RNAquarium Metadata Server
Institute Website Terms of Use Privacy Policy

run_metadata

819 rows where devstage_curation = "Undetermined" and tissue_curation = "Embryo Imprecise"

✎ View and edit SQL

This data as json, CSV (advanced)

experiment.library_selection 8

technology 6

experiment.library_strategy 4

experiment.library_source 2

experiment.library_layout 2

tissue_curation_coarse 1

tissue_curation 1

  • Embryo Imprecise · 819 ✖

experiment.platform 1

devstage_curation_coarse 1

devstage_curation 1

  • Undetermined · 819 ✖
Link rowid ▼ run.accession experiment.accession sample.accession study.accession bioproject study.title study.alias study.type study.abstract study.attributes study.PMIDs sample.description sample.title sample.alias sample.centername sample.attributes GEOsample.title GEOsample.dataprocessing GEOsample.source GEOsample.treatmentprotocol GEOsample.extractprotocol GEOsample.growthprotocol GEOsample.characteristics GEOsample.accession experiment.title experiment.alias experiment.library_name experiment.design_description experiment.library_construction_protocol experiment.attributes experiment.library_strategy experiment.library_source experiment.library_selection experiment.library_layout experiment.platform experiment.instrument_model experiment.spot_descriptor experiment.study_ref run.title run.attributes run.filename run.semantic_name run.total_bases run.total_spots run.alias run.read_lengths run.base_counts run.r1_length run.r2_length run.r3_length run.r4_length run.Acount run.Ccount run.Gcount run.Tcount run.Ncount run.experiment run.pool_member submission.accession submission.srasource submission.bioprojectsource seqdetective.n_mates seqdetective.mapping_rate.mate1 seqdetective.mapping_rate.mate2 seqdetective.nofeature_rate.mate1 seqdetective.nofeature_rate.mate2 seqdetective.sparsity.mate1 seqdetective.sparsity.mate2 seqdetective.pos_strand_rate.mate1 seqdetective.pos_strand_rate.mate2 seqdetective.readlen.mate1 seqdetective.readlen.mate2 seqdetective.judgement.mate1 seqdetective.judgement.mate2 seqdetective.judgement.reason platform_family instrument_generation read_bias selection_class prep_kit sc_or_bulk tech_class technology tech_variant submission.bioprojectsource.country earliest_date devstage_curation devstage_curation_coarse tissue_curation tissue_curation_coarse
9419 9419 ERR273825 ERX248101 ERS092357 ERP001559 PRJEB3118 Zebrafish transcript profiling Zebrafish_transcript_profiling-sc-2012-06-28T15:47:32Z-82 Transcriptome Analysis Paired end sequence data from the Illumina Genome Analyzer was prepared from normal and mutant zebrafish embryos for transcript profiling. This includes pilot studies for transcript indexing within the sequence reads.         SAMEA1888984 SC ArrayExpress Sex:mixed|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2013 05 13T11:13:14Z|ENA LAST UPDATE:2018 03 08T15:36:21Z|External Id:SAMEA1888984|INSDC center name:SC|INSDC first public:2013 05 13T11:13:14Z|INSDC last update:2018 03 08T15:36:21Z|INSDC status:public|Submitter Id:hu2117 mutant vs wild type sc 2012 02 06T13:11:11Z 1107268|common name:zebrafish|sample description:3 prime end enriched mRNA from 3 morphological mutant hu2117 embryo samples and 3 matched sibling wild type samples. A 6 base indexing sequence is bases 5 to 10 of read 1 followed by polyT.|sample name:hu2117 mutant vs wild type sc 2012 02 06T13:11:11Z 1107268|scientific name:Danio rerio                 1 SC EXP 6316 8 2387558 Illumina sequencing of library 2387558 constructed from sample accession ERS092357 for study accession ERP001559. qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP001559 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2013 05 13|ENA LAST UPDATE:2018 11 16 6316_8.bam bam 12715227300.0 84768182.0 SC RUN 6316 8 0:75 1:75 A:3986328155;C:1983554902;G:2466211000;T:4277430579;N:1702664 75 75     3986328155 1983554902 2466211000 4277430579 1702664 ERX248101 ERS092357 ERA212579 SC Wellcome Sanger Institute 2 0.06657 0.60346 0.04569 0.19203 0.9767 0.82014 0.52373 0.4048 75 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2013-05-13 Undetermined Embryo Embryo Imprecise All anatomical structures
9420 9420 ERR273824 ERX248100 ERS092356 ERP001559 PRJEB3118 Zebrafish transcript profiling Zebrafish_transcript_profiling-sc-2012-06-28T15:47:32Z-82 Transcriptome Analysis Paired end sequence data from the Illumina Genome Analyzer was prepared from normal and mutant zebrafish embryos for transcript profiling. This includes pilot studies for transcript indexing within the sequence reads.         SAMEA1889000 SC ArrayExpress Sex:mixed|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2013 05 13T11:13:13Z|ENA LAST UPDATE:2018 03 08T15:36:25Z|External Id:SAMEA1889000|INSDC center name:SC|INSDC first public:2013 05 13T11:13:13Z|INSDC last update:2018 03 08T15:36:25Z|INSDC status:public|Submitter Id:e48 mutant vs wild type sc 2012 02 06T13:11:09Z 1107267|common name:zebrafish|sample description:3 prime end enriched mRNA from 3 morphological mutant e48 embryo samples and 3 matched sibling wild type samples. A 6 base indexing sequence is bases 5 to 10 of read 1 followed by polyT.|sample name:e48 mutant vs wild type sc 2012 02 06T13:11:09Z 1107267|scientific name:Danio rerio                 1 SC EXP 6316 7 2387557 Illumina sequencing of library 2387557 constructed from sample accession ERS092356 for study accession ERP001559. qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP001559 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2013 05 13|ENA LAST UPDATE:2018 11 16 6316_7.bam bam 17475932100.0 116506214.0 SC RUN 6316 7 0:75 1:75 A:5548228936;C:2693024343;G:3365940794;T:5867204994;N:1533033 75 75     5548228936 2693024343 3365940794 5867204994 1533033 ERX248100 ERS092356 ERA212579 SC Wellcome Sanger Institute 2 0.05939 0.59457 0.04089 0.19671 0.98068 0.838 0.46304 0.62741 75 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2013-05-13 Undetermined Embryo Embryo Imprecise All anatomical structures
9421 9421 ERR273823 ERX248099 ERS092354 ERP001559 PRJEB3118 Zebrafish transcript profiling Zebrafish_transcript_profiling-sc-2012-06-28T15:47:32Z-82 Transcriptome Analysis Paired end sequence data from the Illumina Genome Analyzer was prepared from normal and mutant zebrafish embryos for transcript profiling. This includes pilot studies for transcript indexing within the sequence reads.         SAMEA1889008 SC ArrayExpress Sex:mixed|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2013 05 13T11:13:13Z|ENA LAST UPDATE:2018 03 08T15:36:21Z|External Id:SAMEA1889008|INSDC center name:SC|INSDC first public:2013 05 13T11:13:13Z|INSDC last update:2018 03 08T15:36:21Z|INSDC status:public|Submitter Id:hu3332 mutant vs wild type sc 2012 02 06T13:11:07Z 1107265|common name:zebrafish|sample description:3 prime end enriched mRNA from 3 morphological mutant hu3332 embryo samples and 3 matched sibling wild type samples. A 6 base indexing sequence is bases 5 to 10 of read 1 followed by polyT.|sample name:hu3332 mutant vs wild type sc 2012 02 06T13:11:07Z 1107265|scientific name:Danio rerio                 1 SC EXP 6316 5 2387555 Illumina sequencing of library 2387555 constructed from sample accession ERS092354 for study accession ERP001559. qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP001559 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2013 05 13|ENA LAST UPDATE:2018 11 16 6316_5.bam bam 13995917850.0 93306119.0 SC RUN 6316 5 0:75 1:75 A:4367273029;C:2176748810;G:2714026832;T:4736121060;N:1748119 75 75     4367273029 2176748810 2714026832 4736121060 1748119 ERX248099 ERS092354 ERA212579 SC Wellcome Sanger Institute 2 0.06401 0.62019 0.04224 0.18728 0.97723 0.81071 0.461 0.55379 75 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2013-05-13 Undetermined Embryo Embryo Imprecise All anatomical structures
9422 9422 ERR273822 ERX248098 ERS092063 ERP001559 PRJEB3118 Zebrafish transcript profiling Zebrafish_transcript_profiling-sc-2012-06-28T15:47:32Z-82 Transcriptome Analysis Paired end sequence data from the Illumina Genome Analyzer was prepared from normal and mutant zebrafish embryos for transcript profiling. This includes pilot studies for transcript indexing within the sequence reads.         SAMEA1888996 SC ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2013 05 13T11:13:13Z|ENA LAST UPDATE:2018 03 08T15:36:13Z|External Id:SAMEA1888996|INSDC center name:SC|INSDC first public:2013 05 13T11:13:13Z|INSDC last update:2018 03 08T15:36:13Z|INSDC status:public|Submitter Id:sa0058 mutant vs wild type sc 2012 02 06T13:05:07Z 265521|common name:zebrafish|sample description:33 prime end enriched mRNA from 3 morphological mutant sa0058 embryo samples and 3 matched sibling wild type samples. A 6 base indexing sequence is bases 5 to 10 of read 1 followed by polyT.|sample name:sa0058 mutant vs wild type sc 2012 02 06T13:05:07Z 265521|scientific name:Danio rerio                 1 SC EXP 5287 7 449230 Illumina sequencing of library 449230 constructed from sample accession ERS092063 for study accession ERP001559. qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina Genome Analyzer II   ERP001559 Illumina Genome Analyzer II paired end sequencing ENA FIRST PUBLIC:2013 05 13|ENA LAST UPDATE:2018 11 16 5287_7.bam bam 2216402460.0 20522245.0 SC RUN 5287 7 0:54 1:54 A:646882787;C:346392353;G:394060191;T:827745173;N:1321956 54 54     646882787 346392353 394060191 827745173 1321956 ERX248098 ERS092063 ERA212579 SC Wellcome Sanger Institute 2 0.02565 0.72009 0.01691 0.21429 0.98725 0.78944 0.62084 0.61278 54 54 T B mate1 technical by mapping diff illumina early_illumina 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2013-05-13 Undetermined Embryo Embryo Imprecise All anatomical structures
11777 11777 ERR11758595 ERX11157718 ERS16172936 ERP149744 PRJEB64563 Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos E-MTAB-13196 Transcriptome Analysis Development of the dorsal aorta is a key step in the establishment of the adult blood forming system since hematopoietic stem and progenitor cells HSPCs arise from ventral aortic endothelium in all vertebrate animals studied. Work in zebrafish has demonstrated that arterial and venous endothelial precursors arise from distinct subsets of lateral plate mesoderm. Here we profile the transcriptome of the earliest detectable endothelial cells ECs during zebrafish embryogenesis to demonstrate that tissue specific EC programs initiate much earlier than previously appreciated by the end of gastrulation. Classic studies in the chick embryo showed that paraxial mesoderm generates a subset of somite derived endothelial cells SDECs that incorporate into the dorsal aorta to replace HSPCs as they exit the aorta and enter circulation. We describe a conserved program in the zebrafish where a rare population of endothelial precursors delaminates from the dermomyotome to incorporate exclusively into the developing dorsal aorta. Whereas SDECs lack hematopoietic potential they act as a local niche to support the emergence of HSPCs from neighboring hemogenic endothelium. Thus at least three subsets of ECs contribute to the developing dorsal aorta: vascular ECs hemogenic ECs and SDECs. Taken together our findings indicate that the distinct spatial origins of endothelial precursors dictate different cellular potentials within the developing dorsal aorta. ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01   Protocols: Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. drl tb SAMEA114192243 Institute of Molecular Genetics of the Czech Academy of Sciences ENA FIRST PUBLIC:2023 08 01T00:17:16Z|ENA LAST UPDATE:2023 08 01T00:17:16Z|External Id:SAMEA114192243|INSDC center alias:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC center name:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC first public:2023 08 01T00:17:16Z|INSDC last update:2023 08 01T00:17:16Z|INSDC status:public|Submitter Id:E MTAB 13196:drl tb|age:10|broker name:ArrayExpress|cell type:endothelial cell|collection date:not collected|common name:zebrafish|developmental stage:tail bud prominent stage|genotype:drl:H2B Dendra2|geographic location country and/or sea:not collected|immunophenotype:drl:H2B Dendra2+|isolate:not applicable|organism part:embryo|sample name:E MTAB 13196:drl tb|scientific name:Danio rerio|strain:drl:H2B Dendra2                 Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos E MTAB 13196:drl tb p drl tb p Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.   RNA-Seq TRANSCRIPTOMIC SINGLE CELL Oligo-dT PAIRED ILLUMINA Illumina HiSeq 2500   ERP149744 Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01 drl_h2b-dendra_tb_S36_L001_R2_001.fastq.gz drl_h2b-dendra_tb_S36_L001_R1_001.fastq.gz fastq fastq 211593816.0 1679316.0 E MTAB 13196:drl h2b dendra tb S36 L001 0:28 1:98 A:62689430;C:45809168;G:45709128;T:57272091;N:113999 28 98     62689430 45809168 45709128 57272091 113999 ERX11157718 ERS16172936 ERA25628220 Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive 2 0.00192 0.91331 0.00072 0.14588 0.99675 0.89292 0.51304 0.63144 28 98 T B sc-like readlen illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Czech Republic 2023-08-01 Undetermined Embryo Embryo Imprecise All anatomical structures
11778 11778 ERR11758629 ERX11157718 ERS16172936 ERP149744 PRJEB64563 Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos E-MTAB-13196 Transcriptome Analysis Development of the dorsal aorta is a key step in the establishment of the adult blood forming system since hematopoietic stem and progenitor cells HSPCs arise from ventral aortic endothelium in all vertebrate animals studied. Work in zebrafish has demonstrated that arterial and venous endothelial precursors arise from distinct subsets of lateral plate mesoderm. Here we profile the transcriptome of the earliest detectable endothelial cells ECs during zebrafish embryogenesis to demonstrate that tissue specific EC programs initiate much earlier than previously appreciated by the end of gastrulation. Classic studies in the chick embryo showed that paraxial mesoderm generates a subset of somite derived endothelial cells SDECs that incorporate into the dorsal aorta to replace HSPCs as they exit the aorta and enter circulation. We describe a conserved program in the zebrafish where a rare population of endothelial precursors delaminates from the dermomyotome to incorporate exclusively into the developing dorsal aorta. Whereas SDECs lack hematopoietic potential they act as a local niche to support the emergence of HSPCs from neighboring hemogenic endothelium. Thus at least three subsets of ECs contribute to the developing dorsal aorta: vascular ECs hemogenic ECs and SDECs. Taken together our findings indicate that the distinct spatial origins of endothelial precursors dictate different cellular potentials within the developing dorsal aorta. ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01   Protocols: Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. drl tb SAMEA114192243 Institute of Molecular Genetics of the Czech Academy of Sciences ENA FIRST PUBLIC:2023 08 01T00:17:16Z|ENA LAST UPDATE:2023 08 01T00:17:16Z|External Id:SAMEA114192243|INSDC center alias:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC center name:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC first public:2023 08 01T00:17:16Z|INSDC last update:2023 08 01T00:17:16Z|INSDC status:public|Submitter Id:E MTAB 13196:drl tb|age:10|broker name:ArrayExpress|cell type:endothelial cell|collection date:not collected|common name:zebrafish|developmental stage:tail bud prominent stage|genotype:drl:H2B Dendra2|geographic location country and/or sea:not collected|immunophenotype:drl:H2B Dendra2+|isolate:not applicable|organism part:embryo|sample name:E MTAB 13196:drl tb|scientific name:Danio rerio|strain:drl:H2B Dendra2                 Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos E MTAB 13196:drl tb p drl tb p Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.   RNA-Seq TRANSCRIPTOMIC SINGLE CELL Oligo-dT PAIRED ILLUMINA Illumina HiSeq 2500   ERP149744 Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01 drl_h2b-dendra_tb_S37_L001_R2_001.fastq.gz drl_h2b-dendra_tb_S37_L001_R1_001.fastq.gz fastq fastq 980164836.0 7779086.0 E MTAB 13196:drl h2b dendra tb S37 L001 0:28 1:98 A:281375011;C:216067640;G:222839674;T:259781180;N:101331 28 98     281375011 216067640 222839674 259781180 101331 ERX11157718 ERS16172936 ERA25628220 Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive 2 0.00817 0.89718 0.00237 0.12153 0.98912 0.82643 0.46403 0.64954 28 98 T B sc-like readlen illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Czech Republic 2023-08-01 Undetermined Embryo Embryo Imprecise All anatomical structures
11779 11779 ERR11758618 ERX11157718 ERS16172936 ERP149744 PRJEB64563 Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos E-MTAB-13196 Transcriptome Analysis Development of the dorsal aorta is a key step in the establishment of the adult blood forming system since hematopoietic stem and progenitor cells HSPCs arise from ventral aortic endothelium in all vertebrate animals studied. Work in zebrafish has demonstrated that arterial and venous endothelial precursors arise from distinct subsets of lateral plate mesoderm. Here we profile the transcriptome of the earliest detectable endothelial cells ECs during zebrafish embryogenesis to demonstrate that tissue specific EC programs initiate much earlier than previously appreciated by the end of gastrulation. Classic studies in the chick embryo showed that paraxial mesoderm generates a subset of somite derived endothelial cells SDECs that incorporate into the dorsal aorta to replace HSPCs as they exit the aorta and enter circulation. We describe a conserved program in the zebrafish where a rare population of endothelial precursors delaminates from the dermomyotome to incorporate exclusively into the developing dorsal aorta. Whereas SDECs lack hematopoietic potential they act as a local niche to support the emergence of HSPCs from neighboring hemogenic endothelium. Thus at least three subsets of ECs contribute to the developing dorsal aorta: vascular ECs hemogenic ECs and SDECs. Taken together our findings indicate that the distinct spatial origins of endothelial precursors dictate different cellular potentials within the developing dorsal aorta. ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01   Protocols: Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. drl tb SAMEA114192243 Institute of Molecular Genetics of the Czech Academy of Sciences ENA FIRST PUBLIC:2023 08 01T00:17:16Z|ENA LAST UPDATE:2023 08 01T00:17:16Z|External Id:SAMEA114192243|INSDC center alias:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC center name:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC first public:2023 08 01T00:17:16Z|INSDC last update:2023 08 01T00:17:16Z|INSDC status:public|Submitter Id:E MTAB 13196:drl tb|age:10|broker name:ArrayExpress|cell type:endothelial cell|collection date:not collected|common name:zebrafish|developmental stage:tail bud prominent stage|genotype:drl:H2B Dendra2|geographic location country and/or sea:not collected|immunophenotype:drl:H2B Dendra2+|isolate:not applicable|organism part:embryo|sample name:E MTAB 13196:drl tb|scientific name:Danio rerio|strain:drl:H2B Dendra2                 Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos E MTAB 13196:drl tb p drl tb p Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.   RNA-Seq TRANSCRIPTOMIC SINGLE CELL Oligo-dT PAIRED ILLUMINA Illumina HiSeq 2500   ERP149744 Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01 drl_h2b-dendra_tb_S39_L001_R2_001.fastq.gz drl_h2b-dendra_tb_S39_L001_R1_001.fastq.gz fastq fastq 12118302.0 96177.0 E MTAB 13196:drl h2b dendra tb S39 L001 0:28 1:98 A:3543790;C:2662872;G:2728134;T:3182383;N:1123 28 98     3543790 2662872 2728134 3182383 1123 ERX11157718 ERS16172936 ERA25628220 Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive 2 0.00786 0.88963 0.0025 0.12543 0.99403 0.88635 0.50098 0.64694 28 98 T B sc-like readlen illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Czech Republic 2023-08-01 Undetermined Embryo Embryo Imprecise All anatomical structures
11780 11780 ERR11758643 ERX11157718 ERS16172936 ERP149744 PRJEB64563 Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos E-MTAB-13196 Transcriptome Analysis Development of the dorsal aorta is a key step in the establishment of the adult blood forming system since hematopoietic stem and progenitor cells HSPCs arise from ventral aortic endothelium in all vertebrate animals studied. Work in zebrafish has demonstrated that arterial and venous endothelial precursors arise from distinct subsets of lateral plate mesoderm. Here we profile the transcriptome of the earliest detectable endothelial cells ECs during zebrafish embryogenesis to demonstrate that tissue specific EC programs initiate much earlier than previously appreciated by the end of gastrulation. Classic studies in the chick embryo showed that paraxial mesoderm generates a subset of somite derived endothelial cells SDECs that incorporate into the dorsal aorta to replace HSPCs as they exit the aorta and enter circulation. We describe a conserved program in the zebrafish where a rare population of endothelial precursors delaminates from the dermomyotome to incorporate exclusively into the developing dorsal aorta. Whereas SDECs lack hematopoietic potential they act as a local niche to support the emergence of HSPCs from neighboring hemogenic endothelium. Thus at least three subsets of ECs contribute to the developing dorsal aorta: vascular ECs hemogenic ECs and SDECs. Taken together our findings indicate that the distinct spatial origins of endothelial precursors dictate different cellular potentials within the developing dorsal aorta. ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01   Protocols: Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. drl tb SAMEA114192243 Institute of Molecular Genetics of the Czech Academy of Sciences ENA FIRST PUBLIC:2023 08 01T00:17:16Z|ENA LAST UPDATE:2023 08 01T00:17:16Z|External Id:SAMEA114192243|INSDC center alias:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC center name:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC first public:2023 08 01T00:17:16Z|INSDC last update:2023 08 01T00:17:16Z|INSDC status:public|Submitter Id:E MTAB 13196:drl tb|age:10|broker name:ArrayExpress|cell type:endothelial cell|collection date:not collected|common name:zebrafish|developmental stage:tail bud prominent stage|genotype:drl:H2B Dendra2|geographic location country and/or sea:not collected|immunophenotype:drl:H2B Dendra2+|isolate:not applicable|organism part:embryo|sample name:E MTAB 13196:drl tb|scientific name:Danio rerio|strain:drl:H2B Dendra2                 Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos E MTAB 13196:drl tb p drl tb p Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.   RNA-Seq TRANSCRIPTOMIC SINGLE CELL Oligo-dT PAIRED ILLUMINA Illumina HiSeq 2500   ERP149744 Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01 drl_h2b-dendra_tb_S5_L005_R2_001.fastq.gz drl_h2b-dendra_tb_S5_L005_R1_001.fastq.gz fastq fastq 2061022698.0 16357323.0 E MTAB 13196:drl h2b dendra tb S5 L005 0:28 1:98 A:587730953;C:457631700;G:470283474;T:545196979;N:179592 28 98     587730953 457631700 470283474 545196979 179592 ERX11157718 ERS16172936 ERA25628220 Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive 2 0.01192 0.91661 0.00336 0.12397 0.98518 0.82568 0.45692 0.65555 28 98 T B sc-like readlen illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Czech Republic 2023-08-01 Undetermined Embryo Embryo Imprecise All anatomical structures
11781 11781 ERR11758610 ERX11157718 ERS16172936 ERP149744 PRJEB64563 Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos E-MTAB-13196 Transcriptome Analysis Development of the dorsal aorta is a key step in the establishment of the adult blood forming system since hematopoietic stem and progenitor cells HSPCs arise from ventral aortic endothelium in all vertebrate animals studied. Work in zebrafish has demonstrated that arterial and venous endothelial precursors arise from distinct subsets of lateral plate mesoderm. Here we profile the transcriptome of the earliest detectable endothelial cells ECs during zebrafish embryogenesis to demonstrate that tissue specific EC programs initiate much earlier than previously appreciated by the end of gastrulation. Classic studies in the chick embryo showed that paraxial mesoderm generates a subset of somite derived endothelial cells SDECs that incorporate into the dorsal aorta to replace HSPCs as they exit the aorta and enter circulation. We describe a conserved program in the zebrafish where a rare population of endothelial precursors delaminates from the dermomyotome to incorporate exclusively into the developing dorsal aorta. Whereas SDECs lack hematopoietic potential they act as a local niche to support the emergence of HSPCs from neighboring hemogenic endothelium. Thus at least three subsets of ECs contribute to the developing dorsal aorta: vascular ECs hemogenic ECs and SDECs. Taken together our findings indicate that the distinct spatial origins of endothelial precursors dictate different cellular potentials within the developing dorsal aorta. ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01   Protocols: Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. drl tb SAMEA114192243 Institute of Molecular Genetics of the Czech Academy of Sciences ENA FIRST PUBLIC:2023 08 01T00:17:16Z|ENA LAST UPDATE:2023 08 01T00:17:16Z|External Id:SAMEA114192243|INSDC center alias:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC center name:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC first public:2023 08 01T00:17:16Z|INSDC last update:2023 08 01T00:17:16Z|INSDC status:public|Submitter Id:E MTAB 13196:drl tb|age:10|broker name:ArrayExpress|cell type:endothelial cell|collection date:not collected|common name:zebrafish|developmental stage:tail bud prominent stage|genotype:drl:H2B Dendra2|geographic location country and/or sea:not collected|immunophenotype:drl:H2B Dendra2+|isolate:not applicable|organism part:embryo|sample name:E MTAB 13196:drl tb|scientific name:Danio rerio|strain:drl:H2B Dendra2                 Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos E MTAB 13196:drl tb p drl tb p Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.   RNA-Seq TRANSCRIPTOMIC SINGLE CELL Oligo-dT PAIRED ILLUMINA Illumina HiSeq 2500   ERP149744 Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01 drl_h2b-dendra_tb_S38_L001_R2_001.fastq.gz drl_h2b-dendra_tb_S38_L001_R1_001.fastq.gz fastq fastq 924603120.0 7338120.0 E MTAB 13196:drl h2b dendra tb S38 L001 0:28 1:98 A:265987815;C:203824483;G:210024160;T:244670646;N:96016 28 98     265987815 203824483 210024160 244670646 96016 ERX11157718 ERS16172936 ERA25628220 Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive 2 0.00773 0.89881 0.00242 0.12145 0.98944 0.82948 0.50529 0.66568 28 98 T B sc-like readlen illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Czech Republic 2023-08-01 Undetermined Embryo Embryo Imprecise All anatomical structures
11782 11782 ERR11758641 ERX11157718 ERS16172936 ERP149744 PRJEB64563 Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos E-MTAB-13196 Transcriptome Analysis Development of the dorsal aorta is a key step in the establishment of the adult blood forming system since hematopoietic stem and progenitor cells HSPCs arise from ventral aortic endothelium in all vertebrate animals studied. Work in zebrafish has demonstrated that arterial and venous endothelial precursors arise from distinct subsets of lateral plate mesoderm. Here we profile the transcriptome of the earliest detectable endothelial cells ECs during zebrafish embryogenesis to demonstrate that tissue specific EC programs initiate much earlier than previously appreciated by the end of gastrulation. Classic studies in the chick embryo showed that paraxial mesoderm generates a subset of somite derived endothelial cells SDECs that incorporate into the dorsal aorta to replace HSPCs as they exit the aorta and enter circulation. We describe a conserved program in the zebrafish where a rare population of endothelial precursors delaminates from the dermomyotome to incorporate exclusively into the developing dorsal aorta. Whereas SDECs lack hematopoietic potential they act as a local niche to support the emergence of HSPCs from neighboring hemogenic endothelium. Thus at least three subsets of ECs contribute to the developing dorsal aorta: vascular ECs hemogenic ECs and SDECs. Taken together our findings indicate that the distinct spatial origins of endothelial precursors dictate different cellular potentials within the developing dorsal aorta. ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01   Protocols: Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. drl tb SAMEA114192243 Institute of Molecular Genetics of the Czech Academy of Sciences ENA FIRST PUBLIC:2023 08 01T00:17:16Z|ENA LAST UPDATE:2023 08 01T00:17:16Z|External Id:SAMEA114192243|INSDC center alias:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC center name:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC first public:2023 08 01T00:17:16Z|INSDC last update:2023 08 01T00:17:16Z|INSDC status:public|Submitter Id:E MTAB 13196:drl tb|age:10|broker name:ArrayExpress|cell type:endothelial cell|collection date:not collected|common name:zebrafish|developmental stage:tail bud prominent stage|genotype:drl:H2B Dendra2|geographic location country and/or sea:not collected|immunophenotype:drl:H2B Dendra2+|isolate:not applicable|organism part:embryo|sample name:E MTAB 13196:drl tb|scientific name:Danio rerio|strain:drl:H2B Dendra2                 Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos E MTAB 13196:drl tb p drl tb p Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.   RNA-Seq TRANSCRIPTOMIC SINGLE CELL Oligo-dT PAIRED ILLUMINA Illumina HiSeq 2500   ERP149744 Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01 drl_h2b-dendra_tb_S6_L005_R2_001.fastq.gz drl_h2b-dendra_tb_S6_L005_R1_001.fastq.gz fastq fastq 1954661562.0 15513187.0 E MTAB 13196:drl h2b dendra tb S6 L005 0:28 1:98 A:558769608;C:433724557;G:445550100;T:516443984;N:173313 28 98     558769608 433724557 445550100 516443984 173313 ERX11157718 ERS16172936 ERA25628220 Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive 2 0.0125 0.91697 0.00373 0.12359 0.98447 0.82558 0.4881 0.6456 28 98 T B sc-like readlen illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Czech Republic 2023-08-01 Undetermined Embryo Embryo Imprecise All anatomical structures
11783 11783 ERR11758591 ERX11157718 ERS16172936 ERP149744 PRJEB64563 Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos E-MTAB-13196 Transcriptome Analysis Development of the dorsal aorta is a key step in the establishment of the adult blood forming system since hematopoietic stem and progenitor cells HSPCs arise from ventral aortic endothelium in all vertebrate animals studied. Work in zebrafish has demonstrated that arterial and venous endothelial precursors arise from distinct subsets of lateral plate mesoderm. Here we profile the transcriptome of the earliest detectable endothelial cells ECs during zebrafish embryogenesis to demonstrate that tissue specific EC programs initiate much earlier than previously appreciated by the end of gastrulation. Classic studies in the chick embryo showed that paraxial mesoderm generates a subset of somite derived endothelial cells SDECs that incorporate into the dorsal aorta to replace HSPCs as they exit the aorta and enter circulation. We describe a conserved program in the zebrafish where a rare population of endothelial precursors delaminates from the dermomyotome to incorporate exclusively into the developing dorsal aorta. Whereas SDECs lack hematopoietic potential they act as a local niche to support the emergence of HSPCs from neighboring hemogenic endothelium. Thus at least three subsets of ECs contribute to the developing dorsal aorta: vascular ECs hemogenic ECs and SDECs. Taken together our findings indicate that the distinct spatial origins of endothelial precursors dictate different cellular potentials within the developing dorsal aorta. ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01   Protocols: Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. drl tb SAMEA114192243 Institute of Molecular Genetics of the Czech Academy of Sciences ENA FIRST PUBLIC:2023 08 01T00:17:16Z|ENA LAST UPDATE:2023 08 01T00:17:16Z|External Id:SAMEA114192243|INSDC center alias:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC center name:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC first public:2023 08 01T00:17:16Z|INSDC last update:2023 08 01T00:17:16Z|INSDC status:public|Submitter Id:E MTAB 13196:drl tb|age:10|broker name:ArrayExpress|cell type:endothelial cell|collection date:not collected|common name:zebrafish|developmental stage:tail bud prominent stage|genotype:drl:H2B Dendra2|geographic location country and/or sea:not collected|immunophenotype:drl:H2B Dendra2+|isolate:not applicable|organism part:embryo|sample name:E MTAB 13196:drl tb|scientific name:Danio rerio|strain:drl:H2B Dendra2                 Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos E MTAB 13196:drl tb p drl tb p Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.   RNA-Seq TRANSCRIPTOMIC SINGLE CELL Oligo-dT PAIRED ILLUMINA Illumina HiSeq 2500   ERP149744 Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01 drl_h2b-dendra_tb_S35_L001_R2_001.fastq.gz drl_h2b-dendra_tb_S35_L001_R1_001.fastq.gz fastq fastq 4717188.0 37438.0 E MTAB 13196:drl h2b dendra tb S35 L001 0:28 1:98 A:1419430;C:1014265;G:1016661;T:1264642;N:2190 28 98     1419430 1014265 1016661 1264642 2190 ERX11157718 ERS16172936 ERA25628220 Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive 2 0.0012 0.65482 0.00054 0.10783 0.99953 0.97157 0.625 0.63689 28 98 T B sc-like readlen illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Czech Republic 2023-08-01 Undetermined Embryo Embryo Imprecise All anatomical structures
11784 11784 ERR11758606 ERX11157718 ERS16172936 ERP149744 PRJEB64563 Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos E-MTAB-13196 Transcriptome Analysis Development of the dorsal aorta is a key step in the establishment of the adult blood forming system since hematopoietic stem and progenitor cells HSPCs arise from ventral aortic endothelium in all vertebrate animals studied. Work in zebrafish has demonstrated that arterial and venous endothelial precursors arise from distinct subsets of lateral plate mesoderm. Here we profile the transcriptome of the earliest detectable endothelial cells ECs during zebrafish embryogenesis to demonstrate that tissue specific EC programs initiate much earlier than previously appreciated by the end of gastrulation. Classic studies in the chick embryo showed that paraxial mesoderm generates a subset of somite derived endothelial cells SDECs that incorporate into the dorsal aorta to replace HSPCs as they exit the aorta and enter circulation. We describe a conserved program in the zebrafish where a rare population of endothelial precursors delaminates from the dermomyotome to incorporate exclusively into the developing dorsal aorta. Whereas SDECs lack hematopoietic potential they act as a local niche to support the emergence of HSPCs from neighboring hemogenic endothelium. Thus at least three subsets of ECs contribute to the developing dorsal aorta: vascular ECs hemogenic ECs and SDECs. Taken together our findings indicate that the distinct spatial origins of endothelial precursors dictate different cellular potentials within the developing dorsal aorta. ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01   Protocols: Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. drl tb SAMEA114192243 Institute of Molecular Genetics of the Czech Academy of Sciences ENA FIRST PUBLIC:2023 08 01T00:17:16Z|ENA LAST UPDATE:2023 08 01T00:17:16Z|External Id:SAMEA114192243|INSDC center alias:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC center name:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC first public:2023 08 01T00:17:16Z|INSDC last update:2023 08 01T00:17:16Z|INSDC status:public|Submitter Id:E MTAB 13196:drl tb|age:10|broker name:ArrayExpress|cell type:endothelial cell|collection date:not collected|common name:zebrafish|developmental stage:tail bud prominent stage|genotype:drl:H2B Dendra2|geographic location country and/or sea:not collected|immunophenotype:drl:H2B Dendra2+|isolate:not applicable|organism part:embryo|sample name:E MTAB 13196:drl tb|scientific name:Danio rerio|strain:drl:H2B Dendra2                 Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos E MTAB 13196:drl tb p drl tb p Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.   RNA-Seq TRANSCRIPTOMIC SINGLE CELL Oligo-dT PAIRED ILLUMINA Illumina HiSeq 2500   ERP149744 Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01 drl_h2b-dendra_tb_S34_L001_R1_001.fastq.gz drl_h2b-dendra_tb_S34_L001_R2_001.fastq.gz fastq fastq 303645636.0 2409886.0 E MTAB 13196:drl h2b dendra tb S34 L001 0:28 1:98 A:90748559;C:65369482;G:65969002;T:81405258;N:153335 28 98     90748559 65369482 65969002 81405258 153335 ERX11157718 ERS16172936 ERA25628220 Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive 2 0.00228 0.91262 0.00099 0.14666 0.99638 0.89006 0.47177 0.63109 28 98 T B sc-like readlen illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Czech Republic 2023-08-01 Undetermined Embryo Embryo Imprecise All anatomical structures
11785 11785 ERR11758640 ERX11157718 ERS16172936 ERP149744 PRJEB64563 Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos E-MTAB-13196 Transcriptome Analysis Development of the dorsal aorta is a key step in the establishment of the adult blood forming system since hematopoietic stem and progenitor cells HSPCs arise from ventral aortic endothelium in all vertebrate animals studied. Work in zebrafish has demonstrated that arterial and venous endothelial precursors arise from distinct subsets of lateral plate mesoderm. Here we profile the transcriptome of the earliest detectable endothelial cells ECs during zebrafish embryogenesis to demonstrate that tissue specific EC programs initiate much earlier than previously appreciated by the end of gastrulation. Classic studies in the chick embryo showed that paraxial mesoderm generates a subset of somite derived endothelial cells SDECs that incorporate into the dorsal aorta to replace HSPCs as they exit the aorta and enter circulation. We describe a conserved program in the zebrafish where a rare population of endothelial precursors delaminates from the dermomyotome to incorporate exclusively into the developing dorsal aorta. Whereas SDECs lack hematopoietic potential they act as a local niche to support the emergence of HSPCs from neighboring hemogenic endothelium. Thus at least three subsets of ECs contribute to the developing dorsal aorta: vascular ECs hemogenic ECs and SDECs. Taken together our findings indicate that the distinct spatial origins of endothelial precursors dictate different cellular potentials within the developing dorsal aorta. ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01   Protocols: Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. drl tb SAMEA114192243 Institute of Molecular Genetics of the Czech Academy of Sciences ENA FIRST PUBLIC:2023 08 01T00:17:16Z|ENA LAST UPDATE:2023 08 01T00:17:16Z|External Id:SAMEA114192243|INSDC center alias:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC center name:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC first public:2023 08 01T00:17:16Z|INSDC last update:2023 08 01T00:17:16Z|INSDC status:public|Submitter Id:E MTAB 13196:drl tb|age:10|broker name:ArrayExpress|cell type:endothelial cell|collection date:not collected|common name:zebrafish|developmental stage:tail bud prominent stage|genotype:drl:H2B Dendra2|geographic location country and/or sea:not collected|immunophenotype:drl:H2B Dendra2+|isolate:not applicable|organism part:embryo|sample name:E MTAB 13196:drl tb|scientific name:Danio rerio|strain:drl:H2B Dendra2                 Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos E MTAB 13196:drl tb p drl tb p Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.   RNA-Seq TRANSCRIPTOMIC SINGLE CELL Oligo-dT PAIRED ILLUMINA Illumina HiSeq 2500   ERP149744 Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01 drl_h2b-dendra_tb_S40_L001_R2_001.fastq.gz drl_h2b-dendra_tb_S40_L001_R1_001.fastq.gz fastq fastq 661361022.0 5248897.0 E MTAB 13196:drl h2b dendra tb S40 L001 0:28 1:98 A:190087869;C:145985661;G:150124621;T:175095762;N:67109 28 98     190087869 145985661 150124621 175095762 67109 ERX11157718 ERS16172936 ERA25628220 Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive 2 0.00785 0.89784 0.00251 0.12159 0.98948 0.83055 0.46095 0.64951 28 98 T B sc-like readlen illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Czech Republic 2023-08-01 Undetermined Embryo Embryo Imprecise All anatomical structures
11786 11786 ERR11758605 ERX11157718 ERS16172936 ERP149744 PRJEB64563 Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos E-MTAB-13196 Transcriptome Analysis Development of the dorsal aorta is a key step in the establishment of the adult blood forming system since hematopoietic stem and progenitor cells HSPCs arise from ventral aortic endothelium in all vertebrate animals studied. Work in zebrafish has demonstrated that arterial and venous endothelial precursors arise from distinct subsets of lateral plate mesoderm. Here we profile the transcriptome of the earliest detectable endothelial cells ECs during zebrafish embryogenesis to demonstrate that tissue specific EC programs initiate much earlier than previously appreciated by the end of gastrulation. Classic studies in the chick embryo showed that paraxial mesoderm generates a subset of somite derived endothelial cells SDECs that incorporate into the dorsal aorta to replace HSPCs as they exit the aorta and enter circulation. We describe a conserved program in the zebrafish where a rare population of endothelial precursors delaminates from the dermomyotome to incorporate exclusively into the developing dorsal aorta. Whereas SDECs lack hematopoietic potential they act as a local niche to support the emergence of HSPCs from neighboring hemogenic endothelium. Thus at least three subsets of ECs contribute to the developing dorsal aorta: vascular ECs hemogenic ECs and SDECs. Taken together our findings indicate that the distinct spatial origins of endothelial precursors dictate different cellular potentials within the developing dorsal aorta. ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01   Protocols: Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. drl tb SAMEA114192243 Institute of Molecular Genetics of the Czech Academy of Sciences ENA FIRST PUBLIC:2023 08 01T00:17:16Z|ENA LAST UPDATE:2023 08 01T00:17:16Z|External Id:SAMEA114192243|INSDC center alias:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC center name:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC first public:2023 08 01T00:17:16Z|INSDC last update:2023 08 01T00:17:16Z|INSDC status:public|Submitter Id:E MTAB 13196:drl tb|age:10|broker name:ArrayExpress|cell type:endothelial cell|collection date:not collected|common name:zebrafish|developmental stage:tail bud prominent stage|genotype:drl:H2B Dendra2|geographic location country and/or sea:not collected|immunophenotype:drl:H2B Dendra2+|isolate:not applicable|organism part:embryo|sample name:E MTAB 13196:drl tb|scientific name:Danio rerio|strain:drl:H2B Dendra2                 Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos E MTAB 13196:drl tb p drl tb p Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.   RNA-Seq TRANSCRIPTOMIC SINGLE CELL Oligo-dT PAIRED ILLUMINA Illumina HiSeq 2500   ERP149744 Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01 drl_h2b-dendra_tb_S7_L005_R2_001.fastq.gz drl_h2b-dendra_tb_S7_L005_R1_001.fastq.gz fastq fastq 25157790.0 199665.0 E MTAB 13196:drl h2b dendra tb S7 L005 0:28 1:98 A:7330053;C:5600451;G:5635840;T:6589498;N:1948 28 98     7330053 5600451 5635840 6589498 1948 ERX11157718 ERS16172936 ERA25628220 Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive 2 0.01201 0.91385 0.00341 0.12826 0.98595 0.85161 0.49226 0.64953 28 98 T B sc-like readlen illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Czech Republic 2023-08-01 Undetermined Embryo Embryo Imprecise All anatomical structures
11787 11787 ERR11758600 ERX11157718 ERS16172936 ERP149744 PRJEB64563 Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos E-MTAB-13196 Transcriptome Analysis Development of the dorsal aorta is a key step in the establishment of the adult blood forming system since hematopoietic stem and progenitor cells HSPCs arise from ventral aortic endothelium in all vertebrate animals studied. Work in zebrafish has demonstrated that arterial and venous endothelial precursors arise from distinct subsets of lateral plate mesoderm. Here we profile the transcriptome of the earliest detectable endothelial cells ECs during zebrafish embryogenesis to demonstrate that tissue specific EC programs initiate much earlier than previously appreciated by the end of gastrulation. Classic studies in the chick embryo showed that paraxial mesoderm generates a subset of somite derived endothelial cells SDECs that incorporate into the dorsal aorta to replace HSPCs as they exit the aorta and enter circulation. We describe a conserved program in the zebrafish where a rare population of endothelial precursors delaminates from the dermomyotome to incorporate exclusively into the developing dorsal aorta. Whereas SDECs lack hematopoietic potential they act as a local niche to support the emergence of HSPCs from neighboring hemogenic endothelium. Thus at least three subsets of ECs contribute to the developing dorsal aorta: vascular ECs hemogenic ECs and SDECs. Taken together our findings indicate that the distinct spatial origins of endothelial precursors dictate different cellular potentials within the developing dorsal aorta. ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01   Protocols: Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. drl tb SAMEA114192243 Institute of Molecular Genetics of the Czech Academy of Sciences ENA FIRST PUBLIC:2023 08 01T00:17:16Z|ENA LAST UPDATE:2023 08 01T00:17:16Z|External Id:SAMEA114192243|INSDC center alias:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC center name:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC first public:2023 08 01T00:17:16Z|INSDC last update:2023 08 01T00:17:16Z|INSDC status:public|Submitter Id:E MTAB 13196:drl tb|age:10|broker name:ArrayExpress|cell type:endothelial cell|collection date:not collected|common name:zebrafish|developmental stage:tail bud prominent stage|genotype:drl:H2B Dendra2|geographic location country and/or sea:not collected|immunophenotype:drl:H2B Dendra2+|isolate:not applicable|organism part:embryo|sample name:E MTAB 13196:drl tb|scientific name:Danio rerio|strain:drl:H2B Dendra2                 Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos E MTAB 13196:drl tb p drl tb p Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.   RNA-Seq TRANSCRIPTOMIC SINGLE CELL Oligo-dT PAIRED ILLUMINA Illumina HiSeq 2500   ERP149744 Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01 drl_h2b-dendra_tb_S8_L005_R2_001.fastq.gz drl_h2b-dendra_tb_S8_L005_R1_001.fastq.gz fastq fastq 1422735804.0 11291554.0 E MTAB 13196:drl h2b dendra tb S8 L005 0:28 1:98 A:405788442;C:317299433;G:322206476;T:377317416;N:124037 28 98     405788442 317299433 322206476 377317416 124037 ERX11157718 ERS16172936 ERA25628220 Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive 2 0.01226 0.91547 0.0037 0.12565 0.9849 0.83662 0.48279 0.64531 28 98 T B sc-like readlen illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Czech Republic 2023-08-01 Undetermined Embryo Embryo Imprecise All anatomical structures
11788 11788 ERR11758616 ERX11157718 ERS16172936 ERP149744 PRJEB64563 Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos E-MTAB-13196 Transcriptome Analysis Development of the dorsal aorta is a key step in the establishment of the adult blood forming system since hematopoietic stem and progenitor cells HSPCs arise from ventral aortic endothelium in all vertebrate animals studied. Work in zebrafish has demonstrated that arterial and venous endothelial precursors arise from distinct subsets of lateral plate mesoderm. Here we profile the transcriptome of the earliest detectable endothelial cells ECs during zebrafish embryogenesis to demonstrate that tissue specific EC programs initiate much earlier than previously appreciated by the end of gastrulation. Classic studies in the chick embryo showed that paraxial mesoderm generates a subset of somite derived endothelial cells SDECs that incorporate into the dorsal aorta to replace HSPCs as they exit the aorta and enter circulation. We describe a conserved program in the zebrafish where a rare population of endothelial precursors delaminates from the dermomyotome to incorporate exclusively into the developing dorsal aorta. Whereas SDECs lack hematopoietic potential they act as a local niche to support the emergence of HSPCs from neighboring hemogenic endothelium. Thus at least three subsets of ECs contribute to the developing dorsal aorta: vascular ECs hemogenic ECs and SDECs. Taken together our findings indicate that the distinct spatial origins of endothelial precursors dictate different cellular potentials within the developing dorsal aorta. ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01   Protocols: Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. drl tb SAMEA114192243 Institute of Molecular Genetics of the Czech Academy of Sciences ENA FIRST PUBLIC:2023 08 01T00:17:16Z|ENA LAST UPDATE:2023 08 01T00:17:16Z|External Id:SAMEA114192243|INSDC center alias:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC center name:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC first public:2023 08 01T00:17:16Z|INSDC last update:2023 08 01T00:17:16Z|INSDC status:public|Submitter Id:E MTAB 13196:drl tb|age:10|broker name:ArrayExpress|cell type:endothelial cell|collection date:not collected|common name:zebrafish|developmental stage:tail bud prominent stage|genotype:drl:H2B Dendra2|geographic location country and/or sea:not collected|immunophenotype:drl:H2B Dendra2+|isolate:not applicable|organism part:embryo|sample name:E MTAB 13196:drl tb|scientific name:Danio rerio|strain:drl:H2B Dendra2                 Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos E MTAB 13196:drl tb p drl tb p Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.   RNA-Seq TRANSCRIPTOMIC SINGLE CELL Oligo-dT PAIRED ILLUMINA Illumina HiSeq 2500   ERP149744 Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01 drl_h2b-dendra_tb_S33_L001_R2_001.fastq.gz drl_h2b-dendra_tb_S33_L001_R1_001.fastq.gz fastq fastq 328918212.0 2610462.0 E MTAB 13196:drl h2b dendra tb S33 L001 0:28 1:98 A:98036464;C:71090137;G:71650807;T:87969481;N:171323 28 98     98036464 71090137 71650807 87969481 171323 ERX11157718 ERS16172936 ERA25628220 Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive 2 0.00197 0.89969 0.00087 0.14269 0.99681 0.89134 0.49763 0.63651 28 98 T B sc-like readlen illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Czech Republic 2023-08-01 Undetermined Embryo Embryo Imprecise All anatomical structures
21439 21439 ERR863500 ERX943150 ERS709981 ERP010224 PRJEB9145 Transcriptome profiling protocol development Transcriptome_profiling_protocol_development-sc-2914 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from mutant and wild type zebrafish embryos from the Zebrafish Mutation Project for transcriptome profiling         SAMEA3355680 SC ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 04 21T14:58:32Z|ENA LAST UPDATE:2018 03 09T00:28:53Z|External Id:SAMEA3355680|INSDC center name:SC|INSDC first public:2015 04 21T14:58:32Z|INSDC last update:2018 03 09T00:28:53Z|INSDC status:public|Submitter Id:spike dilution 5x 3 sc 1822515|common name:zebrafish|sample description:3 prime end enriched mRNA from morphologically normal zebrafish embryos for protocol development. A 8 base indexing sequence CTTGTACT is bases 13 to 20 of read 1 followed by CG and polyT. 10uM 8mers used. Spike dilution of 5x used.|sample name:spike dilution 5x 3 sc 1822515|scientific name:Danio rerio|strain:mixed                 Illumina MiSeq paired end sequencing SC EXP 12025 1#12 9199436 Illumina sequencing of library 9199436 constructed from sample accession ERS709981 for study accession ERP010224. This is part of an Illumina multiplexed sequencing run 12025 1. This submission includes reads tagged with the sequence CTTGTACT. qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina MiSeq   ERP010224 Illumina MiSeq paired end sequencing ENA FIRST PUBLIC:2015 04 21|ENA LAST UPDATE:2018 11 16 12025_1#12.cram cram 594698440.0 2123923.0 SC RUN 12025 1#12 0:130 1:150 A:191689930;C:107464803;G:124772545;T:170732108;N:39054 130 150     191689930 107464803 124772545 170732108 39054 ERX943150 ERS709981 ERA432392 The Wellcome Trust Sanger Institute|European Nucleotide Archive Wellcome Sanger Institute 2 0.64129 0.51516 0.21404 0.14552 0.84687 0.88377 0.72598 0.68367 130 150 B B biological fallback assumption illumina miseq 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-04-21 Undetermined Embryo Embryo Imprecise All anatomical structures
21440 21440 ERR863499 ERX943149 ERS709980 ERP010224 PRJEB9145 Transcriptome profiling protocol development Transcriptome_profiling_protocol_development-sc-2914 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from mutant and wild type zebrafish embryos from the Zebrafish Mutation Project for transcriptome profiling         SAMEA3355679 SC ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 04 21T14:58:32Z|ENA LAST UPDATE:2018 03 09T00:28:08Z|External Id:SAMEA3355679|INSDC center name:SC|INSDC first public:2015 04 21T14:58:32Z|INSDC last update:2018 03 09T00:28:08Z|INSDC status:public|Submitter Id:spike dilution 5x 2 sc 1822514|common name:zebrafish|sample description:3 prime end enriched mRNA from morphologically normal zebrafish embryos for protocol development. A 8 base indexing sequence GGCTACAG is bases 13 to 20 of read 1 followed by CG and polyT. 10uM 8mers used. Spike dilution of 5x used.|sample name:spike dilution 5x 2 sc 1822514|scientific name:Danio rerio|strain:mixed                 Illumina MiSeq paired end sequencing SC EXP 12025 1#11 9199435 Illumina sequencing of library 9199435 constructed from sample accession ERS709980 for study accession ERP010224. This is part of an Illumina multiplexed sequencing run 12025 1. This submission includes reads tagged with the sequence GGCTACAG. qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina MiSeq   ERP010224 Illumina MiSeq paired end sequencing ENA FIRST PUBLIC:2015 04 21|ENA LAST UPDATE:2018 11 16 12025_1#11.cram cram 581766920.0 2077739.0 SC RUN 12025 1#11 0:130 1:150 A:183939274;C:107734540;G:120783489;T:169271980;N:37637 130 150     183939274 107734540 120783489 169271980 37637 ERX943149 ERS709980 ERA432392 The Wellcome Trust Sanger Institute|European Nucleotide Archive Wellcome Sanger Institute 2 0.64005 0.5261 0.23053 0.15645 0.84589 0.88055 0.69474 0.68776 130 150 B B biological fallback assumption illumina miseq 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-04-21 Undetermined Embryo Embryo Imprecise All anatomical structures
21441 21441 ERR863498 ERX943148 ERS709979 ERP010224 PRJEB9145 Transcriptome profiling protocol development Transcriptome_profiling_protocol_development-sc-2914 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from mutant and wild type zebrafish embryos from the Zebrafish Mutation Project for transcriptome profiling         SAMEA3355678 SC ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 04 21T14:58:32Z|ENA LAST UPDATE:2018 03 09T00:19:26Z|External Id:SAMEA3355678|INSDC center name:SC|INSDC first public:2015 04 21T14:58:32Z|INSDC last update:2018 03 09T00:19:26Z|INSDC status:public|Submitter Id:spike dilution 5x 1 sc 1822513|common name:zebrafish|sample description:3 prime end enriched mRNA from morphologically normal zebrafish embryos for protocol development.. A 8 base indexing sequence TAGCTTGT is bases 13 to 20 of read 1 followed by CG and polyT. 10uM 8mers used. Spike dilution of 5x used.|sample name:spike dilution 5x 1 sc 1822513|scientific name:Danio rerio|strain:mixed                 Illumina MiSeq paired end sequencing SC EXP 12025 1#10 9199434 Illumina sequencing of library 9199434 constructed from sample accession ERS709979 for study accession ERP010224. This is part of an Illumina multiplexed sequencing run 12025 1. This submission includes reads tagged with the sequence TAGCTTGT. qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina MiSeq   ERP010224 Illumina MiSeq paired end sequencing ENA FIRST PUBLIC:2015 04 21|ENA LAST UPDATE:2018 11 16 12025_1#10.cram cram 476835240.0 1702983.0 SC RUN 12025 1#10 0:130 1:150 A:152841008;C:89036877;G:100030474;T:134895194;N:31687 130 150     152841008 89036877 100030474 134895194 31687 ERX943148 ERS709979 ERA432392 The Wellcome Trust Sanger Institute|European Nucleotide Archive Wellcome Sanger Institute 2 0.64423 0.53089 0.22177 0.15517 0.84301 0.88061 0.69469 0.68545 130 150 B B biological fallback assumption illumina miseq 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-04-21 Undetermined Embryo Embryo Imprecise All anatomical structures
21442 21442 ERR863497 ERX943147 ERS709978 ERP010224 PRJEB9145 Transcriptome profiling protocol development Transcriptome_profiling_protocol_development-sc-2914 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from mutant and wild type zebrafish embryos from the Zebrafish Mutation Project for transcriptome profiling         SAMEA3355677 SC ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 04 21T14:58:32Z|ENA LAST UPDATE:2018 03 08T23:24:54Z|External Id:SAMEA3355677|INSDC center name:SC|INSDC first public:2015 04 21T14:58:32Z|INSDC last update:2018 03 08T23:24:54Z|INSDC status:public|Submitter Id:spike dilution 1x 3 sc 1822512|common name:zebrafish|sample description:3 prime end enriched mRNA from morphologically normal zebrafish embryos for protocol development. A 8 base indexing sequence GATCAGCG is bases 13 to 20 of read 1 followed by CG and polyT. 10uM 8mers used. Spike dilution of 1x used.|sample name:spike dilution 1x 3 sc 1822512|scientific name:Danio rerio|strain:mixed                 Illumina MiSeq paired end sequencing SC EXP 12025 1#9 9199433 Illumina sequencing of library 9199433 constructed from sample accession ERS709978 for study accession ERP010224. This is part of an Illumina multiplexed sequencing run 12025 1. This submission includes reads tagged with the sequence GATCAGCG. qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina MiSeq   ERP010224 Illumina MiSeq paired end sequencing ENA FIRST PUBLIC:2015 04 21|ENA LAST UPDATE:2018 11 16 12025_1#9.cram cram 491187760.0 1754242.0 SC RUN 12025 1#9 0:130 1:150 A:153998911;C:91564987;G:102964774;T:142629578;N:29510 130 150     153998911 91564987 102964774 142629578 29510 ERX943147 ERS709978 ERA432392 The Wellcome Trust Sanger Institute|European Nucleotide Archive Wellcome Sanger Institute 2 0.64377 0.57656 0.20075 0.14986 0.83617 0.86991 0.67695 0.66089 130 150 B B biological fallback assumption illumina miseq 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-04-21 Undetermined Embryo Embryo Imprecise All anatomical structures
21443 21443 ERR863496 ERX943146 ERS709977 ERP010224 PRJEB9145 Transcriptome profiling protocol development Transcriptome_profiling_protocol_development-sc-2914 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from mutant and wild type zebrafish embryos from the Zebrafish Mutation Project for transcriptome profiling         SAMEA3355676 SC ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 04 21T14:58:32Z|ENA LAST UPDATE:2018 03 09T00:28:08Z|External Id:SAMEA3355676|INSDC center name:SC|INSDC first public:2015 04 21T14:58:32Z|INSDC last update:2018 03 09T00:28:08Z|INSDC status:public|Submitter Id:spike dilution 1x 2 sc 1822511|common name:zebrafish|sample description:3 prime end enriched mRNA from morphologically normal zebrafish embryos for protocol development.. A 8 base indexing sequence ACTTGATG is bases 13 to 20 of read 1 followed by CG and polyT. 10uM 8mers used. Spike dilution of 1x used.|sample name:spike dilution 1x 2 sc 1822511|scientific name:Danio rerio|strain:mixed                 Illumina MiSeq paired end sequencing SC EXP 12025 1#8 9199432 Illumina sequencing of library 9199432 constructed from sample accession ERS709977 for study accession ERP010224. This is part of an Illumina multiplexed sequencing run 12025 1. This submission includes reads tagged with the sequence ACTTGATG. qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina MiSeq   ERP010224 Illumina MiSeq paired end sequencing ENA FIRST PUBLIC:2015 04 21|ENA LAST UPDATE:2018 11 16 12025_1#8.cram cram 533824480.0 1906516.0 SC RUN 12025 1#8 0:130 1:150 A:174500124;C:96003940;G:110166141;T:153115655;N:38620 130 150     174500124 96003940 110166141 153115655 38620 ERX943146 ERS709977 ERA432392 The Wellcome Trust Sanger Institute|European Nucleotide Archive Wellcome Sanger Institute 2 0.60583 0.49667 0.19917 0.13412 0.84488 0.88657 0.71075 0.69436 130 150 B B biological fallback assumption illumina miseq 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-04-21 Undetermined Embryo Embryo Imprecise All anatomical structures
21444 21444 ERR863495 ERX943145 ERS709976 ERP010224 PRJEB9145 Transcriptome profiling protocol development Transcriptome_profiling_protocol_development-sc-2914 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from mutant and wild type zebrafish embryos from the Zebrafish Mutation Project for transcriptome profiling         SAMEA3355675 SC ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 04 21T14:58:32Z|ENA LAST UPDATE:2018 03 09T00:19:26Z|External Id:SAMEA3355675|INSDC center name:SC|INSDC first public:2015 04 21T14:58:32Z|INSDC last update:2018 03 09T00:19:26Z|INSDC status:public|Submitter Id:spike dilution 1x 1 sc 1822510|common name:zebrafish|sample description:3 prime end enriched mRNA from morphologically normal zebrafish embryos for protocol development. A 8 base indexing sequence CAGATCTG is bases 13 to 20 of read 1 followed by CG and polyT. 10uM 8mers used. Spike dilution of 1x used.|sample name:spike dilution 1x 1 sc 1822510|scientific name:Danio rerio|strain:mixed                 Illumina MiSeq paired end sequencing SC EXP 12025 1#7 9199431 Illumina sequencing of library 9199431 constructed from sample accession ERS709976 for study accession ERP010224. This is part of an Illumina multiplexed sequencing run 12025 1. This submission includes reads tagged with the sequence CAGATCTG. qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina MiSeq   ERP010224 Illumina MiSeq paired end sequencing ENA FIRST PUBLIC:2015 04 21|ENA LAST UPDATE:2018 11 16 12025_1#7.cram cram 479344040.0 1711943.0 SC RUN 12025 1#7 0:130 1:150 A:153765243;C:86981600;G:100250304;T:138314172;N:32721 130 150     153765243 86981600 100250304 138314172 32721 ERX943145 ERS709976 ERA432392 The Wellcome Trust Sanger Institute|European Nucleotide Archive Wellcome Sanger Institute 2 0.61061 0.50608 0.21328 0.13841 0.84585 0.88446 0.66959 0.36844 130 150 B B biological fallback assumption illumina miseq 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-04-21 Undetermined Embryo Embryo Imprecise All anatomical structures
21445 21445 ERR863494 ERX943144 ERS709975 ERP010224 PRJEB9145 Transcriptome profiling protocol development Transcriptome_profiling_protocol_development-sc-2914 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from mutant and wild type zebrafish embryos from the Zebrafish Mutation Project for transcriptome profiling         SAMEA3355674 SC ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 04 21T14:58:32Z|ENA LAST UPDATE:2018 03 08T23:24:54Z|External Id:SAMEA3355674|INSDC center name:SC|INSDC first public:2015 04 21T14:58:32Z|INSDC last update:2018 03 08T23:24:54Z|INSDC status:public|Submitter Id:spike dilution 0 2x 3 sc 1822509|common name:zebrafish|sample description:3 prime end enriched mRNA from morphologically normal zebrafish embryos for protocol development. A 8 base indexing sequence GCCAATGT is bases 13 to 20 of read 1 followed by CG and polyT. 10uM 8mers used. Spike dilution of 1/5x used.|sample name:spike dilution 0 2x 3 sc 1822509|scientific name:Danio rerio|strain:mixed                 Illumina MiSeq paired end sequencing SC EXP 12025 1#6 9199430 Illumina sequencing of library 9199430 constructed from sample accession ERS709975 for study accession ERP010224. This is part of an Illumina multiplexed sequencing run 12025 1. This submission includes reads tagged with the sequence GCCAATGT. qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina MiSeq   ERP010224 Illumina MiSeq paired end sequencing ENA FIRST PUBLIC:2015 04 21|ENA LAST UPDATE:2018 11 16 12025_1#6.cram cram 591015320.0 2110769.0 SC RUN 12025 1#6 0:130 1:150 A:188141976;C:106674036;G:122384245;T:173776046;N:39017 130 150     188141976 106674036 122384245 173776046 39017 ERX943144 ERS709975 ERA432392 The Wellcome Trust Sanger Institute|European Nucleotide Archive Wellcome Sanger Institute 2 0.62433 0.52721 0.18742 0.13166 0.84273 0.87507 0.69441 0.67941 130 150 B B biological fallback assumption illumina miseq 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-04-21 Undetermined Embryo Embryo Imprecise All anatomical structures
21446 21446 ERR863493 ERX943143 ERS709974 ERP010224 PRJEB9145 Transcriptome profiling protocol development Transcriptome_profiling_protocol_development-sc-2914 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from mutant and wild type zebrafish embryos from the Zebrafish Mutation Project for transcriptome profiling         SAMEA3355673 SC ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 04 21T14:58:32Z|ENA LAST UPDATE:2018 03 09T00:28:08Z|External Id:SAMEA3355673|INSDC center name:SC|INSDC first public:2015 04 21T14:58:32Z|INSDC last update:2018 03 09T00:28:08Z|INSDC status:public|Submitter Id:spike dilution 0 2x 2 sc 1822508|common name:zebrafish|sample description:3 prime end enriched mRNA from morphologically normal zebrafish embryos for protocol development. A 8 base indexing sequence ACAGTGGT is bases 13 to 20 of read 1 followed by CG and polyT. 10uM 8mers used. Spike dilution of 1/5x used.|sample name:spike dilution 0 2x 2 sc 1822508|scientific name:Danio rerio|strain:mixed                 Illumina MiSeq paired end sequencing SC EXP 12025 1#5 9199429 Illumina sequencing of library 9199429 constructed from sample accession ERS709974 for study accession ERP010224. This is part of an Illumina multiplexed sequencing run 12025 1. This submission includes reads tagged with the sequence ACAGTGGT. qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina MiSeq   ERP010224 Illumina MiSeq paired end sequencing ENA FIRST PUBLIC:2015 04 21|ENA LAST UPDATE:2018 11 16 12025_1#5.cram cram 602681240.0 2152433.0 SC RUN 12025 1#5 0:130 1:150 A:190852332;C:112068952;G:124549622;T:175168287;N:42047 130 150     190852332 112068952 124549622 175168287 42047 ERX943143 ERS709974 ERA432392 The Wellcome Trust Sanger Institute|European Nucleotide Archive Wellcome Sanger Institute 2 0.63341 0.5243 0.17928 0.12195 0.842 0.87963 0.70223 0.68203 130 150 B B biological fallback assumption illumina miseq 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-04-21 Undetermined Embryo Embryo Imprecise All anatomical structures
21447 21447 ERR863492 ERX943142 ERS709973 ERP010224 PRJEB9145 Transcriptome profiling protocol development Transcriptome_profiling_protocol_development-sc-2914 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from mutant and wild type zebrafish embryos from the Zebrafish Mutation Project for transcriptome profiling         SAMEA3355672 SC ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 04 21T14:58:32Z|ENA LAST UPDATE:2018 03 09T00:19:26Z|External Id:SAMEA3355672|INSDC center name:SC|INSDC first public:2015 04 21T14:58:32Z|INSDC last update:2018 03 09T00:19:26Z|INSDC status:public|Submitter Id:spike dilution 0 2x 1 sc 1822507|common name:zebrafish|sample description:3 prime end enriched mRNA from morphologically normal zebrafish embryos for protocol development.. A 8 base indexing sequence TGACCACT is bases 13 to 20 of read 1 followed by CG and polyT. 10uM 8mers used. Spike dilution of 1/5x used.|sample name:spike dilution 0 2x 1 sc 1822507|scientific name:Danio rerio|strain:mixed                 Illumina MiSeq paired end sequencing SC EXP 12025 1#4 9199428 Illumina sequencing of library 9199428 constructed from sample accession ERS709973 for study accession ERP010224. This is part of an Illumina multiplexed sequencing run 12025 1. This submission includes reads tagged with the sequence TGACCACT. qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina MiSeq   ERP010224 Illumina MiSeq paired end sequencing ENA FIRST PUBLIC:2015 04 21|ENA LAST UPDATE:2018 11 16 12025_1#4.cram cram 608612200.0 2173615.0 SC RUN 12025 1#4 0:130 1:150 A:190261414;C:112413582;G:131456617;T:174436676;N:43911 130 150     190261414 112413582 131456617 174436676 43911 ERX943142 ERS709973 ERA432392 The Wellcome Trust Sanger Institute|European Nucleotide Archive Wellcome Sanger Institute 2 0.63718 0.51969 0.19272 0.13088 0.84591 0.88016 0.70626 0.67478 130 150 B B biological fallback assumption illumina miseq 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-04-21 Undetermined Embryo Embryo Imprecise All anatomical structures
21448 21448 ERR863491 ERX943141 ERS709972 ERP010224 PRJEB9145 Transcriptome profiling protocol development Transcriptome_profiling_protocol_development-sc-2914 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from mutant and wild type zebrafish embryos from the Zebrafish Mutation Project for transcriptome profiling         SAMEA3355671 SC ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 04 21T14:58:32Z|ENA LAST UPDATE:2018 03 08T23:24:54Z|External Id:SAMEA3355671|INSDC center name:SC|INSDC first public:2015 04 21T14:58:32Z|INSDC last update:2018 03 08T23:24:54Z|INSDC status:public|Submitter Id:spike dilution 0 1x 3 sc 1822506|common name:zebrafish|sample description:3 prime end enriched mRNA from morphologically normal zebrafish embryos for protocol development. A 8 base indexing sequence TTAGGCAT is bases 13 to 20 of read 1 followed by CG and polyT. 10uM 8mers used. Spike dilution of 1/10x used.|sample name:spike dilution 0 1x 3 sc 1822506|scientific name:Danio rerio|strain:mixed                 Illumina MiSeq paired end sequencing SC EXP 12025 1#3 9199427 Illumina sequencing of library 9199427 constructed from sample accession ERS709972 for study accession ERP010224. This is part of an Illumina multiplexed sequencing run 12025 1. This submission includes reads tagged with the sequence TTAGGCAT. qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina MiSeq   ERP010224 Illumina MiSeq paired end sequencing ENA FIRST PUBLIC:2015 04 21|ENA LAST UPDATE:2018 11 16 12025_1#3.cram cram 559727840.0 1999028.0 SC RUN 12025 1#3 0:130 1:150 A:176833359;C:103868174;G:116658831;T:162329215;N:38261 130 150     176833359 103868174 116658831 162329215 38261 ERX943141 ERS709972 ERA432392 The Wellcome Trust Sanger Institute|European Nucleotide Archive Wellcome Sanger Institute 2 0.64315 0.53769 0.19922 0.14749 0.84467 0.88075 0.71042 0.68107 130 150 B B biological fallback assumption illumina miseq 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-04-21 Undetermined Embryo Embryo Imprecise All anatomical structures
21449 21449 ERR863490 ERX943140 ERS709971 ERP010224 PRJEB9145 Transcriptome profiling protocol development Transcriptome_profiling_protocol_development-sc-2914 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from mutant and wild type zebrafish embryos from the Zebrafish Mutation Project for transcriptome profiling         SAMEA3355670 SC ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 04 21T14:58:32Z|ENA LAST UPDATE:2018 03 09T00:28:08Z|External Id:SAMEA3355670|INSDC center name:SC|INSDC first public:2015 04 21T14:58:32Z|INSDC last update:2018 03 09T00:28:08Z|INSDC status:public|Submitter Id:spike dilution 0 1x 2 sc 1822505|common name:zebrafish|sample description:3 prime end enriched mRNA from morphologically normal zebrafish embryos for protocol development. A 8 base indexing sequence CGATGTTT is bases 13 to 20 of read 1 followed by CG and polyT. 10uM 8mers used. Spike dilution of 1/10x used.|sample name:spike dilution 0 1x 2 sc 1822505|scientific name:Danio rerio|strain:mixed                 Illumina MiSeq paired end sequencing SC EXP 12025 1#2 9199426 Illumina sequencing of library 9199426 constructed from sample accession ERS709971 for study accession ERP010224. This is part of an Illumina multiplexed sequencing run 12025 1. This submission includes reads tagged with the sequence CGATGTTT. qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina MiSeq   ERP010224 Illumina MiSeq paired end sequencing ENA FIRST PUBLIC:2015 04 21|ENA LAST UPDATE:2018 11 16 12025_1#2.cram cram 544839960.0 1945857.0 SC RUN 12025 1#2 0:130 1:150 A:174691595;C:103044374;G:115824582;T:151241960;N:37449 130 150     174691595 103044374 115824582 151241960 37449 ERX943140 ERS709971 ERA432392 The Wellcome Trust Sanger Institute|European Nucleotide Archive Wellcome Sanger Institute 2 0.61405 0.52252 0.19134 0.13417 0.8578 0.89532 0.74009 0.73124 130 150 B B biological fallback assumption illumina miseq 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-04-21 Undetermined Embryo Embryo Imprecise All anatomical structures
21450 21450 ERR863489 ERX943139 ERS709970 ERP010224 PRJEB9145 Transcriptome profiling protocol development Transcriptome_profiling_protocol_development-sc-2914 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from mutant and wild type zebrafish embryos from the Zebrafish Mutation Project for transcriptome profiling         SAMEA3355669 SC ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 04 21T14:58:32Z|ENA LAST UPDATE:2018 03 09T00:28:08Z|External Id:SAMEA3355669|INSDC center name:SC|INSDC first public:2015 04 21T14:58:32Z|INSDC last update:2018 03 09T00:28:08Z|INSDC status:public|Submitter Id:spike dilution 0 1x 1 sc 1822504|common name:zebrafish|sample description:3 prime end enriched mRNA from morphologically normal zebrafish embryos for protocol development. A 8 base indexing sequence ATCACGTT is bases 13 to 20 of read 1 followed by CG and polyT. 10uM 8mers used. Spike dilution of 1/10x used.|sample name:spike dilution 0 1x 1 sc 1822504|scientific name:Danio rerio|strain:mixed                 Illumina MiSeq paired end sequencing SC EXP 12025 1#1 9199425 Illumina sequencing of library 9199425 constructed from sample accession ERS709970 for study accession ERP010224. This is part of an Illumina multiplexed sequencing run 12025 1. This submission includes reads tagged with the sequence ATCACGTT. qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina MiSeq   ERP010224 Illumina MiSeq paired end sequencing ENA FIRST PUBLIC:2015 04 21|ENA LAST UPDATE:2018 11 16 12025_1#1.cram cram 591722600.0 2113295.0 SC RUN 12025 1#1 0:130 1:150 A:191185742;C:104479067;G:118593479;T:177428654;N:35658 130 150     191185742 104479067 118593479 177428654 35658 ERX943139 ERS709970 ERA432392 The Wellcome Trust Sanger Institute|European Nucleotide Archive Wellcome Sanger Institute 2 0.59931 0.5446 0.18474 0.13393 0.85005 0.87856 0.67344 0.38597 130 150 B B biological fallback assumption illumina miseq 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-04-21 Undetermined Embryo Embryo Imprecise All anatomical structures
28690 28690 SRR26535341 SRX22238472 SRS19292733 SRP468564 PRJNA1032461 A syngeneic spontaneous zebrafish model oftp53 deficient EGFRviii and PI3KCAH1047R driven glioblastoma reveals inhibitory roles for inflammation during tumor initiation and relapsein vivo GSE246295 Transcriptome Analysis To build a patient relevantin vivomodel of human glioblastoma we expressed common oncogenic variants including activated human EGFRviii or KRAS and PI3KCAH1047Runder the control of the radial glial specific promoterher4.1in syngeneictp53loss of function mutant zebrafish.Robust tumor formation was observed prior to 45 days of life with a gene expression signature similar to human glioblastoma of the mesenchymal subtype along with a strong inflammatory component. Within early stage tumor lesions and in an intact and endogenous tumor microenvironment we visualized infiltration of phagocytic cells as well as internalization of tumor cells bympeg1.1:GFP+ microglia/macrophages suggesting negative regulatory pressure by pro inflammatory cell types on tumor growth at early stages of glioblastoma initiationin vivo. Furthermore CRISPR/Cas9 mediated gene targeting of master inflammatory transcription factorsirf7andirf8led to increased tumor formation in the primary context while suppression of microglial/macrophage activity led to enhanced tumor cell engraftment following transplantation into otherwise immune competent zebrafish hosts. Altogether we developed a genetically relevant model of aggressive human glioblastoma and harnessed the unique advantages of zebrafish including live imaging high throughput genetic and chemical manipulations to highlight important tumor suppressive roles for the innate immune system on glioblastoma initiation with important future significance for therapeutic discovery and optimizations. Overall design: To capture broad transcriptomic differences in tumor burdened brains versus normal brains we performed bulk RNA sequencing and gene expression analysis of whole brains and sorted cells. EGFRviii derived tumors were induced by microinjection of EGFRviii PI3KCAH1047R and mScarlet constructs defined as EPS. KRAS derived tumors were induced by microinjection of KRAS PI3KCAH1047R GFP constructs defined as KPG. Three whole brains positive for fluorescent tumors EPS 1 3 KPG 1 3 a…   pubmed:39052000   Pooled EPS brains mScarlet ve Sorted Cells GSM7866396   source name:Sorted Cells|strain:CG1 p53null|tissue:Sorted Cells|geo loc name:missing|collection date:missing Pooled EPS brains mScarlet ve Sorted Cells Raw .fastq data was processed using Salmon quantification of transcripts for each sample. A “decoy aware” index was built with the Danio rerio transcriptome and genome using the GRCz11 assembly with a k mers length of 23 with entries manually added for GFP mScarlet EGFRviii KRAS and PI3KCAH1047R transcripts. Samples were then quantified with the following arguments: r seqBias mp 3 validateMappings rangeFactorizationBins 4. Differential gene expression was compared utilizing DESeq2 and GSEA. Assembly: GRCz11 Supplementary files format and content: Tab delimited .csv file including raw counts for all conditions. Sorted Cells Fertilized embryos injected with either EPS or KPG construct mix Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer’s recommendations Zebrafish were housed and reared following approved animal use protocol strain:CG1 p53null|tissue:Sorted Cells GSM7866396 GSM7866396: Pooled EPS brains mScarlet ve Sorted Cells; Danio rerio; RNA Seq GSM7866396 r1 GSM7866396 1 Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer's recommendations   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina NovaSeq 6000   SRP468564   loader:fastq load.py CS_Neg.fastq.gz fastq 6384313020.0 63211020.0 GSM7866396 r1 0:101 A:1646899028;C:1504048934;G:1428638008;T:1804712211;N:14839 101       1646899028 1504048934 1428638008 1804712211 14839 SRX22238472 SRS19292733 SRA1740017 Hayes Lab, DSCB, Sickkids Research Hayes Lab, DSCB, Sickkids Research 1 0.94094   0.14273   0.67416   0.48471   101   B   usable mapping rate illumina novaseq_era unknown poly_a unknown bulk bulk bulk   Canada 2023-10-26 Undetermined Embryo Embryo Imprecise All anatomical structures
28691 28691 SRR26535342 SRX22238471 SRS19292732 SRP468564 PRJNA1032461 A syngeneic spontaneous zebrafish model oftp53 deficient EGFRviii and PI3KCAH1047R driven glioblastoma reveals inhibitory roles for inflammation during tumor initiation and relapsein vivo GSE246295 Transcriptome Analysis To build a patient relevantin vivomodel of human glioblastoma we expressed common oncogenic variants including activated human EGFRviii or KRAS and PI3KCAH1047Runder the control of the radial glial specific promoterher4.1in syngeneictp53loss of function mutant zebrafish.Robust tumor formation was observed prior to 45 days of life with a gene expression signature similar to human glioblastoma of the mesenchymal subtype along with a strong inflammatory component. Within early stage tumor lesions and in an intact and endogenous tumor microenvironment we visualized infiltration of phagocytic cells as well as internalization of tumor cells bympeg1.1:GFP+ microglia/macrophages suggesting negative regulatory pressure by pro inflammatory cell types on tumor growth at early stages of glioblastoma initiationin vivo. Furthermore CRISPR/Cas9 mediated gene targeting of master inflammatory transcription factorsirf7andirf8led to increased tumor formation in the primary context while suppression of microglial/macrophage activity led to enhanced tumor cell engraftment following transplantation into otherwise immune competent zebrafish hosts. Altogether we developed a genetically relevant model of aggressive human glioblastoma and harnessed the unique advantages of zebrafish including live imaging high throughput genetic and chemical manipulations to highlight important tumor suppressive roles for the innate immune system on glioblastoma initiation with important future significance for therapeutic discovery and optimizations. Overall design: To capture broad transcriptomic differences in tumor burdened brains versus normal brains we performed bulk RNA sequencing and gene expression analysis of whole brains and sorted cells. EGFRviii derived tumors were induced by microinjection of EGFRviii PI3KCAH1047R and mScarlet constructs defined as EPS. KRAS derived tumors were induced by microinjection of KRAS PI3KCAH1047R GFP constructs defined as KPG. Three whole brains positive for fluorescent tumors EPS 1 3 KPG 1 3 a…   pubmed:39052000   Pooled EPS brains mScarlet+ve Sorted Cells GSM7866395   source name:Sorted Cells|strain:CG1 p53null|tissue:Sorted Cells|geo loc name:missing|collection date:missing Pooled EPS brains mScarlet+ve Sorted Cells Raw .fastq data was processed using Salmon quantification of transcripts for each sample. A “decoy aware” index was built with the Danio rerio transcriptome and genome using the GRCz11 assembly with a k mers length of 23 with entries manually added for GFP mScarlet EGFRviii KRAS and PI3KCAH1047R transcripts. Samples were then quantified with the following arguments: r seqBias mp 3 validateMappings rangeFactorizationBins 4. Differential gene expression was compared utilizing DESeq2 and GSEA. Assembly: GRCz11 Supplementary files format and content: Tab delimited .csv file including raw counts for all conditions. Sorted Cells Fertilized embryos injected with either EPS or KPG construct mix Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer’s recommendations Zebrafish were housed and reared following approved animal use protocol strain:CG1 p53null|tissue:Sorted Cells GSM7866395 GSM7866395: Pooled EPS brains mScarlet+ve Sorted Cells; Danio rerio; RNA Seq GSM7866395 r1 GSM7866395 1 Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer's recommendations   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina NovaSeq 6000   SRP468564   loader:fastq load.py CS_Pos.fastq.gz fastq 6221936027.0 61603327.0 GSM7866395 r1 0:101 A:1586867899;C:1467436044;G:1398048259;T:1769569401;N:14424 101       1586867899 1467436044 1398048259 1769569401 14424 SRX22238471 SRS19292732 SRA1740017 Hayes Lab, DSCB, Sickkids Research Hayes Lab, DSCB, Sickkids Research 1 0.88463   0.14567   0.69126   0.48428   101   B   usable mapping rate illumina novaseq_era unknown poly_a unknown bulk bulk bulk   Canada 2023-10-26 Undetermined Embryo Embryo Imprecise All anatomical structures
30115 30115 SRR29493648 SRX25004180 SRS21704884 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   20ss 8 GSM8339626   tissue:RNA from single embryo at mRNA|strain:RW|geo loc name:missing|collection date:missing 20ss 8 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RNA from single embryo at mRNA   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:20ss GSM8339626 GSM8339626: 20ss 8; Danio rerio; RNA Seq GSM8339626 r1 GSM8339626 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     DrRyu-016_1.fastq.gz fastq 873781583.0 5786633.0 GSM8339626 r1 0:151 A:304485577;C:165950616;G:172432015;T:230907975;N:5400 151       304485577 165950616 172432015 230907975 5400 SRX25004180 SRS21704884 SRA1904789 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.69607   0.06918   0.8116   0.5221   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-06-20 Undetermined Embryo Embryo Imprecise All anatomical structures
30116 30116 SRR29493649 SRX25004179 SRS21704886 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   20ss 7 GSM8339625   tissue:RNA from single embryo at mRNA|strain:RW|geo loc name:missing|collection date:missing 20ss 7 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RNA from single embryo at mRNA   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:20ss GSM8339625 GSM8339625: 20ss 7; Danio rerio; RNA Seq GSM8339625 r1 GSM8339625 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     DrRyu-015_1.fastq.gz fastq 1267562554.0 8394454.0 GSM8339625 r1 0:151 A:443947351;C:241828235;G:251111334;T:330668191;N:7443 151       443947351 241828235 251111334 330668191 7443 SRX25004179 SRS21704886 SRA1904789 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.69888   0.06395   0.80819   0.54378   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-06-20 Undetermined Embryo Embryo Imprecise All anatomical structures
30117 30117 SRR29493650 SRX25004178 SRS21704885 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   20ss 6 GSM8339624   tissue:RNA from single embryo at mRNA|strain:RW|geo loc name:missing|collection date:missing 20ss 6 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RNA from single embryo at mRNA   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:20ss GSM8339624 GSM8339624: 20ss 6; Danio rerio; RNA Seq GSM8339624 r1 GSM8339624 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     DrRyu-014_1.fastq.gz fastq 1308765773.0 8667323.0 GSM8339624 r1 0:151 A:463621915;C:248487609;G:258441703;T:338206460;N:8086 151       463621915 248487609 258441703 338206460 8086 SRX25004178 SRS21704885 SRA1904789 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.68474   0.05599   0.80935   0.53499   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-06-20 Undetermined Embryo Embryo Imprecise All anatomical structures
30118 30118 SRR29493651 SRX25004177 SRS21704882 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   20ss 5 GSM8339623   tissue:RNA from single embryo at mRNA|strain:RW|geo loc name:missing|collection date:missing 20ss 5 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RNA from single embryo at mRNA   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:20ss GSM8339623 GSM8339623: 20ss 5; Danio rerio; RNA Seq GSM8339623 r1 GSM8339623 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     DrRyu-013_1.fastq.gz fastq 1162568781.0 7699131.0 GSM8339623 r1 0:151 A:400374400;C:224477850;G:233635718;T:304073841;N:6972 151       400374400 224477850 233635718 304073841 6972 SRX25004177 SRS21704882 SRA1904789 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.71228   0.05604   0.81292   0.53526   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-06-20 Undetermined Embryo Embryo Imprecise All anatomical structures
30119 30119 SRR29493652 SRX25004176 SRS21704880 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   20ss 4 GSM8339622   tissue:RNA from single embryo at mRNA|strain:RW|geo loc name:missing|collection date:missing 20ss 4 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RNA from single embryo at mRNA   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:20ss GSM8339622 GSM8339622: 20ss 4; Danio rerio; RNA Seq GSM8339622 r1 GSM8339622 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     DrRyu-012_1.fastq.gz fastq 517602028.0 3427828.0 GSM8339622 r1 0:151 A:182978429;C:99031373;G:102229989;T:133359023;N:3214 151       182978429 99031373 102229989 133359023 3214 SRX25004176 SRS21704880 SRA1904789 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.68764   0.06639   0.82692   0.53449   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-06-20 Undetermined Embryo Embryo Imprecise All anatomical structures
30120 30120 SRR29493653 SRX25004175 SRS21704877 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   20ss 3 GSM8339621   tissue:RNA from single embryo at mRNA|strain:RW|geo loc name:missing|collection date:missing 20ss 3 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RNA from single embryo at mRNA   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:20ss GSM8339621 GSM8339621: 20ss 3; Danio rerio; RNA Seq GSM8339621 r1 GSM8339621 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     DrRyu-011_1.fastq.gz fastq 301191848.0 1994648.0 GSM8339621 r1 0:151 A:106755903;C:57289515;G:59757902;T:77386571;N:1957 151       106755903 57289515 59757902 77386571 1957 SRX25004175 SRS21704877 SRA1904789 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.67695   0.06443   0.83491   0.5365   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-06-20 Undetermined Embryo Embryo Imprecise All anatomical structures
30121 30121 SRR29493654 SRX25004174 SRS21704881 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   20ss 2 GSM8339620   tissue:RNA from single embryo at mRNA|strain:RW|geo loc name:missing|collection date:missing 20ss 2 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RNA from single embryo at mRNA   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:20ss GSM8339620 GSM8339620: 20ss 2; Danio rerio; RNA Seq GSM8339620 r1 GSM8339620 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     DrRyu-010_1.fastq.gz fastq 448021983.0 2967033.0 GSM8339620 r1 0:151 A:154862122;C:87128816;G:90406996;T:115621285;N:2764 151       154862122 87128816 90406996 115621285 2764 SRX25004174 SRS21704881 SRA1904789 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.7036   0.0603   0.8327   0.55569   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-06-20 Undetermined Embryo Embryo Imprecise All anatomical structures
30122 30122 SRR29493655 SRX25004173 SRS21704874 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   20ss 1 GSM8339619   tissue:RNA from single embryo at mRNA|strain:RW|geo loc name:missing|collection date:missing 20ss 1 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RNA from single embryo at mRNA   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:20ss GSM8339619 GSM8339619: 20ss 1; Danio rerio; RNA Seq GSM8339619 r1 GSM8339619 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     DrRyu-009_1.fastq.gz fastq 474612177.0 3143127.0 GSM8339619 r1 0:151 A:165855833;C:92383218;G:95962939;T:120407376;N:2811 151       165855833 92383218 95962939 120407376 2811 SRX25004173 SRS21704874 SRA1904789 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.69299   0.05915   0.83246   0.55097   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-06-20 Undetermined Embryo Embryo Imprecise All anatomical structures
30130 30130 SRR27710060 SRX23376560 SRS20238481 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   65 20ss 8 GSM8032998   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 65 20ss 8 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:20ss GSM8032998 GSM8032998: 65 20ss 8; Danio rerio; RNA Seq GSM8032998 r1 GSM8032998 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-065_R1.fastq.gz fastq 315451684.0 2089084.0 GSM8032998 r1 0:151 A:107025597;C:61268322;G:63960453;T:83196458;N:854 151       107025597 61268322 63960453 83196458 854 SRX23376560 SRS20238481 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.7085   0.04727   0.80488   0.51062   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30131 30131 SRR27710061 SRX23376559 SRS20238482 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   40 15ss S4 GSM8032973   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 40 15ss S4 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:15ss GSM8032973 GSM8032973: 40 15ss S4; Danio rerio; RNA Seq GSM8032973 r1 GSM8032973 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-040_R1.fastq.gz fastq 498553529.0 3301679.0 GSM8032973 r1 0:151 A:166809389;C:97016597;G:101866712;T:132859644;N:1187 151       166809389 97016597 101866712 132859644 1187 SRX23376559 SRS20238482 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.71715   0.0483   0.8003   0.50987   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30132 30132 SRR27710062 SRX23376558 SRS20238480 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   39 15ss S3 GSM8032972   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 39 15ss S3 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:15ss GSM8032972 GSM8032972: 39 15ss S3; Danio rerio; RNA Seq GSM8032972 r1 GSM8032972 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-039_R1.fastq.gz fastq 390771239.0 2587889.0 GSM8032972 r1 0:151 A:132215529;C:75372095;G:78886679;T:104295997;N:939 151       132215529 75372095 78886679 104295997 939 SRX23376558 SRS20238480 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.71184   0.05123   0.80081   0.50063   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30133 30133 SRR27710063 SRX23376557 SRS20238479 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   38 15ss S2 GSM8032971   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 38 15ss S2 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:15ss GSM8032971 GSM8032971: 38 15ss S2; Danio rerio; RNA Seq GSM8032971 r1 GSM8032971 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5×   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-038_R1.fastq.gz fastq 474938941.0 3145291.0 GSM8032971 r1 0:151 A:158127143;C:92840155;G:97530312;T:126440178;N:1153 151       158127143 92840155 97530312 126440178 1153 SRX23376557 SRS20238479 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.72239   0.04594   0.80332   0.51087   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30134 30134 SRR27710064 SRX23376556 SRS20238478 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   37 15ss S1 GSM8032970   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 37 15ss S1 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:15ss GSM8032970 GSM8032970: 37 15ss S1; Danio rerio; RNA Seq GSM8032970 r1 GSM8032970 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-037_R1.fastq.gz fastq 337359972.0 2234172.0 GSM8032970 r1 0:151 A:113092761;C:65637958;G:68845967;T:89782587;N:699 151       113092761 65637958 68845967 89782587 699 SRX23376556 SRS20238478 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.71517   0.04941   0.80223   0.50509   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30135 30135 SRR27710065 SRX23376555 SRS20238475 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   36 10ss S8 GSM8032969   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 36 10ss S8 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:10ss GSM8032969 GSM8032969: 36 10ss S8; Danio rerio; RNA Seq GSM8032969 r1 GSM8032969 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-036_R1.fastq.gz fastq 667384666.0 4419766.0 GSM8032969 r1 0:151 A:222892885;C:128753556;G:135360227;T:180376349;N:1649 151       222892885 128753556 135360227 180376349 1649 SRX23376555 SRS20238475 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.72097   0.04947   0.80482   0.50176   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30136 30136 SRR27710066 SRX23376554 SRS20238476 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   35 10ss S7 GSM8032968   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 35 10ss S7 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:10ss GSM8032968 GSM8032968: 35 10ss S7; Danio rerio; RNA Seq GSM8032968 r1 GSM8032968 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-035_R1.fastq.gz fastq 343431078.0 2274378.0 GSM8032968 r1 0:151 A:115086242;C:66384157;G:70152965;T:91806893;N:821 151       115086242 66384157 70152965 91806893 821 SRX23376554 SRS20238476 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.72038   0.04972   0.80817   0.51065   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30137 30137 SRR27710067 SRX23376553 SRS20238477 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   34 10ss S6 GSM8032967   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 34 10ss S6 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:10ss GSM8032967 GSM8032967: 34 10ss S6; Danio rerio; RNA Seq GSM8032967 r1 GSM8032967 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-034_R1.fastq.gz fastq 367343589.0 2432739.0 GSM8032967 r1 0:151 A:122986132;C:70561308;G:74047754;T:99747430;N:965 151       122986132 70561308 74047754 99747430 965 SRX23376553 SRS20238477 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.7141   0.05134   0.80624   0.49975   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30138 30138 SRR27710068 SRX23376552 SRS20238474 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   33 10ss S5 GSM8032966   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 33 10ss S5 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:10ss GSM8032966 GSM8032966: 33 10ss S5; Danio rerio; RNA Seq GSM8032966 r1 GSM8032966 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-033_R1.fastq.gz fastq 500101581.0 3311931.0 GSM8032966 r1 0:151 A:166659447;C:96782939;G:102086513;T:134571440;N:1242 151       166659447 96782939 102086513 134571440 1242 SRX23376552 SRS20238474 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.72135   0.04817   0.80501   0.51772   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30148 30148 SRR27710078 SRX23376542 SRS20238464 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   24 6ss S4 GSM8032957   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 24 6ss S4 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:6ss GSM8032957 GSM8032957: 24 6ss S4; Danio rerio; RNA Seq GSM8032957 r1 GSM8032957 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-024_R1.fastq.gz fastq 311028441.0 2059791.0 GSM8032957 r1 0:151 A:104670505;C:60352595;G:62877196;T:83127441;N:704 151       104670505 60352595 62877196 83127441 704 SRX23376542 SRS20238464 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.71421   0.05562   0.81671   0.52501   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30149 30149 SRR27710079 SRX23376541 SRS20238462 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   23 6ss S3 GSM8032956   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 23 6ss S3 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:6ss GSM8032956 GSM8032956: 23 6ss S3; Danio rerio; RNA Seq GSM8032956 r1 GSM8032956 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-023_R1.fastq.gz fastq 900525193.0 5963743.0 GSM8032956 r1 0:151 A:302108212;C:171811037;G:180635986;T:245967863;N:2095 151       302108212 171811037 180635986 245967863 2095 SRX23376541 SRS20238462 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.72187   0.05423   0.80523   0.509   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30150 30150 SRR27710080 SRX23376540 SRS20238463 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   22 6ss S2 GSM8032955   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 22 6ss S2 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:6ss GSM8032955 GSM8032955: 22 6ss S2; Danio rerio; RNA Seq GSM8032955 r1 GSM8032955 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-022_R1.fastq.gz fastq 296192238.0 1961538.0 GSM8032955 r1 0:151 A:99348376;C:56752476;G:59956890;T:80133851;N:645 151       99348376 56752476 59956890 80133851 645 SRX23376540 SRS20238463 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.71708   0.05521   0.81329   0.52671   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30151 30151 SRR27710081 SRX23376539 SRS20238461 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   21 6ss S1 GSM8032954   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 21 6ss S1 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:6ss GSM8032954 GSM8032954: 21 6ss S1; Danio rerio; RNA Seq GSM8032954 r1 GSM8032954 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-021_R1.fastq.gz fastq 405205631.0 2683481.0 GSM8032954 r1 0:151 A:136134806;C:77430521;G:81422532;T:110216684;N:1088 151       136134806 77430521 81422532 110216684 1088 SRX23376539 SRS20238461 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.72045   0.05386   0.80783   0.50795   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30171 30171 SRR27710101 SRX23376519 SRS20238441 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   41 15ss S5 GSM8032974   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 41 15ss S5 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:15ss GSM8032974 GSM8032974: 41 15ss S5; Danio rerio; RNA Seq GSM8032974 r1 GSM8032974 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-041_R1.fastq.gz fastq 649715401.0 4302751.0 GSM8032974 r1 0:151 A:216414707;C:127064944;G:132545819;T:173688314;N:1617 151       216414707 127064944 132545819 173688314 1617 SRX23376519 SRS20238441 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.7252   0.04719   0.79979   0.50615   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30176 30176 SRR27710106 SRX23376514 SRS20238436 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   12 15ss 4 GSM8032945   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 12 15ss 4 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:15ss GSM8032945 GSM8032945: 12 15ss 4; Danio rerio; RNA Seq GSM8032945 r1 GSM8032945 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-012_R1.fastq.gz fastq 879932719.0 5827369.0 GSM8032945 r1 0:151 A:295722952;C:169204528;G:176727368;T:238275542;N:2329 151       295722952 169204528 176727368 238275542 2329 SRX23376514 SRS20238436 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.72281   0.04966   0.80081   0.50989   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30177 30177 SRR27710107 SRX23376513 SRS20238435 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   11 15ss 3 GSM8032944   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 11 15ss 3 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:15ss GSM8032944 GSM8032944: 11 15ss 3; Danio rerio; RNA Seq GSM8032944 r1 GSM8032944 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-011_R1.fastq.gz fastq 453450886.0 3002986.0 GSM8032944 r1 0:151 A:151317456;C:87084620;G:91618535;T:123429147;N:1128 151       151317456 87084620 91618535 123429147 1128 SRX23376513 SRS20238435 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.72201   0.05792   0.80255   0.5133   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30178 30178 SRR27710108 SRX23376512 SRS20238434 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   10 15ss 2 GSM8032943   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 10 15ss 2 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:15ss GSM8032943 GSM8032943: 10 15ss 2; Danio rerio; RNA Seq GSM8032943 r1 GSM8032943 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-010_R1.fastq.gz fastq 551480841.0 3652191.0 GSM8032943 r1 0:151 A:183791565;C:106604483;G:111620483;T:149462978;N:1332 151       183791565 106604483 111620483 149462978 1332 SRX23376512 SRS20238434 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.72399   0.05154   0.80695   0.52026   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30179 30179 SRR27710109 SRX23376511 SRS20238433 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   9 15ss 1 GSM8032942   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 9 15ss 1 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:15ss GSM8032942 GSM8032942: 9 15ss 1; Danio rerio; RNA Seq GSM8032942 r1 GSM8032942 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-009_R1.fastq.gz fastq 497394906.0 3294006.0 GSM8032942 r1 0:151 A:167109996;C:95711974;G:100225234;T:134346439;N:1263 151       167109996 95711974 100225234 134346439 1263 SRX23376511 SRS20238433 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.71991   0.05182   0.80521   0.52364   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30180 30180 SRR27710110 SRX23376510 SRS20238432 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   64 20ss 7 GSM8032997   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 64 20ss 7 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:20ss GSM8032997 GSM8032997: 64 20ss 7; Danio rerio; RNA Seq GSM8032997 r1 GSM8032997 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-064_R1.fastq.gz fastq 350772094.0 2322994.0 GSM8032997 r1 0:151 A:118203787;C:68346677;G:71132328;T:93088400;N:902 151       118203787 68346677 71132328 93088400 902 SRX23376510 SRS20238432 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.71487   0.04522   0.80271   0.50943   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30181 30181 SRR27710111 SRX23376509 SRS20238431 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   63 20ss 6 GSM8032996   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 63 20ss 6 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:20ss GSM8032996 GSM8032996: 63 20ss 6; Danio rerio; RNA Seq GSM8032996 r1 GSM8032996 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-063_R1.fastq.gz fastq 437789921.0 2899271.0 GSM8032996 r1 0:151 A:146190276;C:85351980;G:89392608;T:116853971;N:1086 151       146190276 85351980 89392608 116853971 1086 SRX23376509 SRS20238431 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.72305   0.04991   0.80004   0.50619   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30182 30182 SRR27710112 SRX23376508 SRS20238430 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   62 20ss 5 GSM8032995   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 62 20ss 5 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:20ss GSM8032995 GSM8032995: 62 20ss 5; Danio rerio; RNA Seq GSM8032995 r1 GSM8032995 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-062_R1.fastq.gz fastq 502558049.0 3328199.0 GSM8032995 r1 0:151 A:167647133;C:98376006;G:103165276;T:133368326;N:1308 151       167647133 98376006 103165276 133368326 1308 SRX23376508 SRS20238430 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.72672   0.04873   0.80095   0.513   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30183 30183 SRR27710113 SRX23376507 SRS20238429 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   61 20ss 4 GSM8032994   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 61 20ss 4 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:20ss GSM8032994 GSM8032994: 61 20ss 4; Danio rerio; RNA Seq GSM8032994 r1 GSM8032994 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-061_R1.fastq.gz fastq 366103728.0 2424528.0 GSM8032994 r1 0:151 A:124292130;C:71142743;G:74133274;T:96534644;N:937 151       124292130 71142743 74133274 96534644 937 SRX23376507 SRS20238429 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.7103   0.04427   0.80367   0.50994   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30184 30184 SRR27710114 SRX23376506 SRS20238428 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   60 20ss 3 GSM8032993   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 60 20ss 3 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:20ss GSM8032993 GSM8032993: 60 20ss 3; Danio rerio; RNA Seq GSM8032993 r1 GSM8032993 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-060_R1.fastq.gz fastq 519806326.0 3442426.0 GSM8032993 r1 0:151 A:173658961;C:101699167;G:106103956;T:138343024;N:1218 151       173658961 101699167 106103956 138343024 1218 SRX23376506 SRS20238428 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.7227   0.04793   0.80168   0.51023   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30185 30185 SRR27710115 SRX23376505 SRS20238427 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   59 20ss 2 GSM8032992   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 59 20ss 2 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:20ss GSM8032992 GSM8032992: 59 20ss 2; Danio rerio; RNA Seq GSM8032992 r1 GSM8032992 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-059_R1.fastq.gz fastq 393704414.0 2607314.0 GSM8032992 r1 0:151 A:133373380;C:76448436;G:80014902;T:103866747;N:949 151       133373380 76448436 80014902 103866747 949 SRX23376505 SRS20238427 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.71277   0.04824   0.80308   0.5146   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30186 30186 SRR27710116 SRX23376504 SRS20238426 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   58 20ss 1 GSM8032991   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 58 20ss 1 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:20ss GSM8032991 GSM8032991: 58 20ss 1; Danio rerio; RNA Seq GSM8032991 r1 GSM8032991 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-058_R1.fastq.gz fastq 371849278.0 2462578.0 GSM8032991 r1 0:151 A:125795809;C:72793712;G:75742213;T:97516456;N:1088 151       125795809 72793712 75742213 97516456 1088 SRX23376504 SRS20238426 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.7164   0.04484   0.80681   0.51466   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30188 30188 SRR27710118 SRX23376502 SRS20238424 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   32 10ss S4 GSM8032965   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 32 10ss S4 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:10ss GSM8032965 GSM8032965: 32 10ss S4; Danio rerio; RNA Seq GSM8032965 r1 GSM8032965 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-032_R1.fastq.gz fastq 359160144.0 2378544.0 GSM8032965 r1 0:151 A:121695927;C:68878856;G:72208959;T:96375451;N:951 151       121695927 68878856 72208959 96375451 951 SRX23376502 SRS20238424 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.7106   0.05003   0.80582   0.50783   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30189 30189 SRR27710119 SRX23376501 SRS20238423 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   31 10ss S3 GSM8032964   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 31 10ss S3 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:10ss GSM8032964 GSM8032964: 31 10ss S3; Danio rerio; RNA Seq GSM8032964 r1 GSM8032964 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-031_R1.fastq.gz fastq 484559604.0 3209004.0 GSM8032964 r1 0:151 A:162437596;C:93209283;G:98058841;T:130852705;N:1179 151       162437596 93209283 98058841 130852705 1179 SRX23376501 SRS20238423 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.71911   0.04811   0.80511   0.50613   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30190 30190 SRR27710120 SRX23376500 SRS20238422 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   30 10ss S2 GSM8032963   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 30 10ss S2 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:10ss GSM8032963 GSM8032963: 30 10ss S2; Danio rerio; RNA Seq GSM8032963 r1 GSM8032963 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-030_R1.fastq.gz fastq 326953052.0 2165252.0 GSM8032963 r1 0:151 A:109677089;C:62822068;G:66297601;T:88155491;N:803 151       109677089 62822068 66297601 88155491 803 SRX23376500 SRS20238422 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.7175   0.05175   0.8059   0.51155   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30191 30191 SRR27710121 SRX23376499 SRS20238421 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   29 10ss S1 GSM8032962   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 29 10ss S1 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:10ss GSM8032962 GSM8032962: 29 10ss S1; Danio rerio; RNA Seq GSM8032962 r1 GSM8032962 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-029_R1.fastq.gz fastq 413637471.0 2739321.0 GSM8032962 r1 0:151 A:138530860;C:79675749;G:84088966;T:111340930;N:966 151       138530860 79675749 84088966 111340930 966 SRX23376499 SRS20238421 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.71717   0.0495   0.80659   0.51539   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30192 30192 SRR27710122 SRX23376498 SRS20238420 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   28 6ss S8 GSM8032961   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 28 6ss S8 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:6ss GSM8032961 GSM8032961: 28 6ss S8; Danio rerio; RNA Seq GSM8032961 r1 GSM8032961 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-028_R1.fastq.gz fastq 312104769.0 2066919.0 GSM8032961 r1 0:151 A:104811820;C:59763722;G:63032942;T:84495610;N:675 151       104811820 59763722 63032942 84495610 675 SRX23376498 SRS20238420 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.71142   0.05609   0.81481   0.52449   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30193 30193 SRR27710123 SRX23376497 SRS20238419 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   27 6ss S7 GSM8032960   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 27 6ss S7 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:6ss GSM8032960 GSM8032960: 27 6ss S7; Danio rerio; RNA Seq GSM8032960 r1 GSM8032960 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-027_R1.fastq.gz fastq 406291623.0 2690673.0 GSM8032960 r1 0:151 A:135404744;C:78279561;G:82142129;T:110464173;N:1016 151       135404744 78279561 82142129 110464173 1016 SRX23376497 SRS20238419 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.7226   0.05837   0.81126   0.52229   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30194 30194 SRR27710124 SRX23376496 SRS20238418 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   26 6ss S6 GSM8032959   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 26 6ss S6 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:6ss GSM8032959 GSM8032959: 26 6ss S6; Danio rerio; RNA Seq GSM8032959 r1 GSM8032959 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-026_R1.fastq.gz fastq 731946528.0 4847328.0 GSM8032959 r1 0:151 A:245812695;C:140238291;G:147006461;T:198887459;N:1622 151       245812695 140238291 147006461 198887459 1622 SRX23376496 SRS20238418 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.71794   0.05461   0.80819   0.51908   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30195 30195 SRR27710125 SRX23376495 SRS20238417 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   25 6ss S5 GSM8032958   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 25 6ss S5 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:6ss GSM8032958 GSM8032958: 25 6ss S5; Danio rerio; RNA Seq GSM8032958 r1 GSM8032958 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-025_R1.fastq.gz fastq 745928071.0 4939921.0 GSM8032958 r1 0:151 A:250680771;C:142881010;G:149860265;T:202504044;N:1981 151       250680771 142881010 149860265 202504044 1981 SRX23376495 SRS20238417 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.71868   0.05743   0.80967   0.50573   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30196 30196 SRR27710126 SRX23376494 SRS20238416 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   8 6ss 8 GSM8032941   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 8 6ss 8 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:6ss GSM8032941 GSM8032941: 8 6ss 8; Danio rerio; RNA Seq GSM8032941 r1 GSM8032941 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-008_R1.fastq.gz fastq 392774556.0 2601156.0 GSM8032941 r1 0:151 A:132863929;C:74787244;G:78470819;T:106651643;N:921 151       132863929 74787244 78470819 106651643 921 SRX23376494 SRS20238416 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.71576   0.05161   0.81393   0.52756   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30197 30197 SRR27710127 SRX23376493 SRS20238415 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   7 6ss 7 GSM8032940   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 7 6ss 7 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:6ss GSM8032940 GSM8032940: 7 6ss 7; Danio rerio; RNA Seq GSM8032940 r1 GSM8032940 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-007_R1.fastq.gz fastq 333216230.0 2206730.0 GSM8032940 r1 0:151 A:111551893;C:63560817;G:66541800;T:91560950;N:770 151       111551893 63560817 66541800 91560950 770 SRX23376493 SRS20238415 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.7193   0.0601   0.81268   0.52207   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30198 30198 SRR27710128 SRX23376492 SRS20238414 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   6 6ss 6 GSM8032939   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 6 6ss 6 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:6ss GSM8032939 GSM8032939: 6 6ss 6; Danio rerio; RNA Seq GSM8032939 r1 GSM8032939 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-006_R1.fastq.gz fastq 392108495.0 2596745.0 GSM8032939 r1 0:151 A:130191991;C:75278820;G:79178866;T:107457991;N:827 151       130191991 75278820 79178866 107457991 827 SRX23376492 SRS20238414 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.72703   0.05576   0.81195   0.51811   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30199 30199 SRR27710129 SRX23376491 SRS20238413 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   5 6ss 5 GSM8032938   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 5 6ss 5 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:6ss GSM8032938 GSM8032938: 5 6ss 5; Danio rerio; RNA Seq GSM8032938 r1 GSM8032938 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-005_R1.fastq.gz fastq 410697350.0 2719850.0 GSM8032938 r1 0:151 A:137174407;C:78514592;G:82425334;T:112581962;N:1055 151       137174407 78514592 82425334 112581962 1055 SRX23376491 SRS20238413 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.72668   0.04983   0.81389   0.51594   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30200 30200 SRR27710130 SRX23376490 SRS20238412 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   4 6ss 4 GSM8032937   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 4 6ss 4 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:6ss GSM8032937 GSM8032937: 4 6ss 4; Danio rerio; RNA Seq GSM8032937 r1 GSM8032937 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-004_R1.fastq.gz fastq 422651567.0 2799017.0 GSM8032937 r1 0:151 A:141786425;C:80388438;G:85080241;T:115395302;N:1161 151       141786425 80388438 85080241 115395302 1161 SRX23376490 SRS20238412 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.72186   0.05657   0.81148   0.52572   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30201 30201 SRR27710131 SRX23376489 SRS20238411 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   3 6ss 3 GSM8032936   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 3 6ss 3 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:6ss GSM8032936 GSM8032936: 3 6ss 3; Danio rerio; RNA Seq GSM8032936 r1 GSM8032936 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-003_R1.fastq.gz fastq 358201898.0 2372198.0 GSM8032936 r1 0:151 A:121199812;C:68388325;G:71426496;T:97186269;N:996 151       121199812 68388325 71426496 97186269 996 SRX23376489 SRS20238411 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.71083   0.05172   0.81414   0.52509   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30202 30202 SRR27710132 SRX23376488 SRS20238410 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   2 6ss 2 GSM8032935   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 2 6ss 2 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:6ss GSM8032935 GSM8032935: 2 6ss 2; Danio rerio; RNA Seq GSM8032935 r1 GSM8032935 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-002_R1.fastq.gz fastq 392878746.0 2601846.0 GSM8032935 r1 0:151 A:131932969;C:74531672;G:78651691;T:107761556;N:858 151       131932969 74531672 78651691 107761556 858 SRX23376488 SRS20238410 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.7184   0.05833   0.81186   0.52246   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
30203 30203 SRR27710133 SRX23376487 SRS20238409 SRP485624 PRJNA1068513 Time course indivudal RNA Seq of zebrafish early development GSE254071 Transcriptome Analysis Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.   pubmed:39320016   1 6ss 1 GSM8032934   tissue:RW|strain:RW|geo loc name:missing|collection date:missing 1 6ss 1 Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample RW   Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum… The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. strain:RW|developmental.stage:6ss GSM8032934 GSM8032934: 1 6ss 1; Danio rerio; RNA Seq GSM8032934 r1 GSM8032934 1 Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA HiSeq X Ten   SRP485624     Tasaki1-001_R1.fastq.gz fastq 399940563.0 2648613.0 GSM8032934 r1 0:151 A:134296994;C:76342891;G:80537022;T:108762689;N:967 151       134296994 76342891 80537022 108762689 967 SRX23376487 SRS20238409 SRA1791114 Aoyama Gakuinn University Aoyama Gakuinn University 1 0.72009   0.0546   0.81485   0.53318   151   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2024-01-24 Undetermined Embryo Embryo Imprecise All anatomical structures
36265 36265 SRR058073 SRX022206 SRS084221 SRP002640 PRJNA128943 Expanding the MicroRNA Targeting Code: A Novel Type of Site with Centered Pairing GSE22068 Other We present “centered sites ” a class of microRNA target sites that lacks both perfect seed pairing and three prime compensatory pairing and instead has 11–12 contiguous Watson–Crick pairs to the center of the microRNA. In elevated Mg2+ centered sites impart mRNA cleavage but in cells centered sites repress protein output without xxx Agronaute catalyzed cleavage. Our study also identified novel extensively paired sites that are cleavage substrates in cultured cells and human brain. This expanded repertoire of cleavage targets and the identification of the centered site type help explain why central regions of many microRNAs are evolutionarily conserved. Overall design: To study centered sites and identify miRNA cleavage targets mRNA degradomes were sequenced from human brain and HeLa cells and smallRNAs were sequenced from human brain and zebrafish embryo at 24 hpf. Replicates were combined before the analysis. Fastq files are not available for GSM548638 and GSM548639.   pubmed:20620952   Zebrafish Embryo small RNAs GSM548640   source name:Embryo Cells|data type:small RNAs|tissue:embryo Zebrafish Embryo small RNAs Small RNA sequences from same total RNA samples were mapped to the human genome hg18 requiring a perfect match and reads co localizing to annotated miRNA loci miRBase version 11.0 were counted. sequence reads are summarized as frequency counts Embryo Cells   The small RNA cDNA libraries were made as described Grimson et al. 2008 except for the three prime adaptor ligation which was five prime adenylated pTCGTATGCCGTCTTCTGCTTGidT. For a detailed protocol see http://web.wi.mit.edu/bartel/pub/protocols.html.   data type:small RNAs|tissue:embryo GSM548640 GSM548640: Zebrafish Embryo small RNAs GSM548640: Zebrafish Embryo small RNAs GSM548640: Zebrafish Embryo small RNAs 1   GEO Accession:GSM548640 RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina Genome Analyzer <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP002640   quality book char:@|quality scoring system:log odds Zebrafish_embryo_24h.fastq fastq 62213148.0 1728143.0 GSM548640 1 0:36 A:13550515;C:14269249;G:15670049;T:18673533;N:49802 36       13550515 14269249 15670049 18673533 49802 SRX022206 SRS084221 SRA020539 GEO Bartel lab, Whitehead Institute 1 0.02298   0.02186   0.9988   0.3246   36   B   usable mapping rate illumina early_illumina unknown small_rna unknown bulk unknown unknown   United States 2010-06-01 Undetermined Embryo Embryo Imprecise All anatomical structures
36405 36405 SRR546820 SRX180750 SRS347212 SRP013950 PRJNA169500 Danio rerio embryonic promoterome PRJNA169500 Transcriptome Analysis Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development.   pubmed:24531765 Zebrafish wild type AB strain embryo prim6 stage D. rerio prim6 embryo D. rerio prim6 embryo                     RNAseq D. rerio prim6 embryo RNAseq D. rerio prim6 embryo 1 1     RNA-Seq TRANSCRIPTOMIC unspecified PAIRED ILLUMINA Illumina Genome Analyzer IIx <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>152</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>77</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP013950     RNAseq_prim6_2_fix.fastq fastq 3011340704.0 19811452.0 RNAseq D. rerio prim6 embryo 0:76 1:76 A:727345664;C:767747833;G:787766862;T:725606403;N:2873942 76 76     727345664 767747833 787766862 725606403 2873942 SRX180750 SRS347212 SRA055273 University of Bergen ZEPROME consortium 2 0.94491 0.94492 0.04196 0.04323 0.76641 0.76928 0.48087 0.48787 76 76 B B biological fallback assumption illumina early_illumina unknown unknown unknown bulk unknown unknown   Unknown 2015-07-22 Undetermined Embryo Embryo Imprecise All anatomical structures
36409 36409 SRR516560 SRX156356 SRS347213 SRP013950 PRJNA169500 Danio rerio embryonic promoterome PRJNA169500 Transcriptome Analysis Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development.   pubmed:24531765 Zebrafish wild type AB strain embryo prim20 stage D. rerio prim20 embryo D. rerio prim20 embryo                     CAGE D. rerio prim20 embryo CAGE D. rerio prim20 embryo run2 D. rerio prim20 embryo 1     OTHER TRANSCRIPTOMIC CAGE SINGLE ILLUMINA Illumina Genome Analyzer IIx <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>27</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP013950     CAGE_prim20_run1.fastq fastq 76770666.0 2843358.0 CAGE D. rerio prim20 embryo run1 0:27 A:19320047;C:17585086;G:22511175;T:17354358;N:0 27       19320047 17585086 22511175 17354358 0 SRX156356 SRS347213 SRA055273 University of Bergen ZEPROME consortium 1 0.56472   0.10044   0.77469   0.74192   27   B   usable mapping rate illumina early_illumina unknown cage unknown bulk unknown unknown   Unknown 2012-06-28 Undetermined Embryo Embryo Imprecise All anatomical structures
36410 36410 SRR516561 SRX156356 SRS347213 SRP013950 PRJNA169500 Danio rerio embryonic promoterome PRJNA169500 Transcriptome Analysis Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development.   pubmed:24531765 Zebrafish wild type AB strain embryo prim20 stage D. rerio prim20 embryo D. rerio prim20 embryo                     CAGE D. rerio prim20 embryo CAGE D. rerio prim20 embryo run2 D. rerio prim20 embryo 1     OTHER TRANSCRIPTOMIC CAGE SINGLE ILLUMINA Illumina Genome Analyzer IIx <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>27</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP013950     CAGE_prim20_run2.fastq fastq 163254906.0 6046478.0 CAGE D. rerio prim20 embryo run2 0:27 A:40211042;C:36959797;G:46866669;T:39217398;N:0 27       40211042 36959797 46866669 39217398 0 SRX156356 SRS347213 SRA055273 University of Bergen ZEPROME consortium 1 0.47475   0.06947   0.78409   0.78014   27   B   usable mapping rate illumina early_illumina unknown cage unknown bulk unknown unknown   Unknown 2013-08-31 Undetermined Embryo Embryo Imprecise All anatomical structures
36411 36411 SRR516559 SRX156355 SRS347212 SRP013950 PRJNA169500 Danio rerio embryonic promoterome PRJNA169500 Transcriptome Analysis Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development.   pubmed:24531765 Zebrafish wild type AB strain embryo prim6 stage D. rerio prim6 embryo D. rerio prim6 embryo                     CAGE D. rerio prim6 embryo CAGE D. rerio prim6 embryo D. rerio prim6 embryo 1     OTHER TRANSCRIPTOMIC CAGE SINGLE ILLUMINA Illumina Genome Analyzer IIx <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>27</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP013950     CAGE_prim6.fastq fastq 283414275.0 10496825.0 CAGE D. rerio prim6 embryo 0:27 A:70974303;C:66202040;G:80064124;T:66173808;N:0 27       70974303 66202040 80064124 66173808 0 SRX156355 SRS347212 SRA055273 University of Bergen ZEPROME consortium 1 0.53395   0.07806   0.78255   0.77575   27   B   usable mapping rate illumina early_illumina unknown cage unknown bulk unknown unknown   Unknown 2013-08-31 Undetermined Embryo Embryo Imprecise All anatomical structures
36420 36420 SRR516550 SRX156337 SRS347206 SRP013950 PRJNA169500 Danio rerio embryonic promoterome PRJNA169500 Transcriptome Analysis Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development.   pubmed:24531765 Zebrafish wild type AB strain embryo high stage D. rerio high embryo D. rerio high embryo                     CAGE D. rerio high embryo CAGE D. rerio high embryo D. rerio high embryo 1     OTHER TRANSCRIPTOMIC CAGE SINGLE ILLUMINA Illumina Genome Analyzer IIx <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>27</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP013950     CAGE_high.fastq fastq 128592846.0 4762698.0 CAGE D. rerio high embryo 0:27 A:33693838;C:27629256;G:36692263;T:30577489;N:0 27       33693838 27629256 36692263 30577489 0 SRX156337 SRS347206 SRA055273 University of Bergen ZEPROME consortium 1 0.53282   0.08323   0.80854   0.77395   27   B   usable mapping rate illumina early_illumina unknown cage unknown bulk unknown unknown   Unknown 2013-08-31 Undetermined Embryo Embryo Imprecise All anatomical structures
36581 36581 SRR594769 SRX195432 SRS369361 SRP016134 PRJNA177654 Danio rerio Transcriptome or Gene expression PRJNA177654 Other We use zebrafish embryos to characterise the transcriptome of the developing blood and endothelium.     1 Test GFP Negative 1                     Global analysis of the haematopoietic and endothelial transcriptome during zebrafish development Embryos 1 1     RNA-Seq TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina Genome Analyzer IIx <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>40</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP016134         2525199228.0 65962848.0 GFP Positive 0:38.28 A:665802914;C:594493287;G:612298433;T:652078696;N:525898 38       665802914 594493287 612298433 652078696 525898 SRX195432 SRS369361     University of Cambridge 1 0.89062   0.09595   0.74059   0.47506   36   B   usable mapping rate illumina early_illumina unknown unknown unknown bulk unknown unknown   United Kingdom 2015-07-22 Undetermined Embryo Embryo Imprecise All anatomical structures
36582 36582 SRR594771 SRX195432 SRS369361 SRP016134 PRJNA177654 Danio rerio Transcriptome or Gene expression PRJNA177654 Other We use zebrafish embryos to characterise the transcriptome of the developing blood and endothelium.     1 Test GFP Negative 1                     Global analysis of the haematopoietic and endothelial transcriptome during zebrafish development Embryos 1 1     RNA-Seq TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina Genome Analyzer IIx <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>40</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP016134     gfp_negative_replicate_1_sequence.txt.gz fastq 2549682148.0 66546682.0 GFP Negative 0:38.31 A:686329592;C:587342682;G:601330559;T:674194074;N:485241 38       686329592 587342682 601330559 674194074 485241 SRX195432 SRS369361     University of Cambridge 1 0.90413   0.13272   0.71342   0.48186   36   B   usable mapping rate illumina early_illumina unknown unknown unknown bulk unknown unknown   United Kingdom 2015-07-22 Undetermined Embryo Embryo Imprecise All anatomical structures
37129 37129 SRR953087 SRX335692 SRS470740 SRP028862 PRJNA215266 Danio rerio Transcriptome or Gene expression PRJNA215266 Other During early vertebrate development various small non coding RNAs sRNAs such as MicroRNAs miRNAs and Piwi interacting RNAs piRNAs are dynamically expressed for orchestrating the maternal to zygotic transition MZT. Systematic analysis of expression profiles of zebrafish small RNAome will be greatly helpful for understanding the sRNA regulation during embryonic development.     small RNA sequencing for zebrafish early development General Sample for zebrafish zebrafish early development   breed:wild type zebrafish                 1 cell of zebrafish development 1 cell stage 1 Total RNA from embryos was isolated using Trizol reagent Invitrogen. RNAs were fractioned on 15% denaturing polyacrylamide gels and small RNAs were isolated and purified. Subsequently small RNAs were ligated with both a 5’ adapter and 3’ adapter for reverse transcription using SuperscriptTM II reverse transcription kit Invitrogen following the manufacturer's instructions at 42 oC for 1 h and 70 oC for 15 min. post that the reverse transcribed product cDNA was amplified by the following PCR program: a 15 cycle reaction at 98 oC for 30 sec followed by 15 cycles consisting of 10 sec at 98 oC 15 sec at 72 oC and then 10 min at 72 oC. post obtaining a 92bp DNA band on 6% denaturing PAGE gels the PCR products were enriched by ethanol precipitation and purified using Spin X filter columns Fisher.     RNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>49</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP028862         1002077048.0 20450552.0 1 cell stage 0:49 A:210178307;C:226566574;G:255003953;T:310259058;N:69156 49       210178307 226566574 255003953 310259058 69156 SRX335692 SRS470740 SRA098041 Huazhong University of Science and Technology|cuckoo Huazhong University of Science and Technology 1 0.0001   3e-05   0.99975   0.76923   49   T   under 1.2% mapping rate illumina hiseq_era unknown size_fractionation unknown bulk unknown unknown   China 2015-07-22 Undetermined Embryo Embryo Imprecise All anatomical structures
38020 38020 SRR1265736 SRX529131 SRS598827 SRP041544 PRJNA245824 Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish GSE57169 Transcriptome Analysis The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.   pubmed:26574018   Embryo Replicate 3 sRNAseq GSM1376619   source name:Embryo|tissue:Embryo|genetic background:Wild type Singapore strain Embryo Replicate 3 sRNAseq Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p <zebrafish precursor miRNA fasta file> m <zebrafish mature miRNA fasta file> r <unique reads fasta file> t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis. Embryo N/A Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing. Fishes were purchased from a local supplier and acclimatized before tissue extraction. tissue:Embryo|genetic background:Wild type Singapore strain GSM1376619 GSM1376619: Embryo Replicate 3 sRNAseq; Danio rerio; miRNA Seq GSM1376619   1 Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing. GEO Accession:GSM1376619 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP041544     MZE006_CTTGTA_L008_R1.fastq.gz fastq 1714180635.0 33611385.0 GSM1376619 r1 0:51 A:338559677;C:431494863;G:537012008;T:406904091;N:209996 51       338559677 431494863 537012008 406904091 209996 SRX529131 SRS598827 SRA160430 GEO Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore 1 0.09044   0.01776   0.97782   0.77023   51   B   usable mapping rate illumina hiseq_era unknown size_fractionation trueseq bulk unknown unknown   Singapore 2014-04-29 Undetermined Embryo Embryo Imprecise All anatomical structures
38021 38021 SRR1265735 SRX529130 SRS598828 SRP041544 PRJNA245824 Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish GSE57169 Transcriptome Analysis The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.   pubmed:26574018   Embryo Replicate 2 sRNAseq GSM1376618   source name:Embryo|tissue:Embryo|genetic background:Wild type Singapore strain Embryo Replicate 2 sRNAseq Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p <zebrafish precursor miRNA fasta file> m <zebrafish mature miRNA fasta file> r <unique reads fasta file> t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis. Embryo N/A Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing. Fishes were purchased from a local supplier and acclimatized before tissue extraction. tissue:Embryo|genetic background:Wild type Singapore strain GSM1376618 GSM1376618: Embryo Replicate 2 sRNAseq; Danio rerio; miRNA Seq GSM1376618   1 Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing. GEO Accession:GSM1376618 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP041544     MZE005_GGCTAC_L008_R1.fastq.gz fastq 736486002.0 14440902.0 GSM1376618 r1 0:51 A:145757737;C:194417932;G:231157927;T:165060763;N:91643 51       145757737 194417932 231157927 165060763 91643 SRX529130 SRS598828 SRA160430 GEO Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore 1 0.01133   0.00234   0.99515   0.73854   51   T   under 1.2% mapping rate illumina hiseq_era unknown size_fractionation trueseq bulk unknown unknown   Singapore 2014-04-29 Undetermined Embryo Embryo Imprecise All anatomical structures
38022 38022 SRR1265734 SRX529129 SRS598825 SRP041544 PRJNA245824 Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish GSE57169 Transcriptome Analysis The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.   pubmed:26574018   Embryo Replicate 1 sRNAseq GSM1376617   source name:Embryo|tissue:Embryo|genetic background:Wild type Singapore strain Embryo Replicate 1 sRNAseq Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p <zebrafish precursor miRNA fasta file> m <zebrafish mature miRNA fasta file> r <unique reads fasta file> t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis. Embryo N/A Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing. Fishes were purchased from a local supplier and acclimatized before tissue extraction. tissue:Embryo|genetic background:Wild type Singapore strain GSM1376617 GSM1376617: Embryo Replicate 1 sRNAseq; Danio rerio; miRNA Seq GSM1376617   1 Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing. GEO Accession:GSM1376617 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP041544     MZE004_TAGCTT_L008_R1.fastq.gz fastq 477426912.0 9361312.0 GSM1376617 r1 0:51 A:93534991;C:123428376;G:148877677;T:111524753;N:61115 51       93534991 123428376 148877677 111524753 61115 SRX529129 SRS598825 SRA160430 GEO Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore 1 0.02061   0.00461   0.99379   0.8448   51   B   usable mapping rate illumina hiseq_era unknown size_fractionation trueseq bulk unknown unknown   Singapore 2014-04-29 Undetermined Embryo Embryo Imprecise All anatomical structures
38253 38253 SRR1593716 SRX718002 SRS713862 SRP048545 PRJNA262696 Adenylation of maternally inherited microRNAs by Wispy GSE61931 Other Early development depends heavily on accurate control of maternally inherited mRNAs and yet it remains unknown how maternal microRNAs miRNAs are regulated during maternal to zygotic transition MZT. We here find that maternal miRNAs are highly adenylated at their three prime ends in mature oocytes and early embryos. Pervasive adenylation is observed in oocytes of fly sea urchin and mouse indicating that maternal miRNA adenylation may be widely conserved in animals. We identify Wispy as the enzyme responsible for miRNA adenylation in flies. Wispy is known to be expressed specifically in oocytes and early embryos and function as a noncanonical polyA polymerase. Knockout of wispy abrogates miRNA adenylation and induces miRNA accumulation in fly eggs whereas overexpression of Wispy increases adenylation and reduces miRNA levels in S2 cells. Adenylation occurs on both the 5p and 3p miRNAs indicating that Wispy acts on miRNAs post Dicer processing. We further find that Wispy interacts with Ago1 through protein protein interaction which may allow the effective and selective adenylation of miRNAs. Thus adenylation may contribute to the clearance of maternally deposited miRNAs during MZT. Our work provides the first mechanistic insights into the regulation of maternal miRNAs and illustrates the importance of RNA tailing in development. Overall design: MiRNA expression and modification profile during early embryo development of fruit fly and zebra fish using high throughput sequencing   pubmed:25454948   Zeb fish Emb t 30m GSM1517417   tissue:embryo|genotype/variation:WT|developmental stage:embryo 30m Zeb fish Emb t 30m The base calling was done by Illumina Pipeline CASAVA v1.8.2. The 3′ adaptor sequences starting with “TGGAATTC” were removed and the sequence reads with short length <16 nt or artifacts e.g. long homopolymer or low quality Phred quality <30 in >15% of nucleotides were filtered out using the FASTX Toolkit http://hannonlab.cshl.edu/fastx toolkit/. Filtered sequence reads from Drosophila melanogaster and Danio rerio were aligned to dm3 and danRer7 reference genomes from UCSC respectively. The BWA short read aligner Li and Durbin 2009 version 0.7.5a r405 was used for the alignment with options of ‘18nt long seed length’ and ‘no allowed mismatches in the seed region. Each aligned read was classified using intersectBed in Bedtools Quinlan and Hall 2010 with annotations retrieved from RefSeq GtRNAdb FlyBase RepeatMasker Rfam and miRBase. We collected reads that perfectly match to the mature miRNA sequences annotated in miRBase as well as those that have 3’ additions to the perfectly matching sequences. Sample wise normalization of miRNA read counts was done by TMM normalization Robinson and Oshlack 2010 using edgR package http://www.bioconductor.org/packages/release/bioc/html/edgeR.html. Genome build: dm3 GCF 000001215.2; danRer7 GCA 000002035.2 Supplementary files format and content: *.classcount.csv : comma separated files containing sequencing statistics. Column class indicates each class of RNA. Column reads indicates number of sequence reads mapped on each class of RNA. Column proportion indicates the read count proportion to the total pre processed reads of each class of RNA; dme miRNA TMM.csv : comma separated files containing expression level of miRNAs normalized by TMM. Column hairpin indicates name of each mature miRNA. Rest of the columns indicates the normalized expression levels of each mature miRNA in each sample. embryo   Small RNA cDNA libraries were generated using TruSeq small RNA sample preparation kit Illumina according to manufacturer’s guide. For each library 10 ug of total RNA was separated on 15% urea PAGE. RNA of 15 29 nt was gel purified and then ligated to the 3’ adaptor with T4 RNA ligase2 truncated NEB. post gel purification of 3’ adaptor ligated RNA the 5’ adaptor ligation was performed using T4 RNA ligase1. The ligation product was reverse transcribed by SuperScript II Life Technologies and amplified by PCR with Phusion DNA polymerase. The cDNA libraries were sequenced by HiSeq 2000 or HiSeq 2500. Total RNA was extracted using TRIzol reagent for each experimental condition.   genotype/variation:WT|developmental stage:embryo 30m GSM1517417 GSM1517417: Zeb fish Emb t 30m; Danio rerio; miRNA Seq GSM1517417   1 Small RNA cDNA libraries were generated using TruSeq small RNA sample preparation kit Illumina according to manufacturer’s guide. For each library 10 ug of total RNA was separated on 15% urea PAGE. RNA of 15 29 nt was gel purified and then ligated to the 3’ adaptor with T4 RNA ligase2 truncated NEB. post gel purification of 3’ adaptor ligated RNA the 5’ adaptor ligation was performed using T4 RNA ligase1. The ligation product was reverse transcribed by SuperScript II Life Technologies and amplified by PCR with Phusion DNA polymerase. The cDNA libraries were sequenced by HiSeq 2000 or HiSeq 2500. Total RNA was extracted using TRIzol reagent for each experimental condition. GEO Accession:GSM1517417 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP048545     Zeb_fish_Emb_t_30m_1.fastq.gz fastq 3380715591.0 66288541.0 GSM1517417 r1 0:51 A:854040134;C:726173965;G:952338238;T:848081062;N:82192 51       854040134 726173965 952338238 848081062 82192 SRX718002 SRS713862 SRA188351 GEO Narry Kim Lab, School of Biological Sciences, Seoul National University 1 1e-05   0.0   0.99997   1.0   51   T   under 1.2% mapping rate illumina hiseq_era 3prime size_fractionation trueseq bulk unknown unknown   South Korea 2014-09-30 Undetermined Embryo Embryo Imprecise All anatomical structures
38254 38254 SRR1593715 SRX718001 SRS713861 SRP048545 PRJNA262696 Adenylation of maternally inherited microRNAs by Wispy GSE61931 Other Early development depends heavily on accurate control of maternally inherited mRNAs and yet it remains unknown how maternal microRNAs miRNAs are regulated during maternal to zygotic transition MZT. We here find that maternal miRNAs are highly adenylated at their three prime ends in mature oocytes and early embryos. Pervasive adenylation is observed in oocytes of fly sea urchin and mouse indicating that maternal miRNA adenylation may be widely conserved in animals. We identify Wispy as the enzyme responsible for miRNA adenylation in flies. Wispy is known to be expressed specifically in oocytes and early embryos and function as a noncanonical polyA polymerase. Knockout of wispy abrogates miRNA adenylation and induces miRNA accumulation in fly eggs whereas overexpression of Wispy increases adenylation and reduces miRNA levels in S2 cells. Adenylation occurs on both the 5p and 3p miRNAs indicating that Wispy acts on miRNAs post Dicer processing. We further find that Wispy interacts with Ago1 through protein protein interaction which may allow the effective and selective adenylation of miRNAs. Thus adenylation may contribute to the clearance of maternally deposited miRNAs during MZT. Our work provides the first mechanistic insights into the regulation of maternal miRNAs and illustrates the importance of RNA tailing in development. Overall design: MiRNA expression and modification profile during early embryo development of fruit fly and zebra fish using high throughput sequencing   pubmed:25454948   Zeb fish Emb t 10m GSM1517416   tissue:embryo|genotype/variation:WT|developmental stage:embryo 10m Zeb fish Emb t 10m The base calling was done by Illumina Pipeline CASAVA v1.8.2. The 3′ adaptor sequences starting with “TGGAATTC” were removed and the sequence reads with short length <16 nt or artifacts e.g. long homopolymer or low quality Phred quality <30 in >15% of nucleotides were filtered out using the FASTX Toolkit http://hannonlab.cshl.edu/fastx toolkit/. Filtered sequence reads from Drosophila melanogaster and Danio rerio were aligned to dm3 and danRer7 reference genomes from UCSC respectively. The BWA short read aligner Li and Durbin 2009 version 0.7.5a r405 was used for the alignment with options of ‘18nt long seed length’ and ‘no allowed mismatches in the seed region. Each aligned read was classified using intersectBed in Bedtools Quinlan and Hall 2010 with annotations retrieved from RefSeq GtRNAdb FlyBase RepeatMasker Rfam and miRBase. We collected reads that perfectly match to the mature miRNA sequences annotated in miRBase as well as those that have 3’ additions to the perfectly matching sequences. Sample wise normalization of miRNA read counts was done by TMM normalization Robinson and Oshlack 2010 using edgR package http://www.bioconductor.org/packages/release/bioc/html/edgeR.html. Genome build: dm3 GCF 000001215.2; danRer7 GCA 000002035.2 Supplementary files format and content: *.classcount.csv : comma separated files containing sequencing statistics. Column class indicates each class of RNA. Column reads indicates number of sequence reads mapped on each class of RNA. Column proportion indicates the read count proportion to the total pre processed reads of each class of RNA; dme miRNA TMM.csv : comma separated files containing expression level of miRNAs normalized by TMM. Column hairpin indicates name of each mature miRNA. Rest of the columns indicates the normalized expression levels of each mature miRNA in each sample. embryo   Small RNA cDNA libraries were generated using TruSeq small RNA sample preparation kit Illumina according to manufacturer’s guide. For each library 10 ug of total RNA was separated on 15% urea PAGE. RNA of 15 29 nt was gel purified and then ligated to the 3’ adaptor with T4 RNA ligase2 truncated NEB. post gel purification of 3’ adaptor ligated RNA the 5’ adaptor ligation was performed using T4 RNA ligase1. The ligation product was reverse transcribed by SuperScript II Life Technologies and amplified by PCR with Phusion DNA polymerase. The cDNA libraries were sequenced by HiSeq 2000 or HiSeq 2500. Total RNA was extracted using TRIzol reagent for each experimental condition.   genotype/variation:WT|developmental stage:embryo 10m GSM1517416 GSM1517416: Zeb fish Emb t 10m; Danio rerio; miRNA Seq GSM1517416   1 Small RNA cDNA libraries were generated using TruSeq small RNA sample preparation kit Illumina according to manufacturer’s guide. For each library 10 ug of total RNA was separated on 15% urea PAGE. RNA of 15 29 nt was gel purified and then ligated to the 3’ adaptor with T4 RNA ligase2 truncated NEB. post gel purification of 3’ adaptor ligated RNA the 5’ adaptor ligation was performed using T4 RNA ligase1. The ligation product was reverse transcribed by SuperScript II Life Technologies and amplified by PCR with Phusion DNA polymerase. The cDNA libraries were sequenced by HiSeq 2000 or HiSeq 2500. Total RNA was extracted using TRIzol reagent for each experimental condition. GEO Accession:GSM1517416 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP048545     Zeb_fish_Emb_t_10m_1.fastq.gz fastq 3339395697.0 65478347.0 GSM1517416 r1 0:51 A:847877403;C:714050198;G:934084609;T:843302102;N:81385 51       847877403 714050198 934084609 843302102 81385 SRX718001 SRS713861 SRA188351 GEO Narry Kim Lab, School of Biological Sciences, Seoul National University 1 0.0   0.0   1.0       51   T   under 1.2% mapping rate illumina hiseq_era 3prime size_fractionation trueseq bulk unknown unknown   South Korea 2014-09-30 Undetermined Embryo Embryo Imprecise All anatomical structures
38255 38255 SRR1593714 SRX718000 SRS713860 SRP048545 PRJNA262696 Adenylation of maternally inherited microRNAs by Wispy GSE61931 Other Early development depends heavily on accurate control of maternally inherited mRNAs and yet it remains unknown how maternal microRNAs miRNAs are regulated during maternal to zygotic transition MZT. We here find that maternal miRNAs are highly adenylated at their three prime ends in mature oocytes and early embryos. Pervasive adenylation is observed in oocytes of fly sea urchin and mouse indicating that maternal miRNA adenylation may be widely conserved in animals. We identify Wispy as the enzyme responsible for miRNA adenylation in flies. Wispy is known to be expressed specifically in oocytes and early embryos and function as a noncanonical polyA polymerase. Knockout of wispy abrogates miRNA adenylation and induces miRNA accumulation in fly eggs whereas overexpression of Wispy increases adenylation and reduces miRNA levels in S2 cells. Adenylation occurs on both the 5p and 3p miRNAs indicating that Wispy acts on miRNAs post Dicer processing. We further find that Wispy interacts with Ago1 through protein protein interaction which may allow the effective and selective adenylation of miRNAs. Thus adenylation may contribute to the clearance of maternally deposited miRNAs during MZT. Our work provides the first mechanistic insights into the regulation of maternal miRNAs and illustrates the importance of RNA tailing in development. Overall design: MiRNA expression and modification profile during early embryo development of fruit fly and zebra fish using high throughput sequencing   pubmed:25454948   Zeb fish Emb t 0m GSM1517415   tissue:egg|genotype/variation:WT|developmental stage:embryo 0m Zeb fish Emb t 0m The base calling was done by Illumina Pipeline CASAVA v1.8.2. The 3′ adaptor sequences starting with “TGGAATTC” were removed and the sequence reads with short length <16 nt or artifacts e.g. long homopolymer or low quality Phred quality <30 in >15% of nucleotides were filtered out using the FASTX Toolkit http://hannonlab.cshl.edu/fastx toolkit/. Filtered sequence reads from Drosophila melanogaster and Danio rerio were aligned to dm3 and danRer7 reference genomes from UCSC respectively. The BWA short read aligner Li and Durbin 2009 version 0.7.5a r405 was used for the alignment with options of ‘18nt long seed length’ and ‘no allowed mismatches in the seed region. Each aligned read was classified using intersectBed in Bedtools Quinlan and Hall 2010 with annotations retrieved from RefSeq GtRNAdb FlyBase RepeatMasker Rfam and miRBase. We collected reads that perfectly match to the mature miRNA sequences annotated in miRBase as well as those that have 3’ additions to the perfectly matching sequences. Sample wise normalization of miRNA read counts was done by TMM normalization Robinson and Oshlack 2010 using edgR package http://www.bioconductor.org/packages/release/bioc/html/edgeR.html. Genome build: dm3 GCF 000001215.2; danRer7 GCA 000002035.2 Supplementary files format and content: *.classcount.csv : comma separated files containing sequencing statistics. Column class indicates each class of RNA. Column reads indicates number of sequence reads mapped on each class of RNA. Column proportion indicates the read count proportion to the total pre processed reads of each class of RNA; dme miRNA TMM.csv : comma separated files containing expression level of miRNAs normalized by TMM. Column hairpin indicates name of each mature miRNA. Rest of the columns indicates the normalized expression levels of each mature miRNA in each sample. egg   Small RNA cDNA libraries were generated using TruSeq small RNA sample preparation kit Illumina according to manufacturer’s guide. For each library 10 ug of total RNA was separated on 15% urea PAGE. RNA of 15 29 nt was gel purified and then ligated to the 3’ adaptor with T4 RNA ligase2 truncated NEB. post gel purification of 3’ adaptor ligated RNA the 5’ adaptor ligation was performed using T4 RNA ligase1. The ligation product was reverse transcribed by SuperScript II Life Technologies and amplified by PCR with Phusion DNA polymerase. The cDNA libraries were sequenced by HiSeq 2000 or HiSeq 2500. Total RNA was extracted using TRIzol reagent for each experimental condition.   genotype/variation:WT|developmental stage:embryo 0m GSM1517415 GSM1517415: Zeb fish Emb t 0m; Danio rerio; miRNA Seq GSM1517415   1 Small RNA cDNA libraries were generated using TruSeq small RNA sample preparation kit Illumina according to manufacturer’s guide. For each library 10 ug of total RNA was separated on 15% urea PAGE. RNA of 15 29 nt was gel purified and then ligated to the 3’ adaptor with T4 RNA ligase2 truncated NEB. post gel purification of 3’ adaptor ligated RNA the 5’ adaptor ligation was performed using T4 RNA ligase1. The ligation product was reverse transcribed by SuperScript II Life Technologies and amplified by PCR with Phusion DNA polymerase. The cDNA libraries were sequenced by HiSeq 2000 or HiSeq 2500. Total RNA was extracted using TRIzol reagent for each experimental condition. GEO Accession:GSM1517415 miRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP048545     Zeb_fish_Emb_t_0m_1.fastq.gz fastq 3135589293.0 61482143.0 GSM1517415 r1 0:51 A:800912828;C:671516191;G:883139862;T:779944407;N:76005 51       800912828 671516191 883139862 779944407 76005 SRX718000 SRS713860 SRA188351 GEO Narry Kim Lab, School of Biological Sciences, Seoul National University 1 0.0   0.0   1.0       51   T   under 1.2% mapping rate illumina hiseq_era 3prime size_fractionation trueseq bulk unknown unknown   South Korea 2014-09-30 Undetermined Embryo Embryo Imprecise All anatomical structures
38355 38355 SRR1785161 SRX864132 SRS834993 SRP053099 PRJNA274362 Transcriptomics analysis of gene expression in 10 embryo development stages of Danio rerio GSE65556 Transcriptome Analysis RNA was isolated from Danio embryo cells using the TRIzol Invitrogen reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100. All samples showed a RIN RNA integrity number of higher than 9. Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 Illumina San Diego CA USA according to the manufacturer's protocol.The libraries were sequenced using HiSeq2000 Illumina in single read mode creating reads with a length of 101 bp. Sequencing chemistry v2 Illumina was used and samples were multiplexed in two samples per lane. Overall design: Examination of gene expressive levels in embryo development of Danio       1 cell rep1 GSM1600037   tissue:Danio embryo cells|developmental stage:embryo|cell type:1 cell 1 cell rep1 Reads were aligned to theZv9 genome assembly using TopHat v2.0.9 For each sample RPKM was computed as the number of reads which map per kilobase of exon model per million mapped reads for each gene. Genome build: Zv9 Supplementary files format and content: RPKM for each gene in each development stage Danio embryo cells   RNA was isolated from Danio cells using the TRIzol Invitrogen reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100 Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 Illumina San Diego CA USA according to the manufacturer’s protocol.The libraries were sequenced using HiSeq2000 Illumina in single read mode creating reads with a length of 50 bp.   developmental stage:embryo|cell type:1 cell GSM1600037 GSM1600037: 1 cell rep1; Danio rerio; RNA Seq GSM1600037   1 RNA was isolated from Danio cells using the TRIzol Invitrogen reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100 Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 Illumina San Diego CA USA according to the manufacturer’s protocol.The libraries were sequenced using HiSeq2000 Illumina in single read mode creating reads with a length of 50 bp. GEO Accession:GSM1600037 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP053099     W3T_1.fastq.gz fastq 4678817425.0 46324925.0 GSM1600037 r1 0:101 A:1226268061;C:1122155105;G:1116587571;T:1213657606;N:149082 101       1226268061 1122155105 1116587571 1213657606 149082 SRX864132 SRS834993 SRA236187 GEO Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS) 1 0.95665   0.0188   0.83631   0.49048   101   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified trueseq bulk bulk bulk   China 2015-02-03 Undetermined Embryo Embryo Imprecise All anatomical structures
39762 39762 SRR2136169 SRX1125646 SRS1017709 SRP061852 PRJNA291530 DNA methylome patterns of zebrafish cells under cold pressure GSE71567 Other In this study MeDIP seq and RNA seq were performed to reveal a genome wide methylation profile of zebrafish Danio rerio embryonic fibroblast cell line ZF4 and its variation under cold environment.This study puts a new insight into the genome wide epigenetic regulation under cold environment. Overall design: ZF4 cells were cultured at 28 °C as control and at 18 °C for 5 days and 30 days seperately. Each condition has three biological replica.       ZF4 18d30dRNA3 GSM1838568   tissue:embryonic fibroblast cells|cell type:fibroblast cell line|growth:cultured at 18°C for 30 days|treatment:cold treatment for 30 days ZF4 18d30dRNA3 Illumina Casava1.7 software was used for basecalling. The fastx toolkit program was used to filter off low quality sequences from raw sequencing data. Sequences were aligned with Zebrafish genomeZR9/danRer7 downloaded from iGenome using Bowtie2. MeDIP seq peaks were called with the Model based Analysis of MeDIP Seq MACS software with default parameters with alignment results. The three peak sets generated by MACS were merged using Bedtools for peaks with at least 1bp overlap to get a reference peak set REF for following analysis. Genome build: ZR9/danRer7 Supplementary files format and content: .txt embryonic fibroblast cells For cold treatment cells were grown at 18 °C 5% CO2 in the same medium for up to 30 days. For MeDIP seq genomic DNAs were isolated and sonicated. End repair adenylation adapter ligation methylated DNA enrichment and methylated DNA library construction were all performed with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. For RNA seq total RNA was isolated using TRlzol reagent Invitrogen life Technologies. The zebrafish embryonic fibroblast cell line ZF4 was purchased from the American Type Culture Collection ATCC CRL 2050; Driever and Rangini 1993. The cells were grown at 28 °C 5% CO2 in Dulbecco's modified Eagle's medium/F12 nutrient mix DMEM/F12 supplemented with 10% FBS 1% l glutamine 100 u/ml penicillin 100 μg/ml streptomycin. For cold treatment cells were grown at 18 °C 5% CO2 in the same medium for up to 30 days. All cell culture medium components were purchased from Gibco BRL Life Technologies Ltd USA. cell type:fibroblast cell line|growth:cultured at 18°C for 30 days|treatment:cold treatment for 30 days GSM1838568 GSM1838568: ZF4 18d30dRNA3; Danio rerio; RNA Seq GSM1838568   1 For MeDIP seq genomic DNAs were isolated and sonicated. End repair adenylation adapter ligation methylated DNA enrichment and methylated DNA library construction were all performed with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. For RNA seq total RNA was isolated using TRlzol reagent Invitrogen life Technologies. MeDIP DNA libraries were prepared with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. RNA libraries were prepared for sequencing using standard Illumina protocols． GEO Accession:GSM1838568 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP061852     18_30_replica3_2.fastq.gz 18_30_replica3_1.fastq.gz fastq fastq 2119584182.0 10492991.0 GSM1838568 r1 0:101 1:101 A:536167639;C:523355640;G:520266539;T:537210435;N:2583929 101 101     536167639 523355640 520266539 537210435 2583929 SRX1125646 SRS1017709 SRA281140 GEO College of fishery and life science, Shanghai Ocean University 2 0.95676 0.95804 0.17177 0.17513 0.74361 0.74675 0.50106 0.53867 101 101 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   China 2015-07-30 Undetermined Embryo Embryo Imprecise All anatomical structures
39763 39763 SRR2136168 SRX1125644 SRS1017710 SRP061852 PRJNA291530 DNA methylome patterns of zebrafish cells under cold pressure GSE71567 Other In this study MeDIP seq and RNA seq were performed to reveal a genome wide methylation profile of zebrafish Danio rerio embryonic fibroblast cell line ZF4 and its variation under cold environment.This study puts a new insight into the genome wide epigenetic regulation under cold environment. Overall design: ZF4 cells were cultured at 28 °C as control and at 18 °C for 5 days and 30 days seperately. Each condition has three biological replica.       ZF4 18d30dRNA2 GSM1838567   tissue:embryonic fibroblast cells|cell type:fibroblast cell line|growth:cultured at 18°C for 30 days|treatment:cold treatment for 30 days ZF4 18d30dRNA2 Illumina Casava1.7 software was used for basecalling. The fastx toolkit program was used to filter off low quality sequences from raw sequencing data. Sequences were aligned with Zebrafish genomeZR9/danRer7 downloaded from iGenome using Bowtie2. MeDIP seq peaks were called with the Model based Analysis of MeDIP Seq MACS software with default parameters with alignment results. The three peak sets generated by MACS were merged using Bedtools for peaks with at least 1bp overlap to get a reference peak set REF for following analysis. Genome build: ZR9/danRer7 Supplementary files format and content: .txt embryonic fibroblast cells For cold treatment cells were grown at 18 °C 5% CO2 in the same medium for up to 30 days. For MeDIP seq genomic DNAs were isolated and sonicated. End repair adenylation adapter ligation methylated DNA enrichment and methylated DNA library construction were all performed with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. For RNA seq total RNA was isolated using TRlzol reagent Invitrogen life Technologies. The zebrafish embryonic fibroblast cell line ZF4 was purchased from the American Type Culture Collection ATCC CRL 2050; Driever and Rangini 1993. The cells were grown at 28 °C 5% CO2 in Dulbecco's modified Eagle's medium/F12 nutrient mix DMEM/F12 supplemented with 10% FBS 1% l glutamine 100 u/ml penicillin 100 μg/ml streptomycin. For cold treatment cells were grown at 18 °C 5% CO2 in the same medium for up to 30 days. All cell culture medium components were purchased from Gibco BRL Life Technologies Ltd USA. cell type:fibroblast cell line|growth:cultured at 18°C for 30 days|treatment:cold treatment for 30 days GSM1838567 GSM1838567: ZF4 18d30dRNA2; Danio rerio; RNA Seq GSM1838567   1 For MeDIP seq genomic DNAs were isolated and sonicated. End repair adenylation adapter ligation methylated DNA enrichment and methylated DNA library construction were all performed with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. For RNA seq total RNA was isolated using TRlzol reagent Invitrogen life Technologies. MeDIP DNA libraries were prepared with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. RNA libraries were prepared for sequencing using standard Illumina protocols． GEO Accession:GSM1838567 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP061852     18_30_replica2_1.fastq.gz 18_30_replica2_2.fastq.gz fastq fastq 2953584814.0 14621707.0 GSM1838567 r1 0:101 1:101 A:787167276;C:695721456;G:682643125;T:787744527;N:308430 101 101     787167276 695721456 682643125 787744527 308430 SRX1125644 SRS1017710 SRA281140 GEO College of fishery and life science, Shanghai Ocean University 2 0.94845 0.94723 0.09069 0.09086 0.739 0.74061 0.49017 0.48951 101 101 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   China 2015-07-30 Undetermined Embryo Embryo Imprecise All anatomical structures
39764 39764 SRR2136167 SRX1125643 SRS1017711 SRP061852 PRJNA291530 DNA methylome patterns of zebrafish cells under cold pressure GSE71567 Other In this study MeDIP seq and RNA seq were performed to reveal a genome wide methylation profile of zebrafish Danio rerio embryonic fibroblast cell line ZF4 and its variation under cold environment.This study puts a new insight into the genome wide epigenetic regulation under cold environment. Overall design: ZF4 cells were cultured at 28 °C as control and at 18 °C for 5 days and 30 days seperately. Each condition has three biological replica.       ZF4 18d30dRNA1 GSM1838566   tissue:embryonic fibroblast cells|cell type:fibroblast cell line|growth:cultured at 18°C for 30 days|treatment:cold treatment for 30 days ZF4 18d30dRNA1 Illumina Casava1.7 software was used for basecalling. The fastx toolkit program was used to filter off low quality sequences from raw sequencing data. Sequences were aligned with Zebrafish genomeZR9/danRer7 downloaded from iGenome using Bowtie2. MeDIP seq peaks were called with the Model based Analysis of MeDIP Seq MACS software with default parameters with alignment results. The three peak sets generated by MACS were merged using Bedtools for peaks with at least 1bp overlap to get a reference peak set REF for following analysis. Genome build: ZR9/danRer7 Supplementary files format and content: .txt embryonic fibroblast cells For cold treatment cells were grown at 18 °C 5% CO2 in the same medium for up to 30 days. For MeDIP seq genomic DNAs were isolated and sonicated. End repair adenylation adapter ligation methylated DNA enrichment and methylated DNA library construction were all performed with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. For RNA seq total RNA was isolated using TRlzol reagent Invitrogen life Technologies. The zebrafish embryonic fibroblast cell line ZF4 was purchased from the American Type Culture Collection ATCC CRL 2050; Driever and Rangini 1993. The cells were grown at 28 °C 5% CO2 in Dulbecco's modified Eagle's medium/F12 nutrient mix DMEM/F12 supplemented with 10% FBS 1% l glutamine 100 u/ml penicillin 100 μg/ml streptomycin. For cold treatment cells were grown at 18 °C 5% CO2 in the same medium for up to 30 days. All cell culture medium components were purchased from Gibco BRL Life Technologies Ltd USA. cell type:fibroblast cell line|growth:cultured at 18°C for 30 days|treatment:cold treatment for 30 days GSM1838566 GSM1838566: ZF4 18d30dRNA1; Danio rerio; RNA Seq GSM1838566   1 For MeDIP seq genomic DNAs were isolated and sonicated. End repair adenylation adapter ligation methylated DNA enrichment and methylated DNA library construction were all performed with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. For RNA seq total RNA was isolated using TRlzol reagent Invitrogen life Technologies. MeDIP DNA libraries were prepared with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. RNA libraries were prepared for sequencing using standard Illumina protocols． GEO Accession:GSM1838566 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP061852     18_30_replica1_1.fastq.gz 18_30_replica1_2.fastq.gz fastq fastq 2287951443.0 11382843.0 GSM1838566 r1 0:100 1:101 A:605485570;C:541783445;G:533913145;T:606360277;N:409006 100 101     605485570 541783445 533913145 606360277 409006 SRX1125643 SRS1017711 SRA281140 GEO College of fishery and life science, Shanghai Ocean University 2 0.93784 0.93575 0.10431 0.10502 0.72153 0.72472 0.49277 0.49322 100 101 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   China 2015-07-30 Undetermined Embryo Embryo Imprecise All anatomical structures
39765 39765 SRR2136166 SRX1125642 SRS1017712 SRP061852 PRJNA291530 DNA methylome patterns of zebrafish cells under cold pressure GSE71567 Other In this study MeDIP seq and RNA seq were performed to reveal a genome wide methylation profile of zebrafish Danio rerio embryonic fibroblast cell line ZF4 and its variation under cold environment.This study puts a new insight into the genome wide epigenetic regulation under cold environment. Overall design: ZF4 cells were cultured at 28 °C as control and at 18 °C for 5 days and 30 days seperately. Each condition has three biological replica.       ZF4 18d5dRNA3 GSM1838565   tissue:embryonic fibroblast cells|cell type:fibroblast cell line|growth:cultured at 18°C for 5 days|treatment:cold treatment for 5 days ZF4 18d5dRNA3 Illumina Casava1.7 software was used for basecalling. The fastx toolkit program was used to filter off low quality sequences from raw sequencing data. Sequences were aligned with Zebrafish genomeZR9/danRer7 downloaded from iGenome using Bowtie2. MeDIP seq peaks were called with the Model based Analysis of MeDIP Seq MACS software with default parameters with alignment results. The three peak sets generated by MACS were merged using Bedtools for peaks with at least 1bp overlap to get a reference peak set REF for following analysis. Genome build: ZR9/danRer7 Supplementary files format and content: .txt embryonic fibroblast cells For cold treatment cells were grown at 18 °C 5% CO2 in the same medium for up to 30 days. For MeDIP seq genomic DNAs were isolated and sonicated. End repair adenylation adapter ligation methylated DNA enrichment and methylated DNA library construction were all performed with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. For RNA seq total RNA was isolated using TRlzol reagent Invitrogen life Technologies. The zebrafish embryonic fibroblast cell line ZF4 was purchased from the American Type Culture Collection ATCC CRL 2050; Driever and Rangini 1993. The cells were grown at 28 °C 5% CO2 in Dulbecco's modified Eagle's medium/F12 nutrient mix DMEM/F12 supplemented with 10% FBS 1% l glutamine 100 u/ml penicillin 100 μg/ml streptomycin. For cold treatment cells were grown at 18 °C 5% CO2 in the same medium for up to 30 days. All cell culture medium components were purchased from Gibco BRL Life Technologies Ltd USA. cell type:fibroblast cell line|growth:cultured at 18°C for 5 days|treatment:cold treatment for 5 days GSM1838565 GSM1838565: ZF4 18d5dRNA3; Danio rerio; RNA Seq GSM1838565   1 For MeDIP seq genomic DNAs were isolated and sonicated. End repair adenylation adapter ligation methylated DNA enrichment and methylated DNA library construction were all performed with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. For RNA seq total RNA was isolated using TRlzol reagent Invitrogen life Technologies. MeDIP DNA libraries were prepared with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. RNA libraries were prepared for sequencing using standard Illumina protocols． GEO Accession:GSM1838565 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP061852     18_5_replica3_2.fastq.gz 18_5_replica3_1.fastq.gz fastq fastq 2161339804.0 10699702.0 GSM1838565 r1 0:101 1:101 A:536759371;C:543672217;G:540702028;T:537573543;N:2632645 101 101     536759371 543672217 540702028 537573543 2632645 SRX1125642 SRS1017712 SRA281140 GEO College of fishery and life science, Shanghai Ocean University 2 0.96121 0.96196 0.15571 0.1569 0.75491 0.75759 0.48619 0.52542 101 101 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   China 2015-07-30 Undetermined Embryo Embryo Imprecise All anatomical structures
39766 39766 SRR2136165 SRX1125641 SRS1017713 SRP061852 PRJNA291530 DNA methylome patterns of zebrafish cells under cold pressure GSE71567 Other In this study MeDIP seq and RNA seq were performed to reveal a genome wide methylation profile of zebrafish Danio rerio embryonic fibroblast cell line ZF4 and its variation under cold environment.This study puts a new insight into the genome wide epigenetic regulation under cold environment. Overall design: ZF4 cells were cultured at 28 °C as control and at 18 °C for 5 days and 30 days seperately. Each condition has three biological replica.       ZF4 18d5dRNA2 GSM1838564   tissue:embryonic fibroblast cells|cell type:fibroblast cell line|growth:cultured at 18°C for 5 days|treatment:cold treatment for 5 days ZF4 18d5dRNA2 Illumina Casava1.7 software was used for basecalling. The fastx toolkit program was used to filter off low quality sequences from raw sequencing data. Sequences were aligned with Zebrafish genomeZR9/danRer7 downloaded from iGenome using Bowtie2. MeDIP seq peaks were called with the Model based Analysis of MeDIP Seq MACS software with default parameters with alignment results. The three peak sets generated by MACS were merged using Bedtools for peaks with at least 1bp overlap to get a reference peak set REF for following analysis. Genome build: ZR9/danRer7 Supplementary files format and content: .txt embryonic fibroblast cells For cold treatment cells were grown at 18 °C 5% CO2 in the same medium for up to 30 days. For MeDIP seq genomic DNAs were isolated and sonicated. End repair adenylation adapter ligation methylated DNA enrichment and methylated DNA library construction were all performed with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. For RNA seq total RNA was isolated using TRlzol reagent Invitrogen life Technologies. The zebrafish embryonic fibroblast cell line ZF4 was purchased from the American Type Culture Collection ATCC CRL 2050; Driever and Rangini 1993. The cells were grown at 28 °C 5% CO2 in Dulbecco's modified Eagle's medium/F12 nutrient mix DMEM/F12 supplemented with 10% FBS 1% l glutamine 100 u/ml penicillin 100 μg/ml streptomycin. For cold treatment cells were grown at 18 °C 5% CO2 in the same medium for up to 30 days. All cell culture medium components were purchased from Gibco BRL Life Technologies Ltd USA. cell type:fibroblast cell line|growth:cultured at 18°C for 5 days|treatment:cold treatment for 5 days GSM1838564 GSM1838564: ZF4 18d5dRNA2; Danio rerio; RNA Seq GSM1838564   1 For MeDIP seq genomic DNAs were isolated and sonicated. End repair adenylation adapter ligation methylated DNA enrichment and methylated DNA library construction were all performed with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. For RNA seq total RNA was isolated using TRlzol reagent Invitrogen life Technologies. MeDIP DNA libraries were prepared with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. RNA libraries were prepared for sequencing using standard Illumina protocols． GEO Accession:GSM1838564 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP061852     18_5_replica2_2.fastq.gz 18_5_replica2_1.fastq.gz fastq fastq 2948189798.0 14594999.0 GSM1838564 r1 0:101 1:101 A:784972120;C:694695628;G:681782943;T:786426712;N:312395 101 101     784972120 694695628 681782943 786426712 312395 SRX1125641 SRS1017713 SRA281140 GEO College of fishery and life science, Shanghai Ocean University 2 0.94304 0.94274 0.10665 0.10697 0.72383 0.72508 0.48863 0.4889 101 101 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   China 2015-07-30 Undetermined Embryo Embryo Imprecise All anatomical structures

Next page

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;