RNAquarium Metadata Server
Institute Website Terms of Use Privacy Policy

run_metadata

57 rows where devstage_curation = "Undetermined" and experiment.library_strategy = "ncRNA-Seq"

✎ View and edit SQL

This data as json, CSV (advanced)

tissue_curation 5

devstage_curation_coarse 3

technology 2

experiment.library_layout 2

experiment.platform 1

experiment.library_strategy 1

  • ncRNA-Seq · 57 ✖

experiment.library_source 1

experiment.library_selection 1

devstage_curation 1

  • Undetermined · 57 ✖
Link rowid ▼ run.accession experiment.accession sample.accession study.accession bioproject study.title study.alias study.type study.abstract study.attributes study.PMIDs sample.description sample.title sample.alias sample.centername sample.attributes GEOsample.title GEOsample.dataprocessing GEOsample.source GEOsample.treatmentprotocol GEOsample.extractprotocol GEOsample.growthprotocol GEOsample.characteristics GEOsample.accession experiment.title experiment.alias experiment.library_name experiment.design_description experiment.library_construction_protocol experiment.attributes experiment.library_strategy experiment.library_source experiment.library_selection experiment.library_layout experiment.platform experiment.instrument_model experiment.spot_descriptor experiment.study_ref run.title run.attributes run.filename run.semantic_name run.total_bases run.total_spots run.alias run.read_lengths run.base_counts run.r1_length run.r2_length run.r3_length run.r4_length run.Acount run.Ccount run.Gcount run.Tcount run.Ncount run.experiment run.pool_member submission.accession submission.srasource submission.bioprojectsource seqdetective.n_mates seqdetective.mapping_rate.mate1 seqdetective.mapping_rate.mate2 seqdetective.nofeature_rate.mate1 seqdetective.nofeature_rate.mate2 seqdetective.sparsity.mate1 seqdetective.sparsity.mate2 seqdetective.pos_strand_rate.mate1 seqdetective.pos_strand_rate.mate2 seqdetective.readlen.mate1 seqdetective.readlen.mate2 seqdetective.judgement.mate1 seqdetective.judgement.mate2 seqdetective.judgement.reason platform_family instrument_generation read_bias selection_class prep_kit sc_or_bulk tech_class technology tech_variant submission.bioprojectsource.country earliest_date devstage_curation devstage_curation_coarse tissue_curation tissue_curation_coarse
28985 28985 SRR26936267 SRX22630108 SRS19628590 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   La 6 GSM7916507   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing La 6 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low2 GSM7916507 GSM7916507: La 6; Danio rerio; ncRNA Seq GSM7916507 r1 GSM7916507 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X32_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz fastq 810705967.0 27544418.0 GSM7916507 r1 0:29.43 A:141437993;C:173890211;G:258408531;T:236922660;N:46572 29       141437993 173890211 258408531 236922660 46572 SRX22630108 SRS19628590 SRA1756943 University of East Anglia University of East Anglia 1 0.86832   0.1884   0.84735   0.64657   21   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28986 28986 SRR26936231 SRX22630107 SRS19628589 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   La 5 GSM7916506   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing La 5 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low1 GSM7916506 GSM7916506: La 5; Danio rerio; ncRNA Seq GSM7916506 r1 GSM7916506 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X31_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz fastq 1237906972.0 45149037.0 GSM7916506 r1 0:27.42 A:273044213;C:252818121;G:368519115;T:343444331;N:81192 27       273044213 252818121 368519115 343444331 81192 SRX22630107 SRS19628589 SRA1756943 University of East Anglia University of East Anglia 1 0.86015   0.25463   0.83798   0.67166   25   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28987 28987 SRR26936232 SRX22630106 SRS19628588 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Hb 2 GSM7916505   tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing Hb 2 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High2 GSM7916505 GSM7916505: Hb 2; Danio rerio; ncRNA Seq GSM7916505 r1 GSM7916505 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X30_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz fastq 214730387.0 7217086.0 GSM7916505 r1 0:29.75 A:42819722;C:48080032;G:67677978;T:56140049;N:12606 29       42819722 48080032 67677978 56140049 12606 SRX22630106 SRS19628588 SRA1756943 University of East Anglia University of East Anglia 1 0.85212   0.1617   0.86856   0.69163   50   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28988 28988 SRR26936233 SRX22630105 SRS19628587 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Hb 1 GSM7916504   tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing Hb 1 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High2 GSM7916504 GSM7916504: Hb 1; Danio rerio; ncRNA Seq GSM7916504 r1 GSM7916504 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X29_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz fastq 595989272.0 21399963.0 GSM7916504 r1 0:27.85 A:128259525;C:125823294;G:181746588;T:160121380;N:38485 27       128259525 125823294 181746588 160121380 38485 SRX22630105 SRS19628587 SRA1756943 University of East Anglia University of East Anglia 1 0.85218   0.22941   0.83595   0.6151   30   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28989 28989 SRR26936234 SRX22630104 SRS19628586 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Lb 6 GSM7916503   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing Lb 6 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low2 GSM7916503 GSM7916503: Lb 6; Danio rerio; ncRNA Seq GSM7916503 r1 GSM7916503 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X28_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz fastq 969307398.0 35511411.0 GSM7916503 r1 0:27.30 A:205174189;C:203840471;G:285952255;T:274278193;N:62290 27       205174189 203840471 285952255 274278193 62290 SRX22630104 SRS19628586 SRA1756943 University of East Anglia University of East Anglia 1 0.85414   0.22608   0.8505   0.62202   33   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28990 28990 SRR26936235 SRX22630103 SRS19628585 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Ha 6 GSM7916502   tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing Ha 6 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High1 GSM7916502 GSM7916502: Ha 6; Danio rerio; ncRNA Seq GSM7916502 r1 GSM7916502 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X27_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz fastq 1326612630.0 47094729.0 GSM7916502 r1 0:28.17 A:303455697;C:273680466;G:382978796;T:366416311;N:81360 28       303455697 273680466 382978796 366416311 81360 SRX22630103 SRS19628585 SRA1756943 University of East Anglia University of East Anglia 1 0.84786   0.24696   0.82946   0.68975   37   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28991 28991 SRR26936236 SRX22630102 SRS19628584 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Ha 5 GSM7916501   tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing Ha 5 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High1 GSM7916501 GSM7916501: Ha 5; Danio rerio; ncRNA Seq GSM7916501 r1 GSM7916501 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X26_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz fastq 471823428.0 16704799.0 GSM7916501 r1 0:28.24 A:103178860;C:100561292;G:155557190;T:112495106;N:30980 28       103178860 100561292 155557190 112495106 30980 SRX22630102 SRS19628584 SRA1756943 University of East Anglia University of East Anglia 1 0.61628   0.14433   0.91275   0.6543   28   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28992 28992 SRR26936237 SRX22630101 SRS19628583 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   La 4 GSM7916500   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing La 4 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low1 GSM7916500 GSM7916500: La 4; Danio rerio; ncRNA Seq GSM7916500 r1 GSM7916500 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X25_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz fastq 713371286.0 25212566.0 GSM7916500 r1 0:28.29 A:155201946;C:151864186;G:207971547;T:198288220;N:45387 28       155201946 151864186 207971547 198288220 45387 SRX22630101 SRS19628583 SRA1756943 University of East Anglia University of East Anglia 1 0.8507   0.2078   0.83031   0.62739   22   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28993 28993 SRR26936238 SRX22630100 SRS19628582 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Hb 5 GSM7916499   tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing Hb 5 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High2 GSM7916499 GSM7916499: Hb 5; Danio rerio; ncRNA Seq GSM7916499 r1 GSM7916499 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X24_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz fastq 1043060550.0 35761504.0 GSM7916499 r1 0:29.17 A:217942105;C:216398395;G:316456102;T:292217159;N:46789 29       217942105 216398395 316456102 292217159 46789 SRX22630100 SRS19628582 SRA1756943 University of East Anglia University of East Anglia 1 0.82114   0.20881   0.85622   0.68486   19   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28994 28994 SRR26936239 SRX22630099 SRS19628581 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Hb 4 GSM7916498   tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing Hb 4 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High2 GSM7916498 GSM7916498: Hb 4; Danio rerio; ncRNA Seq GSM7916498 r1 GSM7916498 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X23_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz fastq 1357956641.0 47869361.0 GSM7916498 r1 0:28.37 A:293740473;C:276333777;G:404639503;T:383181225;N:61663 28       293740473 276333777 404639503 383181225 61663 SRX22630099 SRS19628581 SRA1756943 University of East Anglia University of East Anglia 1 0.79885   0.22306   0.8425   0.6656   26   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28995 28995 SRR26936240 SRX22630098 SRS19628580 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Lb 5 GSM7916497   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing Lb 5 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low2 GSM7916497 GSM7916497: Lb 5; Danio rerio; ncRNA Seq GSM7916497 r1 GSM7916497 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X22_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz fastq 669771811.0 23848259.0 GSM7916497 r1 0:28.08 A:132916986;C:135594797;G:198730347;T:202498953;N:30728 28       132916986 135594797 198730347 202498953 30728 SRX22630098 SRS19628580 SRA1756943 University of East Anglia University of East Anglia 1 0.80999   0.24188   0.84658   0.68339   20   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28996 28996 SRR26936241 SRX22630097 SRS19628579 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Ha 4 GSM7916496   tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing Ha 4 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High1 GSM7916496 GSM7916496: Ha 4; Danio rerio; ncRNA Seq GSM7916496 r1 GSM7916496 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X21_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz fastq 853803123.0 28538725.0 GSM7916496 r1 0:29.92 A:158220512;C:186146914;G:264519321;T:244878221;N:38155 29       158220512 186146914 264519321 244878221 38155 SRX22630097 SRS19628579 SRA1756943 University of East Anglia University of East Anglia 1 0.828   0.18458   0.85851   0.6483   32   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28997 28997 SRR26936242 SRX22630096 SRS19628578 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Ha 3 GSM7916495   tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing Ha 3 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High1 GSM7916495 GSM7916495: Ha 3; Danio rerio; ncRNA Seq GSM7916495 r1 GSM7916495 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X20_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz fastq 629106097.0 21383957.0 GSM7916495 r1 0:29.42 A:117216944;C:131994022;G:192623524;T:187243523;N:28084 29       117216944 131994022 192623524 187243523 28084 SRX22630096 SRS19628578 SRA1756943 University of East Anglia University of East Anglia 1 0.8166   0.20457   0.84112   0.65357   22   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28998 28998 SRR26936243 SRX22630095 SRS19628577 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   La 1 GSM7916494   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing La 1 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low1 GSM7916494 GSM7916494: La 1; Danio rerio; ncRNA Seq GSM7916494 r1 GSM7916494 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X19_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz fastq 21178378.0 739280.0 GSM7916494 r1 0:28.65 A:4323144;C:4478932;G:6303136;T:6072190;N:976 28       4323144 4478932 6303136 6072190 976 SRX22630095 SRS19628577 SRA1756943 University of East Anglia University of East Anglia 1 0.85277   0.21158   0.87434   0.62601   26   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
28999 28999 SRR26936244 SRX22630094 SRS19628576 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Lb 4 GSM7916493   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing Lb 4 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low2 GSM7916493 GSM7916493: Lb 4; Danio rerio; ncRNA Seq GSM7916493 r1 GSM7916493 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X18_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz fastq 959247745.0 33043430.0 GSM7916493 r1 0:29.03 A:225208425;C:212535680;G:284062577;T:237397072;N:43991 29       225208425 212535680 284062577 237397072 43991 SRX22630094 SRS19628576 SRA1756943 University of East Anglia University of East Anglia 1 0.82232   0.22592   0.87073   0.6135   22   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29000 29000 SRR26936245 SRX22630093 SRS19628575 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Lb 3 GSM7916492   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing Lb 3 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low1 GSM7916492 GSM7916492: Lb 3; Danio rerio; ncRNA Seq GSM7916492 r1 GSM7916492 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X17_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz fastq 900287704.0 31947371.0 GSM7916492 r1 0:28.18 A:224093089;C:188919051;G:262824615;T:224407166;N:43783 28       224093089 188919051 262824615 224407166 43783 SRX22630093 SRS19628575 SRA1756943 University of East Anglia University of East Anglia 1 0.67003   0.17024   0.87095   0.6869   19   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29001 29001 SRR26936246 SRX22630092 SRS19628574 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Hb 3 GSM7916491   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing Hb 3 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low2 GSM7916491 GSM7916491: Hb 3; Danio rerio; ncRNA Seq GSM7916491 r1 GSM7916491 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X16_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz fastq 80986783.0 3427704.0 GSM7916491 r1 0:23.63 A:18164838;C:19014879;G:24153410;T:19641723;N:11933 23       18164838 19014879 24153410 19641723 11933 SRX22630092 SRS19628574 SRA1756943 University of East Anglia University of East Anglia 1 0.83312   0.24402   0.88749   0.63345   50   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29002 29002 SRR26936247 SRX22630091 SRS19628573 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   La 3 GSM7916490   tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing La 3 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High2 GSM7916490 GSM7916490: La 3; Danio rerio; ncRNA Seq GSM7916490 r1 GSM7916490 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X15_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz fastq 148933985.0 6314805.0 GSM7916490 r1 0:23.58 A:39058546;C:30363738;G:44242466;T:35240575;N:28660 23       39058546 30363738 44242466 35240575 28660 SRX22630091 SRS19628573 SRA1756943 University of East Anglia University of East Anglia 1 0.41302   0.13369   0.89802   0.57553   22   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29003 29003 SRR26936248 SRX22630090 SRS19628572 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   La 2 GSM7916489   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing La 2 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low1 GSM7916489 GSM7916489: La 2; Danio rerio; ncRNA Seq GSM7916489 r1 GSM7916489 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X14_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz fastq 538382421.0 23079847.0 GSM7916489 r1 0:23.33 A:119659971;C:112896468;G:162693210;T:143063074;N:69698 23       119659971 112896468 162693210 143063074 69698 SRX22630090 SRS19628572 SRA1756943 University of East Anglia University of East Anglia 1 0.81532   0.23945   0.8758   0.62425   50   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29004 29004 SRR26936249 SRX22630089 SRS19628571 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Ha 1 GSM7916488   tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing Ha 1 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High1 GSM7916488 GSM7916488: Ha 1; Danio rerio; ncRNA Seq GSM7916488 r1 GSM7916488 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X13_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz fastq 761541737.0 32310434.0 GSM7916488 r1 0:23.57 A:182485471;C:173949932;G:214306916;T:190683160;N:116258 23       182485471 173949932 214306916 190683160 116258 SRX22630089 SRS19628571 SRA1756943 University of East Anglia University of East Anglia 1 0.82936   0.23022   0.85098   0.59571   19   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29005 29005 SRR26936250 SRX22630088 SRS19628570 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Lb 2 GSM7916487   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing Lb 2 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low2 GSM7916487 GSM7916487: Lb 2; Danio rerio; ncRNA Seq GSM7916487 r1 GSM7916487 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X12_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz fastq 559417322.0 23757934.0 GSM7916487 r1 0:23.55 A:126286771;C:106333997;G:170445137;T:156287131;N:64286 23       126286771 106333997 170445137 156287131 64286 SRX22630088 SRS19628570 SRA1756943 University of East Anglia University of East Anglia 1 0.85098   0.26224   0.8608   0.59344   22   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29006 29006 SRR26936251 SRX22630087 SRS19628569 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Lb 1 GSM7916486   tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing Lb 1 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High2 GSM7916486 GSM7916486: Lb 1; Danio rerio; ncRNA Seq GSM7916486 r1 GSM7916486 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X11_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz fastq 498695572.0 21269833.0 GSM7916486 r1 0:23.45 A:122716879;C:84997892;G:144626268;T:146292630;N:61903 23       122716879 84997892 144626268 146292630 61903 SRX22630087 SRS19628569 SRA1756943 University of East Anglia University of East Anglia 1 0.84251   0.1958   0.8591   0.61008   24   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29007 29007 SRR26936252 SRX22630086 SRS19628568 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Hb 10 GSM7916485   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing Hb 10 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low1 GSM7916485 GSM7916485: Hb 10; Danio rerio; ncRNA Seq GSM7916485 r1 GSM7916485 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X10_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz fastq 686865211.0 29320389.0 GSM7916485 r1 0:23.43 A:156131568;C:132162427;G:201526230;T:196961742;N:83244 23       156131568 132162427 201526230 196961742 83244 SRX22630086 SRS19628568 SRA1756943 University of East Anglia University of East Anglia 1 0.85707   0.27856   0.85648   0.59717   28   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29008 29008 SRR26936253 SRX22630085 SRS19628567 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   La 9 GSM7916484   tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing La 9 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High1 GSM7916484 GSM7916484: La 9; Danio rerio; ncRNA Seq GSM7916484 r1 GSM7916484 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X9_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz fastq 561289514.0 23860643.0 GSM7916484 r1 0:23.52 A:140848879;C:98838555;G:161520871;T:160013845;N:67364 23       140848879 98838555 161520871 160013845 67364 SRX22630085 SRS19628567 SRA1756943 University of East Anglia University of East Anglia 1 0.85507   0.17768   0.86969   0.64792   22   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29009 29009 SRR26936254 SRX22630084 SRS19628566 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   La 8 GSM7916483   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing La 8 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low2 GSM7916483 GSM7916483: La 8; Danio rerio; ncRNA Seq GSM7916483 r1 GSM7916483 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X8_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz fastq 458491681.0 16224249.0 GSM7916483 r1 0:28.26 A:99631677;C:90884289;G:139467457;T:128470855;N:37403 28       99631677 90884289 139467457 128470855 37403 SRX22630084 SRS19628566 SRA1756943 University of East Anglia University of East Anglia 1 0.81704   0.21909   0.84762   0.6293   50   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29010 29010 SRR26936255 SRX22630083 SRS19628565 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Ha 9 GSM7916482   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing Ha 9 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low1 GSM7916482 GSM7916482: Ha 9; Danio rerio; ncRNA Seq GSM7916482 r1 GSM7916482 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X7_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz fastq 574511047.0 20295283.0 GSM7916482 r1 0:28.31 A:134481373;C:122719422;G:169313406;T:147944946;N:51900 28       134481373 122719422 169313406 147944946 51900 SRX22630083 SRS19628565 SRA1756943 University of East Anglia University of East Anglia 1 0.81932   0.19984   0.85987   0.58268   23   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29011 29011 SRR26936256 SRX22630082 SRS19628564 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Lb 8 GSM7916481   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing Lb 8 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low2 GSM7916481 GSM7916481: Lb 8; Danio rerio; ncRNA Seq GSM7916481 r1 GSM7916481 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X6_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz fastq 1086899780.0 37486748.0 GSM7916481 r1 0:28.99 A:219996636;C:232899819;G:335644980;T:298269921;N:88424 28       219996636 232899819 335644980 298269921 88424 SRX22630082 SRS19628564 SRA1756943 University of East Anglia University of East Anglia 1 0.86943   0.2105   0.84461   0.67703   44   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29012 29012 SRR26936257 SRX22630081 SRS19628563 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Hb 9 GSM7916480   tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing Hb 9 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High2 GSM7916480 GSM7916480: Hb 9; Danio rerio; ncRNA Seq GSM7916480 r1 GSM7916480 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X5_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz fastq 1144093618.0 39048750.0 GSM7916480 r1 0:29.30 A:223769668;C:238953593;G:358148504;T:323130325;N:91528 29       223769668 238953593 358148504 323130325 91528 SRX22630081 SRS19628563 SRA1756943 University of East Anglia University of East Anglia 1 0.87445   0.1906   0.87237   0.70919   50   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29013 29013 SRR26936258 SRX22630080 SRS19628562 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Hb 7 GSM7916515   tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing Hb 7 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High2 GSM7916515 GSM7916515: Hb 7; Danio rerio; ncRNA Seq GSM7916515 r1 GSM7916515 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X40_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz fastq 263782568.0 9802454.0 GSM7916515 r1 0:26.91 A:59378855;C:53589034;G:83219251;T:67574216;N:21212 26       59378855 53589034 83219251 67574216 21212 SRX22630080 SRS19628562 SRA1756943 University of East Anglia University of East Anglia 1 0.80146   0.31524   0.81008   0.47305   30   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29014 29014 SRR26936260 SRX22630079 SRS19628561 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Ha 8 GSM7916514   tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing Ha 8 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High1 GSM7916514 GSM7916514: Ha 8; Danio rerio; ncRNA Seq GSM7916514 r1 GSM7916514 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X39_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz fastq 252119227.0 9309447.0 GSM7916514 r1 0:27.08 A:53293803;C:51577689;G:79148986;T:68078043;N:20706 27       53293803 51577689 79148986 68078043 20706 SRX22630079 SRS19628561 SRA1756943 University of East Anglia University of East Anglia 1 0.75593   0.29042   0.83412   0.59657   21   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29015 29015 SRR26936261 SRX22630078 SRS19628560 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Hb 6 GSM7916513   tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing Hb 6 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High2 GSM7916513 GSM7916513: Hb 6; Danio rerio; ncRNA Seq GSM7916513 r1 GSM7916513 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X38_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz fastq 516408240.0 19719085.0 GSM7916513 r1 0:26.19 A:112791146;C:102652986;G:160354602;T:140566375;N:43131 26       112791146 102652986 160354602 140566375 43131 SRX22630078 SRS19628560 SRA1756943 University of East Anglia University of East Anglia 1 0.80401   0.31982   0.83765   0.57755   22   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29016 29016 SRR26936262 SRX22630077 SRS19628559 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Ha 7 GSM7916512   tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing Ha 7 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High1 GSM7916512 GSM7916512: Ha 7; Danio rerio; ncRNA Seq GSM7916512 r1 GSM7916512 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X37_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz fastq 554171558.0 20779285.0 GSM7916512 r1 0:26.67 A:125256371;C:111354628;G:172197000;T:145317427;N:46132 26       125256371 111354628 172197000 145317427 46132 SRX22630077 SRS19628559 SRA1756943 University of East Anglia University of East Anglia 1 0.81035   0.28326   0.82933   0.62525   35   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29017 29017 SRR26936263 SRX22630076 SRS19628558 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Lb 10 GSM7916511   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing Lb 10 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low2 GSM7916511 GSM7916511: Lb 10; Danio rerio; ncRNA Seq GSM7916511 r1 GSM7916511 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X36_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz fastq 983846643.0 32513493.0 GSM7916511 r1 0:30.26 A:181840038;C:211101778;G:320659770;T:270174775;N:70282 30       181840038 211101778 320659770 270174775 70282 SRX22630076 SRS19628558 SRA1756943 University of East Anglia University of East Anglia 1 0.88133   0.15829   0.86324   0.67761   37   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29018 29018 SRR26936264 SRX22630075 SRS19628557 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Lb 9 GSM7916510   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing Lb 9 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low2 GSM7916510 GSM7916510: Lb 9; Danio rerio; ncRNA Seq GSM7916510 r1 GSM7916510 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X35_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz fastq 1077131964.0 37869598.0 GSM7916510 r1 0:28.44 A:210508796;C:220304812;G:327237157;T:319001223;N:79976 28       210508796 220304812 327237157 319001223 79976 SRX22630075 SRS19628557 SRA1756943 University of East Anglia University of East Anglia 1 0.84871   0.22867   0.83968   0.66027   35   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29019 29019 SRR26936265 SRX22630074 SRS19628556 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Lb 7 GSM7916509   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing Lb 7 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low1 GSM7916509 GSM7916509: Lb 7; Danio rerio; ncRNA Seq GSM7916509 r1 GSM7916509 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X34_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz fastq 1203153474.0 42565421.0 GSM7916509 r1 0:28.27 A:269760359;C:263088083;G:348288367;T:321910116;N:106549 28       269760359 263088083 348288367 321910116 106549 SRX22630074 SRS19628556 SRA1756943 University of East Anglia University of East Anglia 1 0.82319   0.21661   0.82432   0.65954   33   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29020 29020 SRR26936266 SRX22630073 SRS19628555 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   La 7 GSM7916508   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing La 7 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low1 GSM7916508 GSM7916508: La 7; Danio rerio; ncRNA Seq GSM7916508 r1 GSM7916508 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X33_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz fastq 1137464666.0 42434385.0 GSM7916508 r1 0:26.81 A:240256314;C:218420241;G:336730784;T:341968066;N:89261 26       240256314 218420241 336730784 341968066 89261 SRX22630073 SRS19628555 SRA1756943 University of East Anglia University of East Anglia 1 0.84647   0.26357   0.85313   0.67665   22   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29021 29021 SRR26936259 SRX22630072 SRS19628554 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Hb 8 GSM7916479   tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing Hb 8 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High2 GSM7916479 GSM7916479: Hb 8; Danio rerio; ncRNA Seq GSM7916479 r1 GSM7916479 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X4_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz fastq 1014850001.0 36540733.0 GSM7916479 r1 0:27.77 A:205870762;C:199482442;G:294628769;T:314783528;N:84500 27       205870762 199482442 294628769 314783528 84500 SRX22630072 SRS19628554 SRA1756943 University of East Anglia University of East Anglia 1 0.84303   0.28884   0.81692   0.66059   26   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29022 29022 SRR26936268 SRX22630071 SRS19628553 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   La 10 GSM7916478   tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing La 10 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:Low1 GSM7916478 GSM7916478: La 10; Danio rerio; ncRNA Seq GSM7916478 r1 GSM7916478 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X3_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz fastq 916186556.0 32659639.0 GSM7916478 r1 0:28.05 A:216314501;C:191651870;G:267047552;T:241092719;N:79914 28       216314501 191651870 267047552 241092719 79914 SRX22630071 SRS19628553 SRA1756943 University of East Anglia University of East Anglia 1 0.84312   0.23836   0.83132   0.57754   33   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29023 29023 SRR26936269 SRX22630070 SRS19628552 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Ha 10 GSM7916477   tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing Ha 10 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High1 GSM7916477 GSM7916477: Ha 10; Danio rerio; ncRNA Seq GSM7916477 r1 GSM7916477 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X2_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz fastq 858990742.0 30463457.0 GSM7916477 r1 0:28.20 A:182799146;C:179417249;G:265490509;T:231201694;N:82144 28       182799146 179417249 265490509 231201694 82144 SRX22630070 SRS19628552 SRA1756943 University of East Anglia University of East Anglia 1 0.67221   0.19137   0.87986   0.67831   33   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
29024 29024 SRR26936270 SRX22630069 SRS19628551 SRP473892 PRJNA1044439 Social stress in fathers affects sperm small RNA and offspring transcriptome profiles GSE248535 Transcriptome Analysis Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.   pubmed:40121340   Ha 2 GSM7916476   tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing Ha 2 Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses. sperm   Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   cell line:sperm|genotype:WT|treatment:High1 GSM7916476 GSM7916476: Ha 2; Danio rerio; ncRNA Seq GSM7916476 r1 GSM7916476 1 Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP473892     12235X1_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz fastq 262855265.0 9317037.0 GSM7916476 r1 0:28.21 A:59555006;C:56655912;G:79385169;T:67236972;N:22206 28       59555006 56655912 79385169 67236972 22206 SRX22630069 SRS19628551 SRA1756943 University of East Anglia University of East Anglia 1 0.85088   0.21543   0.84102   0.63415   28   B   usable mapping rate illumina hiseq_era unknown size_fractionation nebnext bulk unknown unknown   United Kingdom 2023-11-23 Undetermined Embryo Cell Line Cell Line
44967 44967 SRR6345660 SRX3442976 SRS2733636 SRP126106 PRJNA421016 Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] GSE107682 Transcriptome Analysis Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. parent bioproject:PRJNA315403 pubmed:30086300   smRNA seq library of ovary from tdrd6a mut fish GSM2875719   source name:Ovary from tdrd6a mut fish|tissue:whole ovary|genotype:tdrd6a mutant smRNA seq library of ovary from tdrd6a mut fish 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15  6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.    8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.  Supplementary files format and content: Files ending in .bw are bigwig tracks. Ovary from tdrd6a mut fish   RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation   tissue:whole ovary|genotype:tdrd6a mutant GSM2875719 GSM2875719: smRNA seq library of ovary from tdrd6a mut fish; Danio rerio; ncRNA Seq GSM2875719   1 RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation GEO Accession:GSM2875719 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP126106     Tdrd6a-mut-ovary-input-Adult.fastq.gz fastq 817885062.0 16036962.0 GSM2875719 r1 0:51 A:212456064;C:163491733;G:233627239;T:208262707;N:47319 51       212456064 163491733 233627239 208262707 47319 SRX3442976 SRS2733636 SRA636010 GEO Rene Ketting, RNA silencing, IMB 1 0.46308   0.13668   0.83587   0.79104   51   B   usable mapping rate illumina hiseq_era 5prime size_fractionation unknown sc_generic single_cell_generic generic-scrnaseq-only   Germany 2017-12-04 Undetermined Undetermined Gonad Reproductive System
44968 44968 SRR6345659 SRX3442975 SRS2733637 SRP126106 PRJNA421016 Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA] GSE107682 Transcriptome Analysis Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish. parent bioproject:PRJNA315403 pubmed:30086300   smRNA seq library of ovary from tdrd6a het fish GSM2875718   source name:Ovary from tdrd6a het fish|tissue:whole ovary|genotype:tdrd6a heterozygous smRNA seq library of ovary from tdrd6a het fish 1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15  6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.    8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.  Supplementary files format and content: Files ending in .bw are bigwig tracks. Ovary from tdrd6a het fish   RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation   tissue:whole ovary|genotype:tdrd6a heterozygous GSM2875718 GSM2875718: smRNA seq library of ovary from tdrd6a het fish; Danio rerio; ncRNA Seq GSM2875718   1 RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation GEO Accession:GSM2875718 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP126106     Tdrd6a-het-ovary-input-Adult.fastq.gz fastq 1452353571.0 28477521.0 GSM2875718 r1 0:51 A:397993735;C:284194126;G:396142390;T:373939235;N:84085 51       397993735 284194126 396142390 373939235 84085 SRX3442975 SRS2733637 SRA636010 GEO Rene Ketting, RNA silencing, IMB 1 0.3869   0.1369   0.86397   0.77165   51   B   usable mapping rate illumina hiseq_era 5prime size_fractionation unknown sc_generic single_cell_generic generic-scrnaseq-only   Germany 2017-12-04 Undetermined Undetermined Gonad Reproductive System
58545 58545 SRR13652352 SRX10049115 SRS8212343 SRP253438 PRJNA613601 five prime half of specific tRNAs feeds back to promote corresponding tRNA gene transcription in vertebrate embryos [small RNA Seq ssDRIP seq] GSE147253 Other five primetRFls are small tRNA fragments derived from five prime half of mature tRNAs. However it is unknown whether five primetRFls could feed back to regulate tRNA biogenesis. Here we show that five primetRFlGly/GCC and five primetRFlGlu/CTC function to promote transcription of corresponding tRNA genes and are essential for vertebrate early embryogenesis. During zebrafish embryogenesis dynamics of five primetRFlGly/GCC and five primetRFlGlu/CTC levels correlates with that of tRNAGly/GCC and tRNAGlu/CTC levels. Morpholino mediated knockdown of five primetRFlGly/GCC or five primetRFlGlu/CTC down regulates tRNAGly/GCC or tRNAGlu/CTC levels respectively and causes embryonic lethality that is efficiently rescued by co injection of properly refolded corresponding tRNA. In zebrafish embryos tRNA:DNA and five primetRFl:DNA hybrids commonly exist on the template strand of tRNA genes. Mechanistically unstable five primetRFl:DNA hybrid may prevent the formation of transcriptionally inhibitory stable tRNA:DNA hybrids on the same tRNA loci so as to facilitate tRNA genes transcription. The uncovered mechanism may be implicated in other physiological and pathological processes. Overall design: For small RNA sequencing total RNA were extracted respectively from wildtype zebrafish embryos Tübingen Strain of 6 chosen stages and then subjected to small RNA library preparation individually. To investigate the distribution and stability of R loop on genome we performed ssDRIP seq with S9.6 antibody which specifically recognize RNA:DNA hybrid. Two replicates from wildtype embryos of 256c sphere and shield stage were collected to perform ssDRIPseq. RNaseH pre treated genome DNA was used as negative control which was also performed the standard ssDRIP seq procedure. Genomic DNA extracted from these samples were fragmentated by restriction enzymes and then immunoprecipitated by S9.6 antibody.The ssDNA strands in RNA:DNA hybrids were purified and subjected to library preparation. parent bioproject:PRJNA753013 pubmed:34797706   256c ncRNA seq GSM5069282   tissue:embryo|strain:Tubingen|developmental stage:256c stage|treatement:no 256c ncRNA seq For data processing reads were quality checked by FastQCVersion 0.11.8 and adaptors were cut off by Cutadapt Version 1.16 and only reads that lay between 18 40 nt were kept. The reads of each sample were first aligned to different database by using Bowtie2 Version 2.3.4.1 count table was generated by featureCounts. Genome build: GRCz11 genome and cDNA tRNA database GtRNAdb GRCz11 embryo   For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 μl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4℃ the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80℃ until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37℃ then purified by phenol: chloroform extraction. The aim of this step is removing the 2 3’ cyclic phosphate group from the 3’end of 5’tRFls and add phosphate group to the 5’end of 3’tRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 μg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol.   strain:Tubingen|developmental stage:256c stage|treatement:no GSM5069282 GSM5069282: 256c ncRNA seq; Danio rerio; ncRNA Seq GSM5069282   1 For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 μl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4℃ the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80℃ until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37℃ then purified by phenol: chloroform extraction. The aim of this step is removing the 2 three prime cyclic phosphate group from the three primeend of five primetRFls and add phosphate group to the five primeend of three primetRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 μg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol. GEO Accession:GSM5069282 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP253438     256c-RNA_seq.fq.gz fastq 4634985600.0 30899904.0 GSM5069282 r1 0:150 1:0 A:815670917;C:820280105;G:2237895473;T:760861465;N:277640 150 0     815670917 820280105 2237895473 760861465 277640 SRX10049115 SRS8212343 SRA1056877 GEO Anming Meng Lab, School of Life Science, Tsinghua University 1 0.67611   0.16429   0.8076   0.58827   150   B   usable mapping rate illumina novaseq_era 5prime size_fractionation nebnext bulk unknown unknown   China 2021-02-08 Undetermined Embryo Embryo Imprecise All anatomical structures
61688 61688 SRR13302966 SRX9731824 SRS7924603 SRP290217 PRJNA673345 Zebrafish as an animal model for the antiviral RNA interference pathway GSE160475 Transcriptome Analysis We have evaluated the possible use of zebrafish to study antiviral RNAi with sindbis virus SINV vesicular stomatitis virus VSV and nodamura virus NoV. We find that SINV and NoV viruses induce the production of virus derived small interfering RNAs vsiRNAs the hallmark of antiviral RNAi with a preference of 22 nucleotides in length post infection of larval zebrafish. Meanwhile the suppressor of RNAi VSR protein NoV B2 may affect the accumulation of the NoV virus in zebrafish. Overall design: 5 virus derived small RNA from zebrafish infected with different viruses was detected by small RNA seq.       NoV△B2: Ago2 IP 3 dpi GSM4988099   source name:zebrafish whole body|zebrafish background:AB|infection:NoV△B2|injection way:microinjection|tissue:zebrafish whole body NoV△B2: Ago2 IP 3 dpi Sequenced reads were trimmed for adaptor sequence then mapped to virus genome using bowtie 1.1.2 with perfect match. Genome build: AF174533.1 AF174534.1;J02363.1;NC 001560.1 Supplementary files format and content: mapping results files generated by bowtie1.1.2 zebrafish whole body   Total RNA was extracted from zebrafish using TRIzol reagent. Small RNA libraries were constructed by the TruSeq Small RNA Sample Preparation Kit of Illumina from total RNA.   zebrafish background:AB|infection:NoV△B2|injection way:microinjection|tissue:zebrafish whole body GSM4988099 GSM4988099: NoV△B2: Ago2 IP 3 dpi; Danio rerio; ncRNA Seq GSM4988099   1 Total RNA was extracted from zebrafish using TRIzol reagent. Small RNA libraries were constructed by the TruSeq Small RNA Sample Preparation Kit of Illumina from total RNA. GEO Accession:GSM4988099 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP290217     LY272.fq.gz fastq 2608504950.0 17390033.0 GSM4988099 r1 0:150 1:0 A:741941121;C:669191911;G:747181676;T:450096994;N:93248 150 0     741941121 669191911 747181676 450096994 93248 SRX9731824 SRS7924603 SRA1151114 GEO Fudan University 1 0.13133   0.03425   0.96802   0.60095   150   B   usable mapping rate illumina hiseq_era unknown size_fractionation trueseq bulk unknown unknown   China 2020-12-24 Undetermined Larval Trunk Surface Structure
61689 61689 SRR12951276 SRX9404383 SRS7622158 SRP290217 PRJNA673345 Zebrafish as an animal model for the antiviral RNA interference pathway GSE160475 Transcriptome Analysis We have evaluated the possible use of zebrafish to study antiviral RNAi with sindbis virus SINV vesicular stomatitis virus VSV and nodamura virus NoV. We find that SINV and NoV viruses induce the production of virus derived small interfering RNAs vsiRNAs the hallmark of antiviral RNAi with a preference of 22 nucleotides in length post infection of larval zebrafish. Meanwhile the suppressor of RNAi VSR protein NoV B2 may affect the accumulation of the NoV virus in zebrafish. Overall design: 5 virus derived small RNA from zebrafish infected with different viruses was detected by small RNA seq.       SINV: zebrafish 3 dpi GSM4873784   source name:zebrafish whole body|tissue:whole body|infection:SINV|injection way:microinjection|zebrafish background:AB SINV: zebrafish 3 dpi Sequenced reads were trimmed for adaptor sequence then mapped to virus genome using bowtie 1.1.2 with perfect match. Genome build: AF174533.1 AF174534.1;J02363.1;NC 001560.1 Supplementary files format and content: mapping results files generated by bowtie1.1.2 zebrafish whole body   Total RNA was extracted from zebrafish using TRIzol reagent. Small RNA libraries were constructed by the TruSeq Small RNA Sample Preparation Kit of Illumina from total RNA.   tissue:whole body|infection:SINV|injection way:microinjection|zebrafish background:AB GSM4873784 GSM4873784: SINV: zebrafish 3 dpi; Danio rerio; ncRNA Seq GSM4873784   1 Total RNA was extracted from zebrafish using TRIzol reagent. Small RNA libraries were constructed by the TruSeq Small RNA Sample Preparation Kit of Illumina from total RNA. GEO Accession:GSM4873784 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2000   SRP290217     4_LY215.fq.gz fastq 1328044600.0 26560892.0 GSM4873784 r1 0:50 1:0 A:383401484;C:303337306;G:339848340;T:301397824;N:59646 50 0     383401484 303337306 339848340 301397824 59646 SRX9404383 SRS7622158 SRA1151114 GEO Fudan University 1 0.83242   0.11559   0.93634   0.53516   50   B   usable mapping rate illumina hiseq_era unknown size_fractionation trueseq bulk unknown unknown   China 2020-10-30 Undetermined Larval Trunk Surface Structure
61690 61690 SRR12951275 SRX9404382 SRS7622159 SRP290217 PRJNA673345 Zebrafish as an animal model for the antiviral RNA interference pathway GSE160475 Transcriptome Analysis We have evaluated the possible use of zebrafish to study antiviral RNAi with sindbis virus SINV vesicular stomatitis virus VSV and nodamura virus NoV. We find that SINV and NoV viruses induce the production of virus derived small interfering RNAs vsiRNAs the hallmark of antiviral RNAi with a preference of 22 nucleotides in length post infection of larval zebrafish. Meanwhile the suppressor of RNAi VSR protein NoV B2 may affect the accumulation of the NoV virus in zebrafish. Overall design: 5 virus derived small RNA from zebrafish infected with different viruses was detected by small RNA seq.       VSV: zebrafish 24 hpi GSM4873783   source name:zebrafish whole body|tissue:whole body|infection:VSV|injection way:microinjection|zebrafish background:AB VSV: zebrafish 24 hpi Sequenced reads were trimmed for adaptor sequence then mapped to virus genome using bowtie 1.1.2 with perfect match. Genome build: AF174533.1 AF174534.1;J02363.1;NC 001560.1 Supplementary files format and content: mapping results files generated by bowtie1.1.2 zebrafish whole body   Total RNA was extracted from zebrafish using TRIzol reagent. Small RNA libraries were constructed by the TruSeq Small RNA Sample Preparation Kit of Illumina from total RNA.   tissue:whole body|infection:VSV|injection way:microinjection|zebrafish background:AB GSM4873783 GSM4873783: VSV: zebrafish 24 hpi; Danio rerio; ncRNA Seq GSM4873783   1 Total RNA was extracted from zebrafish using TRIzol reagent. Small RNA libraries were constructed by the TruSeq Small RNA Sample Preparation Kit of Illumina from total RNA. GEO Accession:GSM4873783 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP290217     3_LY157.fq.gz fastq 706147852.0 29418915.0 GSM4873783 r1 0:24.00 1:0 A:151681768;C:131117267;G:189016204;T:234316361;N:16252 24 0     151681768 131117267 189016204 234316361 16252 SRX9404382 SRS7622159 SRA1151114 GEO Fudan University 1 0.92973   0.12628   0.90664   0.45104   23   B   usable mapping rate illumina hiseq_era unknown size_fractionation trueseq bulk unknown unknown   China 2020-10-30 Undetermined Larval Trunk Surface Structure
61691 61691 SRR12951274 SRX9404381 SRS7622157 SRP290217 PRJNA673345 Zebrafish as an animal model for the antiviral RNA interference pathway GSE160475 Transcriptome Analysis We have evaluated the possible use of zebrafish to study antiviral RNAi with sindbis virus SINV vesicular stomatitis virus VSV and nodamura virus NoV. We find that SINV and NoV viruses induce the production of virus derived small interfering RNAs vsiRNAs the hallmark of antiviral RNAi with a preference of 22 nucleotides in length post infection of larval zebrafish. Meanwhile the suppressor of RNAi VSR protein NoV B2 may affect the accumulation of the NoV virus in zebrafish. Overall design: 5 virus derived small RNA from zebrafish infected with different viruses was detected by small RNA seq.       NoV△B2: zebrafish 24 hpi GSM4873782   source name:zebrafish whole body|tissue:whole body|infection:NoV{delta}B2|injection way:microinjection|zebrafish background:AB NoV△B2: zebrafish 24 hpi Sequenced reads were trimmed for adaptor sequence then mapped to virus genome using bowtie 1.1.2 with perfect match. Genome build: AF174533.1 AF174534.1;J02363.1;NC 001560.1 Supplementary files format and content: mapping results files generated by bowtie1.1.2 zebrafish whole body   Total RNA was extracted from zebrafish using TRIzol reagent. Small RNA libraries were constructed by the TruSeq Small RNA Sample Preparation Kit of Illumina from total RNA.   tissue:whole body|infection:NoV{delta}B2|injection way:microinjection|zebrafish background:AB GSM4873782 GSM4873782: NoV△B2: zebrafish 24 hpi; Danio rerio; ncRNA Seq GSM4873782   1 Total RNA was extracted from zebrafish using TRIzol reagent. Small RNA libraries were constructed by the TruSeq Small RNA Sample Preparation Kit of Illumina from total RNA. GEO Accession:GSM4873782 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP290217     2_LY156.fq.gz fastq 748544818.0 30779865.0 GSM4873782 r1 0:24.32 1:0 A:166631198;C:138321792;G:208615021;T:234953337;N:23470 24 0     166631198 138321792 208615021 234953337 23470 SRX9404381 SRS7622157 SRA1151114 GEO Fudan University 1 0.94115   0.12368   0.91076   0.48684   23   B   usable mapping rate illumina hiseq_era unknown size_fractionation trueseq bulk unknown unknown   China 2020-10-30 Undetermined Larval Trunk Surface Structure
61692 61692 SRR12951273 SRX9404380 SRS7622156 SRP290217 PRJNA673345 Zebrafish as an animal model for the antiviral RNA interference pathway GSE160475 Transcriptome Analysis We have evaluated the possible use of zebrafish to study antiviral RNAi with sindbis virus SINV vesicular stomatitis virus VSV and nodamura virus NoV. We find that SINV and NoV viruses induce the production of virus derived small interfering RNAs vsiRNAs the hallmark of antiviral RNAi with a preference of 22 nucleotides in length post infection of larval zebrafish. Meanwhile the suppressor of RNAi VSR protein NoV B2 may affect the accumulation of the NoV virus in zebrafish. Overall design: 5 virus derived small RNA from zebrafish infected with different viruses was detected by small RNA seq.       NoV: zebrafish 24 hpi GSM4873781   source name:zebrafish whole body|tissue:whole body|infection:NoV|injection way:microinjection|zebrafish background:AB NoV: zebrafish 24 hpi Sequenced reads were trimmed for adaptor sequence then mapped to virus genome using bowtie 1.1.2 with perfect match. Genome build: AF174533.1 AF174534.1;J02363.1;NC 001560.1 Supplementary files format and content: mapping results files generated by bowtie1.1.2 zebrafish whole body   Total RNA was extracted from zebrafish using TRIzol reagent. Small RNA libraries were constructed by the TruSeq Small RNA Sample Preparation Kit of Illumina from total RNA.   tissue:whole body|infection:NoV|injection way:microinjection|zebrafish background:AB GSM4873781 GSM4873781: NoV: zebrafish 24 hpi; Danio rerio; ncRNA Seq GSM4873781   1 Total RNA was extracted from zebrafish using TRIzol reagent. Small RNA libraries were constructed by the TruSeq Small RNA Sample Preparation Kit of Illumina from total RNA. GEO Accession:GSM4873781 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP290217     1_LY155.fq.gz fastq 594676353.0 25019145.0 GSM4873781 r1 0:23.77 1:0 A:129139705;C:108465388;G:162500636;T:194556532;N:14092 23 0     129139705 108465388 162500636 194556532 14092 SRX9404380 SRS7622156 SRA1151114 GEO Fudan University 1 0.93471   0.10892   0.90814   0.48797   22   B   usable mapping rate illumina hiseq_era unknown size_fractionation trueseq bulk unknown unknown   China 2020-10-30 Undetermined Larval Trunk Surface Structure
67823 67823 SRR17335719 SRX13511115 SRS11405356 SRP352585 PRJNA792582 circRNA based biomarker candidates for acute cypermethrin and chlorpyrisfos toxication in the brain of Zebrafish Danio rerio GSE192669 Transcriptome Analysis Cypermethrin CYP and chlorpyrifos CPF are pesticides which are frequently used in agricultural areas around the world. These chemicals have been shown to cause serious toxicological damage in the brain of fish which is non target organisms. However circRNAs associated with acute brain toxicity caused by cypermethrin and chlorpyrifos have not been studied yet. In this study circRNAs were identified and characterized using RNA seq in Zebrafish brains exposed to acute cypermethrin and chlorpyrifos toxicity. A total of 10375 circRNAs were detected. It was determined that 6 circRNAs were up regulated 10 circRNAs were down regulated in CYP brain samples compared to controls . In addition it was found that 57 circRNAs are up regulated and 3 circRNAs down regulated in CPF brain samples compared to controls. Moreover 62 circRNAs were down regulated in the CYP samples when CYP and CPF samples were compared. However up regulated circRNA could not be detected. It was revealed that the detected circRNAs specifically regulated the MAPK signaling pathway endocytosis mechanism apoptosis and p53 signaling pathway. This study which was conducted for the first time in terms of the subject of the study could bring a different perspective especially to pesticide toxicity studies. Overall design: Examination of circRNA related to acute cypermethrin and chlopyrifos toxication in brain of zebrafish   pubmed:35304207   CPF3 GSM5754470   source name:Brain tissue|tissue:Brain|treatment:CPF toxication|geo loc name:missing|collection date:missing CPF3 Raw data raw reads of FASTQ format were firstly processed through in house scripts. In this step clean data clean reads were obtained by removing reads containing adapter and poly N sequences and reads with low quality from raw data. At the same time Q20 Q30 and GC content of the clean data were calculated. All the downstream analyses were based on the clean data with high quality.An upgraded computational pipeline CIRCexplorer2 is applied to detect circRNAs and identify alternative back splicing in back spliced circular RNAs circRNAs The expression of circRNAs is usually represented by the fragments that are mapped to the back spliced exon–exon junction sites. In addition to the raw fragment numbers normalized RNA seq fragments that are mapped to a specific back spliced exon–exon junction by total mapped fragments is used to quantitate circRNA expression. With FPM Fragments mapped to back spliced junction Per Million mapped fragments circRNAs from different samples with distinct sequencing depths can be directly compared. The input data for differential gene expression analysis is read counts from gene expression level analysis. For DESeq2 with biological replicates Differential expression analysis between two conditions/groups three biological replicates per condition was performed using DESeq2 R package. DESeq2 provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting P values were adjusted using the Benjamini and Hochberg’s approach for controlling the False Discovery Rate FDR. Genes with an adjusted P value < 0.05 found by DESeq2 were assigned as differentially expressed. A common way for searching shared functions among genes is to incorporate the biological knowledge provided by biological ontologies. Gene Ontology GO annotates genes to biological processes molecular functions and cellular components in a directed acyclic graph structure and Kyoto Encyclopedia of Genes and Genomes … Brain tissue   Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols   tissue:Brain|treatment:CPF toxication GSM5754470 GSM5754470: CPF3; Danio rerio; ncRNA Seq GSM5754470 r1 GSM5754470 1 Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols   ncRNA-Seq TRANSCRIPTOMIC size fractionation PAIRED ILLUMINA Illumina HiSeq 4000   SRP352585   loader:fastq load.py CPF3_1.fq.gz CPF3_2.fq.gz fastq fastq 12726241500.0 42420805.0 GSM5754470 r1 0:150 1:150 A:3447613023;C:2896153797;G:2922038320;T:3459698412;N:737948 150 150     3447613023 2896153797 2922038320 3459698412 737948 SRX13511115 SRS11405356 SRA1349262 Atatürk University Atatürk University 2 0.89399 0.89612 0.38172 0.37657 0.66628 0.66799 0.53056 0.53213 150 150 B B biological fallback assumption illumina hiseq_era unknown size_fractionation unknown bulk unknown unknown   Turkey 2021-12-27 Undetermined Undetermined Brain Nervous System
67824 67824 SRR17335720 SRX13511114 SRS11405355 SRP352585 PRJNA792582 circRNA based biomarker candidates for acute cypermethrin and chlorpyrisfos toxication in the brain of Zebrafish Danio rerio GSE192669 Transcriptome Analysis Cypermethrin CYP and chlorpyrifos CPF are pesticides which are frequently used in agricultural areas around the world. These chemicals have been shown to cause serious toxicological damage in the brain of fish which is non target organisms. However circRNAs associated with acute brain toxicity caused by cypermethrin and chlorpyrifos have not been studied yet. In this study circRNAs were identified and characterized using RNA seq in Zebrafish brains exposed to acute cypermethrin and chlorpyrifos toxicity. A total of 10375 circRNAs were detected. It was determined that 6 circRNAs were up regulated 10 circRNAs were down regulated in CYP brain samples compared to controls . In addition it was found that 57 circRNAs are up regulated and 3 circRNAs down regulated in CPF brain samples compared to controls. Moreover 62 circRNAs were down regulated in the CYP samples when CYP and CPF samples were compared. However up regulated circRNA could not be detected. It was revealed that the detected circRNAs specifically regulated the MAPK signaling pathway endocytosis mechanism apoptosis and p53 signaling pathway. This study which was conducted for the first time in terms of the subject of the study could bring a different perspective especially to pesticide toxicity studies. Overall design: Examination of circRNA related to acute cypermethrin and chlopyrifos toxication in brain of zebrafish   pubmed:35304207   CPF2 GSM5754469   source name:Brain tissue|tissue:Brain|treatment:CPF toxication|geo loc name:missing|collection date:missing CPF2 Raw data raw reads of FASTQ format were firstly processed through in house scripts. In this step clean data clean reads were obtained by removing reads containing adapter and poly N sequences and reads with low quality from raw data. At the same time Q20 Q30 and GC content of the clean data were calculated. All the downstream analyses were based on the clean data with high quality.An upgraded computational pipeline CIRCexplorer2 is applied to detect circRNAs and identify alternative back splicing in back spliced circular RNAs circRNAs The expression of circRNAs is usually represented by the fragments that are mapped to the back spliced exon–exon junction sites. In addition to the raw fragment numbers normalized RNA seq fragments that are mapped to a specific back spliced exon–exon junction by total mapped fragments is used to quantitate circRNA expression. With FPM Fragments mapped to back spliced junction Per Million mapped fragments circRNAs from different samples with distinct sequencing depths can be directly compared. The input data for differential gene expression analysis is read counts from gene expression level analysis. For DESeq2 with biological replicates Differential expression analysis between two conditions/groups three biological replicates per condition was performed using DESeq2 R package. DESeq2 provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting P values were adjusted using the Benjamini and Hochberg’s approach for controlling the False Discovery Rate FDR. Genes with an adjusted P value < 0.05 found by DESeq2 were assigned as differentially expressed. A common way for searching shared functions among genes is to incorporate the biological knowledge provided by biological ontologies. Gene Ontology GO annotates genes to biological processes molecular functions and cellular components in a directed acyclic graph structure and Kyoto Encyclopedia of Genes and Genomes … Brain tissue   Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols   tissue:Brain|treatment:CPF toxication GSM5754469 GSM5754469: CPF2; Danio rerio; ncRNA Seq GSM5754469 r1 GSM5754469 1 Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols   ncRNA-Seq TRANSCRIPTOMIC size fractionation PAIRED ILLUMINA Illumina HiSeq 4000   SRP352585   loader:fastq load.py CPF2_1.fq.gz CPF2_2.fq.gz fastq fastq 14881715100.0 49605717.0 GSM5754469 r1 0:150 1:150 A:4214905088;C:3201163283;G:3225795074;T:4239665352;N:186303 150 150     4214905088 3201163283 3225795074 4239665352 186303 SRX13511114 SRS11405355 SRA1349262 Atatürk University Atatürk University 2 0.87491 0.87638 0.40844 0.40479 0.67123 0.67018 0.49174 0.48952 150 150 B B biological fallback assumption illumina hiseq_era unknown size_fractionation unknown bulk unknown unknown   Turkey 2021-12-27 Undetermined Undetermined Brain Nervous System
67825 67825 SRR17335721 SRX13511113 SRS11405354 SRP352585 PRJNA792582 circRNA based biomarker candidates for acute cypermethrin and chlorpyrisfos toxication in the brain of Zebrafish Danio rerio GSE192669 Transcriptome Analysis Cypermethrin CYP and chlorpyrifos CPF are pesticides which are frequently used in agricultural areas around the world. These chemicals have been shown to cause serious toxicological damage in the brain of fish which is non target organisms. However circRNAs associated with acute brain toxicity caused by cypermethrin and chlorpyrifos have not been studied yet. In this study circRNAs were identified and characterized using RNA seq in Zebrafish brains exposed to acute cypermethrin and chlorpyrifos toxicity. A total of 10375 circRNAs were detected. It was determined that 6 circRNAs were up regulated 10 circRNAs were down regulated in CYP brain samples compared to controls . In addition it was found that 57 circRNAs are up regulated and 3 circRNAs down regulated in CPF brain samples compared to controls. Moreover 62 circRNAs were down regulated in the CYP samples when CYP and CPF samples were compared. However up regulated circRNA could not be detected. It was revealed that the detected circRNAs specifically regulated the MAPK signaling pathway endocytosis mechanism apoptosis and p53 signaling pathway. This study which was conducted for the first time in terms of the subject of the study could bring a different perspective especially to pesticide toxicity studies. Overall design: Examination of circRNA related to acute cypermethrin and chlopyrifos toxication in brain of zebrafish   pubmed:35304207   CPF1 GSM5754468   source name:Brain tissue|tissue:Brain|treatment:CPF toxication|geo loc name:missing|collection date:missing CPF1 Raw data raw reads of FASTQ format were firstly processed through in house scripts. In this step clean data clean reads were obtained by removing reads containing adapter and poly N sequences and reads with low quality from raw data. At the same time Q20 Q30 and GC content of the clean data were calculated. All the downstream analyses were based on the clean data with high quality.An upgraded computational pipeline CIRCexplorer2 is applied to detect circRNAs and identify alternative back splicing in back spliced circular RNAs circRNAs The expression of circRNAs is usually represented by the fragments that are mapped to the back spliced exon–exon junction sites. In addition to the raw fragment numbers normalized RNA seq fragments that are mapped to a specific back spliced exon–exon junction by total mapped fragments is used to quantitate circRNA expression. With FPM Fragments mapped to back spliced junction Per Million mapped fragments circRNAs from different samples with distinct sequencing depths can be directly compared. The input data for differential gene expression analysis is read counts from gene expression level analysis. For DESeq2 with biological replicates Differential expression analysis between two conditions/groups three biological replicates per condition was performed using DESeq2 R package. DESeq2 provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting P values were adjusted using the Benjamini and Hochberg’s approach for controlling the False Discovery Rate FDR. Genes with an adjusted P value < 0.05 found by DESeq2 were assigned as differentially expressed. A common way for searching shared functions among genes is to incorporate the biological knowledge provided by biological ontologies. Gene Ontology GO annotates genes to biological processes molecular functions and cellular components in a directed acyclic graph structure and Kyoto Encyclopedia of Genes and Genomes … Brain tissue   Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols   tissue:Brain|treatment:CPF toxication GSM5754468 GSM5754468: CPF1; Danio rerio; ncRNA Seq GSM5754468 r1 GSM5754468 1 Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols   ncRNA-Seq TRANSCRIPTOMIC size fractionation PAIRED ILLUMINA Illumina HiSeq 4000   SRP352585   loader:fastq load.py CPF1_1.fq.gz CPF1_2.fq.gz fastq fastq 16447798800.0 54825996.0 GSM5754468 r1 0:150 1:150 A:4454573413;C:3748270411;G:3776995203;T:4467442717;N:517056 150 150     4454573413 3748270411 3776995203 4467442717 517056 SRX13511113 SRS11405354 SRA1349262 Atatürk University Atatürk University 2 0.89313 0.8947 0.35381 0.35194 0.64954 0.64831 0.51962 0.52475 150 150 B B biological fallback assumption illumina hiseq_era unknown size_fractionation unknown bulk unknown unknown   Turkey 2021-12-27 Undetermined Undetermined Brain Nervous System
67826 67826 SRR17335722 SRX13511112 SRS11405353 SRP352585 PRJNA792582 circRNA based biomarker candidates for acute cypermethrin and chlorpyrisfos toxication in the brain of Zebrafish Danio rerio GSE192669 Transcriptome Analysis Cypermethrin CYP and chlorpyrifos CPF are pesticides which are frequently used in agricultural areas around the world. These chemicals have been shown to cause serious toxicological damage in the brain of fish which is non target organisms. However circRNAs associated with acute brain toxicity caused by cypermethrin and chlorpyrifos have not been studied yet. In this study circRNAs were identified and characterized using RNA seq in Zebrafish brains exposed to acute cypermethrin and chlorpyrifos toxicity. A total of 10375 circRNAs were detected. It was determined that 6 circRNAs were up regulated 10 circRNAs were down regulated in CYP brain samples compared to controls . In addition it was found that 57 circRNAs are up regulated and 3 circRNAs down regulated in CPF brain samples compared to controls. Moreover 62 circRNAs were down regulated in the CYP samples when CYP and CPF samples were compared. However up regulated circRNA could not be detected. It was revealed that the detected circRNAs specifically regulated the MAPK signaling pathway endocytosis mechanism apoptosis and p53 signaling pathway. This study which was conducted for the first time in terms of the subject of the study could bring a different perspective especially to pesticide toxicity studies. Overall design: Examination of circRNA related to acute cypermethrin and chlopyrifos toxication in brain of zebrafish   pubmed:35304207   CYP3 GSM5754467   source name:Brain tissue|tissue:Brain|treatment:CYP toxication|geo loc name:missing|collection date:missing CYP3 Raw data raw reads of FASTQ format were firstly processed through in house scripts. In this step clean data clean reads were obtained by removing reads containing adapter and poly N sequences and reads with low quality from raw data. At the same time Q20 Q30 and GC content of the clean data were calculated. All the downstream analyses were based on the clean data with high quality.An upgraded computational pipeline CIRCexplorer2 is applied to detect circRNAs and identify alternative back splicing in back spliced circular RNAs circRNAs The expression of circRNAs is usually represented by the fragments that are mapped to the back spliced exon–exon junction sites. In addition to the raw fragment numbers normalized RNA seq fragments that are mapped to a specific back spliced exon–exon junction by total mapped fragments is used to quantitate circRNA expression. With FPM Fragments mapped to back spliced junction Per Million mapped fragments circRNAs from different samples with distinct sequencing depths can be directly compared. The input data for differential gene expression analysis is read counts from gene expression level analysis. For DESeq2 with biological replicates Differential expression analysis between two conditions/groups three biological replicates per condition was performed using DESeq2 R package. DESeq2 provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting P values were adjusted using the Benjamini and Hochberg’s approach for controlling the False Discovery Rate FDR. Genes with an adjusted P value < 0.05 found by DESeq2 were assigned as differentially expressed. A common way for searching shared functions among genes is to incorporate the biological knowledge provided by biological ontologies. Gene Ontology GO annotates genes to biological processes molecular functions and cellular components in a directed acyclic graph structure and Kyoto Encyclopedia of Genes and Genomes … Brain tissue   Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols   tissue:Brain|treatment:CYP toxication GSM5754467 GSM5754467: CYP3; Danio rerio; ncRNA Seq GSM5754467 r1 GSM5754467 1 Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols   ncRNA-Seq TRANSCRIPTOMIC size fractionation PAIRED ILLUMINA Illumina HiSeq 4000   SRP352585   loader:fastq load.py CYP3_1.fq.gz CYP3_2.fq.gz fastq fastq 13417868100.0 44726227.0 GSM5754467 r1 0:150 1:150 A:3645134270;C:3041754103;G:3084809543;T:3645750889;N:419295 150 150     3645134270 3041754103 3084809543 3645750889 419295 SRX13511112 SRS11405353 SRA1349262 Atatürk University Atatürk University 2 0.86122 0.8638 0.4112 0.40785 0.68738 0.68519 0.54768 0.44856 150 150 B B biological fallback assumption illumina hiseq_era unknown size_fractionation unknown bulk unknown unknown   Turkey 2021-12-27 Undetermined Undetermined Brain Nervous System
67827 67827 SRR17335723 SRX13511111 SRS11405352 SRP352585 PRJNA792582 circRNA based biomarker candidates for acute cypermethrin and chlorpyrisfos toxication in the brain of Zebrafish Danio rerio GSE192669 Transcriptome Analysis Cypermethrin CYP and chlorpyrifos CPF are pesticides which are frequently used in agricultural areas around the world. These chemicals have been shown to cause serious toxicological damage in the brain of fish which is non target organisms. However circRNAs associated with acute brain toxicity caused by cypermethrin and chlorpyrifos have not been studied yet. In this study circRNAs were identified and characterized using RNA seq in Zebrafish brains exposed to acute cypermethrin and chlorpyrifos toxicity. A total of 10375 circRNAs were detected. It was determined that 6 circRNAs were up regulated 10 circRNAs were down regulated in CYP brain samples compared to controls . In addition it was found that 57 circRNAs are up regulated and 3 circRNAs down regulated in CPF brain samples compared to controls. Moreover 62 circRNAs were down regulated in the CYP samples when CYP and CPF samples were compared. However up regulated circRNA could not be detected. It was revealed that the detected circRNAs specifically regulated the MAPK signaling pathway endocytosis mechanism apoptosis and p53 signaling pathway. This study which was conducted for the first time in terms of the subject of the study could bring a different perspective especially to pesticide toxicity studies. Overall design: Examination of circRNA related to acute cypermethrin and chlopyrifos toxication in brain of zebrafish   pubmed:35304207   CYP2 GSM5754466   source name:Brain tissue|tissue:Brain|treatment:CYP toxication|geo loc name:missing|collection date:missing CYP2 Raw data raw reads of FASTQ format were firstly processed through in house scripts. In this step clean data clean reads were obtained by removing reads containing adapter and poly N sequences and reads with low quality from raw data. At the same time Q20 Q30 and GC content of the clean data were calculated. All the downstream analyses were based on the clean data with high quality.An upgraded computational pipeline CIRCexplorer2 is applied to detect circRNAs and identify alternative back splicing in back spliced circular RNAs circRNAs The expression of circRNAs is usually represented by the fragments that are mapped to the back spliced exon–exon junction sites. In addition to the raw fragment numbers normalized RNA seq fragments that are mapped to a specific back spliced exon–exon junction by total mapped fragments is used to quantitate circRNA expression. With FPM Fragments mapped to back spliced junction Per Million mapped fragments circRNAs from different samples with distinct sequencing depths can be directly compared. The input data for differential gene expression analysis is read counts from gene expression level analysis. For DESeq2 with biological replicates Differential expression analysis between two conditions/groups three biological replicates per condition was performed using DESeq2 R package. DESeq2 provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting P values were adjusted using the Benjamini and Hochberg’s approach for controlling the False Discovery Rate FDR. Genes with an adjusted P value < 0.05 found by DESeq2 were assigned as differentially expressed. A common way for searching shared functions among genes is to incorporate the biological knowledge provided by biological ontologies. Gene Ontology GO annotates genes to biological processes molecular functions and cellular components in a directed acyclic graph structure and Kyoto Encyclopedia of Genes and Genomes … Brain tissue   Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols   tissue:Brain|treatment:CYP toxication GSM5754466 GSM5754466: CYP2; Danio rerio; ncRNA Seq GSM5754466 r1 GSM5754466 1 Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols   ncRNA-Seq TRANSCRIPTOMIC size fractionation PAIRED ILLUMINA Illumina HiSeq 4000   SRP352585   loader:fastq load.py CYP2_1.fq.gz CYP2_2.fq.gz fastq fastq 13096007700.0 43653359.0 GSM5754466 r1 0:150 1:150 A:3638241155;C:2892284693;G:2925857490;T:3639296449;N:327913 150 150     3638241155 2892284693 2925857490 3639296449 327913 SRX13511111 SRS11405352 SRA1349262 Atatürk University Atatürk University 2 0.85953 0.86247 0.41975 0.41734 0.68174 0.67862 0.52504 0.5324 150 150 B B biological fallback assumption illumina hiseq_era unknown size_fractionation unknown bulk unknown unknown   Turkey 2021-12-27 Undetermined Undetermined Brain Nervous System
67828 67828 SRR17335724 SRX13511110 SRS11405351 SRP352585 PRJNA792582 circRNA based biomarker candidates for acute cypermethrin and chlorpyrisfos toxication in the brain of Zebrafish Danio rerio GSE192669 Transcriptome Analysis Cypermethrin CYP and chlorpyrifos CPF are pesticides which are frequently used in agricultural areas around the world. These chemicals have been shown to cause serious toxicological damage in the brain of fish which is non target organisms. However circRNAs associated with acute brain toxicity caused by cypermethrin and chlorpyrifos have not been studied yet. In this study circRNAs were identified and characterized using RNA seq in Zebrafish brains exposed to acute cypermethrin and chlorpyrifos toxicity. A total of 10375 circRNAs were detected. It was determined that 6 circRNAs were up regulated 10 circRNAs were down regulated in CYP brain samples compared to controls . In addition it was found that 57 circRNAs are up regulated and 3 circRNAs down regulated in CPF brain samples compared to controls. Moreover 62 circRNAs were down regulated in the CYP samples when CYP and CPF samples were compared. However up regulated circRNA could not be detected. It was revealed that the detected circRNAs specifically regulated the MAPK signaling pathway endocytosis mechanism apoptosis and p53 signaling pathway. This study which was conducted for the first time in terms of the subject of the study could bring a different perspective especially to pesticide toxicity studies. Overall design: Examination of circRNA related to acute cypermethrin and chlopyrifos toxication in brain of zebrafish   pubmed:35304207   CYP1 GSM5754465   source name:Brain tissue|tissue:Brain|treatment:CYP toxication|geo loc name:missing|collection date:missing CYP1 Raw data raw reads of FASTQ format were firstly processed through in house scripts. In this step clean data clean reads were obtained by removing reads containing adapter and poly N sequences and reads with low quality from raw data. At the same time Q20 Q30 and GC content of the clean data were calculated. All the downstream analyses were based on the clean data with high quality.An upgraded computational pipeline CIRCexplorer2 is applied to detect circRNAs and identify alternative back splicing in back spliced circular RNAs circRNAs The expression of circRNAs is usually represented by the fragments that are mapped to the back spliced exon–exon junction sites. In addition to the raw fragment numbers normalized RNA seq fragments that are mapped to a specific back spliced exon–exon junction by total mapped fragments is used to quantitate circRNA expression. With FPM Fragments mapped to back spliced junction Per Million mapped fragments circRNAs from different samples with distinct sequencing depths can be directly compared. The input data for differential gene expression analysis is read counts from gene expression level analysis. For DESeq2 with biological replicates Differential expression analysis between two conditions/groups three biological replicates per condition was performed using DESeq2 R package. DESeq2 provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting P values were adjusted using the Benjamini and Hochberg’s approach for controlling the False Discovery Rate FDR. Genes with an adjusted P value < 0.05 found by DESeq2 were assigned as differentially expressed. A common way for searching shared functions among genes is to incorporate the biological knowledge provided by biological ontologies. Gene Ontology GO annotates genes to biological processes molecular functions and cellular components in a directed acyclic graph structure and Kyoto Encyclopedia of Genes and Genomes … Brain tissue   Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols   tissue:Brain|treatment:CYP toxication GSM5754465 GSM5754465: CYP1; Danio rerio; ncRNA Seq GSM5754465 r1 GSM5754465 1 Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols   ncRNA-Seq TRANSCRIPTOMIC size fractionation PAIRED ILLUMINA Illumina HiSeq 4000   SRP352585   loader:fastq load.py CYP1_1.fq.gz CYP1_2.fq.gz fastq fastq 16372872000.0 54576240.0 GSM5754465 r1 0:150 1:150 A:4747286217;C:3417115980;G:3453793026;T:4754530080;N:146697 150 150     4747286217 3417115980 3453793026 4754530080 146697 SRX13511110 SRS11405351 SRA1349262 Atatürk University Atatürk University 2 0.85322 0.85414 0.46298 0.45901 0.68016 0.67866 0.47694 0.47897 150 150 B B biological fallback assumption illumina hiseq_era unknown size_fractionation unknown bulk unknown unknown   Turkey 2021-12-27 Undetermined Undetermined Brain Nervous System
67829 67829 SRR17335725 SRX13511109 SRS11405350 SRP352585 PRJNA792582 circRNA based biomarker candidates for acute cypermethrin and chlorpyrisfos toxication in the brain of Zebrafish Danio rerio GSE192669 Transcriptome Analysis Cypermethrin CYP and chlorpyrifos CPF are pesticides which are frequently used in agricultural areas around the world. These chemicals have been shown to cause serious toxicological damage in the brain of fish which is non target organisms. However circRNAs associated with acute brain toxicity caused by cypermethrin and chlorpyrifos have not been studied yet. In this study circRNAs were identified and characterized using RNA seq in Zebrafish brains exposed to acute cypermethrin and chlorpyrifos toxicity. A total of 10375 circRNAs were detected. It was determined that 6 circRNAs were up regulated 10 circRNAs were down regulated in CYP brain samples compared to controls . In addition it was found that 57 circRNAs are up regulated and 3 circRNAs down regulated in CPF brain samples compared to controls. Moreover 62 circRNAs were down regulated in the CYP samples when CYP and CPF samples were compared. However up regulated circRNA could not be detected. It was revealed that the detected circRNAs specifically regulated the MAPK signaling pathway endocytosis mechanism apoptosis and p53 signaling pathway. This study which was conducted for the first time in terms of the subject of the study could bring a different perspective especially to pesticide toxicity studies. Overall design: Examination of circRNA related to acute cypermethrin and chlopyrifos toxication in brain of zebrafish   pubmed:35304207   Cont3 GSM5754464   source name:Brain tissue|tissue:Brain|treatment:No toxication|geo loc name:missing|collection date:missing Cont3 Raw data raw reads of FASTQ format were firstly processed through in house scripts. In this step clean data clean reads were obtained by removing reads containing adapter and poly N sequences and reads with low quality from raw data. At the same time Q20 Q30 and GC content of the clean data were calculated. All the downstream analyses were based on the clean data with high quality.An upgraded computational pipeline CIRCexplorer2 is applied to detect circRNAs and identify alternative back splicing in back spliced circular RNAs circRNAs The expression of circRNAs is usually represented by the fragments that are mapped to the back spliced exon–exon junction sites. In addition to the raw fragment numbers normalized RNA seq fragments that are mapped to a specific back spliced exon–exon junction by total mapped fragments is used to quantitate circRNA expression. With FPM Fragments mapped to back spliced junction Per Million mapped fragments circRNAs from different samples with distinct sequencing depths can be directly compared. The input data for differential gene expression analysis is read counts from gene expression level analysis. For DESeq2 with biological replicates Differential expression analysis between two conditions/groups three biological replicates per condition was performed using DESeq2 R package. DESeq2 provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting P values were adjusted using the Benjamini and Hochberg’s approach for controlling the False Discovery Rate FDR. Genes with an adjusted P value < 0.05 found by DESeq2 were assigned as differentially expressed. A common way for searching shared functions among genes is to incorporate the biological knowledge provided by biological ontologies. Gene Ontology GO annotates genes to biological processes molecular functions and cellular components in a directed acyclic graph structure and Kyoto Encyclopedia of Genes and Genomes … Brain tissue   Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols   tissue:Brain|treatment:No toxication GSM5754464 GSM5754464: Cont3; Danio rerio; ncRNA Seq GSM5754464 r1 GSM5754464 1 Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols   ncRNA-Seq TRANSCRIPTOMIC size fractionation PAIRED ILLUMINA Illumina HiSeq 4000   SRP352585   loader:fastq load.py Cont3_1.fq.gz Cont3_2.fq.gz fastq fastq 15202443900.0 50674813.0 GSM5754464 r1 0:150 1:150 A:4400470018;C:3173803928;G:3218623722;T:4409335756;N:210476 150 150     4400470018 3173803928 3218623722 4409335756 210476 SRX13511109 SRS11405350 SRA1349262 Atatürk University Atatürk University 2 0.86129 0.84677 0.45657 0.44799 0.67884 0.68083 0.48291 0.4763 150 150 B B biological fallback assumption illumina hiseq_era unknown size_fractionation unknown bulk unknown unknown   Turkey 2021-12-27 Undetermined Undetermined Brain Nervous System
67830 67830 SRR17335726 SRX13511108 SRS11405349 SRP352585 PRJNA792582 circRNA based biomarker candidates for acute cypermethrin and chlorpyrisfos toxication in the brain of Zebrafish Danio rerio GSE192669 Transcriptome Analysis Cypermethrin CYP and chlorpyrifos CPF are pesticides which are frequently used in agricultural areas around the world. These chemicals have been shown to cause serious toxicological damage in the brain of fish which is non target organisms. However circRNAs associated with acute brain toxicity caused by cypermethrin and chlorpyrifos have not been studied yet. In this study circRNAs were identified and characterized using RNA seq in Zebrafish brains exposed to acute cypermethrin and chlorpyrifos toxicity. A total of 10375 circRNAs were detected. It was determined that 6 circRNAs were up regulated 10 circRNAs were down regulated in CYP brain samples compared to controls . In addition it was found that 57 circRNAs are up regulated and 3 circRNAs down regulated in CPF brain samples compared to controls. Moreover 62 circRNAs were down regulated in the CYP samples when CYP and CPF samples were compared. However up regulated circRNA could not be detected. It was revealed that the detected circRNAs specifically regulated the MAPK signaling pathway endocytosis mechanism apoptosis and p53 signaling pathway. This study which was conducted for the first time in terms of the subject of the study could bring a different perspective especially to pesticide toxicity studies. Overall design: Examination of circRNA related to acute cypermethrin and chlopyrifos toxication in brain of zebrafish   pubmed:35304207   Cont2 GSM5754463   source name:Brain tissue|tissue:Brain|treatment:No toxication|geo loc name:missing|collection date:missing Cont2 Raw data raw reads of FASTQ format were firstly processed through in house scripts. In this step clean data clean reads were obtained by removing reads containing adapter and poly N sequences and reads with low quality from raw data. At the same time Q20 Q30 and GC content of the clean data were calculated. All the downstream analyses were based on the clean data with high quality.An upgraded computational pipeline CIRCexplorer2 is applied to detect circRNAs and identify alternative back splicing in back spliced circular RNAs circRNAs The expression of circRNAs is usually represented by the fragments that are mapped to the back spliced exon–exon junction sites. In addition to the raw fragment numbers normalized RNA seq fragments that are mapped to a specific back spliced exon–exon junction by total mapped fragments is used to quantitate circRNA expression. With FPM Fragments mapped to back spliced junction Per Million mapped fragments circRNAs from different samples with distinct sequencing depths can be directly compared. The input data for differential gene expression analysis is read counts from gene expression level analysis. For DESeq2 with biological replicates Differential expression analysis between two conditions/groups three biological replicates per condition was performed using DESeq2 R package. DESeq2 provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting P values were adjusted using the Benjamini and Hochberg’s approach for controlling the False Discovery Rate FDR. Genes with an adjusted P value < 0.05 found by DESeq2 were assigned as differentially expressed. A common way for searching shared functions among genes is to incorporate the biological knowledge provided by biological ontologies. Gene Ontology GO annotates genes to biological processes molecular functions and cellular components in a directed acyclic graph structure and Kyoto Encyclopedia of Genes and Genomes … Brain tissue   Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols   tissue:Brain|treatment:No toxication GSM5754463 GSM5754463: Cont2; Danio rerio; ncRNA Seq GSM5754463 r1 GSM5754463 1 Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols   ncRNA-Seq TRANSCRIPTOMIC size fractionation PAIRED ILLUMINA Illumina HiSeq 4000   SRP352585   loader:fastq load.py Cont2_1.fq.gz Cont2_2.fq.gz fastq fastq 12927267600.0 43090892.0 GSM5754463 r1 0:150 1:150 A:3474574877;C:2959326086;G:3006553706;T:3486600752;N:212179 150 150     3474574877 2959326086 3006553706 3486600752 212179 SRX13511108 SRS11405349 SRA1349262 Atatürk University Atatürk University 2 0.87695 0.87907 0.41673 0.41416 0.69266 0.69266 0.53339 0.58145 150 150 B B biological fallback assumption illumina hiseq_era unknown size_fractionation unknown bulk unknown unknown   Turkey 2021-12-27 Undetermined Undetermined Brain Nervous System
67831 67831 SRR17335727 SRX13511107 SRS11405348 SRP352585 PRJNA792582 circRNA based biomarker candidates for acute cypermethrin and chlorpyrisfos toxication in the brain of Zebrafish Danio rerio GSE192669 Transcriptome Analysis Cypermethrin CYP and chlorpyrifos CPF are pesticides which are frequently used in agricultural areas around the world. These chemicals have been shown to cause serious toxicological damage in the brain of fish which is non target organisms. However circRNAs associated with acute brain toxicity caused by cypermethrin and chlorpyrifos have not been studied yet. In this study circRNAs were identified and characterized using RNA seq in Zebrafish brains exposed to acute cypermethrin and chlorpyrifos toxicity. A total of 10375 circRNAs were detected. It was determined that 6 circRNAs were up regulated 10 circRNAs were down regulated in CYP brain samples compared to controls . In addition it was found that 57 circRNAs are up regulated and 3 circRNAs down regulated in CPF brain samples compared to controls. Moreover 62 circRNAs were down regulated in the CYP samples when CYP and CPF samples were compared. However up regulated circRNA could not be detected. It was revealed that the detected circRNAs specifically regulated the MAPK signaling pathway endocytosis mechanism apoptosis and p53 signaling pathway. This study which was conducted for the first time in terms of the subject of the study could bring a different perspective especially to pesticide toxicity studies. Overall design: Examination of circRNA related to acute cypermethrin and chlopyrifos toxication in brain of zebrafish   pubmed:35304207   Cont1 GSM5754462   source name:Brain tissue|tissue:Brain|treatment:No toxication|geo loc name:missing|collection date:missing Cont1 Raw data raw reads of FASTQ format were firstly processed through in house scripts. In this step clean data clean reads were obtained by removing reads containing adapter and poly N sequences and reads with low quality from raw data. At the same time Q20 Q30 and GC content of the clean data were calculated. All the downstream analyses were based on the clean data with high quality.An upgraded computational pipeline CIRCexplorer2 is applied to detect circRNAs and identify alternative back splicing in back spliced circular RNAs circRNAs The expression of circRNAs is usually represented by the fragments that are mapped to the back spliced exon–exon junction sites. In addition to the raw fragment numbers normalized RNA seq fragments that are mapped to a specific back spliced exon–exon junction by total mapped fragments is used to quantitate circRNA expression. With FPM Fragments mapped to back spliced junction Per Million mapped fragments circRNAs from different samples with distinct sequencing depths can be directly compared. The input data for differential gene expression analysis is read counts from gene expression level analysis. For DESeq2 with biological replicates Differential expression analysis between two conditions/groups three biological replicates per condition was performed using DESeq2 R package. DESeq2 provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting P values were adjusted using the Benjamini and Hochberg’s approach for controlling the False Discovery Rate FDR. Genes with an adjusted P value < 0.05 found by DESeq2 were assigned as differentially expressed. A common way for searching shared functions among genes is to incorporate the biological knowledge provided by biological ontologies. Gene Ontology GO annotates genes to biological processes molecular functions and cellular components in a directed acyclic graph structure and Kyoto Encyclopedia of Genes and Genomes … Brain tissue   Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols   tissue:Brain|treatment:No toxication GSM5754462 GSM5754462: Cont1; Danio rerio; ncRNA Seq GSM5754462 r1 GSM5754462 1 Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols   ncRNA-Seq TRANSCRIPTOMIC size fractionation PAIRED ILLUMINA Illumina HiSeq 4000   SRP352585   loader:fastq load.py Cont1_1.fq.gz Cont1_2.fq.gz fastq fastq 18395362500.0 61317875.0 GSM5754462 r1 0:150 1:150 A:5379624768;C:3792463355;G:3842313235;T:5380702187;N:258955 150 150     5379624768 3792463355 3842313235 5380702187 258955 SRX13511107 SRS11405348 SRA1349262 Atatürk University Atatürk University 2 0.83439 0.83446 0.45703 0.44894 0.68828 0.68578 0.4957 0.49639 150 150 B B biological fallback assumption illumina hiseq_era unknown size_fractionation unknown bulk unknown unknown   Turkey 2021-12-27 Undetermined Undetermined Brain Nervous System

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;