metadata: run_metadata: 130 rows where devstage_curation = "Undetermined" and tissue

130 rows where devstage_curation = "Undetermined" and tissue_curation = "Gonad"

descending

Link	rowid ▼	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.description	sample.title	sample.alias	sample.centername	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.spot_descriptor	experiment.study_ref	run.title	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.mapping_rate.mate2	seqdetective.nofeature_rate.mate1	seqdetective.nofeature_rate.mate2	seqdetective.sparsity.mate1	seqdetective.sparsity.mate2	seqdetective.pos_strand_rate.mate1	seqdetective.pos_strand_rate.mate2	seqdetective.readlen.mate1	seqdetective.readlen.mate2	seqdetective.judgement.mate1	seqdetective.judgement.mate2	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
5793	5793	ERR1955208	ERX2020800	ERS1697077	ERP017053	PRJEB15333	Transposon driven transcription is a conserved feature of vertebrate spermatogenesis and transcript evolution	ena-STUDY-EMBL EUROPEAN BIOINFORMATICS INSTITUTE-07-09-2016-10:25:55:499-247	Other	In order to better understand the features associated with male germline transcription we profiled the RNA expression in a number of germline cell types. These include spermatogonial stem cells spermatocytes and round spermatids in mouse and spermatocytes in rat. We also profiled the transcription in zebrafish testes. As a consequence it became apparent that transposable elements are driving considerable lncRNA expression in the later stages of spermatogenesis. This is particularly apparent in the case of endogenous retroviruses in rodents.	ENA FIRST PUBLIC:2017 01 31\|ENA LAST UPDATE:2017 05 08			Transcriptional profiling of zebrafish testes for analysis of conserved repeat element associations	SAMEA104033184	EMBL EUROPEAN BIOINFORMATICS INSTITUTE	ENA FIRST PUBLIC:2017 05 10T17:01:28Z\|ENA LAST UPDATE:2017 04 28T10:34:37Z\|External Id:SAMEA104033184\|INSDC center name:EMBL EUROPEAN BIOINFORMATICS INSTITUTE\|INSDC first public:2017 05 10T17:01:28Z\|INSDC last update:2017 04 28T10:34:37Z\|INSDC status:public\|Submitter Id:Zebrafish.Testis 2\|common name:zebrafish\|sample name:Zebrafish.Testis 2\|scientific name:Danio rerio\|strain:AB\|tissue type:testis									Illumina HiSeq 2000 paired end sequencing	ena EXPERIMENT EMBL EUROPEAN BIOINFORMATICS INSTITUTE 03 05 2017 17:32:41:660 16	unspecified	1			RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000		ERP017053	Illumina HiSeq 2000 paired end sequencing	ENA FIRST PUBLIC:2017 05 10\|ENA LAST UPDATE:2018 11 16	zebrafish_testis_2.conserved.1.fastq.gz zebrafish_testis_2.conserved.2.fastq.gz	fastq fastq	46555372886.0	230472143.0	ena RUN EMBL EUROPEAN BIOINFORMATICS INSTITUTE 03 05 2017 17:32:41:660 16	0:101 1:101	A:12260062264;C:10888457642;G:11605642683;T:11637267744;N:163942553	101	101	12260062264	10888457642	11605642683	11637267744	163942553	ERX2020800	ERS1697077	ERA904389	EMBL EUROPEAN BIOINFORMATICS INSTITUTE\|European Nucleotide Archive	EMBL EUROPEAN BIOINFORMATICS INSTITUTE	2	0.93165	0.92785	0.29822	0.32141	0.71386	0.71971	0.66173	0.63843	101	101	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	United Kingdom	2017-01-31	Undetermined	Undetermined	Gonad	Reproductive System
5794	5794	ERR1955207	ERX2020799	ERS1697076	ERP017053	PRJEB15333	Transposon driven transcription is a conserved feature of vertebrate spermatogenesis and transcript evolution	ena-STUDY-EMBL EUROPEAN BIOINFORMATICS INSTITUTE-07-09-2016-10:25:55:499-247	Other	In order to better understand the features associated with male germline transcription we profiled the RNA expression in a number of germline cell types. These include spermatogonial stem cells spermatocytes and round spermatids in mouse and spermatocytes in rat. We also profiled the transcription in zebrafish testes. As a consequence it became apparent that transposable elements are driving considerable lncRNA expression in the later stages of spermatogenesis. This is particularly apparent in the case of endogenous retroviruses in rodents.	ENA FIRST PUBLIC:2017 01 31\|ENA LAST UPDATE:2017 05 08			Transcriptional profiling of zebrafish testes for analysis of conserved repeat element associations	SAMEA104033183	EMBL EUROPEAN BIOINFORMATICS INSTITUTE	ENA FIRST PUBLIC:2017 05 10T17:01:28Z\|ENA LAST UPDATE:2017 04 28T10:34:37Z\|External Id:SAMEA104033183\|INSDC center name:EMBL EUROPEAN BIOINFORMATICS INSTITUTE\|INSDC first public:2017 05 10T17:01:28Z\|INSDC last update:2017 04 28T10:34:37Z\|INSDC status:public\|Submitter Id:Zebrafish.Testis 1\|common name:zebrafish\|sample name:Zebrafish.Testis 1\|scientific name:Danio rerio\|strain:AB\|tissue type:testis									Illumina HiSeq 2000 paired end sequencing	ena EXPERIMENT EMBL EUROPEAN BIOINFORMATICS INSTITUTE 03 05 2017 17:32:41:660 15	unspecified	1			RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000		ERP017053	Illumina HiSeq 2000 paired end sequencing	ENA FIRST PUBLIC:2017 05 10\|ENA LAST UPDATE:2018 11 16	zebrafish_testis_1.conserved.1.fastq.gz zebrafish_testis_1.conserved.2.fastq.gz	fastq fastq	41056086708.0	203247954.0	ena RUN EMBL EUROPEAN BIOINFORMATICS INSTITUTE 03 05 2017 17:32:41:660 15	0:101 1:101	A:10675591750;C:9672762387;G:10139834713;T:10380949257;N:186948601	101	101	10675591750	9672762387	10139834713	10380949257	186948601	ERX2020799	ERS1697076	ERA904389	EMBL EUROPEAN BIOINFORMATICS INSTITUTE\|European Nucleotide Archive	EMBL EUROPEAN BIOINFORMATICS INSTITUTE	2	0.92308	0.9157	0.30221	0.31293	0.68276	0.68836	0.56114	0.5857	101	101	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	United Kingdom	2017-01-31	Undetermined	Undetermined	Gonad	Reproductive System
24594	24594	SRR25462243	SRX21195038	SRS18453964	SRP452269	PRJNA1000446	Genetic Evidence for the Gatekeeping Role of Ybx1 in Controlling Follicle Activation and Early Folliculogenesis by Regulation of Cdkn1a in the Zebrafish	GSE239623	Transcriptome Analysis	Y box binding protein 1 YB 1; Ybx1/ybx1 regulates transcription and translation of targeted genes by DNA/RNA binding. Our previous proteomic study demonstrated a dramatic drop in Ybx1 protein during follicle activation in zebrafish ovary. In this study we created an ybx1 mutant with CRISPR/Cas9 and showed that the folliculogenesis in the mutant ovary ybx1 / was blocked at pre vitellogenic PV to early vitellogenic EV transition leading to small ovaries. The mutant females were therefore sub fertile with reduced fecundity. RNA seq and Western blot analyses identified a variety of genes that showed differential expression between mutant ovary ybx1 / and the control ybx1+/ including cdkn1a p21. Disruption of cdkn1a resulted in embryonic lethality. In p21 heterozygous cdkn1a+/ however follicle activation and maturation in the ovary were both enhanced in contrast to ybx1 mutant ybx1 / . Interestingly partial loss of p21 in heterozygous cdkn1a+/ could rescue the phenotype of ybx1 mutant ybx1 / . Folliculogenesis resumed in ybx1 / ;p21+/ females with normal follicle activation in contrast to the PV EV blockade in ybx1 / mutant. Interestingly the follicle cells from the ybx1 / mutant follicles displayed a poor proliferative activity in vitro; however the cells from the ybx1 / p21+/ follicles resumed normal proliferation compared to that from the wildtype fish. In summary we demonstrated in this study that Ybx1 played a gatekeeping role in controlling PV to EV transition and it might act by suppressing the expression of cdkn1a a cell cycle inhibitor. Overall design: Considering our histological PV to EV follicle blockade we further isolated PV follicles from both WT ybx1+/+ and ybx1 / zebrafish. post RNA isolation we then estbalished bulk RNAseq libraries according to NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. post libraries preparation we performed sequencing using the Genomics Bioinformatics and Single Cell Analysis Core at the Univerisity of Macau.				PV M3	GSM7669033		source name:follicle\|strain:AB\|tissue:follicle\|developmental stage:pre vitellogenin\|genotype:MT ybx1 / \|geo loc name:missing\|collection date:missing	PV M3	Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Zebrafish genome version GRCz11 from Ensemble using HiSat2 Stringtie was used to estimate transcript level counts. Bioconductor package tximport was used to import the gene level read counts from StringTie output files. This raw counts data was analyzed for differential gene expression using DESeq2 package. Assembly: GRCz11 Supplementary files format and content: Raw read counts in a TAB delimited file Supplementary files format and content: DESeq2 normalized read counts in a TAB delimited file	follicle		TRIzol reagent for RNA extraction NEBNext Ultra II Directional RNA Library Prep Kit for Illumina		strain:AB\|tissue:follicle\|developmental stage:pre vitellogenin\|genotype:MT ybx1 /	GSM7669033	GSM7669033: PV M3; Danio rerio; RNA Seq	GSM7669033 r1	GSM7669033	1	TRIzol reagent for RNA extraction NEBNext Ultra II Directional RNA Library Prep Kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP452269			PV_M3_R1.fastq.gz PV_M3_R2.fastq.gz	fastq fastq	4644457090.0	23465750.0	GSM7669033 r1	0:98.98 1:98.94	A:1196567358;C:1114203322;G:1109379777;T:1223156356;N:1150277	98	98	1196567358	1114203322	1109379777	1223156356	1150277	SRX21195038	SRS18453964			Karp 12006A, Biology of Vascular Program, Boston Children's Hospital	2	0.94849	0.95248	0.02727	0.02708	0.73602	0.73718	0.48396	0.4855	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	nebnext	bulk	bulk	bulk	United States	2023-07-31	Undetermined	Embryo	Gonad	Reproductive System
24595	24595	SRR25462244	SRX21195037	SRS18453963	SRP452269	PRJNA1000446	Genetic Evidence for the Gatekeeping Role of Ybx1 in Controlling Follicle Activation and Early Folliculogenesis by Regulation of Cdkn1a in the Zebrafish	GSE239623	Transcriptome Analysis	Y box binding protein 1 YB 1; Ybx1/ybx1 regulates transcription and translation of targeted genes by DNA/RNA binding. Our previous proteomic study demonstrated a dramatic drop in Ybx1 protein during follicle activation in zebrafish ovary. In this study we created an ybx1 mutant with CRISPR/Cas9 and showed that the folliculogenesis in the mutant ovary ybx1 / was blocked at pre vitellogenic PV to early vitellogenic EV transition leading to small ovaries. The mutant females were therefore sub fertile with reduced fecundity. RNA seq and Western blot analyses identified a variety of genes that showed differential expression between mutant ovary ybx1 / and the control ybx1+/ including cdkn1a p21. Disruption of cdkn1a resulted in embryonic lethality. In p21 heterozygous cdkn1a+/ however follicle activation and maturation in the ovary were both enhanced in contrast to ybx1 mutant ybx1 / . Interestingly partial loss of p21 in heterozygous cdkn1a+/ could rescue the phenotype of ybx1 mutant ybx1 / . Folliculogenesis resumed in ybx1 / ;p21+/ females with normal follicle activation in contrast to the PV EV blockade in ybx1 / mutant. Interestingly the follicle cells from the ybx1 / mutant follicles displayed a poor proliferative activity in vitro; however the cells from the ybx1 / p21+/ follicles resumed normal proliferation compared to that from the wildtype fish. In summary we demonstrated in this study that Ybx1 played a gatekeeping role in controlling PV to EV transition and it might act by suppressing the expression of cdkn1a a cell cycle inhibitor. Overall design: Considering our histological PV to EV follicle blockade we further isolated PV follicles from both WT ybx1+/+ and ybx1 / zebrafish. post RNA isolation we then estbalished bulk RNAseq libraries according to NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. post libraries preparation we performed sequencing using the Genomics Bioinformatics and Single Cell Analysis Core at the Univerisity of Macau.				PV M2	GSM7669032		source name:follicle\|strain:AB\|tissue:follicle\|developmental stage:pre vitellogenin\|genotype:MT ybx1 / \|geo loc name:missing\|collection date:missing	PV M2	Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Zebrafish genome version GRCz11 from Ensemble using HiSat2 Stringtie was used to estimate transcript level counts. Bioconductor package tximport was used to import the gene level read counts from StringTie output files. This raw counts data was analyzed for differential gene expression using DESeq2 package. Assembly: GRCz11 Supplementary files format and content: Raw read counts in a TAB delimited file Supplementary files format and content: DESeq2 normalized read counts in a TAB delimited file	follicle		TRIzol reagent for RNA extraction NEBNext Ultra II Directional RNA Library Prep Kit for Illumina		strain:AB\|tissue:follicle\|developmental stage:pre vitellogenin\|genotype:MT ybx1 /	GSM7669032	GSM7669032: PV M2; Danio rerio; RNA Seq	GSM7669032 r1	GSM7669032	1	TRIzol reagent for RNA extraction NEBNext Ultra II Directional RNA Library Prep Kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP452269			PV_M2_R1.fastq.gz PV_M2_R2.fastq.gz	fastq fastq	2464506276.0	12449948.0	GSM7669032 r1	0:98.99 1:98.96	A:632587002;C:593372099;G:591579950;T:646214108;N:753117	98	98	632587002	593372099	591579950	646214108	753117	SRX21195037	SRS18453963			Karp 12006A, Biology of Vascular Program, Boston Children's Hospital	2	0.94889	0.9522	0.02585	0.02585	0.73669	0.73841	0.48398	0.48486	100	99	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	nebnext	bulk	bulk	bulk	United States	2023-07-31	Undetermined	Embryo	Gonad	Reproductive System
24596	24596	SRR25462245	SRX21195036	SRS18453962	SRP452269	PRJNA1000446	Genetic Evidence for the Gatekeeping Role of Ybx1 in Controlling Follicle Activation and Early Folliculogenesis by Regulation of Cdkn1a in the Zebrafish	GSE239623	Transcriptome Analysis	Y box binding protein 1 YB 1; Ybx1/ybx1 regulates transcription and translation of targeted genes by DNA/RNA binding. Our previous proteomic study demonstrated a dramatic drop in Ybx1 protein during follicle activation in zebrafish ovary. In this study we created an ybx1 mutant with CRISPR/Cas9 and showed that the folliculogenesis in the mutant ovary ybx1 / was blocked at pre vitellogenic PV to early vitellogenic EV transition leading to small ovaries. The mutant females were therefore sub fertile with reduced fecundity. RNA seq and Western blot analyses identified a variety of genes that showed differential expression between mutant ovary ybx1 / and the control ybx1+/ including cdkn1a p21. Disruption of cdkn1a resulted in embryonic lethality. In p21 heterozygous cdkn1a+/ however follicle activation and maturation in the ovary were both enhanced in contrast to ybx1 mutant ybx1 / . Interestingly partial loss of p21 in heterozygous cdkn1a+/ could rescue the phenotype of ybx1 mutant ybx1 / . Folliculogenesis resumed in ybx1 / ;p21+/ females with normal follicle activation in contrast to the PV EV blockade in ybx1 / mutant. Interestingly the follicle cells from the ybx1 / mutant follicles displayed a poor proliferative activity in vitro; however the cells from the ybx1 / p21+/ follicles resumed normal proliferation compared to that from the wildtype fish. In summary we demonstrated in this study that Ybx1 played a gatekeeping role in controlling PV to EV transition and it might act by suppressing the expression of cdkn1a a cell cycle inhibitor. Overall design: Considering our histological PV to EV follicle blockade we further isolated PV follicles from both WT ybx1+/+ and ybx1 / zebrafish. post RNA isolation we then estbalished bulk RNAseq libraries according to NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. post libraries preparation we performed sequencing using the Genomics Bioinformatics and Single Cell Analysis Core at the Univerisity of Macau.				PV M1	GSM7669031		source name:follicle\|strain:AB\|tissue:follicle\|developmental stage:pre vitellogenin\|genotype:MT ybx1 / \|geo loc name:missing\|collection date:missing	PV M1	Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Zebrafish genome version GRCz11 from Ensemble using HiSat2 Stringtie was used to estimate transcript level counts. Bioconductor package tximport was used to import the gene level read counts from StringTie output files. This raw counts data was analyzed for differential gene expression using DESeq2 package. Assembly: GRCz11 Supplementary files format and content: Raw read counts in a TAB delimited file Supplementary files format and content: DESeq2 normalized read counts in a TAB delimited file	follicle		TRIzol reagent for RNA extraction NEBNext Ultra II Directional RNA Library Prep Kit for Illumina		strain:AB\|tissue:follicle\|developmental stage:pre vitellogenin\|genotype:MT ybx1 /	GSM7669031	GSM7669031: PV M1; Danio rerio; RNA Seq	GSM7669031 r1	GSM7669031	1	TRIzol reagent for RNA extraction NEBNext Ultra II Directional RNA Library Prep Kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP452269			PV_M1_R1.fastq.gz PV_M1_R2.fastq.gz	fastq fastq	3634173229.0	18461903.0	GSM7669031 r1	0:98.44 1:98.41	A:930322973;C:875929476;G:875710056;T:948595199;N:3615525	98	98	930322973	875929476	875710056	948595199	3615525	SRX21195036	SRS18453962			Karp 12006A, Biology of Vascular Program, Boston Children's Hospital	2	0.94787	0.95134	0.02457	0.02445	0.73762	0.73843	0.48244	0.48069	100	98	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	nebnext	bulk	bulk	bulk	United States	2023-07-31	Undetermined	Embryo	Gonad	Reproductive System
24597	24597	SRR25462246	SRX21195035	SRS18453961	SRP452269	PRJNA1000446	Genetic Evidence for the Gatekeeping Role of Ybx1 in Controlling Follicle Activation and Early Folliculogenesis by Regulation of Cdkn1a in the Zebrafish	GSE239623	Transcriptome Analysis	Y box binding protein 1 YB 1; Ybx1/ybx1 regulates transcription and translation of targeted genes by DNA/RNA binding. Our previous proteomic study demonstrated a dramatic drop in Ybx1 protein during follicle activation in zebrafish ovary. In this study we created an ybx1 mutant with CRISPR/Cas9 and showed that the folliculogenesis in the mutant ovary ybx1 / was blocked at pre vitellogenic PV to early vitellogenic EV transition leading to small ovaries. The mutant females were therefore sub fertile with reduced fecundity. RNA seq and Western blot analyses identified a variety of genes that showed differential expression between mutant ovary ybx1 / and the control ybx1+/ including cdkn1a p21. Disruption of cdkn1a resulted in embryonic lethality. In p21 heterozygous cdkn1a+/ however follicle activation and maturation in the ovary were both enhanced in contrast to ybx1 mutant ybx1 / . Interestingly partial loss of p21 in heterozygous cdkn1a+/ could rescue the phenotype of ybx1 mutant ybx1 / . Folliculogenesis resumed in ybx1 / ;p21+/ females with normal follicle activation in contrast to the PV EV blockade in ybx1 / mutant. Interestingly the follicle cells from the ybx1 / mutant follicles displayed a poor proliferative activity in vitro; however the cells from the ybx1 / p21+/ follicles resumed normal proliferation compared to that from the wildtype fish. In summary we demonstrated in this study that Ybx1 played a gatekeeping role in controlling PV to EV transition and it might act by suppressing the expression of cdkn1a a cell cycle inhibitor. Overall design: Considering our histological PV to EV follicle blockade we further isolated PV follicles from both WT ybx1+/+ and ybx1 / zebrafish. post RNA isolation we then estbalished bulk RNAseq libraries according to NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. post libraries preparation we performed sequencing using the Genomics Bioinformatics and Single Cell Analysis Core at the Univerisity of Macau.				PV WT3	GSM7669030		source name:follicle\|strain:AB\|tissue:follicle\|developmental stage:pre vitellogenin\|genotype:WT ybx1+/+\|geo loc name:missing\|collection date:missing	PV WT3	Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Zebrafish genome version GRCz11 from Ensemble using HiSat2 Stringtie was used to estimate transcript level counts. Bioconductor package tximport was used to import the gene level read counts from StringTie output files. This raw counts data was analyzed for differential gene expression using DESeq2 package. Assembly: GRCz11 Supplementary files format and content: Raw read counts in a TAB delimited file Supplementary files format and content: DESeq2 normalized read counts in a TAB delimited file	follicle		TRIzol reagent for RNA extraction NEBNext Ultra II Directional RNA Library Prep Kit for Illumina		strain:AB\|tissue:follicle\|developmental stage:pre vitellogenin\|genotype:WT ybx1+/+	GSM7669030	GSM7669030: PV WT3; Danio rerio; RNA Seq	GSM7669030 r1	GSM7669030	1	TRIzol reagent for RNA extraction NEBNext Ultra II Directional RNA Library Prep Kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP452269			PV_WT3_R2.fastq PV_WT3_R1.fastq	fastq fastq	2965772270.0	14976621.0	GSM7669030 r1	0:99.03 1:98.99	A:759343389;C:716154246;G:713466520;T:775995980;N:812135	99	98	759343389	716154246	713466520	775995980	812135	SRX21195035	SRS18453961			Karp 12006A, Biology of Vascular Program, Boston Children's Hospital	2	0.95027	0.95485	0.02356	0.02292	0.74422	0.74554	0.47974	0.48267	100	98	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	nebnext	bulk	bulk	bulk	United States	2023-07-31	Undetermined	Embryo	Gonad	Reproductive System
24598	24598	SRR25462247	SRX21195034	SRS18453960	SRP452269	PRJNA1000446	Genetic Evidence for the Gatekeeping Role of Ybx1 in Controlling Follicle Activation and Early Folliculogenesis by Regulation of Cdkn1a in the Zebrafish	GSE239623	Transcriptome Analysis	Y box binding protein 1 YB 1; Ybx1/ybx1 regulates transcription and translation of targeted genes by DNA/RNA binding. Our previous proteomic study demonstrated a dramatic drop in Ybx1 protein during follicle activation in zebrafish ovary. In this study we created an ybx1 mutant with CRISPR/Cas9 and showed that the folliculogenesis in the mutant ovary ybx1 / was blocked at pre vitellogenic PV to early vitellogenic EV transition leading to small ovaries. The mutant females were therefore sub fertile with reduced fecundity. RNA seq and Western blot analyses identified a variety of genes that showed differential expression between mutant ovary ybx1 / and the control ybx1+/ including cdkn1a p21. Disruption of cdkn1a resulted in embryonic lethality. In p21 heterozygous cdkn1a+/ however follicle activation and maturation in the ovary were both enhanced in contrast to ybx1 mutant ybx1 / . Interestingly partial loss of p21 in heterozygous cdkn1a+/ could rescue the phenotype of ybx1 mutant ybx1 / . Folliculogenesis resumed in ybx1 / ;p21+/ females with normal follicle activation in contrast to the PV EV blockade in ybx1 / mutant. Interestingly the follicle cells from the ybx1 / mutant follicles displayed a poor proliferative activity in vitro; however the cells from the ybx1 / p21+/ follicles resumed normal proliferation compared to that from the wildtype fish. In summary we demonstrated in this study that Ybx1 played a gatekeeping role in controlling PV to EV transition and it might act by suppressing the expression of cdkn1a a cell cycle inhibitor. Overall design: Considering our histological PV to EV follicle blockade we further isolated PV follicles from both WT ybx1+/+ and ybx1 / zebrafish. post RNA isolation we then estbalished bulk RNAseq libraries according to NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. post libraries preparation we performed sequencing using the Genomics Bioinformatics and Single Cell Analysis Core at the Univerisity of Macau.				PV WT2	GSM7669029		source name:follicle\|strain:AB\|tissue:follicle\|developmental stage:pre vitellogenin\|genotype:WT ybx1+/+\|geo loc name:missing\|collection date:missing	PV WT2	Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Zebrafish genome version GRCz11 from Ensemble using HiSat2 Stringtie was used to estimate transcript level counts. Bioconductor package tximport was used to import the gene level read counts from StringTie output files. This raw counts data was analyzed for differential gene expression using DESeq2 package. Assembly: GRCz11 Supplementary files format and content: Raw read counts in a TAB delimited file Supplementary files format and content: DESeq2 normalized read counts in a TAB delimited file	follicle		TRIzol reagent for RNA extraction NEBNext Ultra II Directional RNA Library Prep Kit for Illumina		strain:AB\|tissue:follicle\|developmental stage:pre vitellogenin\|genotype:WT ybx1+/+	GSM7669029	GSM7669029: PV WT2; Danio rerio; RNA Seq	GSM7669029 r1	GSM7669029	1	TRIzol reagent for RNA extraction NEBNext Ultra II Directional RNA Library Prep Kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP452269			PV_WT2_R2.fastq PV_WT2_R1.fastq	fastq fastq	2021387268.0	10195384.0	GSM7669029 r1	0:99.15 1:99.12	A:517788644;C:487363563;G:485168383;T:530550229;N:516449	99	99	517788644	487363563	485168383	530550229	516449	SRX21195034	SRS18453960			Karp 12006A, Biology of Vascular Program, Boston Children's Hospital	2	0.95113	0.9544	0.02394	0.02364	0.74168	0.74363	0.47881	0.47499	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	nebnext	bulk	bulk	bulk	United States	2023-07-31	Undetermined	Embryo	Gonad	Reproductive System
24599	24599	SRR25462248	SRX21195033	SRS18453959	SRP452269	PRJNA1000446	Genetic Evidence for the Gatekeeping Role of Ybx1 in Controlling Follicle Activation and Early Folliculogenesis by Regulation of Cdkn1a in the Zebrafish	GSE239623	Transcriptome Analysis	Y box binding protein 1 YB 1; Ybx1/ybx1 regulates transcription and translation of targeted genes by DNA/RNA binding. Our previous proteomic study demonstrated a dramatic drop in Ybx1 protein during follicle activation in zebrafish ovary. In this study we created an ybx1 mutant with CRISPR/Cas9 and showed that the folliculogenesis in the mutant ovary ybx1 / was blocked at pre vitellogenic PV to early vitellogenic EV transition leading to small ovaries. The mutant females were therefore sub fertile with reduced fecundity. RNA seq and Western blot analyses identified a variety of genes that showed differential expression between mutant ovary ybx1 / and the control ybx1+/ including cdkn1a p21. Disruption of cdkn1a resulted in embryonic lethality. In p21 heterozygous cdkn1a+/ however follicle activation and maturation in the ovary were both enhanced in contrast to ybx1 mutant ybx1 / . Interestingly partial loss of p21 in heterozygous cdkn1a+/ could rescue the phenotype of ybx1 mutant ybx1 / . Folliculogenesis resumed in ybx1 / ;p21+/ females with normal follicle activation in contrast to the PV EV blockade in ybx1 / mutant. Interestingly the follicle cells from the ybx1 / mutant follicles displayed a poor proliferative activity in vitro; however the cells from the ybx1 / p21+/ follicles resumed normal proliferation compared to that from the wildtype fish. In summary we demonstrated in this study that Ybx1 played a gatekeeping role in controlling PV to EV transition and it might act by suppressing the expression of cdkn1a a cell cycle inhibitor. Overall design: Considering our histological PV to EV follicle blockade we further isolated PV follicles from both WT ybx1+/+ and ybx1 / zebrafish. post RNA isolation we then estbalished bulk RNAseq libraries according to NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. post libraries preparation we performed sequencing using the Genomics Bioinformatics and Single Cell Analysis Core at the Univerisity of Macau.				PV WT1	GSM7669028		source name:follicle\|strain:AB\|tissue:follicle\|developmental stage:pre vitellogenin\|genotype:WT ybx1+/+\|geo loc name:missing\|collection date:missing	PV WT1	Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Zebrafish genome version GRCz11 from Ensemble using HiSat2 Stringtie was used to estimate transcript level counts. Bioconductor package tximport was used to import the gene level read counts from StringTie output files. This raw counts data was analyzed for differential gene expression using DESeq2 package. Assembly: GRCz11 Supplementary files format and content: Raw read counts in a TAB delimited file Supplementary files format and content: DESeq2 normalized read counts in a TAB delimited file	follicle		TRIzol reagent for RNA extraction NEBNext Ultra II Directional RNA Library Prep Kit for Illumina		strain:AB\|tissue:follicle\|developmental stage:pre vitellogenin\|genotype:WT ybx1+/+	GSM7669028	GSM7669028: PV WT1; Danio rerio; RNA Seq	GSM7669028 r1	GSM7669028	1	TRIzol reagent for RNA extraction NEBNext Ultra II Directional RNA Library Prep Kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP452269			PV_WT1_R1.fastq PV_WT1_R2.fastq	fastq fastq	3244660111.0	16481925.0	GSM7669028 r1	0:98.44 1:98.42	A:831426044;C:781489498;G:779991004;T:848549246;N:3204319	98	98	831426044	781489498	779991004	848549246	3204319	SRX21195033	SRS18453959			Karp 12006A, Biology of Vascular Program, Boston Children's Hospital	2	0.94779	0.95185	0.02328	0.02298	0.74294	0.74391	0.48052	0.47966	95	95	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	nebnext	bulk	bulk	bulk	United States	2023-07-31	Undetermined	Embryo	Gonad	Reproductive System
25267	25267	SRR25744342	SRX21467662	SRS18702380	SRP456724	PRJNA1008624	RNA seq of female gonads isolated from juvenile eif4e1b mutant and wild type zebrafish	GSE241537	Transcriptome Analysis	The mRNA cap binding protein eIF4E1b is critical for female germline development in zebrafish. To study the effect of eIF4E1b loss in zebrafish we isolated gonads with a high expression of ziwi:GFP female germline marker from wild type and eif4e1b mutant juveniles and performed RNA seq. Overall design: We performed differential expression gene analyses of wild type and eif4e1b mutant gonads n = 3 biological replicates containing 3 gonads each		pubmed:38177902		Gonad eif4e1b 3	GSM7730282		source name:Ovary\|tissue:Ovary\|Sex:female\|cell type:Gonad\|genotype:tgziwi:GFP eif4e1b / \|geo loc name:missing\|collection date:missing	Gonad eif4e1b 3	RNA seq reads were trimmed using trim galore v0.5.0 and reads mapping to abundant sequences Dr mitochondrial chromosome SILVA Dr ribosomal RNA phiX174 genome were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c and reads in genes were counted with featureCounts subread v1.6.2. Differential gene expression analysis on raw counts and variance stabilized transformation of count data for heatmap visualization were performed using DESeq2 v1.18.1. Functional annotation enrichment analysis of differentially expressed genes was conducted using clusterprofiler v3.6.0 in R v3.4.1. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files with per gene read counts	Ovary		RNeasy Mini Kit Qiagen SMARTerStrandedRNA library Ribo Zero		tissue:Ovary\|Sex:female\|cell type:Gonad\|genotype:tgziwi:GFP eif4e1b /	GSM7730282	GSM7730282: Gonad eif4e1b 3; Danio rerio; ssRNA seq	GSM7730282 r1	GSM7730282	1	RNeasy Mini Kit Qiagen SMARTerStrandedRNA library Ribo Zero		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP456724		loader:fastq load.py	Ovary_HOM3_1.fastq.gz Ovary_HOM3_2.fastq.gz	fastq fastq	2170738056.0	10746228.0	GSM7730282 r1	0:101 1:101	A:531993767;C:520631008;G:565772072;T:552334154;N:7055	101	101	531993767	520631008	565772072	552334154	7055	SRX21467662	SRS18702380	SRA1698764	IMP	IMP	2	0.77665	0.7702	0.14988	0.14284	0.66716	0.66957	0.49991	0.47425	101	101	B	B	biological fallback assumption	illumina	novaseq_era	full_length	rrna_depletion	ribozero	bulk	unknown	unknown	Austria	2023-08-23	Undetermined	Juvenile	Gonad	Reproductive System
25268	25268	SRR25744343	SRX21467661	SRS18702379	SRP456724	PRJNA1008624	RNA seq of female gonads isolated from juvenile eif4e1b mutant and wild type zebrafish	GSE241537	Transcriptome Analysis	The mRNA cap binding protein eIF4E1b is critical for female germline development in zebrafish. To study the effect of eIF4E1b loss in zebrafish we isolated gonads with a high expression of ziwi:GFP female germline marker from wild type and eif4e1b mutant juveniles and performed RNA seq. Overall design: We performed differential expression gene analyses of wild type and eif4e1b mutant gonads n = 3 biological replicates containing 3 gonads each		pubmed:38177902		Gonad eif4e1b 2	GSM7730281		source name:Ovary\|tissue:Ovary\|Sex:female\|cell type:Gonad\|genotype:tgziwi:GFP eif4e1b / \|geo loc name:missing\|collection date:missing	Gonad eif4e1b 2	RNA seq reads were trimmed using trim galore v0.5.0 and reads mapping to abundant sequences Dr mitochondrial chromosome SILVA Dr ribosomal RNA phiX174 genome were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c and reads in genes were counted with featureCounts subread v1.6.2. Differential gene expression analysis on raw counts and variance stabilized transformation of count data for heatmap visualization were performed using DESeq2 v1.18.1. Functional annotation enrichment analysis of differentially expressed genes was conducted using clusterprofiler v3.6.0 in R v3.4.1. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files with per gene read counts	Ovary		RNeasy Mini Kit Qiagen SMARTerStrandedRNA library Ribo Zero		tissue:Ovary\|Sex:female\|cell type:Gonad\|genotype:tgziwi:GFP eif4e1b /	GSM7730281	GSM7730281: Gonad eif4e1b 2; Danio rerio; ssRNA seq	GSM7730281 r1	GSM7730281	1	RNeasy Mini Kit Qiagen SMARTerStrandedRNA library Ribo Zero		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP456724		loader:fastq load.py	Ovary_HOM2_1.fastq.gz Ovary_HOM2_2.fastq.gz	fastq fastq	3459149000.0	17124500.0	GSM7730281 r1	0:101 1:101	A:876732239;C:796603142;G:882912604;T:902886783;N:14232	101	101	876732239	796603142	882912604	902886783	14232	SRX21467661	SRS18702379	SRA1698764	IMP	IMP	2	0.81761	0.79589	0.26282	0.24746	0.70607	0.7039	0.50658	0.49236	101	101	B	B	biological fallback assumption	illumina	novaseq_era	full_length	rrna_depletion	ribozero	bulk	unknown	unknown	Austria	2023-08-23	Undetermined	Juvenile	Gonad	Reproductive System
25269	25269	SRR25744344	SRX21467660	SRS18702381	SRP456724	PRJNA1008624	RNA seq of female gonads isolated from juvenile eif4e1b mutant and wild type zebrafish	GSE241537	Transcriptome Analysis	The mRNA cap binding protein eIF4E1b is critical for female germline development in zebrafish. To study the effect of eIF4E1b loss in zebrafish we isolated gonads with a high expression of ziwi:GFP female germline marker from wild type and eif4e1b mutant juveniles and performed RNA seq. Overall design: We performed differential expression gene analyses of wild type and eif4e1b mutant gonads n = 3 biological replicates containing 3 gonads each		pubmed:38177902		Gonad eif4e1b 1	GSM7730280		source name:Ovary\|tissue:Ovary\|Sex:female\|cell type:Gonad\|genotype:tgziwi:GFP eif4e1b / \|geo loc name:missing\|collection date:missing	Gonad eif4e1b 1	RNA seq reads were trimmed using trim galore v0.5.0 and reads mapping to abundant sequences Dr mitochondrial chromosome SILVA Dr ribosomal RNA phiX174 genome were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c and reads in genes were counted with featureCounts subread v1.6.2. Differential gene expression analysis on raw counts and variance stabilized transformation of count data for heatmap visualization were performed using DESeq2 v1.18.1. Functional annotation enrichment analysis of differentially expressed genes was conducted using clusterprofiler v3.6.0 in R v3.4.1. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files with per gene read counts	Ovary		RNeasy Mini Kit Qiagen SMARTerStrandedRNA library Ribo Zero		tissue:Ovary\|Sex:female\|cell type:Gonad\|genotype:tgziwi:GFP eif4e1b /	GSM7730280	GSM7730280: Gonad eif4e1b 1; Danio rerio; ssRNA seq	GSM7730280 r1	GSM7730280	1	RNeasy Mini Kit Qiagen SMARTerStrandedRNA library Ribo Zero		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP456724		loader:fastq load.py	Ovary_HOM1_1.fastq.gz Ovary_HOM1_2.fastq.gz	fastq fastq	2189781202.0	10840501.0	GSM7730280 r1	0:101 1:101	A:537591255;C:525448020;G:568979980;T:557754770;N:7177	101	101	537591255	525448020	568979980	557754770	7177	SRX21467660	SRS18702381	SRA1698764	IMP	IMP	2	0.7459	0.74191	0.15778	0.15291	0.65543	0.65841	0.48578	0.48291	101	101	B	B	biological fallback assumption	illumina	novaseq_era	full_length	rrna_depletion	ribozero	bulk	unknown	unknown	Austria	2023-08-23	Undetermined	Juvenile	Gonad	Reproductive System
25270	25270	SRR25744345	SRX21467659	SRS18702378	SRP456724	PRJNA1008624	RNA seq of female gonads isolated from juvenile eif4e1b mutant and wild type zebrafish	GSE241537	Transcriptome Analysis	The mRNA cap binding protein eIF4E1b is critical for female germline development in zebrafish. To study the effect of eIF4E1b loss in zebrafish we isolated gonads with a high expression of ziwi:GFP female germline marker from wild type and eif4e1b mutant juveniles and performed RNA seq. Overall design: We performed differential expression gene analyses of wild type and eif4e1b mutant gonads n = 3 biological replicates containing 3 gonads each		pubmed:38177902		Gonad WT 3	GSM7730279		source name:Ovary\|tissue:Ovary\|Sex:female\|cell type:Gonad\|genotype:tgziwi:GFP eif4e1b +/+\|geo loc name:missing\|collection date:missing	Gonad WT 3	RNA seq reads were trimmed using trim galore v0.5.0 and reads mapping to abundant sequences Dr mitochondrial chromosome SILVA Dr ribosomal RNA phiX174 genome were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c and reads in genes were counted with featureCounts subread v1.6.2. Differential gene expression analysis on raw counts and variance stabilized transformation of count data for heatmap visualization were performed using DESeq2 v1.18.1. Functional annotation enrichment analysis of differentially expressed genes was conducted using clusterprofiler v3.6.0 in R v3.4.1. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files with per gene read counts	Ovary		RNeasy Mini Kit Qiagen SMARTerStrandedRNA library Ribo Zero		tissue:Ovary\|Sex:female\|cell type:Gonad\|genotype:tgziwi:GFP eif4e1b +/+	GSM7730279	GSM7730279: Gonad WT 3; Danio rerio; ssRNA seq	GSM7730279 r1	GSM7730279	1	RNeasy Mini Kit Qiagen SMARTerStrandedRNA library Ribo Zero		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP456724		loader:fastq load.py	Ovary_WT3_1.fastq.gz Ovary_WT3_2.fastq.gz	fastq fastq	3674041448.0	18188324.0	GSM7730279 r1	0:101 1:101	A:910831144;C:876967044;G:953299105;T:932928913;N:15242	101	101	910831144	876967044	953299105	932928913	15242	SRX21467659	SRS18702378	SRA1698764	IMP	IMP	2	0.89093	0.89038	0.09253	0.09348	0.73892	0.73858	0.47115	0.47218	101	101	B	B	biological fallback assumption	illumina	novaseq_era	full_length	rrna_depletion	ribozero	bulk	unknown	unknown	Austria	2023-08-23	Undetermined	Juvenile	Gonad	Reproductive System
25271	25271	SRR25744346	SRX21467658	SRS18702377	SRP456724	PRJNA1008624	RNA seq of female gonads isolated from juvenile eif4e1b mutant and wild type zebrafish	GSE241537	Transcriptome Analysis	The mRNA cap binding protein eIF4E1b is critical for female germline development in zebrafish. To study the effect of eIF4E1b loss in zebrafish we isolated gonads with a high expression of ziwi:GFP female germline marker from wild type and eif4e1b mutant juveniles and performed RNA seq. Overall design: We performed differential expression gene analyses of wild type and eif4e1b mutant gonads n = 3 biological replicates containing 3 gonads each		pubmed:38177902		Gonad WT 2	GSM7730278		source name:Ovary\|tissue:Ovary\|Sex:female\|cell type:Gonad\|genotype:tgziwi:GFP eif4e1b +/+\|geo loc name:missing\|collection date:missing	Gonad WT 2	RNA seq reads were trimmed using trim galore v0.5.0 and reads mapping to abundant sequences Dr mitochondrial chromosome SILVA Dr ribosomal RNA phiX174 genome were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c and reads in genes were counted with featureCounts subread v1.6.2. Differential gene expression analysis on raw counts and variance stabilized transformation of count data for heatmap visualization were performed using DESeq2 v1.18.1. Functional annotation enrichment analysis of differentially expressed genes was conducted using clusterprofiler v3.6.0 in R v3.4.1. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files with per gene read counts	Ovary		RNeasy Mini Kit Qiagen SMARTerStrandedRNA library Ribo Zero		tissue:Ovary\|Sex:female\|cell type:Gonad\|genotype:tgziwi:GFP eif4e1b +/+	GSM7730278	GSM7730278: Gonad WT 2; Danio rerio; ssRNA seq	GSM7730278 r1	GSM7730278	1	RNeasy Mini Kit Qiagen SMARTerStrandedRNA library Ribo Zero		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP456724		loader:fastq load.py	Ovary_WT2_1.fastq.gz Ovary_WT2_2.fastq.gz	fastq fastq	3024886370.0	14974685.0	GSM7730278 r1	0:101 1:101	A:744374909;C:727299396;G:782294774;T:770904797;N:12494	101	101	744374909	727299396	782294774	770904797	12494	SRX21467658	SRS18702377	SRA1698764	IMP	IMP	2	0.91806	0.91689	0.06949	0.07178	0.74458	0.74474	0.47548	0.47338	101	101	B	B	biological fallback assumption	illumina	novaseq_era	full_length	rrna_depletion	ribozero	bulk	unknown	unknown	Austria	2023-08-23	Undetermined	Juvenile	Gonad	Reproductive System
25272	25272	SRR25744347	SRX21467657	SRS18702376	SRP456724	PRJNA1008624	RNA seq of female gonads isolated from juvenile eif4e1b mutant and wild type zebrafish	GSE241537	Transcriptome Analysis	The mRNA cap binding protein eIF4E1b is critical for female germline development in zebrafish. To study the effect of eIF4E1b loss in zebrafish we isolated gonads with a high expression of ziwi:GFP female germline marker from wild type and eif4e1b mutant juveniles and performed RNA seq. Overall design: We performed differential expression gene analyses of wild type and eif4e1b mutant gonads n = 3 biological replicates containing 3 gonads each		pubmed:38177902		Gonad WT 1	GSM7730277		source name:Ovary\|tissue:Ovary\|Sex:female\|cell type:Gonad\|genotype:tgziwi:GFP eif4e1b +/+\|geo loc name:missing\|collection date:missing	Gonad WT 1	RNA seq reads were trimmed using trim galore v0.5.0 and reads mapping to abundant sequences Dr mitochondrial chromosome SILVA Dr ribosomal RNA phiX174 genome were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c and reads in genes were counted with featureCounts subread v1.6.2. Differential gene expression analysis on raw counts and variance stabilized transformation of count data for heatmap visualization were performed using DESeq2 v1.18.1. Functional annotation enrichment analysis of differentially expressed genes was conducted using clusterprofiler v3.6.0 in R v3.4.1. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files with per gene read counts	Ovary		RNeasy Mini Kit Qiagen SMARTerStrandedRNA library Ribo Zero		tissue:Ovary\|Sex:female\|cell type:Gonad\|genotype:tgziwi:GFP eif4e1b +/+	GSM7730277	GSM7730277: Gonad WT 1; Danio rerio; ssRNA seq	GSM7730277 r1	GSM7730277	1	RNeasy Mini Kit Qiagen SMARTerStrandedRNA library Ribo Zero		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP456724		loader:fastq load.py	Ovary_WT1_2.fastq.gz Ovary_WT1_1.fastq.gz	fastq fastq	3571638356.0	17681378.0	GSM7730277 r1	0:101 1:101	A:876280472;C:856417516;G:935896746;T:903028845;N:14777	101	101	876280472	856417516	935896746	903028845	14777	SRX21467657	SRS18702376	SRA1698764	IMP	IMP	2	0.89559	0.89353	0.09223	0.09423	0.73052	0.73012	0.47772	0.47408	101	101	B	B	biological fallback assumption	illumina	novaseq_era	full_length	rrna_depletion	ribozero	bulk	unknown	unknown	Austria	2023-08-23	Undetermined	Juvenile	Gonad	Reproductive System
30556	30556	SRR27836071	SRX23499420	SRS20351177	SRP487485	PRJNA1072072	Rbpms2 promotes female fate upstream of the nutrient sensing Gator2 complex component Mios	GSE254850	Transcriptome Analysis	Reproductive success relies on proper establishment and maintenance of biological sex. In many animals including mammals the primary gonad is initially ovary in character. We previously showed the RNA binding protein RNAbp Rbpms2 is required for ovary fate in zebrafish. Here we identified Rbpms2 targets in oocytesRbpms2 bound oocyte RNAs; rboRNAs. We identify Rbpms2 as a translational regulator ofrboRNAs which include testis factors and ribosome biogenesis factors. Further genetic analyses indicate that Rbpms2 promotes nucleolar amplification via the mTorc1 signaling pathway specifically through the mTorc1 activating Gap activity towards Rags 2 Gator2 component Missing oocyte Mios. Cumulatively our findings indicate that early gonocytes are in a dual poised bipotential state in which Rbpms2 acts as a binary fate switch. Specifically Rbpms2 represses testis factors and promotes oocyte factors to promote oocyte progression through an essential Gator2 mediated checkpoint thereby integrating regulation of sexual differentiation factors and nutritional availability pathways in zebrafish oogenesis. Overall design: To determine the RNA targets of Rbpms2 we generated wildtype female zebrafish expressing Rbpms2 mApple or mApple alone fusion proteins exclusively in the germline. Immunoprecipitation was performed in 2 adult female ovaries per transgene. Crosslinked and uncrosslinked samples for Rbpms2 mApple expressing fish and crosslined and uncrosslinked samples for mApple expressing fish were sequenced. RNAs found in the Rbpms2 mApple crosslinked and the mApple crosslinked and uncrosslinked datasets that were also present in the Rbpms2 mApple uncrosslinked dataset were excluded. RNAs present only in the uncrosslinked datasets were counted as RNA targets of Rbpms2. To characterize the transcriptional differences of rbpms2 mutants vs wildtype fish prior to sex determination 21 dpf we performed bulk RNA sequencing on n=3 dpf 21 dpf wildtype and n=3 rbpms2 mutant fish. DESeq was then performed for Differential…		pubmed:38898112		Rbpms2 mApple crosslinked SR3	GSM8059038		source name:Gonad\|tissue:Gonad\|cell type:Germline and somatic\|genotype:Wildtype\|geo loc name:missing\|collection date:missing	Rbpms2 mApple crosslinked SR3	Basespace illumina platform was used and reads were mapped using tophate2 aligner. Estimation of reference genes and transcript was done using cufflinks and reads were mapped to the genome GRCz10. Reads were aligned with the TopHat Alignment App. GRCz10 CSV file that compiled includes tracking ids gene loci and FPKMs for each samples CSV files include tracking and gene id gene short name tss id locus and FPKM for each sample	Gonad		RNA was extracted with an Rneasy Mini Kit Qiagen 74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina 20020589		tissue:Gonad\|cell type:Germline and somatic\|genotype:Wildtype	GSM8059038	GSM8059038: Rbpms2 mApple crosslinked SR3; Danio rerio; RNA Seq	GSM8059038 r1	GSM8059038	1	RNA was extracted with an Rneasy Mini Kit Qiagen 74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina 20020589		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP487485			SR-3_S4_L001_R1_001.fastq.gz SR-3_S4_L001_R2_001.fastq.gz	fastq fastq	588252864.0	3949222.0	GSM8059038 r1	0:74.42 1:74.53	A:116383167;C:176622592;G:176850622;T:118306997;N:89486	74	74	116383167	176622592	176850622	118306997	89486	SRX23499420	SRS20351177	SRA1796363	Marlow, CDRB, Icahn School of Medicine Mount Sinai	Marlow, CDRB, Icahn School of Medicine Mount Sinai												B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	trueseq	bulk	bulk	bulk	United States	2024-02-01	Undetermined	Undetermined	Gonad	Reproductive System
30557	30557	SRR27836072	SRX23499419	SRS20351178	SRP487485	PRJNA1072072	Rbpms2 promotes female fate upstream of the nutrient sensing Gator2 complex component Mios	GSE254850	Transcriptome Analysis	Reproductive success relies on proper establishment and maintenance of biological sex. In many animals including mammals the primary gonad is initially ovary in character. We previously showed the RNA binding protein RNAbp Rbpms2 is required for ovary fate in zebrafish. Here we identified Rbpms2 targets in oocytesRbpms2 bound oocyte RNAs; rboRNAs. We identify Rbpms2 as a translational regulator ofrboRNAs which include testis factors and ribosome biogenesis factors. Further genetic analyses indicate that Rbpms2 promotes nucleolar amplification via the mTorc1 signaling pathway specifically through the mTorc1 activating Gap activity towards Rags 2 Gator2 component Missing oocyte Mios. Cumulatively our findings indicate that early gonocytes are in a dual poised bipotential state in which Rbpms2 acts as a binary fate switch. Specifically Rbpms2 represses testis factors and promotes oocyte factors to promote oocyte progression through an essential Gator2 mediated checkpoint thereby integrating regulation of sexual differentiation factors and nutritional availability pathways in zebrafish oogenesis. Overall design: To determine the RNA targets of Rbpms2 we generated wildtype female zebrafish expressing Rbpms2 mApple or mApple alone fusion proteins exclusively in the germline. Immunoprecipitation was performed in 2 adult female ovaries per transgene. Crosslinked and uncrosslinked samples for Rbpms2 mApple expressing fish and crosslined and uncrosslinked samples for mApple expressing fish were sequenced. RNAs found in the Rbpms2 mApple crosslinked and the mApple crosslinked and uncrosslinked datasets that were also present in the Rbpms2 mApple uncrosslinked dataset were excluded. RNAs present only in the uncrosslinked datasets were counted as RNA targets of Rbpms2. To characterize the transcriptional differences of rbpms2 mutants vs wildtype fish prior to sex determination 21 dpf we performed bulk RNA sequencing on n=3 dpf 21 dpf wildtype and n=3 rbpms2 mutant fish. DESeq was then performed for Differential…		pubmed:38898112		Rbpms2 mApple uncrosslinked SR2	GSM8059037		source name:Gonad\|tissue:Gonad\|cell type:Germline and somatic\|genotype:Wildtype\|geo loc name:missing\|collection date:missing	Rbpms2 mApple uncrosslinked SR2	Basespace illumina platform was used and reads were mapped using tophate2 aligner. Estimation of reference genes and transcript was done using cufflinks and reads were mapped to the genome GRCz10. Reads were aligned with the TopHat Alignment App. GRCz10 CSV file that compiled includes tracking ids gene loci and FPKMs for each samples CSV files include tracking and gene id gene short name tss id locus and FPKM for each sample	Gonad		RNA was extracted with an Rneasy Mini Kit Qiagen 74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina 20020589		tissue:Gonad\|cell type:Germline and somatic\|genotype:Wildtype	GSM8059037	GSM8059037: Rbpms2 mApple uncrosslinked SR2; Danio rerio; RNA Seq	GSM8059037 r1	GSM8059037	1	RNA was extracted with an Rneasy Mini Kit Qiagen 74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina 20020589		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP487485			SR-2_S3_L001_R1_001.fastq.gz SR-2_S3_L001_R2_001.fastq.gz	fastq fastq	547329260.0	3670350.0	GSM8059037 r1	0:74.51 1:74.61	A:109193152;C:163365002;G:162344228;T:112378069;N:48809	74	74	109193152	163365002	162344228	112378069	48809	SRX23499419	SRS20351178	SRA1796363	Marlow, CDRB, Icahn School of Medicine Mount Sinai	Marlow, CDRB, Icahn School of Medicine Mount Sinai												B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	trueseq	bulk	bulk	bulk	United States	2024-02-01	Undetermined	Undetermined	Gonad	Reproductive System
30558	30558	SRR27836073	SRX23499418	SRS20351176	SRP487485	PRJNA1072072	Rbpms2 promotes female fate upstream of the nutrient sensing Gator2 complex component Mios	GSE254850	Transcriptome Analysis	Reproductive success relies on proper establishment and maintenance of biological sex. In many animals including mammals the primary gonad is initially ovary in character. We previously showed the RNA binding protein RNAbp Rbpms2 is required for ovary fate in zebrafish. Here we identified Rbpms2 targets in oocytesRbpms2 bound oocyte RNAs; rboRNAs. We identify Rbpms2 as a translational regulator ofrboRNAs which include testis factors and ribosome biogenesis factors. Further genetic analyses indicate that Rbpms2 promotes nucleolar amplification via the mTorc1 signaling pathway specifically through the mTorc1 activating Gap activity towards Rags 2 Gator2 component Missing oocyte Mios. Cumulatively our findings indicate that early gonocytes are in a dual poised bipotential state in which Rbpms2 acts as a binary fate switch. Specifically Rbpms2 represses testis factors and promotes oocyte factors to promote oocyte progression through an essential Gator2 mediated checkpoint thereby integrating regulation of sexual differentiation factors and nutritional availability pathways in zebrafish oogenesis. Overall design: To determine the RNA targets of Rbpms2 we generated wildtype female zebrafish expressing Rbpms2 mApple or mApple alone fusion proteins exclusively in the germline. Immunoprecipitation was performed in 2 adult female ovaries per transgene. Crosslinked and uncrosslinked samples for Rbpms2 mApple expressing fish and crosslined and uncrosslinked samples for mApple expressing fish were sequenced. RNAs found in the Rbpms2 mApple crosslinked and the mApple crosslinked and uncrosslinked datasets that were also present in the Rbpms2 mApple uncrosslinked dataset were excluded. RNAs present only in the uncrosslinked datasets were counted as RNA targets of Rbpms2. To characterize the transcriptional differences of rbpms2 mutants vs wildtype fish prior to sex determination 21 dpf we performed bulk RNA sequencing on n=3 dpf 21 dpf wildtype and n=3 rbpms2 mutant fish. DESeq was then performed for Differential…		pubmed:38898112		mApple control crosslinked SR8	GSM8059036		source name:Gonad\|tissue:Gonad\|cell type:Germline and somatic\|genotype:Wildtype\|geo loc name:missing\|collection date:missing	mApple control crosslinked SR8	Basespace illumina platform was used and reads were mapped using tophate2 aligner. Estimation of reference genes and transcript was done using cufflinks and reads were mapped to the genome GRCz10. Reads were aligned with the TopHat Alignment App. GRCz10 CSV file that compiled includes tracking ids gene loci and FPKMs for each samples CSV files include tracking and gene id gene short name tss id locus and FPKM for each sample	Gonad		RNA was extracted with an Rneasy Mini Kit Qiagen 74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina 20020589		tissue:Gonad\|cell type:Germline and somatic\|genotype:Wildtype	GSM8059036	GSM8059036: mApple control crosslinked SR8; Danio rerio; RNA Seq	GSM8059036 r1	GSM8059036	1	RNA was extracted with an Rneasy Mini Kit Qiagen 74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina 20020589		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP487485			SR-8_S6_L001_R1_001.fastq.gz SR-8_S6_L001_R2_001.fastq.gz	fastq fastq	474378287.0	3180744.0	GSM8059036 r1	0:74.52 1:74.62	A:90310344;C:145884340;G:146185172;T:91942086;N:56345	74	74	90310344	145884340	146185172	91942086	56345	SRX23499418	SRS20351176	SRA1796363	Marlow, CDRB, Icahn School of Medicine Mount Sinai	Marlow, CDRB, Icahn School of Medicine Mount Sinai												B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	trueseq	bulk	bulk	bulk	United States	2024-02-01	Undetermined	Undetermined	Gonad	Reproductive System
30559	30559	SRR27836074	SRX23499417	SRS20351175	SRP487485	PRJNA1072072	Rbpms2 promotes female fate upstream of the nutrient sensing Gator2 complex component Mios	GSE254850	Transcriptome Analysis	Reproductive success relies on proper establishment and maintenance of biological sex. In many animals including mammals the primary gonad is initially ovary in character. We previously showed the RNA binding protein RNAbp Rbpms2 is required for ovary fate in zebrafish. Here we identified Rbpms2 targets in oocytesRbpms2 bound oocyte RNAs; rboRNAs. We identify Rbpms2 as a translational regulator ofrboRNAs which include testis factors and ribosome biogenesis factors. Further genetic analyses indicate that Rbpms2 promotes nucleolar amplification via the mTorc1 signaling pathway specifically through the mTorc1 activating Gap activity towards Rags 2 Gator2 component Missing oocyte Mios. Cumulatively our findings indicate that early gonocytes are in a dual poised bipotential state in which Rbpms2 acts as a binary fate switch. Specifically Rbpms2 represses testis factors and promotes oocyte factors to promote oocyte progression through an essential Gator2 mediated checkpoint thereby integrating regulation of sexual differentiation factors and nutritional availability pathways in zebrafish oogenesis. Overall design: To determine the RNA targets of Rbpms2 we generated wildtype female zebrafish expressing Rbpms2 mApple or mApple alone fusion proteins exclusively in the germline. Immunoprecipitation was performed in 2 adult female ovaries per transgene. Crosslinked and uncrosslinked samples for Rbpms2 mApple expressing fish and crosslined and uncrosslinked samples for mApple expressing fish were sequenced. RNAs found in the Rbpms2 mApple crosslinked and the mApple crosslinked and uncrosslinked datasets that were also present in the Rbpms2 mApple uncrosslinked dataset were excluded. RNAs present only in the uncrosslinked datasets were counted as RNA targets of Rbpms2. To characterize the transcriptional differences of rbpms2 mutants vs wildtype fish prior to sex determination 21 dpf we performed bulk RNA sequencing on n=3 dpf 21 dpf wildtype and n=3 rbpms2 mutant fish. DESeq was then performed for Differential…		pubmed:38898112		mApple control uncrosslinked SR6	GSM8059035		source name:Gonad\|tissue:Gonad\|cell type:Germline and somatic\|genotype:Wildtype\|geo loc name:missing\|collection date:missing	mApple control uncrosslinked SR6	Basespace illumina platform was used and reads were mapped using tophate2 aligner. Estimation of reference genes and transcript was done using cufflinks and reads were mapped to the genome GRCz10. Reads were aligned with the TopHat Alignment App. GRCz10 CSV file that compiled includes tracking ids gene loci and FPKMs for each samples CSV files include tracking and gene id gene short name tss id locus and FPKM for each sample	Gonad		RNA was extracted with an Rneasy Mini Kit Qiagen 74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina 20020589		tissue:Gonad\|cell type:Germline and somatic\|genotype:Wildtype	GSM8059035	GSM8059035: mApple control uncrosslinked SR6; Danio rerio; RNA Seq	GSM8059035 r1	GSM8059035	1	RNA was extracted with an Rneasy Mini Kit Qiagen 74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina 20020589		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP487485			SR-6_S5_L001_R1_001.fastq.gz SR-6_S5_L001_R2_001.fastq.gz	fastq fastq	1667210566.0	11187841.0	GSM8059035 r1	0:74.46 1:74.56	A:348153529;C:480420209;G:474792496;T:363567978;N:276354	74	74	348153529	480420209	474792496	363567978	276354	SRX23499417	SRS20351175	SRA1796363	Marlow, CDRB, Icahn School of Medicine Mount Sinai	Marlow, CDRB, Icahn School of Medicine Mount Sinai												B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	trueseq	bulk	bulk	bulk	United States	2024-02-01	Undetermined	Undetermined	Gonad	Reproductive System
32476	32476	SRR29270149	SRX24787634	SRS21505104	SRP511487	PRJNA1119569	RNA seq of zebrafish foxl2l mutant	PRJNA1119569	Other	Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.					foxl2l Mut 20 1		strain:AB\|age:20\|collection date:2023 06 10\|geo loc name:China\|sex:hermaphrodite\|tissue:gonad\|BioSampleModel:Model organism or animal									foxl2l Mut 20 1	E10	E10	50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01			RNA-Seq	TRANSCRIPTOMIC	PCR	PAIRED	ILLUMINA	NextSeq 500		SRP511487			foxl2l_Mut-20-1_S162_R1.fastq.gz foxl2l_Mut-20-1_S162_R2.fastq.gz	fastq fastq	8940963680.0	29605840.0	foxl2l Mut 20 1 S162 R1.fastq.gz	0:151 1:151	A:2232167098;C:2229744850;G:2271326718;T:2207692629;N:32385	151	151	2232167098	2229744850	2271326718	2207692629	32385	SRX24787634	SRS21505104	SRA1887976	Institute of Hydrobiology, Chinese Academy of Sciences\|Center for Fish Biology and Fishery Biotechnology	Institute of Hydrobiology, Chinese Academy of Sciences												B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	bulk	bulk	bulk	China	2024-06-03	Undetermined	Undetermined	Gonad	Reproductive System
32477	32477	SRR29270150	SRX24787633	SRS21505103	SRP511487	PRJNA1119569	RNA seq of zebrafish foxl2l mutant	PRJNA1119569	Other	Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.					foxl2l Het 20 3		strain:AB\|age:20\|collection date:2023 06 09\|geo loc name:China\|sex:hermaphrodite\|tissue:gonad\|BioSampleModel:Model organism or animal									foxl2l Het 20 3	E9	E9	50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01			RNA-Seq	TRANSCRIPTOMIC	PCR	PAIRED	ILLUMINA	NextSeq 500		SRP511487			foxl2l_Het-20-3_S161_R1.fastq.gz foxl2l_Het-20-3_S161_R2.fastq.gz	fastq fastq	7038409282.0	23305991.0	foxl2l Het 20 3 S161 R1.fastq.gz	0:151 1:151	A:1766863186;C:1740008639;G:1787471686;T:1744039429;N:26342	151	151	1766863186	1740008639	1787471686	1744039429	26342	SRX24787633	SRS21505103	SRA1887976	Institute of Hydrobiology, Chinese Academy of Sciences\|Center for Fish Biology and Fishery Biotechnology	Institute of Hydrobiology, Chinese Academy of Sciences												B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	bulk	bulk	bulk	China	2024-06-03	Undetermined	Undetermined	Gonad	Reproductive System
32478	32478	SRR29270151	SRX24787632	SRS21505102	SRP511487	PRJNA1119569	RNA seq of zebrafish foxl2l mutant	PRJNA1119569	Other	Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.					foxl2l Het 20 2		strain:AB\|age:20\|collection date:2023 06 08\|geo loc name:China\|sex:hermaphrodite\|tissue:gonad\|BioSampleModel:Model organism or animal									foxl2l Het 20 2	E8	E8	50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01			RNA-Seq	TRANSCRIPTOMIC	PCR	PAIRED	ILLUMINA	NextSeq 500		SRP511487			foxl2l_Het-20-2_S160_R1.fastq.gz foxl2l_Het-20-2_S160_R2.fastq.gz	fastq fastq	6772505832.0	22425516.0	foxl2l Het 20 2 S160 R1.fastq.gz	0:151 1:151	A:1704124986;C:1673138074;G:1713003931;T:1682214009;N:24832	151	151	1704124986	1673138074	1713003931	1682214009	24832	SRX24787632	SRS21505102	SRA1887976	Institute of Hydrobiology, Chinese Academy of Sciences\|Center for Fish Biology and Fishery Biotechnology	Institute of Hydrobiology, Chinese Academy of Sciences												B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	bulk	bulk	bulk	China	2024-06-03	Undetermined	Undetermined	Gonad	Reproductive System
32479	32479	SRR29270152	SRX24787631	SRS21505101	SRP511487	PRJNA1119569	RNA seq of zebrafish foxl2l mutant	PRJNA1119569	Other	Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.					foxl2l Het 20 1		strain:AB\|age:20\|collection date:2023 06 07\|geo loc name:China\|sex:hermaphrodite\|tissue:gonad\|BioSampleModel:Model organism or animal									foxl2l Het 20 1	E7	E7	50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01			RNA-Seq	TRANSCRIPTOMIC	PCR	PAIRED	ILLUMINA	NextSeq 500		SRP511487			foxl2l_Het-20-1_S159_R1.fastq.gz foxl2l_Het-20-1_S159_R2.fastq.gz	fastq fastq	11685740812.0	38694506.0	foxl2l Het 20 1 S159 R1.fastq.gz	0:151 1:151	A:2939618668;C:2888861085;G:2958173208;T:2899044704;N:43147	151	151	2939618668	2888861085	2958173208	2899044704	43147	SRX24787631	SRS21505101	SRA1887976	Institute of Hydrobiology, Chinese Academy of Sciences\|Center for Fish Biology and Fishery Biotechnology	Institute of Hydrobiology, Chinese Academy of Sciences												B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	bulk	bulk	bulk	China	2024-06-03	Undetermined	Undetermined	Gonad	Reproductive System
32480	32480	SRR29270153	SRX24787630	SRS21505100	SRP511487	PRJNA1119569	RNA seq of zebrafish foxl2l mutant	PRJNA1119569	Other	Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.					foxl2l Mut 15 3		strain:AB\|age:15\|collection date:2023 06 06\|geo loc name:China\|sex:hermaphrodite\|tissue:gonad\|BioSampleModel:Model organism or animal									foxl2l Mut 15 3	E6	E6	50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01			RNA-Seq	TRANSCRIPTOMIC	PCR	PAIRED	ILLUMINA	NextSeq 500		SRP511487			foxl2l_Mut-15-3_S158_R1.fastq.gz foxl2l_Mut-15-3_S158_R2.fastq.gz	fastq fastq	9503789604.0	31469502.0	foxl2l Mut 15 3 S158 R1.fastq.gz	0:151 1:151	A:2393052443;C:2340958111;G:2411502428;T:2358240313;N:36309	151	151	2393052443	2340958111	2411502428	2358240313	36309	SRX24787630	SRS21505100	SRA1887976	Institute of Hydrobiology, Chinese Academy of Sciences\|Center for Fish Biology and Fishery Biotechnology	Institute of Hydrobiology, Chinese Academy of Sciences												B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	bulk	bulk	bulk	China	2024-06-03	Undetermined	Undetermined	Gonad	Reproductive System
32481	32481	SRR29270154	SRX24787629	SRS21505099	SRP511487	PRJNA1119569	RNA seq of zebrafish foxl2l mutant	PRJNA1119569	Other	Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.					foxl2l Mut 15 2		strain:AB\|age:15\|collection date:2023 06 05\|geo loc name:China\|sex:hermaphrodite\|tissue:gonad\|BioSampleModel:Model organism or animal									foxl2l Mut 15 2	E5	E5	50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01			RNA-Seq	TRANSCRIPTOMIC	PCR	PAIRED	ILLUMINA	NextSeq 500		SRP511487			foxl2l_Mut-15-2_S157_R1.fastq.gz foxl2l_Mut-15-2_S157_R2.fastq.gz	fastq fastq	7416837026.0	24559063.0	foxl2l Mut 15 2 S157 R1.fastq.gz	0:151 1:151	A:1865711045;C:1830489703;G:1881612508;T:1838995980;N:27790	151	151	1865711045	1830489703	1881612508	1838995980	27790	SRX24787629	SRS21505099	SRA1887976	Institute of Hydrobiology, Chinese Academy of Sciences\|Center for Fish Biology and Fishery Biotechnology	Institute of Hydrobiology, Chinese Academy of Sciences												B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	bulk	bulk	bulk	China	2024-06-03	Undetermined	Undetermined	Gonad	Reproductive System
32482	32482	SRR29270155	SRX24787628	SRS21505098	SRP511487	PRJNA1119569	RNA seq of zebrafish foxl2l mutant	PRJNA1119569	Other	Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.					foxl2l Mut 15 1		strain:AB\|age:15\|collection date:2023 06 04\|geo loc name:China\|sex:hermaphrodite\|tissue:gonad\|BioSampleModel:Model organism or animal									foxl2l Mut 15 1	E4	E4	50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01			RNA-Seq	TRANSCRIPTOMIC	PCR	PAIRED	ILLUMINA	NextSeq 500		SRP511487			foxl2l_Mut-15-1_S156_R1.fastq.gz foxl2l_Mut-15-1_S156_R2.fastq.gz	fastq fastq	7092721868.0	23485834.0	foxl2l Mut 15 1 S156 R1.fastq.gz	0:151 1:151	A:1764166761;C:1770534219;G:1820397492;T:1737597123;N:26273	151	151	1764166761	1770534219	1820397492	1737597123	26273	SRX24787628	SRS21505098	SRA1887976	Institute of Hydrobiology, Chinese Academy of Sciences\|Center for Fish Biology and Fishery Biotechnology	Institute of Hydrobiology, Chinese Academy of Sciences												B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	bulk	bulk	bulk	China	2024-06-03	Undetermined	Undetermined	Gonad	Reproductive System
32483	32483	SRR29270156	SRX24787627	SRS21505097	SRP511487	PRJNA1119569	RNA seq of zebrafish foxl2l mutant	PRJNA1119569	Other	Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.					foxl2l Het 15 3		strain:AB\|age:15\|collection date:2023 06 03\|geo loc name:China\|sex:hermaphrodite\|tissue:gonad\|BioSampleModel:Model organism or animal									foxl2l Het 15 3	E3	E3	50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01			RNA-Seq	TRANSCRIPTOMIC	PCR	PAIRED	ILLUMINA	NextSeq 500		SRP511487			foxl2l_Het-15-3_S155_R1.fastq.gz foxl2l_Het-15-3_S155_R2.fastq.gz	fastq fastq	8083606820.0	26766910.0	foxl2l Het 15 3 S155 R1.fastq.gz	0:151 1:151	A:2028557443;C:2001113164;G:2050610840;T:2003295953;N:29420	151	151	2028557443	2001113164	2050610840	2003295953	29420	SRX24787627	SRS21505097	SRA1887976	Institute of Hydrobiology, Chinese Academy of Sciences\|Center for Fish Biology and Fishery Biotechnology	Institute of Hydrobiology, Chinese Academy of Sciences												B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	bulk	bulk	bulk	China	2024-06-03	Undetermined	Undetermined	Gonad	Reproductive System
32484	32484	SRR29270157	SRX24787626	SRS21505096	SRP511487	PRJNA1119569	RNA seq of zebrafish foxl2l mutant	PRJNA1119569	Other	Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.					foxl2l Mut 20 3		strain:AB\|age:20\|collection date:2023 06 12\|geo loc name:China\|sex:hermaphrodite\|tissue:gonad\|BioSampleModel:Model organism or animal									foxl2l Mut 20 3	E12	E12	50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01			RNA-Seq	TRANSCRIPTOMIC	PCR	PAIRED	ILLUMINA	NextSeq 500		SRP511487			foxl2l_Mut-20-3_S164_R1.fastq.gz foxl2l_Mut-20-3_S164_R2.fastq.gz	fastq fastq	7474861796.0	24751198.0	foxl2l Mut 20 3 S164 R1.fastq.gz	0:151 1:151	A:1878881650;C:1849512621;G:1891142525;T:1855296720;N:28280	151	151	1878881650	1849512621	1891142525	1855296720	28280	SRX24787626	SRS21505096	SRA1887976	Institute of Hydrobiology, Chinese Academy of Sciences\|Center for Fish Biology and Fishery Biotechnology	Institute of Hydrobiology, Chinese Academy of Sciences												B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	bulk	bulk	bulk	China	2024-06-03	Undetermined	Undetermined	Gonad	Reproductive System
32485	32485	SRR29270158	SRX24787625	SRS21505095	SRP511487	PRJNA1119569	RNA seq of zebrafish foxl2l mutant	PRJNA1119569	Other	Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.					foxl2l Mut 20 2		strain:AB\|age:20\|collection date:2023 06 11\|geo loc name:China\|sex:hermaphrodite\|tissue:gonad\|BioSampleModel:Model organism or animal									foxl2l Mut 20 2	E11	E11	50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01			RNA-Seq	TRANSCRIPTOMIC	PCR	PAIRED	ILLUMINA	NextSeq 500		SRP511487			foxl2l_Mut-20-2_S163_R1.fastq.gz foxl2l_Mut-20-2_S163_R2.fastq.gz	fastq fastq	8203704066.0	27164583.0	foxl2l Mut 20 2 S163 R1.fastq.gz	0:151 1:151	A:2061693689;C:2030126562;G:2072980952;T:2038873198;N:29665	151	151	2061693689	2030126562	2072980952	2038873198	29665	SRX24787625	SRS21505095	SRA1887976	Institute of Hydrobiology, Chinese Academy of Sciences\|Center for Fish Biology and Fishery Biotechnology	Institute of Hydrobiology, Chinese Academy of Sciences												B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	bulk	bulk	bulk	China	2024-06-03	Undetermined	Undetermined	Gonad	Reproductive System
32486	32486	SRR29270159	SRX24787624	SRS21505094	SRP511487	PRJNA1119569	RNA seq of zebrafish foxl2l mutant	PRJNA1119569	Other	Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.					foxl2l Het 15 2		strain:AB\|age:15\|collection date:2023 06 02\|geo loc name:China\|sex:hermaphrodite\|tissue:gonad\|BioSampleModel:Model organism or animal									foxl2l Het 15 2	E2	E2	50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01			RNA-Seq	TRANSCRIPTOMIC	PCR	PAIRED	ILLUMINA	NextSeq 500		SRP511487			foxl2l_Het-15-2_S154_R1.fastq.gz foxl2l_Het-15-2_S154_R2.fastq.gz	fastq fastq	7868286860.0	26053930.0	foxl2l Het 15 2 S154 R1.fastq.gz	0:151 1:151	A:1972210357;C:1946891859;G:2008091153;T:1941064817;N:28674	151	151	1972210357	1946891859	2008091153	1941064817	28674	SRX24787624	SRS21505094	SRA1887976	Institute of Hydrobiology, Chinese Academy of Sciences\|Center for Fish Biology and Fishery Biotechnology	Institute of Hydrobiology, Chinese Academy of Sciences												B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	bulk	bulk	bulk	China	2024-06-03	Undetermined	Undetermined	Gonad	Reproductive System
32487	32487	SRR29270160	SRX24787623	SRS21505093	SRP511487	PRJNA1119569	RNA seq of zebrafish foxl2l mutant	PRJNA1119569	Other	Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.					foxl2l Het 15 1		strain:AB\|age:15\|collection date:2023 06 01\|geo loc name:China\|sex:hermaphrodite\|tissue:gonad\|BioSampleModel:Model organism or animal									foxl2l Het 15 1	E1	E1	50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01			RNA-Seq	TRANSCRIPTOMIC	PCR	PAIRED	ILLUMINA	NextSeq 500		SRP511487			foxl2l_Het-15-1_S153_R1.fastq.gz foxl2l_Het-15-1_S153_R2.fastq.gz	fastq fastq	7117391946.0	23567523.0	foxl2l Het 15 1 S153 R1.fastq.gz	0:151 1:151	A:1795668098;C:1752824783;G:1793720116;T:1775153584;N:25365	151	151	1795668098	1752824783	1793720116	1775153584	25365	SRX24787623	SRS21505093	SRA1887976	Institute of Hydrobiology, Chinese Academy of Sciences\|Center for Fish Biology and Fishery Biotechnology	Institute of Hydrobiology, Chinese Academy of Sciences												B	B	biological fallback assumption	illumina	nextseq	unknown	random_priming	unknown	bulk	bulk	bulk	China	2024-06-03	Undetermined	Undetermined	Gonad	Reproductive System
36285	36285	SRR363985	SRX105298	SRS270141	SRP009275	PRJNA148581	Hen1 analysis in zebrafish	GSE33582	Transcriptome Analysis	small RNA libraries from wild type and Hen1 mutant testes were made with either polyA tailing VASAGFPHen1minus/plus or adapter ligation Hen1Testis and WTTestis and sequenced on an Illumina GAII platform. Overall design: RNA was isolated from total testis tissue of both Hen1 wildtype and Hen1 mutant animals. post size selection from gel the small RNA libraries wre made.		pubmed:20859253		wildtype ligation	GSM830247		source name:testis\|strain:TL\|genotype/variation:Hen1 wildtype\|tissue:testis\|small rna library prep method:adapter ligation	wildtype ligation	three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the zebrafish genome Zv8	testis		Small RNAs in the size range of 19 31 bases were excised from a denaturing gel. Adaptors were ligated to the five prime and three prime ends of the isolated RNA and the product was converted to cDNA using a primer on the three prime adaptor. post 15 cycles PCR amplification of the library the product was gel purified and sequenced on a Solexa platform.		strain:TL\|genotype/variation:Hen1 wildtype\|tissue:testis\|small rna library prep method:adapter ligation	GSM830247	GSM830247: wildtype ligation	GSM830247: wildtype ligation	GSM830247: wildtype ligation	1		GEO Accession:GSM830247	RNA-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina Genome Analyzer II	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>46</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP009275		read name barcode proc directive:ignore	WTTESTIS.fastq	fastq	395791130.0	8604155.0	GSM830247 1	0:46	A:79045664;C:90489917;G:99082007;T:127024229;N:149313	46		79045664	90489917	99082007	127024229	149313	SRX105298	SRS270141	SRA047996	GEO	European Research Institute for the Biology of Ageing, University Medical Center Groningen	1	0.00021		0.00015		0.99989		0.0		46		T		under 1.2% mapping rate	illumina	early_illumina	5prime	poly_a	unknown	bulk	unknown	unknown	Netherlands	2011-11-09	Undetermined	Undetermined	Gonad	Reproductive System
36286	36286	SRR363984	SRX105297	SRS270140	SRP009275	PRJNA148581	Hen1 analysis in zebrafish	GSE33582	Transcriptome Analysis	small RNA libraries from wild type and Hen1 mutant testes were made with either polyA tailing VASAGFPHen1minus/plus or adapter ligation Hen1Testis and WTTestis and sequenced on an Illumina GAII platform. Overall design: RNA was isolated from total testis tissue of both Hen1 wildtype and Hen1 mutant animals. post size selection from gel the small RNA libraries wre made.		pubmed:20859253		hen1 mutant ligation	GSM830246		source name:testis\|strain:TL\|genotype/variation:Hen1 mutant\|tissue:testis\|small rna library prep method:adapter ligation	hen1 mutant ligation	three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the zebrafish genome Zv8	testis		Small RNAs in the size range of 19 31 bases were excised from a denaturing gel. Adaptors were ligated to the five prime and three prime ends of the isolated RNA and the product was converted to cDNA using a primer on the three prime adaptor. post 15 cycles PCR amplification of the library the product was gel purified and sequenced on a Solexa platform.		strain:TL\|genotype/variation:Hen1 mutant\|tissue:testis\|small rna library prep method:adapter ligation	GSM830246	GSM830246: hen1 mutant ligation	GSM830246: hen1 mutant ligation	GSM830246: hen1 mutant ligation	1		GEO Accession:GSM830246	RNA-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina Genome Analyzer II	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>46</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP009275		read name barcode proc directive:ignore	HEN1TESTIS.fastq	fastq	440876374.0	9584269.0	GSM830246 1	0:46	A:91693980;C:99515953;G:105634029;T:143841954;N:190458	46		91693980	99515953	105634029	143841954	190458	SRX105297	SRS270140	SRA047996	GEO	European Research Institute for the Biology of Ageing, University Medical Center Groningen	1	0.00039		0.00033		0.99995		0.0		46		T		under 1.2% mapping rate	illumina	early_illumina	5prime	poly_a	unknown	bulk	unknown	unknown	Netherlands	2011-11-09	Undetermined	Undetermined	Gonad	Reproductive System
36287	36287	SRR363983	SRX105296	SRS270139	SRP009275	PRJNA148581	Hen1 analysis in zebrafish	GSE33582	Transcriptome Analysis	small RNA libraries from wild type and Hen1 mutant testes were made with either polyA tailing VASAGFPHen1minus/plus or adapter ligation Hen1Testis and WTTestis and sequenced on an Illumina GAII platform. Overall design: RNA was isolated from total testis tissue of both Hen1 wildtype and Hen1 mutant animals. post size selection from gel the small RNA libraries wre made.		pubmed:20859253		wildtype polyA	GSM830245		source name:testis\|strain:TL\|genotype/variation:Hen1 wildtype\|tissue:testis\|small rna library prep method:polyA tailing	wildtype polyA	three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the zebrafish genome Zv8	testis		Small RNAs in the size range of 19 31 bases were excised from a denaturing gel. RNA was polyA tailed using polyA polymerase followed by ligation of a RNA adaptor to the five prime phosphate of the small RNAs. First strand cDNA synthesis was performed using an oligodT linker primer and M MLV RNase H reverse transcriptase. post amplification the cDNA was sent for sequencing on an Illumina/Solexa platform.		strain:TL\|genotype/variation:Hen1 wildtype\|tissue:testis\|small rna library prep method:polyA tailing	GSM830245	GSM830245: wildtype polyA	GSM830245: wildtype polyA	GSM830245: wildtype polyA	1		GEO Accession:GSM830245	RNA-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina Genome Analyzer II	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>44</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP009275		read name barcode proc directive:ignore	VASAGFPHEN1plusMALE.fastq	fastq	167344144.0	3803276.0	GSM830245 1	0:44	A:87935982;C:21182538;G:19081938;T:34474815;N:4668871	44		87935982	21182538	19081938	34474815	4668871	SRX105296	SRS270139	SRA047996	GEO	European Research Institute for the Biology of Ageing, University Medical Center Groningen	1	0.06642		0.05042		0.99226		0.38346		44		B		usable mapping rate	illumina	early_illumina	unknown	poly_a	unknown	bulk	unknown	unknown	Netherlands	2011-11-09	Undetermined	Undetermined	Gonad	Reproductive System
36288	36288	SRR363982	SRX105295	SRS270138	SRP009275	PRJNA148581	Hen1 analysis in zebrafish	GSE33582	Transcriptome Analysis	small RNA libraries from wild type and Hen1 mutant testes were made with either polyA tailing VASAGFPHen1minus/plus or adapter ligation Hen1Testis and WTTestis and sequenced on an Illumina GAII platform. Overall design: RNA was isolated from total testis tissue of both Hen1 wildtype and Hen1 mutant animals. post size selection from gel the small RNA libraries wre made.		pubmed:20859253		hen1 mutant polyA	GSM830244		source name:testis\|strain:TL\|genotype/variation:Hen1 mutant\|tissue:testis\|small rna library prep method:polyA tailing	hen1 mutant polyA	three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the zebrafish genome Zv8	testis		Small RNAs in the size range of 19 31 bases were excised from a denaturing gel. RNA was polyA tailed using polyA polymerase followed by ligation of a RNA adaptor to the five prime phosphate of the small RNAs. First strand cDNA synthesis was performed using an oligodT linker primer and M MLV RNase H reverse transcriptase. post amplification the cDNA was sent for sequencing on an Illumina/Solexa platform.		strain:TL\|genotype/variation:Hen1 mutant\|tissue:testis\|small rna library prep method:polyA tailing	GSM830244	GSM830244: hen1 mutant polyA	GSM830244: hen1 mutant polyA	GSM830244: hen1 mutant polyA	1		GEO Accession:GSM830244	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina Genome Analyzer II	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>44</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP009275		read name barcode proc directive:ignore	VASAGFPHEN1minusMALE.fastq	fastq	267208964.0	6072931.0	GSM830244 1	0:44	A:143478691;C:30051676;G:33682677;T:59883224;N:112696	44		143478691	30051676	33682677	59883224	112696	SRX105295	SRS270138	SRA047996	GEO	European Research Institute for the Biology of Ageing, University Medical Center Groningen	1	0.01616		0.01033		0.99381		0.76337		44		B		usable mapping rate	illumina	early_illumina	unknown	poly_a	unknown	bulk	unknown	unknown	Netherlands	2011-11-09	Undetermined	Undetermined	Gonad	Reproductive System
37997	37997	SRR1265760	SRX529154	SRS598851	SRP041544	PRJNA245824	Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish	GSE57169	Transcriptome Analysis	The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.		pubmed:26574018		Testis Replicate 3 sRNAseq	GSM1376643		source name:Testis\|gender:male\|tissue:Testis\|genetic background:Wild type Singapore strain	Testis Replicate 3 sRNAseq	Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p <zebrafish precursor miRNA fasta file> m <zebrafish mature miRNA fasta file> r <unique reads fasta file> t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.	Testis	N/A	Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.	Fishes were purchased from a local supplier and acclimatized before tissue extraction.	gender:Male\|tissue:Testis\|genetic background:Wild type Singapore strain	GSM1376643	GSM1376643: Testis Replicate 3 sRNAseq; Danio rerio; miRNA Seq	GSM1376643		1	Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.	GEO Accession:GSM1376643	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP041544			MZT004_GCCAAT_L004_R1.fastq.gz	fastq	1096387628.0	14426153.0	GSM1376643 r1	0:76	A:268706118;C:286539627;G:262643519;T:278353167;N:145197	76		268706118	286539627	262643519	278353167	145197	SRX529154	SRS598851	SRA160430	GEO	Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore	1	0.00659		0.00333		0.99845		0.7331		76		T		under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	unknown	unknown	Singapore	2014-04-29	Undetermined	Embryo	Gonad	Reproductive System
37998	37998	SRR1265759	SRX529153	SRS598850	SRP041544	PRJNA245824	Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish	GSE57169	Transcriptome Analysis	The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.		pubmed:26574018		Testis Replicate 2 sRNAseq	GSM1376642		source name:Testis\|gender:male\|tissue:Testis\|genetic background:Wild type Singapore strain	Testis Replicate 2 sRNAseq	Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p <zebrafish precursor miRNA fasta file> m <zebrafish mature miRNA fasta file> r <unique reads fasta file> t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.	Testis	N/A	Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.	Fishes were purchased from a local supplier and acclimatized before tissue extraction.	gender:Male\|tissue:Testis\|genetic background:Wild type Singapore strain	GSM1376642	GSM1376642: Testis Replicate 2 sRNAseq; Danio rerio; miRNA Seq	GSM1376642		1	Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.	GEO Accession:GSM1376642	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP041544			MZT003_ACAGTG_L004_R1.fastq.gz	fastq	1562745896.0	20562446.0	GSM1376642 r1	0:76	A:381752411;C:387452090;G:395892335;T:397438930;N:210130	76		381752411	387452090	395892335	397438930	210130	SRX529153	SRS598850	SRA160430	GEO	Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore	1	0.01222		0.00651		0.99788		0.69591		76		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	unknown	unknown	Singapore	2014-04-29	Undetermined	Embryo	Gonad	Reproductive System
37999	37999	SRR1265758	SRX529152	SRS598849	SRP041544	PRJNA245824	Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish	GSE57169	Transcriptome Analysis	The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.		pubmed:26574018		Testis Replicate 1 sRNAseq	GSM1376641		source name:Testis\|gender:male\|tissue:Testis\|genetic background:Wild type Singapore strain	Testis Replicate 1 sRNAseq	Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p <zebrafish precursor miRNA fasta file> m <zebrafish mature miRNA fasta file> r <unique reads fasta file> t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.	Testis	N/A	Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.	Fishes were purchased from a local supplier and acclimatized before tissue extraction.	gender:Male\|tissue:Testis\|genetic background:Wild type Singapore strain	GSM1376641	GSM1376641: Testis Replicate 1 sRNAseq; Danio rerio; miRNA Seq	GSM1376641		1	Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.	GEO Accession:GSM1376641	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP041544			MZT001_TGACCA_L004_R1.fastq.gz	fastq	1368892316.0	18011741.0	GSM1376641 r1	0:76	A:335715713;C:358829703;G:326742789;T:347419137;N:184974	76		335715713	358829703	326742789	347419137	184974	SRX529152	SRS598849	SRA160430	GEO	Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore	1	0.00032		3e-05		0.99943		0.69387		76		T		under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	unknown	unknown	Singapore	2014-04-29	Undetermined	Embryo	Gonad	Reproductive System
38000	38000	SRR1265757	SRX529151	SRS598848	SRP041544	PRJNA245824	Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish	GSE57169	Transcriptome Analysis	The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.		pubmed:26574018		Ovary Replicate 3 sRNAseq	GSM1376640		source name:Ovary\|gender:female\|tissue:Ovary\|genetic background:Wild type Singapore strain	Ovary Replicate 3 sRNAseq	Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p <zebrafish precursor miRNA fasta file> m <zebrafish mature miRNA fasta file> r <unique reads fasta file> t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.	Ovary	N/A	Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.	Fishes were purchased from a local supplier and acclimatized before tissue extraction.	gender:Female\|tissue:Ovary\|genetic background:Wild type Singapore strain	GSM1376640	GSM1376640: Ovary Replicate 3 sRNAseq; Danio rerio; miRNA Seq	GSM1376640		1	Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.	GEO Accession:GSM1376640	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP041544			MZO006_GATCAG_L008_R1.fastq.gz	fastq	1411005984.0	27666784.0	GSM1376640 r1	0:51	A:326542153;C:314421825;G:411019622;T:358847379;N:175005	51		326542153	314421825	411019622	358847379	175005	SRX529151	SRS598848	SRA160430	GEO	Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore	1	0.00638		0.00068		0.99513		0.75483		51		T		under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	unknown	unknown	Singapore	2014-04-29	Undetermined	Embryo	Gonad	Reproductive System
38001	38001	SRR1265756	SRX529150	SRS598847	SRP041544	PRJNA245824	Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish	GSE57169	Transcriptome Analysis	The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.		pubmed:26574018		Ovary Replicate 2 sRNAseq	GSM1376639		source name:Ovary\|gender:female\|tissue:Ovary\|genetic background:Wild type Singapore strain	Ovary Replicate 2 sRNAseq	Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p <zebrafish precursor miRNA fasta file> m <zebrafish mature miRNA fasta file> r <unique reads fasta file> t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.	Ovary	N/A	Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.	Fishes were purchased from a local supplier and acclimatized before tissue extraction.	gender:Female\|tissue:Ovary\|genetic background:Wild type Singapore strain	GSM1376639	GSM1376639: Ovary Replicate 2 sRNAseq; Danio rerio; miRNA Seq	GSM1376639		1	Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.	GEO Accession:GSM1376639	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP041544			MZO005_ACTTGA_L008_R1.fastq.gz	fastq	765419424.0	15008224.0	GSM1376639 r1	0:51	A:179455664;C:170237021;G:221342071;T:194287721;N:96947	51		179455664	170237021	221342071	194287721	96947	SRX529150	SRS598847	SRA160430	GEO	Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore	1	0.02512		0.00355		0.98212		0.67744		51		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	unknown	unknown	Singapore	2014-04-29	Undetermined	Embryo	Gonad	Reproductive System
38002	38002	SRR1265755	SRX529149	SRS598846	SRP041544	PRJNA245824	Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish	GSE57169	Transcriptome Analysis	The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.		pubmed:26574018		Ovary Replicate 1 sRNAseq	GSM1376638		source name:Ovary\|gender:female\|tissue:Ovary\|genetic background:Wild type Singapore strain	Ovary Replicate 1 sRNAseq	Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p <zebrafish precursor miRNA fasta file> m <zebrafish mature miRNA fasta file> r <unique reads fasta file> t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.	Ovary	N/A	Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.	Fishes were purchased from a local supplier and acclimatized before tissue extraction.	gender:Female\|tissue:Ovary\|genetic background:Wild type Singapore strain	GSM1376638	GSM1376638: Ovary Replicate 1 sRNAseq; Danio rerio; miRNA Seq	GSM1376638		1	Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.	GEO Accession:GSM1376638	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP041544			MZO004_CAGATC_L008_R1.fastq.gz	fastq	487558674.0	9559974.0	GSM1376638 r1	0:51	A:114833813;C:108951811;G:140408702;T:123302557;N:61791	51		114833813	108951811	140408702	123302557	61791	SRX529149	SRS598846	SRA160430	GEO	Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore	1	0.00298		0.0004		0.99644		0.84584		51		T		under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	unknown	unknown	Singapore	2014-04-29	Undetermined	Embryo	Gonad	Reproductive System
39861	39861	SRR2177451	SRX1161443	SRS1042406	SRP062686	PRJNA293487	Danio rerio Digital Gene Expression Sequencing	PRJNA293487	Other	Differential expression between WT and CD82a from Morpholino treated embyro of Danio rerio			Differential expression between WT and CD82a Morpholino treated embyro of Danio rerio		control		isolate:Danio rerio embyro\|dev stage:embyro\|sex:missing\|tissue:ovary\|BioSampleModel:Model organism or animal									Danio rerio Digital Gene Expression Sequencing	control	1	1			RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP062686			control_R1.fastq.gz control_R2.fastq.gz	fastq fastq	1381289200.0	6906446.0	control	0:100 1:100	A:362182510;C:331106787;G:327770778;T:360198909;N:30216	100	100	362182510	331106787	327770778	360198909	30216	SRX1161443	SRS1042406	SRA290388	Shanghai Ocean University\|Department of Biology and Biotechnology	Shanghai Ocean University	2	0.95634	0.95016	0.06922	0.06922	0.7013	0.70368	0.46985	0.47013	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	China	2016-08-21	Undetermined	Embryo	Gonad	Reproductive System
39862	39862	SRR2177447	SRX1161442	SRS1042404	SRP062686	PRJNA293487	Danio rerio Digital Gene Expression Sequencing	PRJNA293487	Other	Differential expression between WT and CD82a from Morpholino treated embyro of Danio rerio			Differential expression between WT and CD82a Morpholino treated embyro of Danio rerio		ATG		isolate:Danio rerio embyro\|dev stage:embyro\|sex:missing\|tissue:ovary\|BioSampleModel:Model organism or animal									Danio rerio Digital Gene Expression Sequencing	ATG	1	1			RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP062686			ATG_R1.fastq.gz ATG_R2.fastq.gz	fastq fastq	1278088000.0	6390440.0	ATG	0:100 1:100	A:335532626;C:305947212;G:302508524;T:334072046;N:27592	100	100	335532626	305947212	302508524	334072046	27592	SRX1161442	SRS1042404	SRA290388	Shanghai Ocean University\|Department of Biology and Biotechnology	Shanghai Ocean University	2	0.95535	0.94653	0.07264	0.07271	0.70402	0.7082	0.46712	0.46962	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	China	2016-08-21	Undetermined	Embryo	Gonad	Reproductive System
42465	42465	SRR5605448	SRX2858036	SRS2228760	SRP108050	PRJNA388086	Transcriptomic Analysis for Differentially Expressed Genes in Ovarian Follicle Activation and Puberty Onset in the Zebrafish	GSE99308	Transcriptome Analysis	Puberty is a special transition period in sexual maturation and it has been extensively studied in vertebrates in the past decades. In mammals the initiation of puberty involves activation of numerous genes; however there have been few comprehensive reports in small model teleosts such as the zebrafish. In the zebrafish the onset of puberty in females is marked by the appearance of the first wave of pre vitellogenic PV follicles in the ovary during sexual maturation. Using transcriptomics and real time qPCR this study was undertaken to investigate temporal gene expression differences between the primary growth PG follicles and pre vitellogenic PV follicles with particular emphasis on oocyte and follicular cell specific genes as well as several closely associated signaling pathways. Our results showed that totally 1082 genes were significantly upregulated and 530 evidently downregulated during the PG PV transition and among them were some well recognized biomarkers such as cyp19a1a fshr inha and inhbaa and some novel genes like notch3 amh gadd45ga and lpl. Further gene ontology analysis showed that egg coat formation and steroid hormone mediated signaling pathway might be critical for follicle activation from PG to PV stage. In addition KEGG identified several signaling pathways that might play pivotal roles in early folliculogenesis including phosphatidylinositol signaling system glycolsaminoglycan biosynthesis RNA transport and p53 signaling pathways. Overall this study reported a comprehensive analysis for biomarker genes and potential pathways involved in PG PV transition or follicle activation which also marks female puberty onset in the zebrafish when occurring for the first time in sexual maturation. Overall design: Examination of gene expression patterns in 2 different stage follicles PG and PV follicles		pubmed:30364302		PV WT3	GSM2640960		source name:PV WT3\|strain:AB\|tissue:follice\|developmental stage:pre vitellogenin\|genotype:WT	PV WT3	Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Danio rerio genome version GRCz10 from Ensembl using Tophat2. Parameters: p 6 StringTie and prepDE.py Python script provided with StringTie tool was used to assemble the alignments into transcripts and extract the raw read counts for reference genomic features respectively. The read count matrix was processed by DeSeq2 package for differential gene expression analysis. Genome build: GRCz10 Ensembl build 84 Supplementary files format and content: PG vs PV rawCounts.csv: Raw read counts for each sample. Supplementary files format and content: PG vs PV normCounts.tab: Normalized read counts for each sample.	PV WT3		Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols		strain:AB\|tissue:follice\|developmental stage:pre vitellogenin\|genotype:WT	GSM2640960	GSM2640960: PV WT3; Danio rerio; RNA Seq	GSM2640960		1	Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM2640960	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP108050			PV_WT3_R1.fastq.gz PV_WT3_R2.fastq.gz	fastq fastq	2965772270.0	14976621.0	GSM2640960 r1	0:99.03 1:98.99	A:759343389;C:716154246;G:713466520;T:775995980;N:812135	99	98	759343389	716154246	713466520	775995980	812135	SRX2858036	SRS2228760	SRA566530	GEO	Genomics and Bioinformatics Core, Faculty of Health Sciences, University of Macau	2	0.95025	0.95484	0.02351	0.02292	0.74403	0.74566	0.48148	0.48254	100	98	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	China	2017-05-25	Undetermined	Undetermined	Gonad	Reproductive System
42466	42466	SRR5605447	SRX2858035	SRS2228759	SRP108050	PRJNA388086	Transcriptomic Analysis for Differentially Expressed Genes in Ovarian Follicle Activation and Puberty Onset in the Zebrafish	GSE99308	Transcriptome Analysis	Puberty is a special transition period in sexual maturation and it has been extensively studied in vertebrates in the past decades. In mammals the initiation of puberty involves activation of numerous genes; however there have been few comprehensive reports in small model teleosts such as the zebrafish. In the zebrafish the onset of puberty in females is marked by the appearance of the first wave of pre vitellogenic PV follicles in the ovary during sexual maturation. Using transcriptomics and real time qPCR this study was undertaken to investigate temporal gene expression differences between the primary growth PG follicles and pre vitellogenic PV follicles with particular emphasis on oocyte and follicular cell specific genes as well as several closely associated signaling pathways. Our results showed that totally 1082 genes were significantly upregulated and 530 evidently downregulated during the PG PV transition and among them were some well recognized biomarkers such as cyp19a1a fshr inha and inhbaa and some novel genes like notch3 amh gadd45ga and lpl. Further gene ontology analysis showed that egg coat formation and steroid hormone mediated signaling pathway might be critical for follicle activation from PG to PV stage. In addition KEGG identified several signaling pathways that might play pivotal roles in early folliculogenesis including phosphatidylinositol signaling system glycolsaminoglycan biosynthesis RNA transport and p53 signaling pathways. Overall this study reported a comprehensive analysis for biomarker genes and potential pathways involved in PG PV transition or follicle activation which also marks female puberty onset in the zebrafish when occurring for the first time in sexual maturation. Overall design: Examination of gene expression patterns in 2 different stage follicles PG and PV follicles		pubmed:30364302		PV WT2	GSM2640959		source name:PV WT2\|strain:AB\|tissue:follicle\|developmental stage:pre vitellogenin\|genotype:WT	PV WT2	Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Danio rerio genome version GRCz10 from Ensembl using Tophat2. Parameters: p 6 StringTie and prepDE.py Python script provided with StringTie tool was used to assemble the alignments into transcripts and extract the raw read counts for reference genomic features respectively. The read count matrix was processed by DeSeq2 package for differential gene expression analysis. Genome build: GRCz10 Ensembl build 84 Supplementary files format and content: PG vs PV rawCounts.csv: Raw read counts for each sample. Supplementary files format and content: PG vs PV normCounts.tab: Normalized read counts for each sample.	PV WT2		Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols		strain:AB\|tissue:follicle\|developmental stage:pre vitellogenin\|genotype:WT	GSM2640959	GSM2640959: PV WT2; Danio rerio; RNA Seq	GSM2640959		1	Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM2640959	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP108050			PV_WT2_R2.fastq.gz PV_WT2_R1.fastq.gz	fastq fastq	2021387268.0	10195384.0	GSM2640959 r1	0:99.15 1:99.12	A:517788644;C:487363563;G:485168383;T:530550229;N:516449	99	99	517788644	487363563	485168383	530550229	516449	SRX2858035	SRS2228759	SRA566530	GEO	Genomics and Bioinformatics Core, Faculty of Health Sciences, University of Macau	2	0.95112	0.95441	0.02399	0.02367	0.74221	0.74373	0.47995	0.47334	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	China	2017-05-25	Undetermined	Undetermined	Gonad	Reproductive System
42467	42467	SRR5605446	SRX2858034	SRS2228758	SRP108050	PRJNA388086	Transcriptomic Analysis for Differentially Expressed Genes in Ovarian Follicle Activation and Puberty Onset in the Zebrafish	GSE99308	Transcriptome Analysis	Puberty is a special transition period in sexual maturation and it has been extensively studied in vertebrates in the past decades. In mammals the initiation of puberty involves activation of numerous genes; however there have been few comprehensive reports in small model teleosts such as the zebrafish. In the zebrafish the onset of puberty in females is marked by the appearance of the first wave of pre vitellogenic PV follicles in the ovary during sexual maturation. Using transcriptomics and real time qPCR this study was undertaken to investigate temporal gene expression differences between the primary growth PG follicles and pre vitellogenic PV follicles with particular emphasis on oocyte and follicular cell specific genes as well as several closely associated signaling pathways. Our results showed that totally 1082 genes were significantly upregulated and 530 evidently downregulated during the PG PV transition and among them were some well recognized biomarkers such as cyp19a1a fshr inha and inhbaa and some novel genes like notch3 amh gadd45ga and lpl. Further gene ontology analysis showed that egg coat formation and steroid hormone mediated signaling pathway might be critical for follicle activation from PG to PV stage. In addition KEGG identified several signaling pathways that might play pivotal roles in early folliculogenesis including phosphatidylinositol signaling system glycolsaminoglycan biosynthesis RNA transport and p53 signaling pathways. Overall this study reported a comprehensive analysis for biomarker genes and potential pathways involved in PG PV transition or follicle activation which also marks female puberty onset in the zebrafish when occurring for the first time in sexual maturation. Overall design: Examination of gene expression patterns in 2 different stage follicles PG and PV follicles		pubmed:30364302		PV WT1	GSM2640958		source name:PV WT1\|strain:AB\|tissue:follicle\|developmental stage:pre vitellogenin\|genotype:WT	PV WT1	Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Danio rerio genome version GRCz10 from Ensembl using Tophat2. Parameters: p 6 StringTie and prepDE.py Python script provided with StringTie tool was used to assemble the alignments into transcripts and extract the raw read counts for reference genomic features respectively. The read count matrix was processed by DeSeq2 package for differential gene expression analysis. Genome build: GRCz10 Ensembl build 84 Supplementary files format and content: PG vs PV rawCounts.csv: Raw read counts for each sample. Supplementary files format and content: PG vs PV normCounts.tab: Normalized read counts for each sample.	PV WT1		Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols		strain:AB\|tissue:follicle\|developmental stage:pre vitellogenin\|genotype:WT	GSM2640958	GSM2640958: PV WT1; Danio rerio; RNA Seq	GSM2640958		1	Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM2640958	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP108050			PV_WT1_R1.fastq.gz PV_WT1_R2.fastq.gz	fastq fastq	3244660111.0	16481925.0	GSM2640958 r1	0:98.44 1:98.42	A:831426044;C:781489498;G:779991004;T:848549246;N:3204319	98	98	831426044	781489498	779991004	848549246	3204319	SRX2858034	SRS2228758	SRA566530	GEO	Genomics and Bioinformatics Core, Faculty of Health Sciences, University of Macau	2	0.94778	0.95185	0.02323	0.02295	0.7429	0.74385	0.48023	0.47809	95	95	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	China	2017-05-25	Undetermined	Undetermined	Gonad	Reproductive System
42468	42468	SRR5605445	SRX2858033	SRS2228757	SRP108050	PRJNA388086	Transcriptomic Analysis for Differentially Expressed Genes in Ovarian Follicle Activation and Puberty Onset in the Zebrafish	GSE99308	Transcriptome Analysis	Puberty is a special transition period in sexual maturation and it has been extensively studied in vertebrates in the past decades. In mammals the initiation of puberty involves activation of numerous genes; however there have been few comprehensive reports in small model teleosts such as the zebrafish. In the zebrafish the onset of puberty in females is marked by the appearance of the first wave of pre vitellogenic PV follicles in the ovary during sexual maturation. Using transcriptomics and real time qPCR this study was undertaken to investigate temporal gene expression differences between the primary growth PG follicles and pre vitellogenic PV follicles with particular emphasis on oocyte and follicular cell specific genes as well as several closely associated signaling pathways. Our results showed that totally 1082 genes were significantly upregulated and 530 evidently downregulated during the PG PV transition and among them were some well recognized biomarkers such as cyp19a1a fshr inha and inhbaa and some novel genes like notch3 amh gadd45ga and lpl. Further gene ontology analysis showed that egg coat formation and steroid hormone mediated signaling pathway might be critical for follicle activation from PG to PV stage. In addition KEGG identified several signaling pathways that might play pivotal roles in early folliculogenesis including phosphatidylinositol signaling system glycolsaminoglycan biosynthesis RNA transport and p53 signaling pathways. Overall this study reported a comprehensive analysis for biomarker genes and potential pathways involved in PG PV transition or follicle activation which also marks female puberty onset in the zebrafish when occurring for the first time in sexual maturation. Overall design: Examination of gene expression patterns in 2 different stage follicles PG and PV follicles		pubmed:30364302		PG WT3	GSM2640957		source name:PG WT3\|strain:AB\|tissue:follicle\|developmental stage:primary growth\|genotype:WT	PG WT3	Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Danio rerio genome version GRCz10 from Ensembl using Tophat2. Parameters: p 6 StringTie and prepDE.py Python script provided with StringTie tool was used to assemble the alignments into transcripts and extract the raw read counts for reference genomic features respectively. The read count matrix was processed by DeSeq2 package for differential gene expression analysis. Genome build: GRCz10 Ensembl build 84 Supplementary files format and content: PG vs PV rawCounts.csv: Raw read counts for each sample. Supplementary files format and content: PG vs PV normCounts.tab: Normalized read counts for each sample.	PG WT3		Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols		strain:AB\|tissue:follicle\|developmental stage:primary growth\|genotype:WT	GSM2640957	GSM2640957: PG WT3; Danio rerio; RNA Seq	GSM2640957		1	Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM2640957	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP108050			PG_WT3_R1.fastq.gz PG_WT3_R2.fastq.gz	fastq fastq	1976825713.0	10028723.0	GSM2640957 r1	0:98.57 1:98.54	A:498115588;C:485653640;G:479542298;T:512706941;N:807246	98	98	498115588	485653640	479542298	512706941	807246	SRX2858033	SRS2228757	SRA566530	GEO	Genomics and Bioinformatics Core, Faculty of Health Sciences, University of Macau	2	0.93604	0.93923	0.01349	0.01322	0.76921	0.77029	0.4746	0.4742	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	China	2017-05-25	Undetermined	Undetermined	Gonad	Reproductive System
42469	42469	SRR5605444	SRX2858032	SRS2228756	SRP108050	PRJNA388086	Transcriptomic Analysis for Differentially Expressed Genes in Ovarian Follicle Activation and Puberty Onset in the Zebrafish	GSE99308	Transcriptome Analysis	Puberty is a special transition period in sexual maturation and it has been extensively studied in vertebrates in the past decades. In mammals the initiation of puberty involves activation of numerous genes; however there have been few comprehensive reports in small model teleosts such as the zebrafish. In the zebrafish the onset of puberty in females is marked by the appearance of the first wave of pre vitellogenic PV follicles in the ovary during sexual maturation. Using transcriptomics and real time qPCR this study was undertaken to investigate temporal gene expression differences between the primary growth PG follicles and pre vitellogenic PV follicles with particular emphasis on oocyte and follicular cell specific genes as well as several closely associated signaling pathways. Our results showed that totally 1082 genes were significantly upregulated and 530 evidently downregulated during the PG PV transition and among them were some well recognized biomarkers such as cyp19a1a fshr inha and inhbaa and some novel genes like notch3 amh gadd45ga and lpl. Further gene ontology analysis showed that egg coat formation and steroid hormone mediated signaling pathway might be critical for follicle activation from PG to PV stage. In addition KEGG identified several signaling pathways that might play pivotal roles in early folliculogenesis including phosphatidylinositol signaling system glycolsaminoglycan biosynthesis RNA transport and p53 signaling pathways. Overall this study reported a comprehensive analysis for biomarker genes and potential pathways involved in PG PV transition or follicle activation which also marks female puberty onset in the zebrafish when occurring for the first time in sexual maturation. Overall design: Examination of gene expression patterns in 2 different stage follicles PG and PV follicles		pubmed:30364302		PG WT2	GSM2640956		source name:PG WT2\|strain:AB\|tissue:follicle\|developmental stage:primary growth\|genotype:WT	PG WT2	Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Danio rerio genome version GRCz10 from Ensembl using Tophat2. Parameters: p 6 StringTie and prepDE.py Python script provided with StringTie tool was used to assemble the alignments into transcripts and extract the raw read counts for reference genomic features respectively. The read count matrix was processed by DeSeq2 package for differential gene expression analysis. Genome build: GRCz10 Ensembl build 84 Supplementary files format and content: PG vs PV rawCounts.csv: Raw read counts for each sample. Supplementary files format and content: PG vs PV normCounts.tab: Normalized read counts for each sample.	PG WT2		Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols		strain:AB\|tissue:follicle\|developmental stage:primary growth\|genotype:WT	GSM2640956	GSM2640956: PG WT2; Danio rerio; RNA Seq	GSM2640956		1	Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM2640956	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP108050			PG_WT2_R1.fastq.gz PG_WT2_R2.fastq.gz	fastq fastq	3961495355.0	20078542.0	GSM2640956 r1	0:98.66 1:98.64	A:1001026721;C:972147725;G:960699221;T:1026249480;N:1372208	98	98	1001026721	972147725	960699221	1026249480	1372208	SRX2858032	SRS2228756	SRA566530	GEO	Genomics and Bioinformatics Core, Faculty of Health Sciences, University of Macau	2	0.93922	0.94298	0.01416	0.01405	0.77029	0.77106	0.46461	0.46358	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	China	2017-05-25	Undetermined	Undetermined	Gonad	Reproductive System
42470	42470	SRR5605443	SRX2858031	SRS2228755	SRP108050	PRJNA388086	Transcriptomic Analysis for Differentially Expressed Genes in Ovarian Follicle Activation and Puberty Onset in the Zebrafish	GSE99308	Transcriptome Analysis	Puberty is a special transition period in sexual maturation and it has been extensively studied in vertebrates in the past decades. In mammals the initiation of puberty involves activation of numerous genes; however there have been few comprehensive reports in small model teleosts such as the zebrafish. In the zebrafish the onset of puberty in females is marked by the appearance of the first wave of pre vitellogenic PV follicles in the ovary during sexual maturation. Using transcriptomics and real time qPCR this study was undertaken to investigate temporal gene expression differences between the primary growth PG follicles and pre vitellogenic PV follicles with particular emphasis on oocyte and follicular cell specific genes as well as several closely associated signaling pathways. Our results showed that totally 1082 genes were significantly upregulated and 530 evidently downregulated during the PG PV transition and among them were some well recognized biomarkers such as cyp19a1a fshr inha and inhbaa and some novel genes like notch3 amh gadd45ga and lpl. Further gene ontology analysis showed that egg coat formation and steroid hormone mediated signaling pathway might be critical for follicle activation from PG to PV stage. In addition KEGG identified several signaling pathways that might play pivotal roles in early folliculogenesis including phosphatidylinositol signaling system glycolsaminoglycan biosynthesis RNA transport and p53 signaling pathways. Overall this study reported a comprehensive analysis for biomarker genes and potential pathways involved in PG PV transition or follicle activation which also marks female puberty onset in the zebrafish when occurring for the first time in sexual maturation. Overall design: Examination of gene expression patterns in 2 different stage follicles PG and PV follicles		pubmed:30364302		PG WT1	GSM2640955		source name:PG WT1\|strain:AB\|tissue:follicle\|developmental stage:primary growth\|genotype:WT	PG WT1	Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Danio rerio genome version GRCz10 from Ensembl using Tophat2. Parameters: p 6 StringTie and prepDE.py Python script provided with StringTie tool was used to assemble the alignments into transcripts and extract the raw read counts for reference genomic features respectively. The read count matrix was processed by DeSeq2 package for differential gene expression analysis. Genome build: GRCz10 Ensembl build 84 Supplementary files format and content: PG vs PV rawCounts.csv: Raw read counts for each sample. Supplementary files format and content: PG vs PV normCounts.tab: Normalized read counts for each sample.	PG WT1		Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols		strain:AB\|tissue:follicle\|developmental stage:primary growth\|genotype:WT	GSM2640955	GSM2640955: PG WT1; Danio rerio; RNA Seq	GSM2640955		1	Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM2640955	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP108050			PG_WT1_R1.fastq.gz PG_WT1_R2.fastq.gz	fastq fastq	5007411498.0	25368266.0	GSM2640955 r1	0:98.71 1:98.68	A:1264491896;C:1228178565;G:1216038846;T:1296988060;N:1714131	98	98	1264491896	1228178565	1216038846	1296988060	1714131	SRX2858031	SRS2228755	SRA566530	GEO	Genomics and Bioinformatics Core, Faculty of Health Sciences, University of Macau	2	0.93858	0.94172	0.01418	0.01395	0.76871	0.76995	0.46608	0.46312	100	99	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	China	2017-05-25	Undetermined	Undetermined	Gonad	Reproductive System
44967	44967	SRR6345660	SRX3442976	SRS2733636	SRP126106	PRJNA421016	Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]	GSE107682	Transcriptome Analysis	Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.	parent bioproject:PRJNA315403	pubmed:30086300		smRNA seq library of ovary from tdrd6a mut fish	GSM2875719		source name:Ovary from tdrd6a mut fish\|tissue:whole ovary\|genotype:tdrd6a mutant	smRNA seq library of ovary from tdrd6a mut fish	1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks.	Ovary from tdrd6a mut fish		RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation		tissue:whole ovary\|genotype:tdrd6a mutant	GSM2875719	GSM2875719: smRNA seq library of ovary from tdrd6a mut fish; Danio rerio; ncRNA Seq	GSM2875719		1	RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation	GEO Accession:GSM2875719	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP126106			Tdrd6a-mut-ovary-input-Adult.fastq.gz	fastq	817885062.0	16036962.0	GSM2875719 r1	0:51	A:212456064;C:163491733;G:233627239;T:208262707;N:47319	51		212456064	163491733	233627239	208262707	47319	SRX3442976	SRS2733636	SRA636010	GEO	Rene Ketting, RNA silencing, IMB	1	0.46308		0.13668		0.83587		0.79104		51		B		usable mapping rate	illumina	hiseq_era	5prime	size_fractionation	unknown	sc_generic	single_cell_generic	generic-scrnaseq-only	Germany	2017-12-04	Undetermined	Undetermined	Gonad	Reproductive System
44968	44968	SRR6345659	SRX3442975	SRS2733637	SRP126106	PRJNA421016	Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]	GSE107682	Transcriptome Analysis	Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.	parent bioproject:PRJNA315403	pubmed:30086300		smRNA seq library of ovary from tdrd6a het fish	GSM2875718		source name:Ovary from tdrd6a het fish\|tissue:whole ovary\|genotype:tdrd6a heterozygous	smRNA seq library of ovary from tdrd6a het fish	1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15 6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities. 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to. Supplementary files format and content: Files ending in .bw are bigwig tracks.	Ovary from tdrd6a het fish		RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation		tissue:whole ovary\|genotype:tdrd6a heterozygous	GSM2875718	GSM2875718: smRNA seq library of ovary from tdrd6a het fish; Danio rerio; ncRNA Seq	GSM2875718		1	RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation	GEO Accession:GSM2875718	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP126106			Tdrd6a-het-ovary-input-Adult.fastq.gz	fastq	1452353571.0	28477521.0	GSM2875718 r1	0:51	A:397993735;C:284194126;G:396142390;T:373939235;N:84085	51		397993735	284194126	396142390	373939235	84085	SRX3442975	SRS2733637	SRA636010	GEO	Rene Ketting, RNA silencing, IMB	1	0.3869		0.1369		0.86397		0.77165		51		B		usable mapping rate	illumina	hiseq_era	5prime	size_fractionation	unknown	sc_generic	single_cell_generic	generic-scrnaseq-only	Germany	2017-12-04	Undetermined	Undetermined	Gonad	Reproductive System
47717	47717	SRR6841472	SRX3797301	SRS3049359	SRP135774	PRJNA438478	RNAseq of wild type zebrafish germline ovary oocyte testis	GSE111882	Transcriptome Analysis	Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each		pubmed:30190407;pubmed:34556579		testis rep2	GSM3043290		source name:whole wildtype zebrafish testis dissected from male\|tissue:testis\|genotype:wild type\|strain:TLAB	testis rep2	Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o <output directory> p 16 library type fr firststrand –no novel juncs –g 1 –G <Custom gene table> <Bowtie2 genome index> <fastq reads>”. Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs	whole wildtype zebrafish testis dissected from male		Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.	Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection.	tissue:testis\|genotype:wild type\|strain:TLAB	GSM3043290	GSM3043290: testis rep2; Danio rerio; RNA Seq	GSM3043290		1	Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.	GEO Accession:GSM3043290	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000		SRP135774			zf_testis_2_5_F.fq.gz zf_testis_2_5_R.fq.gz	fastq fastq	5099627816.0	33550183.0	GSM3043290 r1	0:76 1:76	A:1299059138;C:1244888565;G:1262375980;T:1289309350;N:3994783	76	76	1299059138	1244888565	1262375980	1289309350	3994783	SRX3797301	SRS3049359	SRA666799	GEO	IMP	2	0.95446	0.95725	0.13178	0.13422	0.73578	0.74255	0.50147	0.50146	76	76	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Austria	2018-03-15	Undetermined	Undetermined	Gonad	Reproductive System
47718	47718	SRR6841473	SRX3797301	SRS3049359	SRP135774	PRJNA438478	RNAseq of wild type zebrafish germline ovary oocyte testis	GSE111882	Transcriptome Analysis	Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each		pubmed:30190407;pubmed:34556579		testis rep2	GSM3043290		source name:whole wildtype zebrafish testis dissected from male\|tissue:testis\|genotype:wild type\|strain:TLAB	testis rep2	Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o <output directory> p 16 library type fr firststrand –no novel juncs –g 1 –G <Custom gene table> <Bowtie2 genome index> <fastq reads>”. Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs	whole wildtype zebrafish testis dissected from male		Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.	Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection.	tissue:testis\|genotype:wild type\|strain:TLAB	GSM3043290	GSM3043290: testis rep2; Danio rerio; RNA Seq	GSM3043290		1	Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.	GEO Accession:GSM3043290	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000		SRP135774			zf_testis_2_6_R.fq.gz zf_testis_2_6_F.fq.gz	fastq fastq	4863124784.0	31994242.0	GSM3043290 r2	0:76 1:76	A:1239366804;C:1186097287;G:1202405036;T:1232271257;N:2984400	76	76	1239366804	1186097287	1202405036	1232271257	2984400	SRX3797301	SRS3049359	SRA666799	GEO	IMP	2	0.94462	0.95606	0.13046	0.13473	0.73551	0.74063	0.50501	0.50288	76	76	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Austria	2018-03-15	Undetermined	Undetermined	Gonad	Reproductive System
47719	47719	SRR6841474	SRX3797301	SRS3049359	SRP135774	PRJNA438478	RNAseq of wild type zebrafish germline ovary oocyte testis	GSE111882	Transcriptome Analysis	Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each		pubmed:30190407;pubmed:34556579		testis rep2	GSM3043290		source name:whole wildtype zebrafish testis dissected from male\|tissue:testis\|genotype:wild type\|strain:TLAB	testis rep2	Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o <output directory> p 16 library type fr firststrand –no novel juncs –g 1 –G <Custom gene table> <Bowtie2 genome index> <fastq reads>”. Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs	whole wildtype zebrafish testis dissected from male		Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.	Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection.	tissue:testis\|genotype:wild type\|strain:TLAB	GSM3043290	GSM3043290: testis rep2; Danio rerio; RNA Seq	GSM3043290		1	Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.	GEO Accession:GSM3043290	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000		SRP135774			zf_testis_2_7_F.fq.gz zf_testis_2_7_R.fq.gz	fastq fastq	5026658088.0	33070119.0	GSM3043290 r3	0:76 1:76	A:1279542888;C:1226763768;G:1244243364;T:1271608208;N:4499860	76	76	1279542888	1226763768	1244243364	1271608208	4499860	SRX3797301	SRS3049359	SRA666799	GEO	IMP	2	0.94351	0.95825	0.12954	0.1332	0.73645	0.7413	0.50092	0.49891	76	76	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Austria	2018-03-15	Undetermined	Undetermined	Gonad	Reproductive System
47720	47720	SRR6841469	SRX3797300	SRS3049358	SRP135774	PRJNA438478	RNAseq of wild type zebrafish germline ovary oocyte testis	GSE111882	Transcriptome Analysis	Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each		pubmed:30190407;pubmed:34556579		testis rep1	GSM3043289		source name:whole wildtype zebrafish testis dissected from male\|tissue:testis\|genotype:wild type\|strain:TLAB	testis rep1	Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o <output directory> p 16 library type fr firststrand –no novel juncs –g 1 –G <Custom gene table> <Bowtie2 genome index> <fastq reads>”. Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs	whole wildtype zebrafish testis dissected from male		Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.	Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection.	tissue:testis\|genotype:wild type\|strain:TLAB	GSM3043289	GSM3043289: testis rep1; Danio rerio; RNA Seq	GSM3043289		1	Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.	GEO Accession:GSM3043289	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000		SRP135774			zf_testis_1_5_F.fq.gz zf_testis_1_5_R.fq.gz	fastq fastq	5828604008.0	38346079.0	GSM3043289 r1	0:76 1:76	A:1496363417;C:1405966872;G:1430979231;T:1490547871;N:4746617	76	76	1496363417	1405966872	1430979231	1490547871	4746617	SRX3797300	SRS3049358	SRA666799	GEO	IMP	2	0.95085	0.95291	0.13996	0.1422	0.70873	0.71662	0.5006	0.50954	76	76	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Austria	2018-03-15	Undetermined	Undetermined	Gonad	Reproductive System
47721	47721	SRR6841470	SRX3797300	SRS3049358	SRP135774	PRJNA438478	RNAseq of wild type zebrafish germline ovary oocyte testis	GSE111882	Transcriptome Analysis	Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each		pubmed:30190407;pubmed:34556579		testis rep1	GSM3043289		source name:whole wildtype zebrafish testis dissected from male\|tissue:testis\|genotype:wild type\|strain:TLAB	testis rep1	Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o <output directory> p 16 library type fr firststrand –no novel juncs –g 1 –G <Custom gene table> <Bowtie2 genome index> <fastq reads>”. Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs	whole wildtype zebrafish testis dissected from male		Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.	Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection.	tissue:testis\|genotype:wild type\|strain:TLAB	GSM3043289	GSM3043289: testis rep1; Danio rerio; RNA Seq	GSM3043289		1	Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.	GEO Accession:GSM3043289	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000		SRP135774			zf_testis_1_6_F.fq.gz zf_testis_1_6_R.fq.gz	fastq fastq	5548288344.0	36501897.0	GSM3043289 r2	0:76 1:76	A:1424701888;C:1337280760;G:1360693266;T:1422058469;N:3553961	76	76	1424701888	1337280760	1360693266	1422058469	3553961	SRX3797300	SRS3049358	SRA666799	GEO	IMP	2	0.93973	0.95206	0.13904	0.14259	0.70999	0.7177	0.49362	0.50295	76	76	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Austria	2018-03-15	Undetermined	Undetermined	Gonad	Reproductive System
47722	47722	SRR6841471	SRX3797300	SRS3049358	SRP135774	PRJNA438478	RNAseq of wild type zebrafish germline ovary oocyte testis	GSE111882	Transcriptome Analysis	Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each		pubmed:30190407;pubmed:34556579		testis rep1	GSM3043289		source name:whole wildtype zebrafish testis dissected from male\|tissue:testis\|genotype:wild type\|strain:TLAB	testis rep1	Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o <output directory> p 16 library type fr firststrand –no novel juncs –g 1 –G <Custom gene table> <Bowtie2 genome index> <fastq reads>”. Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs	whole wildtype zebrafish testis dissected from male		Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.	Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection.	tissue:testis\|genotype:wild type\|strain:TLAB	GSM3043289	GSM3043289: testis rep1; Danio rerio; RNA Seq	GSM3043289		1	Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.	GEO Accession:GSM3043289	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000		SRP135774			zf_testis_1_7_F.fq.gz zf_testis_1_7_R.fq.gz	fastq fastq	5685121784.0	37402117.0	GSM3043289 r3	0:76 1:76	A:1458152144;C:1370999956;G:1396053726;T:1454648231;N:5267727	76	76	1458152144	1370999956	1396053726	1454648231	5267727	SRX3797300	SRS3049358	SRA666799	GEO	IMP	2	0.9388	0.95443	0.13734	0.14167	0.70759	0.71593	0.49681	0.50673	76	76	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Austria	2018-03-15	Undetermined	Undetermined	Gonad	Reproductive System
47729	47729	SRR6841460	SRX3797297	SRS3049356	SRP135774	PRJNA438478	RNAseq of wild type zebrafish germline ovary oocyte testis	GSE111882	Transcriptome Analysis	Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each		pubmed:30190407;pubmed:34556579		ovary rep2	GSM3043286		source name:whole wildtype zebrafish ovary dissected from female\|tissue:ovary\|genotype:wild type\|strain:TLAB	ovary rep2	Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o <output directory> p 16 library type fr firststrand –no novel juncs –g 1 –G <Custom gene table> <Bowtie2 genome index> <fastq reads>”. Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs	whole wildtype zebrafish ovary dissected from female		Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.	Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection.	tissue:ovary\|genotype:wild type\|strain:TLAB	GSM3043286	GSM3043286: ovary rep2; Danio rerio; RNA Seq	GSM3043286		1	Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.	GEO Accession:GSM3043286	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000		SRP135774			zf_ovary_2_5_R.fq.gz zf_ovary_2_5_F.fq.gz	fastq fastq	5760370600.0	37897175.0	GSM3043286 r1	0:76 1:76	A:1438701176;C:1432115027;G:1438947886;T:1446014914;N:4591597	76	76	1438701176	1432115027	1438947886	1446014914	4591597	SRX3797297	SRS3049356	SRA666799	GEO	IMP	2	0.93588	0.94232	0.0501	0.05082	0.79527	0.79955	0.49845	0.49442	76	76	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Austria	2018-03-15	Undetermined	Undetermined	Gonad	Reproductive System
47730	47730	SRR6841461	SRX3797297	SRS3049356	SRP135774	PRJNA438478	RNAseq of wild type zebrafish germline ovary oocyte testis	GSE111882	Transcriptome Analysis	Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each		pubmed:30190407;pubmed:34556579		ovary rep2	GSM3043286		source name:whole wildtype zebrafish ovary dissected from female\|tissue:ovary\|genotype:wild type\|strain:TLAB	ovary rep2	Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o <output directory> p 16 library type fr firststrand –no novel juncs –g 1 –G <Custom gene table> <Bowtie2 genome index> <fastq reads>”. Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs	whole wildtype zebrafish ovary dissected from female		Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.	Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection.	tissue:ovary\|genotype:wild type\|strain:TLAB	GSM3043286	GSM3043286: ovary rep2; Danio rerio; RNA Seq	GSM3043286		1	Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.	GEO Accession:GSM3043286	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000		SRP135774			zf_ovary_2_6_F.fq.gz zf_ovary_2_6_R.fq.gz	fastq fastq	5494881168.0	36150534.0	GSM3043286 r2	0:76 1:76	A:1372809163;C:1365261188;G:1371912460;T:1381448918;N:3449439	76	76	1372809163	1365261188	1371912460	1381448918	3449439	SRX3797297	SRS3049356	SRA666799	GEO	IMP	2	0.93073	0.94077	0.04966	0.05048	0.79774	0.80014	0.49517	0.49843	76	76	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Austria	2018-03-15	Undetermined	Undetermined	Gonad	Reproductive System
47731	47731	SRR6841462	SRX3797297	SRS3049356	SRP135774	PRJNA438478	RNAseq of wild type zebrafish germline ovary oocyte testis	GSE111882	Transcriptome Analysis	Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each		pubmed:30190407;pubmed:34556579		ovary rep2	GSM3043286		source name:whole wildtype zebrafish ovary dissected from female\|tissue:ovary\|genotype:wild type\|strain:TLAB	ovary rep2	Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o <output directory> p 16 library type fr firststrand –no novel juncs –g 1 –G <Custom gene table> <Bowtie2 genome index> <fastq reads>”. Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs	whole wildtype zebrafish ovary dissected from female		Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.	Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection.	tissue:ovary\|genotype:wild type\|strain:TLAB	GSM3043286	GSM3043286: ovary rep2; Danio rerio; RNA Seq	GSM3043286		1	Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.	GEO Accession:GSM3043286	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000		SRP135774			zf_ovary_2_7_F.fq.gz zf_ovary_2_7_R.fq.gz	fastq fastq	5666410584.0	37279017.0	GSM3043286 r3	0:76 1:76	A:1414483905;C:1408220336;G:1415545424;T:1423029758;N:5131161	76	76	1414483905	1408220336	1415545424	1423029758	5131161	SRX3797297	SRS3049356	SRA666799	GEO	IMP	2	0.9299	0.94287	0.04893	0.04939	0.7974	0.80135	0.49935	0.49202	76	76	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Austria	2018-03-15	Undetermined	Undetermined	Gonad	Reproductive System
47732	47732	SRR6841457	SRX3797296	SRS3049354	SRP135774	PRJNA438478	RNAseq of wild type zebrafish germline ovary oocyte testis	GSE111882	Transcriptome Analysis	Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each		pubmed:30190407;pubmed:34556579		ovary rep1	GSM3043285		source name:whole wildtype zebrafish ovary dissected from female\|tissue:ovary\|genotype:wild type\|strain:TLAB	ovary rep1	Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o <output directory> p 16 library type fr firststrand –no novel juncs –g 1 –G <Custom gene table> <Bowtie2 genome index> <fastq reads>”. Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs	whole wildtype zebrafish ovary dissected from female		Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.	Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection.	tissue:ovary\|genotype:wild type\|strain:TLAB	GSM3043285	GSM3043285: ovary rep1; Danio rerio; RNA Seq	GSM3043285		1	Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.	GEO Accession:GSM3043285	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000		SRP135774			zf_ovary_1_5_R.fq.gz zf_ovary_1_5_F.fq.gz	fastq fastq	6093708728.0	40090189.0	GSM3043285 r1	0:76 1:76	A:1532089324;C:1504701252;G:1515053503;T:1536814286;N:5050363	76	76	1532089324	1504701252	1515053503	1536814286	5050363	SRX3797296	SRS3049354	SRA666799	GEO	IMP	2	0.93785	0.9429	0.0338	0.03321	0.78628	0.7903	0.48856	0.47641	76	76	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Austria	2018-03-15	Undetermined	Undetermined	Gonad	Reproductive System
47733	47733	SRR6841458	SRX3797296	SRS3049354	SRP135774	PRJNA438478	RNAseq of wild type zebrafish germline ovary oocyte testis	GSE111882	Transcriptome Analysis	Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each		pubmed:30190407;pubmed:34556579		ovary rep1	GSM3043285		source name:whole wildtype zebrafish ovary dissected from female\|tissue:ovary\|genotype:wild type\|strain:TLAB	ovary rep1	Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o <output directory> p 16 library type fr firststrand –no novel juncs –g 1 –G <Custom gene table> <Bowtie2 genome index> <fastq reads>”. Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs	whole wildtype zebrafish ovary dissected from female		Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.	Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection.	tissue:ovary\|genotype:wild type\|strain:TLAB	GSM3043285	GSM3043285: ovary rep1; Danio rerio; RNA Seq	GSM3043285		1	Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.	GEO Accession:GSM3043285	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000		SRP135774			zf_ovary_1_6_R.fq.gz zf_ovary_1_6_F.fq.gz	fastq fastq	5797092432.0	38138766.0	GSM3043285 r2	0:76 1:76	A:1457841031;C:1430894241;G:1440413370;T:1464148562;N:3795228	76	76	1457841031	1430894241	1440413370	1464148562	3795228	SRX3797296	SRS3049354	SRA666799	GEO	IMP	2	0.93123	0.94187	0.03345	0.03344	0.78616	0.78991	0.48359	0.48306	76	76	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Austria	2018-03-15	Undetermined	Undetermined	Gonad	Reproductive System
47734	47734	SRR6841459	SRX3797296	SRS3049354	SRP135774	PRJNA438478	RNAseq of wild type zebrafish germline ovary oocyte testis	GSE111882	Transcriptome Analysis	Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each		pubmed:30190407;pubmed:34556579		ovary rep1	GSM3043285		source name:whole wildtype zebrafish ovary dissected from female\|tissue:ovary\|genotype:wild type\|strain:TLAB	ovary rep1	Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o <output directory> p 16 library type fr firststrand –no novel juncs –g 1 –G <Custom gene table> <Bowtie2 genome index> <fastq reads>”. Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs	whole wildtype zebrafish ovary dissected from female		Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.	Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection.	tissue:ovary\|genotype:wild type\|strain:TLAB	GSM3043285	GSM3043285: ovary rep1; Danio rerio; RNA Seq	GSM3043285		1	Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.	GEO Accession:GSM3043285	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000		SRP135774			zf_ovary_1_7_R.fq.gz zf_ovary_1_7_F.fq.gz	fastq fastq	5924015928.0	38973789.0	GSM3043285 r3	0:76 1:76	A:1488452513;C:1462498287;G:1473066232;T:1494401585;N:5597311	76	76	1488452513	1462498287	1473066232	1494401585	5597311	SRX3797296	SRS3049354	SRA666799	GEO	IMP	2	0.93218	0.94439	0.03341	0.03312	0.78715	0.79172	0.48512	0.48267	76	76	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Austria	2018-03-15	Undetermined	Undetermined	Gonad	Reproductive System
52150	52150	SRR18181456	SRX14328420	SRS12144051	SRP194254	PRJNA540466	Characterization of the zebrafish cell landscape at single cell resolution	GSE130487	Transcriptome Analysis	Zebrafish have been found to be a premier model organism in biological and regeneration research. However the comprehensive cell compositions and molecular dynamics during tissue regeneration in zebrafish remain poorly understood. Here we utilized Microwell seq to analyze more than 250 000 single cells covering major zebrafish cell types and constructed a systematic zebrafish cell landscape. We revealed single cell compositions for 18 zebrafish tissue types covering both embryo and adult stages. Single cell mapping of caudal fin regeneration revealed a unique characteristic of blastema population and key genetic regulation involved in zebrafish tissue repair. Overall our single cell datasets demonstrate the utility of zebrafish cell landscape resources in various fields of biological research. Overall design: Expression profiling by high throughput sequencing of major zebrafish organ types. Please note that 19 samples were added and 9 samples were deleted on Mar 1 2022.		pubmed:34660600		Testis7	GSM5924294		source name:testis\|strain:Tubingen\|tissue:testis\|genotype:wild type	Testis7	Base calls were performed with Illumina bcl2fastq Sequenced reads were trimmed for adaptor sequence.Then reads in bam files were tagged with the cell and molecular UMI barcode sequences using Drop seq tools 1.12.The cell barcodes are tagged as XC in the bam file and the UMI is tagged as XM in the bam file. The reads quality under 10 were removed. ScRNA seq reads were aligned to the Mus musculus.GRCm38.88 genome assembly using STAR version 2.5.2a with default configurations. Next merge the STAR alignment tagged bam SAM to recover cell /molecular barcodes and the reads are annotated with exon tags. Last we demultiplexed all cell barcodes taken into consideration for the analysis from the exon tagged bam files to get a digital expression matrix based on UMI counts. Genome build: Danio rerio GRCz10 Supplementary files format and content: tab delimited text files of digital expression matrix dge based on raw UMI counts columns are cells and rows are genes.	testis		Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol		strain:Tubingen\|tissue:testis\|genotype:wild type	GSM5924294	GSM5924294: Testis7; Danio rerio; RNA Seq	GSM5924294		1	Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol	GEO Accession:GSM5924294	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten		SRP194254		assembly:Danio rerio GRCz10\|intentional duplicate	Testis7.bam	bam	22355333400.0	74517778.0	GSM5924294 r1	0:150 1:150	A:6035271880;C:3425705783;G:3638861956;T:9252935935;N:2557846	150	150	6035271880	3425705783	3638861956	9252935935	2557846	SRX14328420	SRS12144051	SRA880843	GEO	Zhejiang University	2	2e-05	0.65459	0.0	0.06753	0.99997	0.78981	1.0	0.50866	150	150	T	B	mate1 technical by mapping diff	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	microwellseq	China	2022-03-01	Undetermined	Multi-stage	Gonad	Reproductive System
52151	52151	SRR18181455	SRX14328419	SRS12144050	SRP194254	PRJNA540466	Characterization of the zebrafish cell landscape at single cell resolution	GSE130487	Transcriptome Analysis	Zebrafish have been found to be a premier model organism in biological and regeneration research. However the comprehensive cell compositions and molecular dynamics during tissue regeneration in zebrafish remain poorly understood. Here we utilized Microwell seq to analyze more than 250 000 single cells covering major zebrafish cell types and constructed a systematic zebrafish cell landscape. We revealed single cell compositions for 18 zebrafish tissue types covering both embryo and adult stages. Single cell mapping of caudal fin regeneration revealed a unique characteristic of blastema population and key genetic regulation involved in zebrafish tissue repair. Overall our single cell datasets demonstrate the utility of zebrafish cell landscape resources in various fields of biological research. Overall design: Expression profiling by high throughput sequencing of major zebrafish organ types. Please note that 19 samples were added and 9 samples were deleted on Mar 1 2022.		pubmed:34660600		Testis6	GSM5924293		source name:testis\|strain:Tubingen\|tissue:testis\|genotype:wild type	Testis6	Base calls were performed with Illumina bcl2fastq Sequenced reads were trimmed for adaptor sequence.Then reads in bam files were tagged with the cell and molecular UMI barcode sequences using Drop seq tools 1.12.The cell barcodes are tagged as XC in the bam file and the UMI is tagged as XM in the bam file. The reads quality under 10 were removed. ScRNA seq reads were aligned to the Mus musculus.GRCm38.88 genome assembly using STAR version 2.5.2a with default configurations. Next merge the STAR alignment tagged bam SAM to recover cell /molecular barcodes and the reads are annotated with exon tags. Last we demultiplexed all cell barcodes taken into consideration for the analysis from the exon tagged bam files to get a digital expression matrix based on UMI counts. Genome build: Danio rerio GRCz10 Supplementary files format and content: tab delimited text files of digital expression matrix dge based on raw UMI counts columns are cells and rows are genes.	testis		Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol		strain:Tubingen\|tissue:testis\|genotype:wild type	GSM5924293	GSM5924293: Testis6; Danio rerio; RNA Seq	GSM5924293		1	Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol	GEO Accession:GSM5924293	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten		SRP194254		assembly:Danio rerio GRCz10\|intentional duplicate	Testis6.bam	bam	26427119100.0	88090397.0	GSM5924293 r1	0:150 1:150	A:6656757738;C:4332393726;G:4530415358;T:10904715070;N:2837208	150	150	6656757738	4332393726	4530415358	10904715070	2837208	SRX14328419	SRS12144050	SRA880843	GEO	Zhejiang University	2	5e-05	0.71817	0.0	0.06748	0.99993	0.78642	0.66666	0.5085	150	150	T	B	mate1 technical by mapping diff	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	microwellseq	China	2022-03-01	Undetermined	Multi-stage	Gonad	Reproductive System
52157	52157	SRR18181449	SRX14328413	SRS12144044	SRP194254	PRJNA540466	Characterization of the zebrafish cell landscape at single cell resolution	GSE130487	Transcriptome Analysis	Zebrafish have been found to be a premier model organism in biological and regeneration research. However the comprehensive cell compositions and molecular dynamics during tissue regeneration in zebrafish remain poorly understood. Here we utilized Microwell seq to analyze more than 250 000 single cells covering major zebrafish cell types and constructed a systematic zebrafish cell landscape. We revealed single cell compositions for 18 zebrafish tissue types covering both embryo and adult stages. Single cell mapping of caudal fin regeneration revealed a unique characteristic of blastema population and key genetic regulation involved in zebrafish tissue repair. Overall our single cell datasets demonstrate the utility of zebrafish cell landscape resources in various fields of biological research. Overall design: Expression profiling by high throughput sequencing of major zebrafish organ types. Please note that 19 samples were added and 9 samples were deleted on Mar 1 2022.		pubmed:34660600		Ovary5	GSM5924287		source name:ovary\|strain:Tubingen\|tissue:ovary\|genotype:wild type	Ovary5	Base calls were performed with Illumina bcl2fastq Sequenced reads were trimmed for adaptor sequence.Then reads in bam files were tagged with the cell and molecular UMI barcode sequences using Drop seq tools 1.12.The cell barcodes are tagged as XC in the bam file and the UMI is tagged as XM in the bam file. The reads quality under 10 were removed. ScRNA seq reads were aligned to the Mus musculus.GRCm38.88 genome assembly using STAR version 2.5.2a with default configurations. Next merge the STAR alignment tagged bam SAM to recover cell /molecular barcodes and the reads are annotated with exon tags. Last we demultiplexed all cell barcodes taken into consideration for the analysis from the exon tagged bam files to get a digital expression matrix based on UMI counts. Genome build: Danio rerio GRCz10 Supplementary files format and content: tab delimited text files of digital expression matrix dge based on raw UMI counts columns are cells and rows are genes.	ovary		Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol		strain:Tubingen\|tissue:ovary\|genotype:wild type	GSM5924287	GSM5924287: Ovary5; Danio rerio; RNA Seq	GSM5924287		1	Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol	GEO Accession:GSM5924287	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten		SRP194254		assembly:Danio rerio GRCz10\|intentional duplicate	Ovary5.bam	bam	19803996900.0	66013323.0	GSM5924287 r1	0:150 1:150	A:5073828462;C:3239587102;G:3356397736;T:8132061615;N:2121985	150	150	5073828462	3239587102	3356397736	8132061615	2121985	SRX14328413	SRS12144044	SRA880843	GEO	Zhejiang University	2	0.0	0.69276	0.0	0.03046	1.0	0.8297		0.5054	150	150	T	B	mate1 technical by mapping diff	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	microwellseq	China	2022-03-01	Undetermined	Multi-stage	Gonad	Reproductive System
52158	52158	SRR18181448	SRX14328412	SRS12144043	SRP194254	PRJNA540466	Characterization of the zebrafish cell landscape at single cell resolution	GSE130487	Transcriptome Analysis	Zebrafish have been found to be a premier model organism in biological and regeneration research. However the comprehensive cell compositions and molecular dynamics during tissue regeneration in zebrafish remain poorly understood. Here we utilized Microwell seq to analyze more than 250 000 single cells covering major zebrafish cell types and constructed a systematic zebrafish cell landscape. We revealed single cell compositions for 18 zebrafish tissue types covering both embryo and adult stages. Single cell mapping of caudal fin regeneration revealed a unique characteristic of blastema population and key genetic regulation involved in zebrafish tissue repair. Overall our single cell datasets demonstrate the utility of zebrafish cell landscape resources in various fields of biological research. Overall design: Expression profiling by high throughput sequencing of major zebrafish organ types. Please note that 19 samples were added and 9 samples were deleted on Mar 1 2022.		pubmed:34660600		Ovary4	GSM5924286		source name:ovary\|strain:Tubingen\|tissue:ovary\|genotype:wild type	Ovary4	Base calls were performed with Illumina bcl2fastq Sequenced reads were trimmed for adaptor sequence.Then reads in bam files were tagged with the cell and molecular UMI barcode sequences using Drop seq tools 1.12.The cell barcodes are tagged as XC in the bam file and the UMI is tagged as XM in the bam file. The reads quality under 10 were removed. ScRNA seq reads were aligned to the Mus musculus.GRCm38.88 genome assembly using STAR version 2.5.2a with default configurations. Next merge the STAR alignment tagged bam SAM to recover cell /molecular barcodes and the reads are annotated with exon tags. Last we demultiplexed all cell barcodes taken into consideration for the analysis from the exon tagged bam files to get a digital expression matrix based on UMI counts. Genome build: Danio rerio GRCz10 Supplementary files format and content: tab delimited text files of digital expression matrix dge based on raw UMI counts columns are cells and rows are genes.	ovary		Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol		strain:Tubingen\|tissue:ovary\|genotype:wild type	GSM5924286	GSM5924286: Ovary4; Danio rerio; RNA Seq	GSM5924286		1	Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol	GEO Accession:GSM5924286	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten		SRP194254		assembly:Danio rerio GRCz10\|intentional duplicate	Ovary4.bam	bam	18909491400.0	63031638.0	GSM5924286 r1	0:150 1:150	A:4449523781;C:3271362982;G:3415526983;T:7771066311;N:2011343	150	150	4449523781	3271362982	3415526983	7771066311	2011343	SRX14328412	SRS12144043	SRA880843	GEO	Zhejiang University	2	2e-05	0.80325	0.0	0.03273	0.99997	0.81895	1.0	0.53235	150	150	T	B	mate1 technical by mapping diff	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	microwellseq	China	2022-03-01	Undetermined	Multi-stage	Gonad	Reproductive System
52181	52181	SRR9058966	SRX5835166	SRS4761462	SRP194254	PRJNA540466	Characterization of the zebrafish cell landscape at single cell resolution	GSE130487	Transcriptome Analysis	Zebrafish have been found to be a premier model organism in biological and regeneration research. However the comprehensive cell compositions and molecular dynamics during tissue regeneration in zebrafish remain poorly understood. Here we utilized Microwell seq to analyze more than 250 000 single cells covering major zebrafish cell types and constructed a systematic zebrafish cell landscape. We revealed single cell compositions for 18 zebrafish tissue types covering both embryo and adult stages. Single cell mapping of caudal fin regeneration revealed a unique characteristic of blastema population and key genetic regulation involved in zebrafish tissue repair. Overall our single cell datasets demonstrate the utility of zebrafish cell landscape resources in various fields of biological research. Overall design: Expression profiling by high throughput sequencing of major zebrafish organ types. Please note that 19 samples were added and 9 samples were deleted on Mar 1 2022.		pubmed:34660600		Testis2	GSM3768163		source name:testis\|strain:Tubingen\|genotype/variation:wild type\|tissue:testis	Testis2	Base calls were performed with Illumina bcl2fastq Sequenced reads were trimmed for adaptor sequence.Then reads in bam files were tagged with the cell and molecular UMI barcode sequences using Drop seq tools 1.12.The cell barcodes are tagged as XC in the bam file and the UMI is tagged as XM in the bam file. The reads quality under 10 were removed. ScRNA seq reads were aligned to the Danio rerio GRCz10 genome assembly using STAR version 2.5.2a with default configurations. Next merge the STAR alignment tagged bam SAM to recover cell /molecular barcodes and the reads are annotated with exon tags. Last we demultiplexed all cell barcodes taken into consideration for the analysis from the exon tagged bam files to get a digital expression matrix based on UMI counts. Genome build: Danio rerio GRCz10 Supplementary files format and content: tab delimited text files of digital expression matrix dge based on raw UMI counts columns are cells and rows are genes.	testis		Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol		strain:Tubingen\|genotype/variation:wild type\|tissue:testis	GSM3768163	GSM3768163: Testis2; Danio rerio; RNA Seq	GSM3768163		1	Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol	GEO Accession:GSM3768163	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq X Ten		SRP194254		assembly:http://dec2017.archive.ensembl.org/Danio rerio/Info/Index	Testis2.bam	bam	10897833300.0	36326111.0	GSM3768163 r1	0:150 1:150	A:2949189012;C:1827068947;G:1843781525;T:4276886403;N:907413	150	150	2949189012	1827068947	1843781525	4276886403	907413	SRX5835166	SRS4761462	SRA880843	GEO	Zhejiang University	2	5e-05	0.72733	1e-05	0.0449	0.99995	0.78216	0.5	0.50959	150	150	T	B	mate1 technical by mapping diff	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	microwellseq	China	2019-05-15	Undetermined	Multi-stage	Gonad	Reproductive System
52182	52182	SRR9058965	SRX5835165	SRS4761461	SRP194254	PRJNA540466	Characterization of the zebrafish cell landscape at single cell resolution	GSE130487	Transcriptome Analysis	Zebrafish have been found to be a premier model organism in biological and regeneration research. However the comprehensive cell compositions and molecular dynamics during tissue regeneration in zebrafish remain poorly understood. Here we utilized Microwell seq to analyze more than 250 000 single cells covering major zebrafish cell types and constructed a systematic zebrafish cell landscape. We revealed single cell compositions for 18 zebrafish tissue types covering both embryo and adult stages. Single cell mapping of caudal fin regeneration revealed a unique characteristic of blastema population and key genetic regulation involved in zebrafish tissue repair. Overall our single cell datasets demonstrate the utility of zebrafish cell landscape resources in various fields of biological research. Overall design: Expression profiling by high throughput sequencing of major zebrafish organ types. Please note that 19 samples were added and 9 samples were deleted on Mar 1 2022.		pubmed:34660600		Testis1	GSM3768162		source name:testis\|strain:Tubingen\|genotype/variation:wild type\|tissue:testis	Testis1	Base calls were performed with Illumina bcl2fastq Sequenced reads were trimmed for adaptor sequence.Then reads in bam files were tagged with the cell and molecular UMI barcode sequences using Drop seq tools 1.12.The cell barcodes are tagged as XC in the bam file and the UMI is tagged as XM in the bam file. The reads quality under 10 were removed. ScRNA seq reads were aligned to the Danio rerio GRCz10 genome assembly using STAR version 2.5.2a with default configurations. Next merge the STAR alignment tagged bam SAM to recover cell /molecular barcodes and the reads are annotated with exon tags. Last we demultiplexed all cell barcodes taken into consideration for the analysis from the exon tagged bam files to get a digital expression matrix based on UMI counts. Genome build: Danio rerio GRCz10 Supplementary files format and content: tab delimited text files of digital expression matrix dge based on raw UMI counts columns are cells and rows are genes.	testis		Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol		strain:Tubingen\|genotype/variation:wild type\|tissue:testis	GSM3768162	GSM3768162: Testis1; Danio rerio; RNA Seq	GSM3768162		1	Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol	GEO Accession:GSM3768162	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq X Ten		SRP194254		assembly:http://dec2017.archive.ensembl.org/Danio rerio/Info/Index	Testis1.bam	bam	20087467800.0	66958226.0	GSM3768162 r1	0:150 1:150	A:5333777727;C:3476144155;G:3519583110;T:7754981380;N:2981428	150	150	5333777727	3476144155	3519583110	7754981380	2981428	SRX5835165	SRS4761461	SRA880843	GEO	Zhejiang University	2	3e-05	0.71273	0.0	0.05569	0.99997	0.78151	1.0	0.49988	150	150	T	B	mate1 technical by mapping diff	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	microwellseq	China	2019-05-15	Undetermined	Multi-stage	Gonad	Reproductive System
52183	52183	SRR9058964	SRX5835164	SRS4761460	SRP194254	PRJNA540466	Characterization of the zebrafish cell landscape at single cell resolution	GSE130487	Transcriptome Analysis	Zebrafish have been found to be a premier model organism in biological and regeneration research. However the comprehensive cell compositions and molecular dynamics during tissue regeneration in zebrafish remain poorly understood. Here we utilized Microwell seq to analyze more than 250 000 single cells covering major zebrafish cell types and constructed a systematic zebrafish cell landscape. We revealed single cell compositions for 18 zebrafish tissue types covering both embryo and adult stages. Single cell mapping of caudal fin regeneration revealed a unique characteristic of blastema population and key genetic regulation involved in zebrafish tissue repair. Overall our single cell datasets demonstrate the utility of zebrafish cell landscape resources in various fields of biological research. Overall design: Expression profiling by high throughput sequencing of major zebrafish organ types. Please note that 19 samples were added and 9 samples were deleted on Mar 1 2022.		pubmed:34660600		Ovary2	GSM3768161		source name:ovary\|strain:Tubingen\|genotype/variation:wild type\|tissue:ovary	Ovary2	Base calls were performed with Illumina bcl2fastq Sequenced reads were trimmed for adaptor sequence.Then reads in bam files were tagged with the cell and molecular UMI barcode sequences using Drop seq tools 1.12.The cell barcodes are tagged as XC in the bam file and the UMI is tagged as XM in the bam file. The reads quality under 10 were removed. ScRNA seq reads were aligned to the Danio rerio GRCz10 genome assembly using STAR version 2.5.2a with default configurations. Next merge the STAR alignment tagged bam SAM to recover cell /molecular barcodes and the reads are annotated with exon tags. Last we demultiplexed all cell barcodes taken into consideration for the analysis from the exon tagged bam files to get a digital expression matrix based on UMI counts. Genome build: Danio rerio GRCz10 Supplementary files format and content: tab delimited text files of digital expression matrix dge based on raw UMI counts columns are cells and rows are genes.	ovary		Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol		strain:Tubingen\|genotype/variation:wild type\|tissue:ovary	GSM3768161	GSM3768161: Ovary2; Danio rerio; RNA Seq	GSM3768161		1	Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol	GEO Accession:GSM3768161	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq X Ten		SRP194254		assembly:http://dec2017.archive.ensembl.org/Danio rerio/Info/Index	Ovary2.bam	bam	27873510686.0	92296393.0	GSM3768161 r1	0:151 1:151	A:7431755509;C:4813567006;G:4753054905;T:10804284010;N:70849256	151	151	7431755509	4813567006	4753054905	10804284010	70849256	SRX5835164	SRS4761460	SRA880843	GEO	Zhejiang University	2	0.0	0.64422	0.0	0.03306	1.0	0.85251		0.49446	151	151	T	B	mate1 technical by mapping diff	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	microwellseq	China	2019-05-15	Undetermined	Multi-stage	Gonad	Reproductive System
52198	52198	SRR8991408	SRX5770476	SRS4704585	SRP194254	PRJNA540466	Characterization of the zebrafish cell landscape at single cell resolution	GSE130487	Transcriptome Analysis	Zebrafish have been found to be a premier model organism in biological and regeneration research. However the comprehensive cell compositions and molecular dynamics during tissue regeneration in zebrafish remain poorly understood. Here we utilized Microwell seq to analyze more than 250 000 single cells covering major zebrafish cell types and constructed a systematic zebrafish cell landscape. We revealed single cell compositions for 18 zebrafish tissue types covering both embryo and adult stages. Single cell mapping of caudal fin regeneration revealed a unique characteristic of blastema population and key genetic regulation involved in zebrafish tissue repair. Overall our single cell datasets demonstrate the utility of zebrafish cell landscape resources in various fields of biological research. Overall design: Expression profiling by high throughput sequencing of major zebrafish organ types. Please note that 19 samples were added and 9 samples were deleted on Mar 1 2022.		pubmed:34660600		Testis5	GSM3740961		source name:testis\|strain:Tubingen\|genotype:wild type\|tissue:testis	Testis5	The drop seq core computational tool was used for preprocessing of the Microwell seq data. The implementation is described in the Drop seq computational cookbook http://mccarrolllab.org/dropseq/. Base calls were performed with Illumina bcl2fastq Sequenced reads were trimmed for adaptor sequence.Then reads in bam files were tagged with the cell and molecular UMI barcode sequences using Drop seq tools 1.12.The cell barcodes are tagged as XC in the bam file and the UMI is tagged as XM in the bam file. The reads quality under 10 were removed. ScRNA seq reads were aligned to the Danio rerio GRCz10 genome assembly using STAR version 2.5.2a with default configurations. Next merge the STAR alignment tagged bam SAM to recover cell /molecular barcodes and the reads are annotated with exon tags. Last we demultiplexed all cell barcodes taken into consideration for the analysis from the exon tagged bam files to get a digital expression matrix based on UMI counts. Genome build: http://dec2017.archive.ensembl.org/Danio rerio/Info/Index Supplementary files format and content: tab delimited text files of digital expression matrix dge based on raw UMI counts columns are cells and rows are genes.	testis		Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol		strain:Tubingen\|genotype:wild type\|tissue:testis	GSM3740961	GSM3740961: Testis5; Danio rerio; RNA Seq	GSM3740961		1	Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol	GEO Accession:GSM3740961	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq X Ten		SRP194254		assembly:Danio rerio GRCz10	Testis5.bam	bam	25120411340.0	83180170.0	GSM3740961 r1	0:151 1:151	A:6309984521;C:4265951177;G:4463773513;T:10013679424;N:67022705	151	151	6309984521	4265951177	4463773513	10013679424	67022705	SRX5770476	SRS4704585	SRA880843	GEO	Zhejiang University	2	0.0	0.73589	0.0	0.05677	1.0	0.76852		0.48176	151	151	T	B	mate1 technical by mapping diff	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	microwellseq	China	2019-04-30	Undetermined	Multi-stage	Gonad	Reproductive System
52202	52202	SRR8991404	SRX5770472	SRS4704581	SRP194254	PRJNA540466	Characterization of the zebrafish cell landscape at single cell resolution	GSE130487	Transcriptome Analysis	Zebrafish have been found to be a premier model organism in biological and regeneration research. However the comprehensive cell compositions and molecular dynamics during tissue regeneration in zebrafish remain poorly understood. Here we utilized Microwell seq to analyze more than 250 000 single cells covering major zebrafish cell types and constructed a systematic zebrafish cell landscape. We revealed single cell compositions for 18 zebrafish tissue types covering both embryo and adult stages. Single cell mapping of caudal fin regeneration revealed a unique characteristic of blastema population and key genetic regulation involved in zebrafish tissue repair. Overall our single cell datasets demonstrate the utility of zebrafish cell landscape resources in various fields of biological research. Overall design: Expression profiling by high throughput sequencing of major zebrafish organ types. Please note that 19 samples were added and 9 samples were deleted on Mar 1 2022.		pubmed:34660600		Ovary3	GSM3740957		source name:ovary\|strain:Tubingen\|genotype:wild type\|tissue:ovary	Ovary3	The drop seq core computational tool was used for preprocessing of the Microwell seq data. The implementation is described in the Drop seq computational cookbook http://mccarrolllab.org/dropseq/. Base calls were performed with Illumina bcl2fastq Sequenced reads were trimmed for adaptor sequence.Then reads in bam files were tagged with the cell and molecular UMI barcode sequences using Drop seq tools 1.12.The cell barcodes are tagged as XC in the bam file and the UMI is tagged as XM in the bam file. The reads quality under 10 were removed. ScRNA seq reads were aligned to the Danio rerio GRCz10 genome assembly using STAR version 2.5.2a with default configurations. Next merge the STAR alignment tagged bam SAM to recover cell /molecular barcodes and the reads are annotated with exon tags. Last we demultiplexed all cell barcodes taken into consideration for the analysis from the exon tagged bam files to get a digital expression matrix based on UMI counts. Genome build: http://dec2017.archive.ensembl.org/Danio rerio/Info/Index Supplementary files format and content: tab delimited text files of digital expression matrix dge based on raw UMI counts columns are cells and rows are genes.	ovary		Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol		strain:Tubingen\|genotype:wild type\|tissue:ovary	GSM3740957	GSM3740957: Ovary3; Danio rerio; RNA Seq	GSM3740957		1	Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol	GEO Accession:GSM3740957	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq X Ten		SRP194254		assembly:Danio rerio GRCz10	Ovary3.bam	bam	28925343900.0	96417813.0	GSM3740957 r1	0:150 1:150	A:7017871289;C:5039388405;G:5052960907;T:11812448419;N:2674880	150	150	7017871289	5039388405	5052960907	11812448419	2674880	SRX5770472	SRS4704581	SRA880843	GEO	Zhejiang University	2	2e-05	0.79333	0.0	0.03249	0.99997	0.83374	0.0	0.48484	150	150	T	B	mate1 technical by mapping diff	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	microwellseq	China	2019-04-30	Undetermined	Multi-stage	Gonad	Reproductive System
52326	52326	SRR9119512	SRX5893495	SRS4815090	SRP199448	PRJNA544696	Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells	GSE131759	Transcriptome Analysis	MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr…		pubmed:31417497		IIIb 3	GSM3816534		source name:stage IIIb follicular cells\|tissue:ovary\|cell type:follicular cells\|developmental stage:IIIb	IIIb 3	LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample	stage IIIb follicular cells		Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols		tissue:ovary\|cell type:follicular cells\|developmental stage:IIIb	GSM3816534	GSM3816534: IIIb 3; Danio rerio; miRNA Seq	GSM3816534		1	Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3816534	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP199448			HI.2030.005.RPI10.IIIb_3_R1.fastq.gz	fastq	1449340900.0	28986818.0	GSM3816534 r1	0:50 1:0	A:351029701;C:324452324;G:401722902;T:371889768;N:246205	50	0	351029701	324452324	401722902	371889768	246205	SRX5893495	SRS4815090	SRA890399	GEO	Biology, YorkU	1	0.08662		0.01333		0.96213		0.83838		50		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	unknown	unknown	Canada	2019-05-24	Undetermined	Undetermined	Gonad	Reproductive System
52327	52327	SRR9119513	SRX5893495	SRS4815090	SRP199448	PRJNA544696	Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells	GSE131759	Transcriptome Analysis	MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr…		pubmed:31417497		IIIb 3	GSM3816534		source name:stage IIIb follicular cells\|tissue:ovary\|cell type:follicular cells\|developmental stage:IIIb	IIIb 3	LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample	stage IIIb follicular cells		Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols		tissue:ovary\|cell type:follicular cells\|developmental stage:IIIb	GSM3816534	GSM3816534: IIIb 3; Danio rerio; miRNA Seq	GSM3816534		1	Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3816534	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP199448			HI.2030.006.RPI10.IIIb_3_R1.fastq	fastq	1447621100.0	28952422.0	GSM3816534 r2	0:50 1:0	A:350650304;C:324162528;G:401055729;T:371582418;N:170121	50	0	350650304	324162528	401055729	371582418	170121	SRX5893495	SRS4815090	SRA890399	GEO	Biology, YorkU	1	0.08676		0.01312		0.96282		0.84604		50		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	unknown	unknown	Canada	2019-05-24	Undetermined	Undetermined	Gonad	Reproductive System
52328	52328	SRR9119510	SRX5893494	SRS4815089	SRP199448	PRJNA544696	Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells	GSE131759	Transcriptome Analysis	MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr…		pubmed:31417497		IIIb 2	GSM3816533		source name:stage IIIb follicular cells\|tissue:ovary\|cell type:follicular cells\|developmental stage:IIIb	IIIb 2	LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample	stage IIIb follicular cells		Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols		tissue:ovary\|cell type:follicular cells\|developmental stage:IIIb	GSM3816533	GSM3816533: IIIb 2; Danio rerio; miRNA Seq	GSM3816533		1	Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3816533	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP199448			HI.2030.005.RPI9.IIIb_2_R1.fastq.gz	fastq	1012538750.0	20250775.0	GSM3816533 r1	0:50 1:0	A:242873339;C:228078637;G:287889366;T:253526026;N:171382	50	0	242873339	228078637	287889366	253526026	171382	SRX5893494	SRS4815089	SRA890399	GEO	Biology, YorkU	1	0.04745		0.00802		0.968		0.75298		50		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	unknown	unknown	Canada	2019-05-24	Undetermined	Undetermined	Gonad	Reproductive System
52329	52329	SRR9119511	SRX5893494	SRS4815089	SRP199448	PRJNA544696	Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells	GSE131759	Transcriptome Analysis	MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr…		pubmed:31417497		IIIb 2	GSM3816533		source name:stage IIIb follicular cells\|tissue:ovary\|cell type:follicular cells\|developmental stage:IIIb	IIIb 2	LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample	stage IIIb follicular cells		Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols		tissue:ovary\|cell type:follicular cells\|developmental stage:IIIb	GSM3816533	GSM3816533: IIIb 2; Danio rerio; miRNA Seq	GSM3816533		1	Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3816533	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP199448			HI.2030.006.RPI9.IIIb_2_R1.fastq	fastq	1010559400.0	20211188.0	GSM3816533 r2	0:50 1:0	A:242471282;C:227664296;G:287157957;T:253147388;N:118477	50	0	242471282	227664296	287157957	253147388	118477	SRX5893494	SRS4815089	SRA890399	GEO	Biology, YorkU	1	0.04679		0.008		0.96946		0.71268		50		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	unknown	unknown	Canada	2019-05-24	Undetermined	Undetermined	Gonad	Reproductive System
52330	52330	SRR9119508	SRX5893493	SRS4815088	SRP199448	PRJNA544696	Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells	GSE131759	Transcriptome Analysis	MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr…		pubmed:31417497		IIIb 1	GSM3816532		source name:stage IIIb follicular cells\|tissue:ovary\|cell type:follicular cells\|developmental stage:IIIb	IIIb 1	LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample	stage IIIb follicular cells		Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols		tissue:ovary\|cell type:follicular cells\|developmental stage:IIIb	GSM3816532	GSM3816532: IIIb 1; Danio rerio; miRNA Seq	GSM3816532		1	Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3816532	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP199448			HI.2030.005.RPI8.IIIb_1_R1.fastq.gz	fastq	1443846950.0	28876939.0	GSM3816532 r1	0:50 1:0	A:350805103;C:319766230;G:407583206;T:365448522;N:243889	50	0	350805103	319766230	407583206	365448522	243889	SRX5893493	SRS4815088	SRA890399	GEO	Biology, YorkU	1	0.02559		0.00389		0.98407		0.82023		50		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	unknown	unknown	Canada	2019-05-24	Undetermined	Undetermined	Gonad	Reproductive System
52331	52331	SRR9119509	SRX5893493	SRS4815088	SRP199448	PRJNA544696	Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells	GSE131759	Transcriptome Analysis	MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr…		pubmed:31417497		IIIb 1	GSM3816532		source name:stage IIIb follicular cells\|tissue:ovary\|cell type:follicular cells\|developmental stage:IIIb	IIIb 1	LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample	stage IIIb follicular cells		Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols		tissue:ovary\|cell type:follicular cells\|developmental stage:IIIb	GSM3816532	GSM3816532: IIIb 1; Danio rerio; miRNA Seq	GSM3816532		1	Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3816532	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP199448			HI.2030.006.RPI8.IIIb_1_R1.fastq	fastq	1442694250.0	28853885.0	GSM3816532 r2	0:50 1:0	A:350607715;C:319569609;G:407049947;T:365297986;N:168993	50	0	350607715	319569609	407049947	365297986	168993	SRX5893493	SRS4815088	SRA890399	GEO	Biology, YorkU	1	0.02565		0.00409		0.98417		0.81633		50		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	unknown	unknown	Canada	2019-05-24	Undetermined	Undetermined	Gonad	Reproductive System
52332	52332	SRR9119506	SRX5893492	SRS4815087	SRP199448	PRJNA544696	Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells	GSE131759	Transcriptome Analysis	MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr…		pubmed:31417497		IIIa 3	GSM3816531		source name:stage IIIa follicular cells\|tissue:ovary\|cell type:follicular cells\|developmental stage:IIIa	IIIa 3	LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample	stage IIIa follicular cells		Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols		tissue:ovary\|cell type:follicular cells\|developmental stage:IIIa	GSM3816531	GSM3816531: IIIa 3; Danio rerio; miRNA Seq	GSM3816531		1	Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3816531	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP199448			HI.2030.005.RPI4.IIIa_3_R1.fastq.gz	fastq	1324489100.0	26489782.0	GSM3816531 r1	0:50 1:0	A:333465386;C:289207984;G:364882545;T:336711699;N:221486	50	0	333465386	289207984	364882545	336711699	221486	SRX5893492	SRS4815087	SRA890399	GEO	Biology, YorkU	1	0.02703		0.00432		0.98313		0.75385		50		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	unknown	unknown	Canada	2019-05-24	Undetermined	Undetermined	Gonad	Reproductive System
52333	52333	SRR9119507	SRX5893492	SRS4815087	SRP199448	PRJNA544696	Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells	GSE131759	Transcriptome Analysis	MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr…		pubmed:31417497		IIIa 3	GSM3816531		source name:stage IIIa follicular cells\|tissue:ovary\|cell type:follicular cells\|developmental stage:IIIa	IIIa 3	LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample	stage IIIa follicular cells		Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols		tissue:ovary\|cell type:follicular cells\|developmental stage:IIIa	GSM3816531	GSM3816531: IIIa 3; Danio rerio; miRNA Seq	GSM3816531		1	Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3816531	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP199448			HI.2030.006.RPI4.IIIa_3_R1.fastq	fastq	1322554650.0	26451093.0	GSM3816531 r2	0:50 1:0	A:333031673;C:288843797;G:364209143;T:336315522;N:154515	50	0	333031673	288843797	364209143	336315522	154515	SRX5893492	SRS4815087	SRA890399	GEO	Biology, YorkU	1	0.02671		0.00422		0.98283		0.76748		50		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	unknown	unknown	Canada	2019-05-24	Undetermined	Undetermined	Gonad	Reproductive System
52334	52334	SRR9119504	SRX5893491	SRS4815086	SRP199448	PRJNA544696	Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells	GSE131759	Transcriptome Analysis	MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr…		pubmed:31417497		IIIa 2	GSM3816530		source name:stage IIIa follicular cells\|tissue:ovary\|cell type:follicular cells\|developmental stage:IIIa	IIIa 2	LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample	stage IIIa follicular cells		Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols		tissue:ovary\|cell type:follicular cells\|developmental stage:IIIa	GSM3816530	GSM3816530: IIIa 2; Danio rerio; miRNA Seq	GSM3816530		1	Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3816530	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP199448			HI.2030.005.RPI3.IIIa_2_R1.fastq.gz	fastq	1382308600.0	27646172.0	GSM3816530 r1	0:50 1:0	A:342206537;C:301597185;G:385756857;T:352517232;N:230789	50	0	342206537	301597185	385756857	352517232	230789	SRX5893491	SRS4815086	SRA890399	GEO	Biology, YorkU	1	0.05315		0.00892		0.9643		0.79967		50		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	unknown	unknown	Canada	2019-05-24	Undetermined	Undetermined	Gonad	Reproductive System
52335	52335	SRR9119505	SRX5893491	SRS4815086	SRP199448	PRJNA544696	Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells	GSE131759	Transcriptome Analysis	MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr…		pubmed:31417497		IIIa 2	GSM3816530		source name:stage IIIa follicular cells\|tissue:ovary\|cell type:follicular cells\|developmental stage:IIIa	IIIa 2	LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample	stage IIIa follicular cells		Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols		tissue:ovary\|cell type:follicular cells\|developmental stage:IIIa	GSM3816530	GSM3816530: IIIa 2; Danio rerio; miRNA Seq	GSM3816530		1	Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3816530	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP199448			HI.2030.006.RPI3.IIIa_2_R1.fastq	fastq	1383050750.0	27661015.0	GSM3816530 r2	0:50 1:0	A:342441286;C:301828080;G:385820344;T:352800933;N:160107	50	0	342441286	301828080	385820344	352800933	160107	SRX5893491	SRS4815086	SRA890399	GEO	Biology, YorkU	1	0.0533		0.00892		0.96323		0.81292		50		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	unknown	unknown	Canada	2019-05-24	Undetermined	Undetermined	Gonad	Reproductive System
52336	52336	SRR9119502	SRX5893490	SRS4815085	SRP199448	PRJNA544696	Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells	GSE131759	Transcriptome Analysis	MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr…		pubmed:31417497		IIIa 1	GSM3816529		source name:stage IIIa follicular cells\|tissue:ovary\|cell type:follicular cells\|developmental stage:IIIa	IIIa 1	LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample	stage IIIa follicular cells		Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols		tissue:ovary\|cell type:follicular cells\|developmental stage:IIIa	GSM3816529	GSM3816529: IIIa 1; Danio rerio; miRNA Seq	GSM3816529		1	Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3816529	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP199448			HI.2030.005.RPI2.IIIa_1_R1.fastq.gz	fastq	1333818450.0	26676369.0	GSM3816529 r1	0:50 1:0	A:320039883;C:296663387;G:380656068;T:336233800;N:225312	50	0	320039883	296663387	380656068	336233800	225312	SRX5893490	SRS4815085	SRA890399	GEO	Biology, YorkU	1	0.0976		0.019		0.93718		0.75404		50		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	unknown	unknown	Canada	2019-05-24	Undetermined	Undetermined	Gonad	Reproductive System
52337	52337	SRR9119503	SRX5893490	SRS4815085	SRP199448	PRJNA544696	Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells	GSE131759	Transcriptome Analysis	MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expr…		pubmed:31417497		IIIa 1	GSM3816529		source name:stage IIIa follicular cells\|tissue:ovary\|cell type:follicular cells\|developmental stage:IIIa	IIIa 1	LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample	stage IIIa follicular cells		Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols		tissue:ovary\|cell type:follicular cells\|developmental stage:IIIa	GSM3816529	GSM3816529: IIIa 1; Danio rerio; miRNA Seq	GSM3816529		1	Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3816529	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP199448			HI.2030.006.RPI2.IIIa_1_R1.fastq	fastq	1334152750.0	26683055.0	GSM3816529 r2	0:50 1:0	A:320194547;C:296827909;G:380547854;T:336424243;N:158197	50	0	320194547	296827909	380547854	336424243	158197	SRX5893490	SRS4815085	SRA890399	GEO	Biology, YorkU	1	0.09727		0.01947		0.93866		0.76527		50		B		usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	unknown	unknown	Canada	2019-05-24	Undetermined	Undetermined	Gonad	Reproductive System
58533	58533	SRR11355387	SRX7957249	SRS6343356	SRP253408	PRJNA613558	Transcriptomic assessments RNA sequencing in ovaries following treatments of gravid female zebrafish to an antibiotic mixture	PRJNA613558	Other	As the use of antimicrobials during pregnancy and the perinatal period may lead to adverse outcomes such as miscarriages and newborn disease the purpose of present study was to evaluate the influence of antibiotic exposure in offspring following treatments of gravid female zebrafish to an antibiotic mixture. For the F0 generation adult zebrafish AB strain at sexual maturity 150 dpf dpf were selected for experimentation 50% male and 50% pregnant female. Given a significant change occurred in eggs production and F1 survival at birth in present study combined with antibiotics bioaccumulated in ovary we suspect that antibiotic exposure might impact the ovary of F0 generation zebrafish and thus affect egg production and survival. Therefore ovaries of the F0 generation were evaluated for transcriptional effects in different antibiotics mixture exposure 0 1 and 100 ug/L using a HTS approach coupled with advanced bioinformatic tools.				C2 3	C2 3		strain:AB\|isolate:C2\|breed:not applicable\|cultivar:not applicable\|ecotype:not applicable\|age:not applicable\|dev stage:not applicable\|sex:female\|tissue:ovary\|collection date:2019 11 01\|geo loc name:China: Shenzhen Guangdong\|replicate:biological replicate 3\|BioSampleModel:Model organism or animal									RNA seq of zebrafish	C2 320200327	C2 320200327	RNA seq of zebrafish in different conditions			RNA-Seq	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	BGISEQ	BGISEQ-500		SRP253408			C2_3_1.fq.gz C2_3_2.fq.gz	fastq fastq	6857650800.0	45717672.0	C2 3 1.fq.gz	0:150 1:150	A:1826466263;C:1599272942;G:1580689630;T:1851144875;N:77090	150	150	1826466263	1599272942	1580689630	1851144875	77090	SRX7957249	SRS6343356	SRA1056819	Southern University of Science and Technology\|School of Environmental Science and Engineering	Southern University of Science and Technology	1	0.93222		0.02854		0.75138		0.50759		150		B		usable mapping rate	bgi	bgi	unknown	random_priming	unknown	bulk	unknown	unknown	China	2020-03-20	Undetermined	Adult	Gonad	Reproductive System
58534	58534	SRR11355388	SRX7957248	SRS6343355	SRP253408	PRJNA613558	Transcriptomic assessments RNA sequencing in ovaries following treatments of gravid female zebrafish to an antibiotic mixture	PRJNA613558	Other	As the use of antimicrobials during pregnancy and the perinatal period may lead to adverse outcomes such as miscarriages and newborn disease the purpose of present study was to evaluate the influence of antibiotic exposure in offspring following treatments of gravid female zebrafish to an antibiotic mixture. For the F0 generation adult zebrafish AB strain at sexual maturity 150 dpf dpf were selected for experimentation 50% male and 50% pregnant female. Given a significant change occurred in eggs production and F1 survival at birth in present study combined with antibiotics bioaccumulated in ovary we suspect that antibiotic exposure might impact the ovary of F0 generation zebrafish and thus affect egg production and survival. Therefore ovaries of the F0 generation were evaluated for transcriptional effects in different antibiotics mixture exposure 0 1 and 100 ug/L using a HTS approach coupled with advanced bioinformatic tools.				C2 2	C2 2		strain:AB\|isolate:C2\|breed:not applicable\|cultivar:not applicable\|ecotype:not applicable\|age:not applicable\|dev stage:not applicable\|sex:female\|tissue:ovary\|collection date:2019 11 01\|geo loc name:China: Shenzhen Guangdong\|replicate:biological replicate 2\|BioSampleModel:Model organism or animal									RNA seq of zebrafish	C2 220200326	C2 220200326	RNA seq of zebrafish in different conditions			RNA-Seq	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	BGISEQ	BGISEQ-500		SRP253408			C2_2_1.fq.gz C2_2_2.fq.gz	fastq fastq	6859954800.0	45733032.0	C2 2 1.fq.gz	0:150 1:150	A:1836618967;C:1591135182;G:1572318102;T:1859806048;N:76501	150	150	1836618967	1591135182	1572318102	1859806048	76501	SRX7957248	SRS6343355	SRA1056819	Southern University of Science and Technology\|School of Environmental Science and Engineering	Southern University of Science and Technology	1	0.93237		0.03248		0.74663		0.5081		150		B		usable mapping rate	bgi	bgi	unknown	random_priming	unknown	bulk	unknown	unknown	China	2020-03-20	Undetermined	Adult	Gonad	Reproductive System
58535	58535	SRR11355389	SRX7957247	SRS6343354	SRP253408	PRJNA613558	Transcriptomic assessments RNA sequencing in ovaries following treatments of gravid female zebrafish to an antibiotic mixture	PRJNA613558	Other	As the use of antimicrobials during pregnancy and the perinatal period may lead to adverse outcomes such as miscarriages and newborn disease the purpose of present study was to evaluate the influence of antibiotic exposure in offspring following treatments of gravid female zebrafish to an antibiotic mixture. For the F0 generation adult zebrafish AB strain at sexual maturity 150 dpf dpf were selected for experimentation 50% male and 50% pregnant female. Given a significant change occurred in eggs production and F1 survival at birth in present study combined with antibiotics bioaccumulated in ovary we suspect that antibiotic exposure might impact the ovary of F0 generation zebrafish and thus affect egg production and survival. Therefore ovaries of the F0 generation were evaluated for transcriptional effects in different antibiotics mixture exposure 0 1 and 100 ug/L using a HTS approach coupled with advanced bioinformatic tools.				C2 1	C2 1		strain:AB\|isolate:C2\|breed:not applicable\|cultivar:not applicable\|ecotype:not applicable\|age:not applicable\|dev stage:not applicable\|sex:female\|tissue:ovary\|collection date:2019 11 01\|geo loc name:China: Shenzhen Guangdong\|replicate:biological replicate 1\|BioSampleModel:Model organism or animal									RNA seq of zebrafish	C2 120200325	C2 120200325	RNA seq of zebrafish in different conditions			RNA-Seq	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	BGISEQ	BGISEQ-500		SRP253408			C2_1_1.fq.gz C2_1_2.fq.gz	fastq fastq	6618974400.0	44126496.0	C2 1 1.fq.gz	0:150 1:150	A:1774116288;C:1533828286;G:1511526952;T:1799423408;N:79466	150	150	1774116288	1533828286	1511526952	1799423408	79466	SRX7957247	SRS6343354	SRA1056819	Southern University of Science and Technology\|School of Environmental Science and Engineering	Southern University of Science and Technology	1	0.9326		0.02973		0.75426		0.50678		150		B		usable mapping rate	bgi	bgi	unknown	random_priming	unknown	bulk	unknown	unknown	China	2020-03-20	Undetermined	Adult	Gonad	Reproductive System
58536	58536	SRR11355390	SRX7957246	SRS6343353	SRP253408	PRJNA613558	Transcriptomic assessments RNA sequencing in ovaries following treatments of gravid female zebrafish to an antibiotic mixture	PRJNA613558	Other	As the use of antimicrobials during pregnancy and the perinatal period may lead to adverse outcomes such as miscarriages and newborn disease the purpose of present study was to evaluate the influence of antibiotic exposure in offspring following treatments of gravid female zebrafish to an antibiotic mixture. For the F0 generation adult zebrafish AB strain at sexual maturity 150 dpf dpf were selected for experimentation 50% male and 50% pregnant female. Given a significant change occurred in eggs production and F1 survival at birth in present study combined with antibiotics bioaccumulated in ovary we suspect that antibiotic exposure might impact the ovary of F0 generation zebrafish and thus affect egg production and survival. Therefore ovaries of the F0 generation were evaluated for transcriptional effects in different antibiotics mixture exposure 0 1 and 100 ug/L using a HTS approach coupled with advanced bioinformatic tools.				C1 3	C1 3		strain:AB\|isolate:C1\|breed:not applicable\|cultivar:not applicable\|ecotype:not applicable\|age:not applicable\|dev stage:not applicable\|sex:female\|tissue:ovary\|collection date:2019 11 01\|geo loc name:China: Shenzhen Guangdong\|replicate:biological replicate 3\|BioSampleModel:Model organism or animal									RNA seq of zebrafish	C1 320200324	C1 320200324	RNA seq of zebrafish in different conditions			RNA-Seq	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	BGISEQ	BGISEQ-500		SRP253408			C1_3_1.fq.gz C1_3_2.fq.gz	fastq fastq	6837729600.0	45584864.0	C1 3 1.fq.gz	0:150 1:150	A:1831266308;C:1587032733;G:1565071069;T:1853950421;N:409069	150	150	1831266308	1587032733	1565071069	1853950421	409069	SRX7957246	SRS6343353	SRA1056819	Southern University of Science and Technology\|School of Environmental Science and Engineering	Southern University of Science and Technology	1	0.93541		0.03212		0.74681		0.50268		150		B		usable mapping rate	bgi	bgi	unknown	random_priming	unknown	bulk	unknown	unknown	China	2020-03-20	Undetermined	Adult	Gonad	Reproductive System
58537	58537	SRR11355391	SRX7957245	SRS6343352	SRP253408	PRJNA613558	Transcriptomic assessments RNA sequencing in ovaries following treatments of gravid female zebrafish to an antibiotic mixture	PRJNA613558	Other	As the use of antimicrobials during pregnancy and the perinatal period may lead to adverse outcomes such as miscarriages and newborn disease the purpose of present study was to evaluate the influence of antibiotic exposure in offspring following treatments of gravid female zebrafish to an antibiotic mixture. For the F0 generation adult zebrafish AB strain at sexual maturity 150 dpf dpf were selected for experimentation 50% male and 50% pregnant female. Given a significant change occurred in eggs production and F1 survival at birth in present study combined with antibiotics bioaccumulated in ovary we suspect that antibiotic exposure might impact the ovary of F0 generation zebrafish and thus affect egg production and survival. Therefore ovaries of the F0 generation were evaluated for transcriptional effects in different antibiotics mixture exposure 0 1 and 100 ug/L using a HTS approach coupled with advanced bioinformatic tools.				C1 2	C1 2		strain:AB\|isolate:C1\|breed:not applicable\|cultivar:not applicable\|ecotype:not applicable\|age:not applicable\|dev stage:not applicable\|sex:female\|tissue:ovary\|collection date:2019 11 01\|geo loc name:China: Shenzhen Guangdong\|replicate:biological replicate 2\|BioSampleModel:Model organism or animal									RNA seq of zebrafish	C1 220200323	C1 220200323	RNA seq of zebrafish in different conditions			RNA-Seq	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	BGISEQ	BGISEQ-500		SRP253408			C1_2_2.fq.gz C1_2_1.fq.gz	fastq fastq	6860328000.0	45735520.0	C1 2 1.fq.gz	0:150 1:150	A:1838176072;C:1591277709;G:1569605888;T:1861063734;N:204597	150	150	1838176072	1591277709	1569605888	1861063734	204597	SRX7957245	SRS6343352	SRA1056819	Southern University of Science and Technology\|School of Environmental Science and Engineering	Southern University of Science and Technology	1	0.93763		0.033		0.74617		0.50287		150		B		usable mapping rate	bgi	bgi	unknown	random_priming	unknown	bulk	unknown	unknown	China	2020-03-20	Undetermined	Adult	Gonad	Reproductive System
58538	58538	SRR11355392	SRX7957244	SRS6343351	SRP253408	PRJNA613558	Transcriptomic assessments RNA sequencing in ovaries following treatments of gravid female zebrafish to an antibiotic mixture	PRJNA613558	Other	As the use of antimicrobials during pregnancy and the perinatal period may lead to adverse outcomes such as miscarriages and newborn disease the purpose of present study was to evaluate the influence of antibiotic exposure in offspring following treatments of gravid female zebrafish to an antibiotic mixture. For the F0 generation adult zebrafish AB strain at sexual maturity 150 dpf dpf were selected for experimentation 50% male and 50% pregnant female. Given a significant change occurred in eggs production and F1 survival at birth in present study combined with antibiotics bioaccumulated in ovary we suspect that antibiotic exposure might impact the ovary of F0 generation zebrafish and thus affect egg production and survival. Therefore ovaries of the F0 generation were evaluated for transcriptional effects in different antibiotics mixture exposure 0 1 and 100 ug/L using a HTS approach coupled with advanced bioinformatic tools.				C1 1	C1 1		strain:AB\|isolate:C1\|breed:not applicable\|cultivar:not applicable\|ecotype:not applicable\|age:not applicable\|dev stage:not applicable\|sex:female\|tissue:ovary\|collection date:2019 11 01\|geo loc name:China: Shenzhen Guangdong\|replicate:biological replicate 1\|BioSampleModel:Model organism or animal									RNA seq of zebrafish	C1 120200322	C1 120200322	RNA seq of zebrafish in different conditions			RNA-Seq	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	BGISEQ	BGISEQ-500		SRP253408			C1_1_1.fq.gz C1_1_2.fq.gz	fastq fastq	6865547700.0	45770318.0	C1 1 1.fq.gz	0:150 1:150	A:1841774713;C:1591288582;G:1570400871;T:1861867728;N:215806	150	150	1841774713	1591288582	1570400871	1861867728	215806	SRX7957244	SRS6343351	SRA1056819	Southern University of Science and Technology\|School of Environmental Science and Engineering	Southern University of Science and Technology	1	0.93567		0.03152		0.74653		0.50239		150		B		usable mapping rate	bgi	bgi	unknown	random_priming	unknown	bulk	unknown	unknown	China	2020-03-20	Undetermined	Adult	Gonad	Reproductive System
58539	58539	SRR11355393	SRX7957243	SRS6343350	SRP253408	PRJNA613558	Transcriptomic assessments RNA sequencing in ovaries following treatments of gravid female zebrafish to an antibiotic mixture	PRJNA613558	Other	As the use of antimicrobials during pregnancy and the perinatal period may lead to adverse outcomes such as miscarriages and newborn disease the purpose of present study was to evaluate the influence of antibiotic exposure in offspring following treatments of gravid female zebrafish to an antibiotic mixture. For the F0 generation adult zebrafish AB strain at sexual maturity 150 dpf dpf were selected for experimentation 50% male and 50% pregnant female. Given a significant change occurred in eggs production and F1 survival at birth in present study combined with antibiotics bioaccumulated in ovary we suspect that antibiotic exposure might impact the ovary of F0 generation zebrafish and thus affect egg production and survival. Therefore ovaries of the F0 generation were evaluated for transcriptional effects in different antibiotics mixture exposure 0 1 and 100 ug/L using a HTS approach coupled with advanced bioinformatic tools.				C0 3	C0 3		strain:AB\|isolate:C0\|breed:not applicable\|cultivar:not applicable\|ecotype:not applicable\|age:not applicable\|dev stage:not applicable\|sex:female\|tissue:ovary\|collection date:2019 11 01\|geo loc name:China: Shenzhen Guangdong\|replicate:biological replicate 3\|BioSampleModel:Model organism or animal									RNA seq of zebrafish	C0 320200321	C0 320200321	RNA seq of zebrafish in different conditions			RNA-Seq	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	BGISEQ	BGISEQ-500		SRP253408			C0_3_1.fq.gz C0_3_2.fq.gz	fastq fastq	6824622600.0	45497484.0	C0 3 1.fq.gz	0:150 1:150	A:1833660953;C:1578510104;G:1558095174;T:1854128169;N:228200	150	150	1833660953	1578510104	1558095174	1854128169	228200	SRX7957243	SRS6343350	SRA1056819	Southern University of Science and Technology\|School of Environmental Science and Engineering	Southern University of Science and Technology	1	0.93758		0.0323		0.75024		0.50852		150		B		usable mapping rate	bgi	bgi	unknown	random_priming	unknown	bulk	unknown	unknown	China	2020-03-20	Undetermined	Adult	Gonad	Reproductive System
58540	58540	SRR11355394	SRX7957242	SRS6343349	SRP253408	PRJNA613558	Transcriptomic assessments RNA sequencing in ovaries following treatments of gravid female zebrafish to an antibiotic mixture	PRJNA613558	Other	As the use of antimicrobials during pregnancy and the perinatal period may lead to adverse outcomes such as miscarriages and newborn disease the purpose of present study was to evaluate the influence of antibiotic exposure in offspring following treatments of gravid female zebrafish to an antibiotic mixture. For the F0 generation adult zebrafish AB strain at sexual maturity 150 dpf dpf were selected for experimentation 50% male and 50% pregnant female. Given a significant change occurred in eggs production and F1 survival at birth in present study combined with antibiotics bioaccumulated in ovary we suspect that antibiotic exposure might impact the ovary of F0 generation zebrafish and thus affect egg production and survival. Therefore ovaries of the F0 generation were evaluated for transcriptional effects in different antibiotics mixture exposure 0 1 and 100 ug/L using a HTS approach coupled with advanced bioinformatic tools.				C0 2	C0 2		strain:AB\|isolate:C0\|breed:not applicable\|cultivar:not applicable\|ecotype:not applicable\|age:not applicable\|dev stage:not applicable\|sex:female\|tissue:ovary\|collection date:2019 11 01\|geo loc name:China: Shenzhen Guangdong\|replicate:biological replicate 2\|BioSampleModel:Model organism or animal									RNA seq of zebrafish	C0 220200320	C0 220200320	RNA seq of zebrafish in different conditions			RNA-Seq	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	BGISEQ	BGISEQ-500		SRP253408			C0_2_2.fq.gz C0_2_1.fq.gz	fastq fastq	6819326400.0	45462176.0	C0 2 1.fq.gz	0:150 1:150	A:1837661215;C:1571877614;G:1550458835;T:1859103408;N:225328	150	150	1837661215	1571877614	1550458835	1859103408	225328	SRX7957242	SRS6343349	SRA1056819	Southern University of Science and Technology\|School of Environmental Science and Engineering	Southern University of Science and Technology	1	0.93697		0.0339		0.74793		0.5035		150		B		usable mapping rate	bgi	bgi	unknown	random_priming	unknown	bulk	unknown	unknown	China	2020-03-20	Undetermined	Adult	Gonad	Reproductive System
58541	58541	SRR11355395	SRX7957241	SRS6343348	SRP253408	PRJNA613558	Transcriptomic assessments RNA sequencing in ovaries following treatments of gravid female zebrafish to an antibiotic mixture	PRJNA613558	Other	As the use of antimicrobials during pregnancy and the perinatal period may lead to adverse outcomes such as miscarriages and newborn disease the purpose of present study was to evaluate the influence of antibiotic exposure in offspring following treatments of gravid female zebrafish to an antibiotic mixture. For the F0 generation adult zebrafish AB strain at sexual maturity 150 dpf dpf were selected for experimentation 50% male and 50% pregnant female. Given a significant change occurred in eggs production and F1 survival at birth in present study combined with antibiotics bioaccumulated in ovary we suspect that antibiotic exposure might impact the ovary of F0 generation zebrafish and thus affect egg production and survival. Therefore ovaries of the F0 generation were evaluated for transcriptional effects in different antibiotics mixture exposure 0 1 and 100 ug/L using a HTS approach coupled with advanced bioinformatic tools.				C0 1	C0 1		strain:AB\|isolate:C0\|breed:not applicable\|cultivar:not applicable\|ecotype:not applicable\|age:not applicable\|dev stage:not applicable\|sex:female\|tissue:ovary\|collection date:2019 11 01\|geo loc name:China: Shenzhen Guangdong\|replicate:biological replicate 1\|BioSampleModel:Model organism or animal									RNA seq of zebrafish	C0 120200319	C0 120200319	RNA seq of zebrafish in different conditions			RNA-Seq	TRANSCRIPTOMIC	RANDOM PCR	PAIRED	BGISEQ	BGISEQ-500		SRP253408			C0_1_1.fq.gz C0_1_2.fq.gz	fastq fastq	7030804800.0	46872032.0	C0 1 1.fq.gz	0:150 1:150	A:1891469955;C:1624531422;G:1603124564;T:1911444454;N:234405	150	150	1891469955	1624531422	1603124564	1911444454	234405	SRX7957241	SRS6343348	SRA1056819	Southern University of Science and Technology\|School of Environmental Science and Engineering	Southern University of Science and Technology	1	0.93519		0.0328		0.74602		0.48272		150		B		usable mapping rate	bgi	bgi	unknown	random_priming	unknown	bulk	unknown	unknown	China	2020-03-20	Undetermined	Adult	Gonad	Reproductive System
61505	61505	SRR12786081	SRX9255339	SRS7487541	SRP286633	PRJNA667863	Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs	GSE159162	Transcriptome Analysis	Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.		pubmed:35532311		Sample WT FG 4	GSM4820795		source name:follicles\|tissue:Ovary\|stage of follicles:FG\|genotype:wild type	Sample WT FG 4	Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample	follicles		Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.		tissue:Ovary\|stage of follicles:FG\|genotype:wild type	GSM4820795	GSM4820795: Sample WT FG 4; Danio rerio; RNA Seq	GSM4820795		1	Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions.	GEO Accession:GSM4820795	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten		SRP286633			Sample_WT_FG_4.R1.fq.gz Sample_WT_FG_4.R2.fq.gz	fastq fastq	6494839649.0	22379034.0	GSM4820795 r1	0:145.94 1:144.28	A:1649345658;C:1579352648;G:1580948162;T:1685086821;N:106360	145	144	1649345658	1579352648	1580948162	1685086821	106360	SRX9255339	SRS7487541	SRA1139682	GEO	Institute of Hydrobiology	2	0.94646	0.94736	0.01915	0.01888	0.75554	0.75566	0.50735	0.50347	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	small_rna	trueseq	bulk	unknown	unknown	China	2020-10-07	Undetermined	Undetermined	Gonad	Reproductive System
61506	61506	SRR12786080	SRX9255338	SRS7487540	SRP286633	PRJNA667863	Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs	GSE159162	Transcriptome Analysis	Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.		pubmed:35532311		Sample WT FG 3	GSM4820794		source name:follicles\|tissue:Ovary\|stage of follicles:FG\|genotype:wild type	Sample WT FG 3	Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample	follicles		Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.		tissue:Ovary\|stage of follicles:FG\|genotype:wild type	GSM4820794	GSM4820794: Sample WT FG 3; Danio rerio; RNA Seq	GSM4820794		1	Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions.	GEO Accession:GSM4820794	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten		SRP286633			Sample_WT_FG_3.R1.fq.gz Sample_WT_FG_3.R2.fq.gz	fastq fastq	6925670591.0	23930393.0	GSM4820794 r1	0:145.51 1:143.90	A:1758516170;C:1686214780;G:1687326968;T:1793466364;N:146309	145	143	1758516170	1686214780	1687326968	1793466364	146309	SRX9255338	SRS7487540	SRA1139682	GEO	Institute of Hydrobiology	2	0.94987	0.95208	0.01972	0.01986	0.75779	0.75891	0.49235	0.49103	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	small_rna	trueseq	bulk	unknown	unknown	China	2020-10-07	Undetermined	Undetermined	Gonad	Reproductive System
61507	61507	SRR12786079	SRX9255337	SRS7487539	SRP286633	PRJNA667863	Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs	GSE159162	Transcriptome Analysis	Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.		pubmed:35532311		Sample WT FG 2	GSM4820793		source name:follicles\|tissue:Ovary\|stage of follicles:FG\|genotype:wild type	Sample WT FG 2	Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample	follicles		Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.		tissue:Ovary\|stage of follicles:FG\|genotype:wild type	GSM4820793	GSM4820793: Sample WT FG 2; Danio rerio; RNA Seq	GSM4820793		1	Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions.	GEO Accession:GSM4820793	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten		SRP286633			Sample_WT_FG_2.R1.fq.gz Sample_WT_FG_2.R2.fq.gz	fastq fastq	6937720341.0	23868543.0	GSM4820793 r1	0:146.23 1:144.43	A:1760323867;C:1687409068;G:1688288208;T:1801543463;N:155735	146	144	1760323867	1687409068	1688288208	1801543463	155735	SRX9255337	SRS7487539	SRA1139682	GEO	Institute of Hydrobiology	2	0.94558	0.94771	0.01901	0.01877	0.75915	0.75893	0.49355	0.49438	86	86	B	B	biological fallback assumption	illumina	hiseq_era	unknown	small_rna	trueseq	bulk	unknown	unknown	China	2020-10-07	Undetermined	Undetermined	Gonad	Reproductive System
61508	61508	SRR12786078	SRX9255336	SRS7487538	SRP286633	PRJNA667863	Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs	GSE159162	Transcriptome Analysis	Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.		pubmed:35532311		Sample WT FG 1	GSM4820792		source name:follicles\|tissue:Ovary\|stage of follicles:FG\|genotype:wild type	Sample WT FG 1	Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample	follicles		Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.		tissue:Ovary\|stage of follicles:FG\|genotype:wild type	GSM4820792	GSM4820792: Sample WT FG 1; Danio rerio; RNA Seq	GSM4820792		1	Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions.	GEO Accession:GSM4820792	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten		SRP286633			Sample_WT_FG_1.R1.fq.gz Sample_WT_FG_1.R2.fq.gz	fastq fastq	6967269048.0	23937357.0	GSM4820792 r1	0:146.29 1:144.78	A:1778908738;C:1684335965;G:1686285595;T:1817522579;N:216171	146	144	1778908738	1684335965	1686285595	1817522579	216171	SRX9255336	SRS7487538	SRA1139682	GEO	Institute of Hydrobiology	2	0.9478	0.94904	0.0209	0.02072	0.75653	0.75716	0.48347	0.48235	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	small_rna	trueseq	bulk	unknown	unknown	China	2020-10-07	Undetermined	Undetermined	Gonad	Reproductive System
61509	61509	SRR12786077	SRX9255335	SRS7487537	SRP286633	PRJNA667863	Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs	GSE159162	Transcriptome Analysis	Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.		pubmed:35532311		Sample WT EGG 5	GSM4820791		source name:follicles\|tissue:Ovary\|stage of follicles:mature egg\|genotype:wild type	Sample WT EGG 5	Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample	follicles		Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.		tissue:Ovary\|stage of follicles:mature egg\|genotype:wild type	GSM4820791	GSM4820791: Sample WT EGG 5; Danio rerio; RNA Seq	GSM4820791		1	Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions.	GEO Accession:GSM4820791	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten		SRP286633			Sample_WT_EGG_5.R1.fq.gz Sample_WT_EGG_5.R2.fq.gz	fastq fastq	6759669369.0	23484870.0	GSM4820791 r1	0:144.70 1:143.13	A:1779446270;C:1589997978;G:1589479961;T:1800569943;N:175217	144	143	1779446270	1589997978	1589479961	1800569943	175217	SRX9255335	SRS7487537	SRA1139682	GEO	Institute of Hydrobiology	2	0.93866	0.94281	0.02922	0.02836	0.81203	0.81211	0.50024	0.50364	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	small_rna	trueseq	bulk	unknown	unknown	China	2020-10-07	Undetermined	Undetermined	Gonad	Reproductive System
61510	61510	SRR12786076	SRX9255334	SRS7487536	SRP286633	PRJNA667863	Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs	GSE159162	Transcriptome Analysis	Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.		pubmed:35532311		Sample WT EGG 4	GSM4820790		source name:follicles\|tissue:Ovary\|stage of follicles:mature egg\|genotype:wild type	Sample WT EGG 4	Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample	follicles		Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.		tissue:Ovary\|stage of follicles:mature egg\|genotype:wild type	GSM4820790	GSM4820790: Sample WT EGG 4; Danio rerio; RNA Seq	GSM4820790		1	Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions.	GEO Accession:GSM4820790	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten		SRP286633			Sample_WT_EGG_4.R1.fq.gz Sample_WT_EGG_4.R2.fq.gz	fastq fastq	6507516169.0	22482048.0	GSM4820790 r1	0:145.79 1:143.66	A:1716909756;C:1525253185;G:1525859003;T:1739392348;N:101877	145	143	1716909756	1525253185	1525859003	1739392348	101877	SRX9255334	SRS7487536	SRA1139682	GEO	Institute of Hydrobiology	2	0.93927	0.94219	0.02868	0.02773	0.81225	0.81268	0.51042	0.50948	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	small_rna	trueseq	bulk	unknown	unknown	China	2020-10-07	Undetermined	Undetermined	Gonad	Reproductive System
61511	61511	SRR12786075	SRX9255333	SRS7487535	SRP286633	PRJNA667863	Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs	GSE159162	Transcriptome Analysis	Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.		pubmed:35532311		Sample WT EGG 3	GSM4820789		source name:follicles\|tissue:Ovary\|stage of follicles:mature egg\|genotype:wild type	Sample WT EGG 3	Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample	follicles		Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.		tissue:Ovary\|stage of follicles:mature egg\|genotype:wild type	GSM4820789	GSM4820789: Sample WT EGG 3; Danio rerio; RNA Seq	GSM4820789		1	Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions.	GEO Accession:GSM4820789	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten		SRP286633			Sample_WT_EGG_3.R1.fq.gz Sample_WT_EGG_3.R2.fq.gz	fastq fastq	6892017136.0	23794526.0	GSM4820789 r1	0:145.73 1:143.92	A:1860381019;C:1583189044;G:1576215039;T:1872104069;N:127965	145	143	1860381019	1583189044	1576215039	1872104069	127965	SRX9255333	SRS7487535	SRA1139682	GEO	Institute of Hydrobiology	2	0.93308	0.93454	0.03385	0.0331	0.82836	0.82862	0.51253	0.52212	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	small_rna	trueseq	bulk	unknown	unknown	China	2020-10-07	Undetermined	Undetermined	Gonad	Reproductive System
61512	61512	SRR12786074	SRX9255332	SRS7487534	SRP286633	PRJNA667863	Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs	GSE159162	Transcriptome Analysis	Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.		pubmed:35532311		Sample WT EGG 2	GSM4820788		source name:follicles\|tissue:Ovary\|stage of follicles:mature egg\|genotype:wild type	Sample WT EGG 2	Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample	follicles		Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.		tissue:Ovary\|stage of follicles:mature egg\|genotype:wild type	GSM4820788	GSM4820788: Sample WT EGG 2; Danio rerio; RNA Seq	GSM4820788		1	Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions.	GEO Accession:GSM4820788	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten		SRP286633			Sample_WT_EGG_2.R1.fq.gz Sample_WT_EGG_2.R2.fq.gz	fastq fastq	5738534730.0	20501677.0	GSM4820788 r1	0:140.71 1:139.19	A:1521303459;C:1341529264;G:1344606059;T:1531008879;N:87069	140	139	1521303459	1341529264	1344606059	1531008879	87069	SRX9255332	SRS7487534	SRA1139682	GEO	Institute of Hydrobiology	2	0.93514	0.93628	0.03038	0.02998	0.82471	0.82477	0.51484	0.52018	78	80	B	B	biological fallback assumption	illumina	hiseq_era	unknown	small_rna	trueseq	bulk	unknown	unknown	China	2020-10-07	Undetermined	Undetermined	Gonad	Reproductive System

Advanced export

JSON shape: default, array, newline-delimited

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;