60138674.0 FCHT5GHDSXX L1 HKRDZEBmfpEAAMRABPEI P50E2 1.fq.gz 0:150 1:150 A:4726391295;C:4303349397;G:4380843440;T:4630991494;N:26574 150 150     4726391295 4303349397 4380843440 4630991494 26574 SRX14364504 SRS12177799 SRA1380603 Instituto de Medicina Molecular Joao Lobo Antunes|JBarata lab Instituto de Medicina Molecular Joao Lobo Antunes 2 0.93138 0.9316 0.11291 0.11196 0.78143 0.78261 0.4799 0.47958 150 150 B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk unknown unknown   Portugal 2022-03-04 Undetermined Undetermined Thymus Hematopoietic System
71972 71972 SRR22163682 SRX18142568 SRS15644032 SRP405990 PRJNA897077 Transcriptome of zebrafish Danio rerio PRJNA897077 Other Zebrafish Danio rerio have been used as a model organism to study innate immune system and hostpathogen interactions. Until now the information related to the immune system against A. hydrophila of zebrafish and the treatment by probiotics is incomplete. To increase knowledge of the molecular mechanisms of the host defense against A. hydrophila and provide evidence that antibiotics can replace by probiotics we conducted transcriptome analysis of spleen in zebrafish 48 h post infection and treatment by Lactococcus lactis post 4h post infection via sequencing.         C3   strain:not applicable|age:not collected|sex:not collected|tissue:spleen|treatment:control|replicate:replicate3|BioSampleModel:Model organism or animal                 RNA seq of Danio rerio C3 C3 control group     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA Illumina NovaSeq 6000   SRP405990     C3.R1.fastq.gz C3.R2.fastq.gz fastq fastq 6777299176.0 22441388.0 C3.R1.fastq.gz 0:151 1:151 A:1869146927;C:1513142912;G:1565477798;T:1829395893;N:135646 151 151     1869146927 1513142912 1565477798 1829395893 135646 SRX18142568 SRS15644032 SRA1532870 Kunming University of Science and Technology|Faculty of Life Science and Technology Kunming University of Science and Technology 2 0.91581 0.91452 0.09416 0.09344 0.71167 0.71338 0.50247 0.50311 151 151 B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk unknown unknown   China 2022-11-02 Undetermined Undetermined Spleen Hematopoietic System
71973 71973 SRR22163683 SRX18142567 SRS15644031 SRP405990 PRJNA897077 Transcriptome of zebrafish Danio rerio PRJNA897077 Other Zebrafish Danio rerio have been used as a model organism to study innate immune system and hostpathogen interactions. Until now the information related to the immune system against A. hydrophila of zebrafish and the treatment by probiotics is incomplete. To increase knowledge of the molecular mechanisms of the host defense against A. hydrophila and provide evidence that antibiotics can replace by probiotics we conducted transcriptome analysis of spleen in zebrafish 48 h post infection and treatment by Lactococcus lactis post 4h post infection via sequencing.         C2   strain:not applicable|age:not collected|sex:not collected|tissue:spleen|treatment:control|replicate:replicate2|BioSampleModel:Model organism or animal                 RNA seq of Danio rerio C2 C2 control group     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA Illumina NovaSeq 6000   SRP405990     C2.R1.fastq.gz C2.R2.fastq.gz fastq fastq 6956425644.0 23034522.0 C2.R1.fastq.gz 0:151 1:151 A:1847551873;C:1616308106;G:1662475314;T:1829952767;N:137584 151 151     1847551873 1616308106 1662475314 1829952767 137584 SRX18142567 SRS15644031 SRA1532870 Kunming University of Science and Technology|Faculty of Life Science and Technology Kunming University of Science and Technology 2 0.93033 0.9312 0.056 0.05619 0.71261 0.71376 0.4668 0.47014 151 151 B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk unknown unknown   China 2022-11-02 Undetermined Undetermined Spleen Hematopoietic System
71974 71974 SRR22163684 SRX18142566 SRS15644030 SRP405990 PRJNA897077 Transcriptome of zebrafish Danio rerio PRJNA897077 Other Zebrafish Danio rerio have been used as a model organism to study innate immune system and hostpathogen interactions. Until now the information related to the immune system against A. hydrophila of zebrafish and the treatment by probiotics is incomplete. To increase knowledge of the molecular mechanisms of the host defense against A. hydrophila and provide evidence that antibiotics can replace by probiotics we conducted transcriptome analysis of spleen in zebrafish 48 h post infection and treatment by Lactococcus lactis post 4h post infection via sequencing.         C1   strain:not applicable|age:not collected|sex:not collected|tissue:spleen|treatment:control|replicate:replicate1|BioSampleModel:Model organism or animal                 RNA seq of Danio rerio C1 C1 control group     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA Illumina NovaSeq 6000   SRP405990     C1.R1.fastq.gz C1.R2.fastq.gz fastq fastq 6218689172.0 20591686.0 C1.R1.fastq.gz 0:151 1:151 A:1651743119;C:1444992966;G:1490934383;T:1630891482;N:127222 151 151     1651743119 1444992966 1490934383 1630891482 127222 SRX18142566 SRS15644030 SRA1532870 Kunming University of Science and Technology|Faculty of Life Science and Technology Kunming University of Science and Technology 2 0.93571 0.93627 0.03427 0.0346 0.73336 0.73401 0.47064 0.47601 151 151 B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk unknown unknown   China 2022-11-02 Undetermined Undetermined Spleen Hematopoietic System
71975 71975 SRR22163685 SRX18142565 SRS15644029 SRP405990 PRJNA897077 Transcriptome of zebrafish Danio rerio PRJNA897077 Other Zebrafish Danio rerio have been used as a model organism to study innate immune system and hostpathogen interactions. Until now the information related to the immune system against A. hydrophila of zebrafish and the treatment by probiotics is incomplete. To increase knowledge of the molecular mechanisms of the host defense against A. hydrophila and provide evidence that antibiotics can replace by probiotics we conducted transcriptome analysis of spleen in zebrafish 48 h post infection and treatment by Lactococcus lactis post 4h post infection via sequencing.         B3   strain:not applicable|age:not collected|sex:not collected|tissue:spleen|treatment:challenge|replicate:replicate3|BioSampleModel:Model organism or animal                 RNA seq of Danio rerio B3 B3 challenge group     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA Illumina NovaSeq 6000   SRP405990     B3.R1.fastq.gz B3.R2.fastq.gz fastq fastq 7958268062.0 26351881.0 B3.R1.fastq.gz 0:151 1:151 A:2067039750;C:1894612680;G:1943559820;T:2052891379;N:164433 151 151     2067039750 1894612680 1943559820 2052891379 164433 SRX18142565 SRS15644029 SRA1532870 Kunming University of Science and Technology|Faculty of Life Science and Technology Kunming University of Science and Technology 2 0.93754 0.93809 0.03309 0.03347 0.71762 0.71731 0.49012 0.4888 151 151 B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk unknown unknown   China 2022-11-02 Undetermined Undetermined Spleen Hematopoietic System

Next page

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;