RNAquarium Metadata Server
Institute Website Terms of Use Privacy Policy

run_metadata

79 rows where devstage_curation = "Undetermined" and experiment.library_strategy = "OTHER"

✎ View and edit SQL

This data as json, CSV (advanced)

tissue_curation 6

experiment.library_selection 5

devstage_curation_coarse 3

technology 2

experiment.library_layout 2

experiment.platform 1

experiment.library_strategy 1

  • OTHER · 79 ✖

experiment.library_source 1

devstage_curation 1

  • Undetermined · 79 ✖
Link rowid ▼ run.accession experiment.accession sample.accession study.accession bioproject study.title study.alias study.type study.abstract study.attributes study.PMIDs sample.description sample.title sample.alias sample.centername sample.attributes GEOsample.title GEOsample.dataprocessing GEOsample.source GEOsample.treatmentprotocol GEOsample.extractprotocol GEOsample.growthprotocol GEOsample.characteristics GEOsample.accession experiment.title experiment.alias experiment.library_name experiment.design_description experiment.library_construction_protocol experiment.attributes experiment.library_strategy experiment.library_source experiment.library_selection experiment.library_layout experiment.platform experiment.instrument_model experiment.spot_descriptor experiment.study_ref run.title run.attributes run.filename run.semantic_name run.total_bases run.total_spots run.alias run.read_lengths run.base_counts run.r1_length run.r2_length run.r3_length run.r4_length run.Acount run.Ccount run.Gcount run.Tcount run.Ncount run.experiment run.pool_member submission.accession submission.srasource submission.bioprojectsource seqdetective.n_mates seqdetective.mapping_rate.mate1 seqdetective.mapping_rate.mate2 seqdetective.nofeature_rate.mate1 seqdetective.nofeature_rate.mate2 seqdetective.sparsity.mate1 seqdetective.sparsity.mate2 seqdetective.pos_strand_rate.mate1 seqdetective.pos_strand_rate.mate2 seqdetective.readlen.mate1 seqdetective.readlen.mate2 seqdetective.judgement.mate1 seqdetective.judgement.mate2 seqdetective.judgement.reason platform_family instrument_generation read_bias selection_class prep_kit sc_or_bulk tech_class technology tech_variant submission.bioprojectsource.country earliest_date devstage_curation devstage_curation_coarse tissue_curation tissue_curation_coarse
29215 29215 SRR27489731 SRX23160978 SRS20111136 SRP483112 PRJNA1056276 five prime UTR MPRA during early zebrafish embryogenesis PRJNA1056276 Other The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter.     RNA product control RNA library RNA mMessage MPRA library   strain:not applicable|age:not applicable|dev stage:not applicable|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:not applicable|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:not applicable|growth protocol:not applicable|sample type:IVT mRNA|sample number:50|replicate:unique sample|BioSampleModel:Model organism or animal                 control RNA library Library 50 Library 50 PCR product was amplified from DNA plasmid pool with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing.     OTHER TRANSCRIPTOMIC RT-PCR PAIRED ILLUMINA Illumina NovaSeq 6000   SRP483112     BSSE_QGF_206685_HGWLYDSX3_3_RNA_mMessage_MPRA_library_test_GGTTATAA_GATATCGA_S50_L003_R1_001_MM_1.fastq.gz BSSE_QGF_206685_HGWLYDSX3_3_RNA_mMessage_MPRA_library_test_GGTTATAA_GATATCGA_S50_L003_R2_001_MM_1.fastq.gz fastq fastq 16695252486.0 55282293.0 BSSE QGF 206685 HGWLYDSX3 3 RNA mMessage MPRA library test GGTTATAA GATATCGA S50 L003 R1 001 MM 1.fastq.gz 0:151 1:151 A:4275447149;C:4413405571;G:3936523108;T:4069049357;N:827301 151 151     4275447149 4413405571 3936523108 4069049357 827301 SRX23160978 SRS20111136 SRA1775336 University of Basel|Biozentrum Basel University of Basel 2 0.02176 0.00021 0.00058 2e-05 0.99056 0.99933 0.41475 0.48571 151 151 T T mates < 9% mapping rate illumina novaseq_era 5prime other unknown bulk unknown unknown   Switzerland 2024-01-11 Undetermined Embryo Undetermined Embryo Imprecise
29745 29745 SRR27467678 SRX23139228 SRS20090268 SRP482074 PRJNA1061456 tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development PRJNA1061456 Other           eggs mock R2   strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:activated eggs|collection date:2022|geo loc name:Austria|sex:mixed|tissue:activated eggs|treatment:mock|BioSampleModel:Model organism or animal                 tRAM seq of zebrafish: eggs mock rep2 EV04001 EV04001 RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.     OTHER TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP482074     EV04001.R1.fastq.gz fastq 970037880.0 6928842.0 EV04001.R1.fastq.gz 0:140 A:258735538;C:237798398;G:268588390;T:204871983;N:43571 140       258735538 237798398 268588390 204871983 43571 SRX23139228 SRS20090268 SRA1781872 Medical University of Vienna|Cell and Developmental Biology Medical University of Vienna 1 0.0   0.0   1.0       140   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation nebnext bulk unknown unknown   Austria 2024-01-09 Undetermined Embryo Undetermined Embryo Imprecise
29761 29761 SRR27437481 SRX23109816 SRS20064569 SRP482074 PRJNA1061456 tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development PRJNA1061456 Other           eggs BS R3   strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:activated eggs|collection date:2022|geo loc name:Austria|sex:mixed|tissue:activated eggs|treatment:BS|BioSampleModel:Model organism or animal                 tRAM seq of zebrafish: eggs BS rep3 EV07003 EV07003 RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.     OTHER TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP482074     EV07003.R1.fastq.gz fastq 688960160.0 4921144.0 EV07003.R1.fastq.gz 0:140 A:187831021;C:119362814;G:195214528;T:186533242;N:18555 140       187831021 119362814 195214528 186533242 18555 SRX23109816 SRS20064569 SRA1780298 Medical University of Vienna|Cell and Developmental Biology Medical University of Vienna 1 0.0   0.0   1.0       140   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation nebnext bulk unknown unknown   Austria 2024-01-06 Undetermined Embryo Undetermined Embryo Imprecise
29762 29762 SRR27437482 SRX23109815 SRS20064568 SRP482074 PRJNA1061456 tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development PRJNA1061456 Other           eggs DM R3   strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:activated eggs|collection date:2022|geo loc name:Austria|sex:mixed|tissue:activated eggs|treatment:DM|BioSampleModel:Model organism or animal                 tRAM seq of zebrafish: eggs DM rep3 EV07002 EV07002 RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.     OTHER TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP482074     EV07002.R1.fastq.gz fastq 520725380.0 3719467.0 EV07002.R1.fastq.gz 0:140 A:138972126;C:125739732;G:142785467;T:113214166;N:13889 140       138972126 125739732 142785467 113214166 13889 SRX23109815 SRS20064568 SRA1780298 Medical University of Vienna|Cell and Developmental Biology Medical University of Vienna 1 0.00014   1e-05   0.99969   0.5   140   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation nebnext bulk unknown unknown   Austria 2024-01-06 Undetermined Embryo Undetermined Embryo Imprecise
29763 29763 SRR27437483 SRX23109814 SRS20064570 SRP482074 PRJNA1061456 tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development PRJNA1061456 Other           eggs mock R3   strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:activated eggs|collection date:2022|geo loc name:Austria|sex:mixed|tissue:activated eggs|treatment:mock|BioSampleModel:Model organism or animal                 tRAM seq of zebrafish: eggs mock rep3 EV07001 EV07001 RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.     OTHER TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP482074     EV07001.R1.fastq.gz fastq 684538960.0 4889564.0 EV07001.R1.fastq.gz 0:140 A:178906891;C:169237174;G:192342342;T:144034095;N:18458 140       178906891 169237174 192342342 144034095 18458 SRX23109814 SRS20064570 SRA1780298 Medical University of Vienna|Cell and Developmental Biology Medical University of Vienna 1 0.0001   1e-05   0.99977   0.76923   140   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation nebnext bulk unknown unknown   Austria 2024-01-06 Undetermined Embryo Undetermined Embryo Imprecise
29782 29782 SRR27435867 SRX23108229 SRS20063067 SRP482074 PRJNA1061456 tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development PRJNA1061456 Other           eggs BS R4   strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:activated eggs|collection date:2022|geo loc name:Austria|sex:mixed|tissue:activated eggs|treatment:BS|BioSampleModel:Model organism or animal                 tRAM seq of zebrafish: eggs BS rep4 EV08006 EV08006 RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.     OTHER TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP482074     EV08006.R1.fastq.gz fastq 501745580.0 3583897.0 EV08006.R1.fastq.gz 0:140 A:124242793;C:76040623;G:131428076;T:170000220;N:33868 140       124242793 76040623 131428076 170000220 33868 SRX23108229 SRS20063067 SRA1780265 Medical University of Vienna|Cell and Developmental Biology Medical University of Vienna 1 4e-05   0.0   0.99993   0.66666   140   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation nebnext bulk unknown unknown   Austria 2024-01-05 Undetermined Embryo Undetermined Embryo Imprecise
29783 29783 SRR27435868 SRX23108228 SRS20063063 SRP482074 PRJNA1061456 tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development PRJNA1061456 Other           eggs DM R4   strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:activated eggs|collection date:2022|geo loc name:Austria|sex:mixed|tissue:activated eggs|treatment:DM|BioSampleModel:Model organism or animal                 tRAM seq of zebrafish: eggs DM rep4 EV08005 EV08005 RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.     OTHER TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP482074     EV08005.R1.fastq.gz fastq 740147520.0 5286768.0 EV08005.R1.fastq.gz 0:140 A:192131338;C:198130943;G:182616631;T:167216834;N:51774 140       192131338 198130943 182616631 167216834 51774 SRX23108228 SRS20063063 SRA1780265 Medical University of Vienna|Cell and Developmental Biology Medical University of Vienna 1 0.00052   8e-05   0.99922   0.92537   140   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation nebnext bulk unknown unknown   Austria 2024-01-05 Undetermined Embryo Undetermined Embryo Imprecise
29784 29784 SRR27435869 SRX23108227 SRS20063065 SRP482074 PRJNA1061456 tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development PRJNA1061456 Other           eggs mock R4   strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:activated eggs|collection date:2022|geo loc name:Austria|sex:mixed|tissue:activated eggs|treatment:mock|BioSampleModel:Model organism or animal                 tRAM seq of zebrafish: eggs mock rep4 EV08004 EV08004 RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.     OTHER TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA NextSeq 500   SRP482074     EV08004.R1.fastq.gz fastq 761663140.0 5440451.0 EV08004.R1.fastq.gz 0:140 A:194684966;C:192212418;G:196372829;T:178340184;N:52743 140       194684966 192212418 196372829 178340184 52743 SRX23108227 SRS20063065 SRA1780265 Medical University of Vienna|Cell and Developmental Biology Medical University of Vienna 1 0.00151   0.00037   0.99884   0.82352   140   T   under 1.2% mapping rate illumina nextseq unknown size_fractionation nebnext bulk unknown unknown   Austria 2024-01-05 Undetermined Embryo Undetermined Embryo Imprecise
32858 32858 SRR29482326 SRX24993370 SRS21694834 SRP515140 PRJNA1126247 Specific oncogene activation of the cell of origin in mucosal melanoma [SORT seq] GSE270356 Other Mucosal melanoma MM is a deadly cancer derived from mucosal melanocytes. To test the consequences of MM genetics we develop a zebrafish model in which all melanocytes experience CCND1 expression and loss of PTEN and TP53. Surprisingly melanoma only develops from melanocytes lining internal organs analogous to the location of patient MM. We find that zebrafish MMs have a unique chromatin landscape from cutaneous melanoma. Internal melanocytes are labeled using a MM specific transcriptional enhancer. Normal zebrafish internal melanocytes share a gene expression signature with MMs. Patient and zebrafish MMs show increased migratory neural crest gene and decreased antigen presentation gene expression consistent with the increased metastatic behavior and decreased immunotherapy sensitivity of MM. Our work suggests the cell state of the originating melanocyte influences the behavior of derived melanomas. Our animal model phenotypically and transcriptionally mimics patient tumors allowing this model to be used for MM therapeutic discovery. As this is a non MAPK driven genetically engineered model of melanoma our work also has implications for the 15% of cutaneous melanoma patients who lack MAPK driving mutations. Overall design: Single cell RNA sequencing was done on internal vs. external normal adult zebrafish melanocytes using the SORT seq platform.       Internal melanocytes GSM8340241   source name:Internal melanocytes|tissue:Internal melanocytes|cell type:melanocytes|genotype:mitfa / ; roy / fish injected with mitfa:GFP|geo loc name:missing|collection date:missing Internal melanocytes BWA was used to align paired end read to danRer11. Count tables were generated using MapAndGo. Count tables were corrected using UMI to remove duplicate reads. Transcript counts were adjusted using Poissonian counting statistics to yield the number of UMIs detected per cell. Counts were imported into R using the Seurat suite version 3.0 Assembly: danRer11 Supplementary files format and content: .tsv file contains count matrix file used for data normalization and visualization using Seurat Library strategy: SORT seq Internal melanocytes   Respective tissues were mechanically dissociated digested in TrypLE for 45 min Invitrogen 12563011 40uM filtered spun down and resuspended in FACs buffer dPBS Mg+/Ca+ free with 2% FBS pen/strep. Cells were heat lysed at 65°C followed by cDNA synthesis with barcodes. All the barcoded material from one plate was pooled into one library and amplified using in vitro transcription. Following amplification library preparation was done following the CEL Seq2 protocol to prepare a cDNA library for sequencing using TruSeq small RNA primers Illumina. mitfa / ; roy / zebrafish injected with mitfa:GFP were Raised to maturity to obtain tissues tissue:Internal melanocytes|cell type:melanocytes|genotype:mitfa / ; roy / fish injected with mitfa:GFP GSM8340241 GSM8340241: Internal melanocytes; Danio rerio; OTHER GSM8340241 r1 GSM8340241 1 Respective tissues were mechanically dissociated digested in TrypLE for 45 min Invitrogen 12563011 40uM filtered spun down and resuspended in FACs buffer dPBS Mg+/Ca+ free with 2% FBS pen/strep. Cells were heat lysed at 65°C followed by cDNA synthesis with barcodes. All the barcoded material from one plate was pooled into one library and amplified using in vitro transcription. Following amplification library preparation was done following the CEL Seq2 protocol to prepare a cDNA library for sequencing using TruSeq small RNA primers Illumina.   OTHER TRANSCRIPTOMIC other PAIRED ILLUMINA NextSeq 500   SRP515140     HAR-MI-002_H5GCWBGXF_R2.fastq.gz HAR-MI-002_H5GCWBGXF_R1.fastq.gz fastq fastq 2957975418.0 34395063.0 GSM8340241 r1 0:26 1:60 A:738954503;C:560052455;G:520746060;T:1137116132;N:1106268 26 60     738954503 560052455 520746060 1137116132 1106268 SRX24993370 SRS21694834 SRA1904773 Insco Lab, Medical Oncology, Dana Farber Cancer Institute Insco Lab, Medical Oncology, Dana Farber Cancer Institute 2 0.11637 0.84116 0.10894 0.31188 0.98851 0.71526 0.6688 0.60221 26 60 T B sc-like readlen illumina nextseq unknown small_rna trueseq sc single_cell_plate celseq   United States 2024-06-20 Undetermined Adult Skin Surface Structure
32859 32859 SRR29482327 SRX24993369 SRS21694833 SRP515140 PRJNA1126247 Specific oncogene activation of the cell of origin in mucosal melanoma [SORT seq] GSE270356 Other Mucosal melanoma MM is a deadly cancer derived from mucosal melanocytes. To test the consequences of MM genetics we develop a zebrafish model in which all melanocytes experience CCND1 expression and loss of PTEN and TP53. Surprisingly melanoma only develops from melanocytes lining internal organs analogous to the location of patient MM. We find that zebrafish MMs have a unique chromatin landscape from cutaneous melanoma. Internal melanocytes are labeled using a MM specific transcriptional enhancer. Normal zebrafish internal melanocytes share a gene expression signature with MMs. Patient and zebrafish MMs show increased migratory neural crest gene and decreased antigen presentation gene expression consistent with the increased metastatic behavior and decreased immunotherapy sensitivity of MM. Our work suggests the cell state of the originating melanocyte influences the behavior of derived melanomas. Our animal model phenotypically and transcriptionally mimics patient tumors allowing this model to be used for MM therapeutic discovery. As this is a non MAPK driven genetically engineered model of melanoma our work also has implications for the 15% of cutaneous melanoma patients who lack MAPK driving mutations. Overall design: Single cell RNA sequencing was done on internal vs. external normal adult zebrafish melanocytes using the SORT seq platform.       Cutaneous melanocytes GSM8340240   source name:Cutaneous melanocytes|tissue:Cutaneous melanocytes|cell type:melanocytes|genotype:mitfa / ; roy / fish injected with mitfa:GFP|geo loc name:missing|collection date:missing Cutaneous melanocytes BWA was used to align paired end read to danRer11. Count tables were generated using MapAndGo. Count tables were corrected using UMI to remove duplicate reads. Transcript counts were adjusted using Poissonian counting statistics to yield the number of UMIs detected per cell. Counts were imported into R using the Seurat suite version 3.0 Assembly: danRer11 Supplementary files format and content: .tsv file contains count matrix file used for data normalization and visualization using Seurat Library strategy: SORT seq Cutaneous melanocytes   Respective tissues were mechanically dissociated digested in TrypLE for 45 min Invitrogen 12563011 40uM filtered spun down and resuspended in FACs buffer dPBS Mg+/Ca+ free with 2% FBS pen/strep. Cells were heat lysed at 65°C followed by cDNA synthesis with barcodes. All the barcoded material from one plate was pooled into one library and amplified using in vitro transcription. Following amplification library preparation was done following the CEL Seq2 protocol to prepare a cDNA library for sequencing using TruSeq small RNA primers Illumina. mitfa / ; roy / zebrafish injected with mitfa:GFP were Raised to maturity to obtain tissues tissue:Cutaneous melanocytes|cell type:melanocytes|genotype:mitfa / ; roy / fish injected with mitfa:GFP GSM8340240 GSM8340240: Cutaneous melanocytes; Danio rerio; OTHER GSM8340240 r1 GSM8340240 1 Respective tissues were mechanically dissociated digested in TrypLE for 45 min Invitrogen 12563011 40uM filtered spun down and resuspended in FACs buffer dPBS Mg+/Ca+ free with 2% FBS pen/strep. Cells were heat lysed at 65°C followed by cDNA synthesis with barcodes. All the barcoded material from one plate was pooled into one library and amplified using in vitro transcription. Following amplification library preparation was done following the CEL Seq2 protocol to prepare a cDNA library for sequencing using TruSeq small RNA primers Illumina.   OTHER TRANSCRIPTOMIC other PAIRED ILLUMINA NextSeq 500   SRP515140     HAR-MI-001_H5GCWBGXF_R2.fastq.gz HAR-MI-001_H5GCWBGXF_R1.fastq.gz fastq fastq 2680460212.0 31168142.0 GSM8340240 r1 0:26 1:60 A:704357434;C:519158361;G:467098420;T:988838604;N:1007393 26 60     704357434 519158361 467098420 988838604 1007393 SRX24993369 SRS21694833 SRA1904773 Insco Lab, Medical Oncology, Dana Farber Cancer Institute Insco Lab, Medical Oncology, Dana Farber Cancer Institute 2 0.11679 0.81545 0.10693 0.5033 0.9808 0.76404 0.44749 0.57623 26 60 T B sc-like readlen illumina nextseq unknown small_rna trueseq sc single_cell_plate celseq   United States 2024-06-20 Undetermined Adult Skin Surface Structure
36409 36409 SRR516560 SRX156356 SRS347213 SRP013950 PRJNA169500 Danio rerio embryonic promoterome PRJNA169500 Transcriptome Analysis Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development.   pubmed:24531765 Zebrafish wild type AB strain embryo prim20 stage D. rerio prim20 embryo D. rerio prim20 embryo                     CAGE D. rerio prim20 embryo CAGE D. rerio prim20 embryo run2 D. rerio prim20 embryo 1     OTHER TRANSCRIPTOMIC CAGE SINGLE ILLUMINA Illumina Genome Analyzer IIx <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>27</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP013950     CAGE_prim20_run1.fastq fastq 76770666.0 2843358.0 CAGE D. rerio prim20 embryo run1 0:27 A:19320047;C:17585086;G:22511175;T:17354358;N:0 27       19320047 17585086 22511175 17354358 0 SRX156356 SRS347213 SRA055273 University of Bergen ZEPROME consortium 1 0.56472   0.10044   0.77469   0.74192   27   B   usable mapping rate illumina early_illumina unknown cage unknown bulk unknown unknown   Unknown 2012-06-28 Undetermined Embryo Embryo Imprecise All anatomical structures
36410 36410 SRR516561 SRX156356 SRS347213 SRP013950 PRJNA169500 Danio rerio embryonic promoterome PRJNA169500 Transcriptome Analysis Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development.   pubmed:24531765 Zebrafish wild type AB strain embryo prim20 stage D. rerio prim20 embryo D. rerio prim20 embryo                     CAGE D. rerio prim20 embryo CAGE D. rerio prim20 embryo run2 D. rerio prim20 embryo 1     OTHER TRANSCRIPTOMIC CAGE SINGLE ILLUMINA Illumina Genome Analyzer IIx <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>27</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP013950     CAGE_prim20_run2.fastq fastq 163254906.0 6046478.0 CAGE D. rerio prim20 embryo run2 0:27 A:40211042;C:36959797;G:46866669;T:39217398;N:0 27       40211042 36959797 46866669 39217398 0 SRX156356 SRS347213 SRA055273 University of Bergen ZEPROME consortium 1 0.47475   0.06947   0.78409   0.78014   27   B   usable mapping rate illumina early_illumina unknown cage unknown bulk unknown unknown   Unknown 2013-08-31 Undetermined Embryo Embryo Imprecise All anatomical structures
36411 36411 SRR516559 SRX156355 SRS347212 SRP013950 PRJNA169500 Danio rerio embryonic promoterome PRJNA169500 Transcriptome Analysis Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development.   pubmed:24531765 Zebrafish wild type AB strain embryo prim6 stage D. rerio prim6 embryo D. rerio prim6 embryo                     CAGE D. rerio prim6 embryo CAGE D. rerio prim6 embryo D. rerio prim6 embryo 1     OTHER TRANSCRIPTOMIC CAGE SINGLE ILLUMINA Illumina Genome Analyzer IIx <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>27</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP013950     CAGE_prim6.fastq fastq 283414275.0 10496825.0 CAGE D. rerio prim6 embryo 0:27 A:70974303;C:66202040;G:80064124;T:66173808;N:0 27       70974303 66202040 80064124 66173808 0 SRX156355 SRS347212 SRA055273 University of Bergen ZEPROME consortium 1 0.53395   0.07806   0.78255   0.77575   27   B   usable mapping rate illumina early_illumina unknown cage unknown bulk unknown unknown   Unknown 2013-08-31 Undetermined Embryo Embryo Imprecise All anatomical structures
36420 36420 SRR516550 SRX156337 SRS347206 SRP013950 PRJNA169500 Danio rerio embryonic promoterome PRJNA169500 Transcriptome Analysis Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development.   pubmed:24531765 Zebrafish wild type AB strain embryo high stage D. rerio high embryo D. rerio high embryo                     CAGE D. rerio high embryo CAGE D. rerio high embryo D. rerio high embryo 1     OTHER TRANSCRIPTOMIC CAGE SINGLE ILLUMINA Illumina Genome Analyzer IIx <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>27</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP013950     CAGE_high.fastq fastq 128592846.0 4762698.0 CAGE D. rerio high embryo 0:27 A:33693838;C:27629256;G:36692263;T:30577489;N:0 27       33693838 27629256 36692263 30577489 0 SRX156337 SRS347206 SRA055273 University of Bergen ZEPROME consortium 1 0.53282   0.08323   0.80854   0.77395   27   B   usable mapping rate illumina early_illumina unknown cage unknown bulk unknown unknown   Unknown 2013-08-31 Undetermined Embryo Embryo Imprecise All anatomical structures
36423 36423 SRR516547 SRX156325 SRS347201 SRP013950 PRJNA169500 Danio rerio embryonic promoterome PRJNA169500 Transcriptome Analysis Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development.   pubmed:24531765 Zebrafish wild type AB strain fertilized egg D. rerio fertilized egg D. rerio fertilized egg                     CAGE D. rerio fertilized egg CAGE D. rerio fertilized egg D. rerio fertilized egg 1     OTHER TRANSCRIPTOMIC CAGE SINGLE ILLUMINA Illumina Genome Analyzer IIx <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>27</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP013950     CAGE_fertilized_egg.fastq fastq 160948350.0 5961050.0 CAGE D. rerio fertilized egg 0:27 A:42030009;C:34700589;G:45399755;T:38817997;N:0 27       42030009 34700589 45399755 38817997 0 SRX156325 SRS347201 SRA055273 University of Bergen ZEPROME consortium 1 0.49394   0.07554   0.81684   0.79759   27   B   usable mapping rate illumina early_illumina unknown cage unknown bulk unknown unknown   Unknown 2012-06-28 Undetermined Embryo Undetermined Embryo Imprecise
41827 41827 SRR5251446 SRX2557171 SRS1974564 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs WT miR139 B1 nicoli mutmir AG01645   strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 139|replicate:1|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs WT miR139 B1 AG01645.1 AG01645.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01645.1_R1.fastq.gz fastq 1574284140.0 20714265.0 AG01645.1 R1.fastq.gz 0:76 A:485471345;C:270854124;G:374164721;T:443766613;N:27337 76       485471345 270854124 374164721 443766613 27337 SRX2557171 SRS1974564 SRA537606 Yale University|Genetics Yale University 1 0.82142   0.14068   0.8002   0.5444   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-27 Undetermined Embryo Endothelium Cardiovascular System
41828 41828 SRR5251445 SRX2557170 SRS1974563 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs WT miR139 B2 nicoli mutmir AG01646   strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 139|replicate:2|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs WT miR139 B2 AG01646.1 AG01646.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01646.1_R1.fastq.gz fastq 1484740104.0 19536054.0 AG01646.1 R1.fastq.gz 0:76 A:453388316;C:246477203;G:365031959;T:419816346;N:26280 76       453388316 246477203 365031959 419816346 26280 SRX2557170 SRS1974563 SRA537606 Yale University|Genetics Yale University 1 0.82649   0.1897   0.79862   0.52759   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-28 Undetermined Embryo Endothelium Cardiovascular System
41829 41829 SRR5251444 SRX2557169 SRS1974562 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs WT miR139 B3 nicoli mutmir AG01647   strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 139|replicate:3|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs WT miR139 B3 AG01647.1 AG01647.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01647.1_R1.fastq.gz fastq 881298660.0 11596035.0 AG01647.1 R1.fastq.gz 0:76 A:270675838;C:160127586;G:228157662;T:222301246;N:36328 76       270675838 160127586 228157662 222301246 36328 SRX2557169 SRS1974562 SRA537606 Yale University|Genetics Yale University 1 0.76133   0.15034   0.83341   0.56596   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-28 Undetermined Embryo Endothelium Cardiovascular System
41830 41830 SRR5251443 SRX2557168 SRS1974561 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs Mut miR139 B1 nicoli mutmir AG01648   strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 139 ya302/ya302|molecule:mRNA|condition:miR 139|replicate:1|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs Mut miR139 B1 AG01648.1 AG01648.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01648.1_R1.fastq.gz fastq 637896880.0 8393380.0 AG01648.1 R1.fastq.gz 0:76 A:192829278;C:112701153;G:153321271;T:179019095;N:26083 76       192829278 112701153 153321271 179019095 26083 SRX2557168 SRS1974561 SRA537606 Yale University|Genetics Yale University 1 0.75971   0.1181   0.82171   0.56797   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-28 Undetermined Embryo Endothelium Cardiovascular System
41831 41831 SRR5251442 SRX2557167 SRS1974560 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs Mut miR139 B2 nicoli mutmir AG01649   strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 139 ya302/ya302|molecule:mRNA|condition:miR 139|replicate:2|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs Mut miR139 B2 AG01649.1 AG01649.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01649.1_R1.fastq.gz fastq 849868328.0 11182478.0 AG01649.1 R1.fastq.gz 0:76 A:258225905;C:148467172;G:205165181;T:237974100;N:35970 76       258225905 148467172 205165181 237974100 35970 SRX2557167 SRS1974560 SRA537606 Yale University|Genetics Yale University 1 0.75096   0.14506   0.81507   0.5545   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-28 Undetermined Embryo Endothelium Cardiovascular System
41832 41832 SRR5251441 SRX2557166 SRS1974559 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs Mut miR139 B3 nicoli mutmir AG01650   strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 139 ya302/ya302|molecule:mRNA|condition:miR 139|replicate:3|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs Mut miR139 B3 AG01650.1 AG01650.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01650.1_R1.fastq.gz fastq 998464668.0 13137693.0 AG01650.1 R1.fastq.gz 0:76 A:311526420;C:176545041;G:251852786;T:258497630;N:42791 76       311526420 176545041 251852786 258497630 42791 SRX2557166 SRS1974559 SRA537606 Yale University|Genetics Yale University 1 0.76479   0.11192   0.82674   0.54621   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-28 Undetermined Embryo Endothelium Cardiovascular System
41833 41833 SRR5251440 SRX2557165 SRS1974558 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs WT miR24 B1 nicoli mutmir AG01651   strain:TU/AB|age:51.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 24|replicate:1|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs WT miR24 B1 AG01651.1 AG01651.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01651.1_R1.fastq.gz fastq 570492252.0 7506477.0 AG01651.1 R1.fastq.gz 0:76 A:162512811;C:104071716;G:135730697;T:168149427;N:27601 76       162512811 104071716 135730697 168149427 27601 SRX2557165 SRS1974558 SRA537606 Yale University|Genetics Yale University 1 0.73988   0.10157   0.86647   0.54252   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-28 Undetermined Embryo Endothelium Cardiovascular System
41834 41834 SRR5251439 SRX2557164 SRS1974557 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs WT miR24 B2 nicoli mutmir AG01652   strain:TU/AB|age:51.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 24|replicate:2|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs WT miR24 B2 AG01652.1 AG01652.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01652.1_R1.fastq.gz fastq 1072886148.0 14116923.0 AG01652.1 R1.fastq.gz 0:76 A:338399596;C:192703439;G:242960887;T:298769761;N:52465 76       338399596 192703439 242960887 298769761 52465 SRX2557164 SRS1974557 SRA537606 Yale University|Genetics Yale University 1 0.76456   0.11024   0.89197   0.59214   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-28 Undetermined Embryo Endothelium Cardiovascular System
41835 41835 SRR5251438 SRX2557163 SRS1974556 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs WT miR24 B3 nicoli mutmir AG01653   strain:TU/AB|age:51.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 24|replicate:3|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs WT miR24 B3 AG01653.1 AG01653.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01653.1_R1.fastq.gz fastq 1016374144.0 13373344.0 AG01653.1 R1.fastq.gz 0:76 A:310958343;C:168702106;G:223420046;T:313241363;N:52286 76       310958343 168702106 223420046 313241363 52286 SRX2557163 SRS1974556 SRA537606 Yale University|Genetics Yale University 1 0.75735   0.12224   0.79756   0.55136   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-02-13 Undetermined Embryo Endothelium Cardiovascular System
41836 41836 SRR5251437 SRX2557162 SRS1974555 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs Mut miR24 B1 nicoli mutmir AG01654   strain:TU/AB|age:51.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 24 ya324/? ya325/? ya326/? ya327/?|molecule:mRNA|condition:miR 24|replicate:1|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs Mut miR24 B1 AG01654.1 AG01654.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01654.1_R1.fastq.gz fastq 782170112.0 10291712.0 AG01654.1 R1.fastq.gz 0:76 A:238316720;C:132163709;G:179301544;T:232350598;N:37541 76       238316720 132163709 179301544 232350598 37541 SRX2557162 SRS1974555 SRA537606 Yale University|Genetics Yale University 1 0.7683   0.10712   0.80034   0.55804   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-28 Undetermined Embryo Endothelium Cardiovascular System
41837 41837 SRR5251436 SRX2557161 SRS1974554 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs Mut miR24 B2 nicoli mutmir AG01655   strain:TU/AB|age:51.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 24 ya324/? ya325/? ya326/? ya327/?|molecule:mRNA|condition:miR 24|replicate:2|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs Mut miR24 B2 AG01655.1 AG01655.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01655.1_R1.fastq.gz fastq 1053946340.0 13867715.0 AG01655.1 R1.fastq.gz 0:76 A:318351311;C:191163031;G:240348413;T:304030367;N:53218 76       318351311 191163031 240348413 304030367 53218 SRX2557161 SRS1974554 SRA537606 Yale University|Genetics Yale University 1 0.77588   0.07983   0.83934   0.56228   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-28 Undetermined Embryo Endothelium Cardiovascular System
41838 41838 SRR5251435 SRX2557160 SRS1974553 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs Mut miR24 B3 nicoli mutmir AG01656   strain:TU/AB|age:51.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 24 ya324/? ya325/? ya326/? ya327/?|molecule:mRNA|condition:miR 24|replicate:3|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs Mut miR24 B3 AG01656.1 AG01656.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01656.1_R1.fastq.gz fastq 1182467736.0 15558786.0 AG01656.1 R1.fastq.gz 0:76 A:344465226;C:204677242;G:269228338;T:364036735;N:60195 76       344465226 204677242 269228338 364036735 60195 SRX2557160 SRS1974553 SRA537606 Yale University|Genetics Yale University 1 0.78956   0.13495   0.81517   0.56342   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-02-13 Undetermined Embryo Endothelium Cardiovascular System
41839 41839 SRR5251434 SRX2557159 SRS1974552 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs WT miR223 B1 nicoli mutmir AG01657   strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 223|replicate:1|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs WT miR223 B1 AG01657.1 AG01657.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01657.1_R1.fastq.gz fastq 536336712.0 7057062.0 AG01657.1 R1.fastq.gz 0:76 A:158301607;C:93070120;G:121382262;T:163555487;N:27236 76       158301607 93070120 121382262 163555487 27236 SRX2557159 SRS1974552 SRA537606 Yale University|Genetics Yale University 1 0.76425   0.1278   0.84222   0.55305   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-02-13 Undetermined Embryo Endothelium Cardiovascular System
41840 41840 SRR5251433 SRX2557158 SRS1974551 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs WT miR223 B2 nicoli mutmir AG01658   strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 223|replicate:2|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs WT miR223 B2 AG01658.1 AG01658.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01658.1_R1.fastq.gz fastq 798581856.0 10507656.0 AG01658.1 R1.fastq.gz 0:76 A:241352089;C:134327379;G:183394123;T:239469845;N:38420 76       241352089 134327379 183394123 239469845 38420 SRX2557158 SRS1974551 SRA537606 Yale University|Genetics Yale University 1 0.76221   0.13398   0.82459   0.55228   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-28 Undetermined Embryo Endothelium Cardiovascular System
41841 41841 SRR5251432 SRX2557157 SRS1974550 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs WT miR223 B3 nicoli mutmir AG01659   strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 223|replicate:3|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs WT miR223 B3 AG01659.1 AG01659.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01659.1_R1.fastq.gz fastq 1093998948.0 14394723.0 AG01659.1 R1.fastq.gz 0:76 A:330741822;C:186325335;G:249557623;T:327320449;N:53719 76       330741822 186325335 249557623 327320449 53719 SRX2557157 SRS1974550 SRA537606 Yale University|Genetics Yale University 1 0.77108   0.14674   0.80955   0.55819   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-28 Undetermined Embryo Endothelium Cardiovascular System
41842 41842 SRR5251431 SRX2557156 SRS1974549 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs Mut miR223 B1 nicoli mutmir AG01660   strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 223 ya304/ya304|molecule:mRNA|condition:miR 223|replicate:1|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs Mut miR223 B1 AG01660.1 AG01660.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01660.1_R1.fastq.gz fastq 849905492.0 11182967.0 AG01660.1 R1.fastq.gz 0:76 A:250953875;C:146191904;G:190040699;T:262674911;N:44103 76       250953875 146191904 190040699 262674911 44103 SRX2557156 SRS1974549 SRA537606 Yale University|Genetics Yale University 1 0.7687   0.14192   0.82842   0.5344   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-02-13 Undetermined Embryo Endothelium Cardiovascular System
41843 41843 SRR5251430 SRX2557155 SRS1974548 SRP099466 PRJNA374579 microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos PRJNA374579 Other Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.       QuantSeq mutant miRNAs Mut miR223 B2 nicoli mutmir AG01661   strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 223 ya304/ya304|molecule:mRNA|condition:miR 223|replicate:2|BioSampleModel:Model organism or animal                 QuantSeq mutant miRNAs Mut miR223 B2 AG01661.1 AG01661.1 1     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP099466     AG01661.1_R1.fastq.gz fastq 840115400.0 11054150.0 AG01661.1 R1.fastq.gz 0:76 A:257057495;C:141775085;G:188281166;T:252960590;N:41064 76       257057495 141775085 188281166 252960590 41064 SRX2557155 SRS1974548 SRA537606 Yale University|Genetics Yale University 1 0.74292   0.10759   0.83615   0.55136   76   B   usable mapping rate illumina hiseq_era unknown small_rna lexogen bulk unknown unknown   United States 2017-03-28 Undetermined Embryo Endothelium Cardiovascular System
43083 43083 SRR7264587 SRX4168710 SRS3380684 SRP114782 PRJNA397065 mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis PRJNA397065 Other RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.       Raw multiplex: DMS Seq IVT 64c B2;DMS Seq IVT 64c B1 Raw multiplex: dmsseq AG01269;dmsseq AG01270   strain:TU/AB|age:2|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:2;1|barcode:AGAG;CACA|BioSampleModel:Model organism or animal                 Raw multiplex: DMS Seq IVT 64c B2;DMS Seq IVT 64c B1 AG01269.4;AG01270.4 AG01269.4;AG01270.4 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP114782     C7MYYANXX_JBCX101_016_R1.fastq.gz fastq 3504515800.0 46112050.0 C7MYYANXX JBCX101 016 R1.fastq.gz 0:76 A:1100987855;C:897481291;G:850509260;T:655386223;N:151171 76       1100987855 897481291 850509260 655386223 151171 SRX4168710 SRS3380684 SRA715414 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.00251   0.00024   0.99334   0.49363   76   T   under 1.2% mapping rate illumina hiseq_era unknown small_rna unknown bulk unknown unknown   United States 2018-06-05 Undetermined Embryo Embryo Imprecise All anatomical structures
43084 43084 SRR7264588 SRX4168709 SRS3380684 SRP114782 PRJNA397065 mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis PRJNA397065 Other RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.       Raw multiplex: DMS Seq IVT 64c B2;DMS Seq IVT 64c B1 Raw multiplex: dmsseq AG01269;dmsseq AG01270   strain:TU/AB|age:2|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:2;1|barcode:AGAG;CACA|BioSampleModel:Model organism or animal                 Raw multiplex: DMS Seq IVT 64c B2;DMS Seq IVT 64c B1 AG01269.3;AG01270.3 AG01269.3;AG01270.3 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP114782     HVJ7NADXX_JBCX101_016_R1.fastq.gz fastq 1533760484.0 20181059.0 HVJ7NADXX JBCX101 016 R1.fastq.gz 0:76 A:486730101;C:387546602;G:372319444;T:287072948;N:91389 76       486730101 387546602 372319444 287072948 91389 SRX4168709 SRS3380684 SRA715414 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 4e-05   2e-05   0.99997   1.0   76   T   under 1.2% mapping rate illumina hiseq_era unknown small_rna unknown bulk unknown unknown   United States 2018-06-07 Undetermined Embryo Embryo Imprecise All anatomical structures
43086 43086 SRR7264590 SRX4168707 SRS3380684 SRP114782 PRJNA397065 mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis PRJNA397065 Other RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.       Raw multiplex: DMS Seq IVT 64c B2;DMS Seq IVT 64c B1 Raw multiplex: dmsseq AG01269;dmsseq AG01270   strain:TU/AB|age:2|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:2;1|barcode:AGAG;CACA|BioSampleModel:Model organism or animal                 Raw multiplex: DMS Seq IVT 64c B2;DMS Seq IVT 64c B1 AG01269.5;AG01270.5 AG01269.5;AG01270.5 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP114782     C7MWLANXX_JBCX101_016_R1.fastq.gz fastq 11187105076.0 147198751.0 C7MWLANXX JBCX101 016 R1.fastq.gz 0:76 A:3525623658;C:2869684594;G:2708534500;T:2083102664;N:159660 76       3525623658 2869684594 2708534500 2083102664 159660 SRX4168707 SRS3380684 SRA715414 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.0   0.0   1.0       76   T   under 1.2% mapping rate illumina hiseq_era unknown small_rna unknown bulk unknown unknown   United States 2018-06-07 Undetermined Embryo Embryo Imprecise All anatomical structures
43089 43089 SRR7264593 SRX4168704 SRS3380684 SRP114782 PRJNA397065 mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis PRJNA397065 Other RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.       Raw multiplex: DMS Seq IVT 64c B2;DMS Seq IVT 64c B1 Raw multiplex: dmsseq AG01269;dmsseq AG01270   strain:TU/AB|age:2|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:2;1|barcode:AGAG;CACA|BioSampleModel:Model organism or animal                 Raw multiplex: DMS Seq IVT 64c B2;DMS Seq IVT 64c B1 AG01269.2;AG01270.2 AG01269.2;AG01270.2 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP114782     HVK53ADXX_JBCX101_016_R1.fastq.gz fastq 4318423208.0 56821358.0 HVK53ADXX JBCX101 016 R1.fastq.gz 0:76 A:1370691469;C:1101595011;G:1048719303;T:796936406;N:481019 76       1370691469 1101595011 1048719303 796936406 481019 SRX4168704 SRS3380684 SRA715414 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 1e-05   0.0   0.99997   0.0   76   T   under 1.2% mapping rate illumina hiseq_era unknown small_rna unknown bulk unknown unknown   United States 2018-06-07 Undetermined Embryo Embryo Imprecise All anatomical structures
43090 43090 SRR7264594 SRX4168703 SRS3380684 SRP114782 PRJNA397065 mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis PRJNA397065 Other RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.       Raw multiplex: DMS Seq IVT 64c B2;DMS Seq IVT 64c B1 Raw multiplex: dmsseq AG01269;dmsseq AG01270   strain:TU/AB|age:2|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:2;1|barcode:AGAG;CACA|BioSampleModel:Model organism or animal                 Raw multiplex: DMS Seq IVT 64c B2;DMS Seq IVT 64c B1 AG01269.1;AG01270.1 AG01269.1;AG01270.1 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP114782     HMHGVADXX_JBCX101_016_R1.fastq.gz fastq 3247405520.0 42729020.0 HMHGVADXX JBCX101 016 R1.fastq.gz 0:76 A:1030573532;C:829398246;G:789085434;T:598013908;N:334400 76       1030573532 829398246 789085434 598013908 334400 SRX4168703 SRS3380684 SRA715414 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.0   0.0   1.0       76   T   under 1.2% mapping rate illumina hiseq_era unknown small_rna unknown bulk unknown unknown   United States 2018-06-07 Undetermined Embryo Embryo Imprecise All anatomical structures
43095 43095 SRR5893054 SRX3058791 SRS2404524 SRP114782 PRJNA397065 mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis PRJNA397065 Other RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.       miniRESA 2h pA RNA B1 miniresa AG01710   strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|molecule:RNA|selection:pA|replicate group:25|replicate:1|BioSampleModel:Model organism or animal                 miniRESA 2h pA RNA B1 AG01710.1 AG01710.1 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP114782     AG01710.1_R1.fastq.gz fastq 236178588.0 3107613.0 AG01710.1 R1.fastq.gz 0:76 A:63902747;C:43772893;G:46507615;T:81990822;N:4511 76       63902747 43772893 46507615 81990822 4511 SRX3058791 SRS2404524 SRA596275 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.92111   4e-05   0.99799   0.56316   76   B   usable mapping rate illumina hiseq_era unknown small_rna unknown bulk unknown unknown   United States 2018-06-07 Undetermined Embryo Embryo Imprecise All anatomical structures
43096 43096 SRR5893055 SRX3058790 SRS2404526 SRP114782 PRJNA397065 mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis PRJNA397065 Other RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.       miniRESA 2h pA RNA B2 miniresa AG01711   strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|molecule:RNA|selection:pA|replicate group:25|replicate:2|BioSampleModel:Model organism or animal                 miniRESA 2h pA RNA B2 AG01711.1 AG01711.1 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP114782     AG01711.1_R1.fastq.gz fastq 226089360.0 2974860.0 AG01711.1 R1.fastq.gz 0:76 A:61341697;C:41846683;G:44622362;T:78273216;N:5402 76       61341697 41846683 44622362 78273216 5402 SRX3058790 SRS2404526 SRA596275 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.91845   1e-05   0.99797   0.60522   76   B   usable mapping rate illumina hiseq_era unknown small_rna unknown bulk unknown unknown   United States 2018-06-07 Undetermined Embryo Embryo Imprecise All anatomical structures
43153 43153 SRR5893120 SRX3058725 SRS2404546 SRP114782 PRJNA397065 mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis PRJNA397065 Other RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.       DMS Seq IVT 64c B2 dmsseq AG01269   strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:2|BioSampleModel:Model organism or animal                 DMS Seq IVT 64c B2 AG01269.2 AG01269.2 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP114782     AG01269.2_R1.fastq.gz fastq 615648941.0 27257391.0 AG01269.2 R1.fastq.gz 0:22.59 1:0 A:163885634;C:143593857;G:157437520;T:150675530;N:56400 22 0     163885634 143593857 157437520 150675530 56400 SRX3058725 SRS2404546 SRA596275 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.6277   0.07639   0.78236   0.60487   20   B   usable mapping rate illumina hiseq_era unknown small_rna unknown bulk unknown unknown   United States 2018-06-07 Undetermined Embryo Embryo Imprecise All anatomical structures
43154 43154 SRR5893121 SRX3058724 SRS2404546 SRP114782 PRJNA397065 mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis PRJNA397065 Other RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.       DMS Seq IVT 64c B2 dmsseq AG01269   strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:2|BioSampleModel:Model organism or animal                 DMS Seq IVT 64c B2 AG01269.1 AG01269.1 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP114782     AG01269.1_R1.fastq.gz fastq 461341500.0 20486790.0 AG01269.1 R1.fastq.gz 0:22.52 1:0 A:122338299;C:107915972;G:118163678;T:112917569;N:5982 22 0     122338299 107915972 118163678 112917569 5982 SRX3058724 SRS2404546 SRA596275 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.62415   0.07628   0.78133   0.60032   19   B   usable mapping rate illumina hiseq_era unknown small_rna unknown bulk unknown unknown   United States 2018-06-07 Undetermined Embryo Embryo Imprecise All anatomical structures
43159 43159 SRR8782100 SRX3058719 SRS2404551 SRP114782 PRJNA397065 mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis PRJNA397065 Other RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.       miniRESA 2h pA RNA B4 miniresa AG01728   strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|molecule:RNA|selection:pA|replicate group:25|replicate:4|BioSampleModel:Model organism or animal                 miniRESA 2h pA RNA B4 AG01728.1 AG01728.1 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP114782     SRR5893126_replace_R1.fastq.gz fastq 156537732.0 2059707.0 SRR5893126 replace R1.fastq.gz 0:76 A:42070748;C:29088642;G:31333987;T:54029008;N:15347 76       42070748 29088642 31333987 54029008 15347 SRX3058719 SRS2404551 SRA596275 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.94152   0.0   0.99797   0.61884   76   B   usable mapping rate illumina hiseq_era unknown small_rna unknown bulk unknown unknown   United States 2019-03-25 Undetermined Embryo Embryo Imprecise All anatomical structures
43160 43160 SRR8782101 SRX3058718 SRS2404553 SRP114782 PRJNA397065 mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis PRJNA397065 Other RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.       miniRESA 2h pA RNA B3 miniresa AG01727   strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|molecule:RNA|selection:pA|replicate group:25|replicate:3|BioSampleModel:Model organism or animal                 miniRESA 2h pA RNA B3 AG01727.1 AG01727.1 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP114782     SRR5893127_replace_R1.fastq.gz fastq 150519748.0 1980523.0 SRR5893127 replace R1.fastq.gz 0:76 A:40089061;C:28406150;G:30480481;T:51528116;N:15940 76       40089061 28406150 30480481 51528116 15940 SRX3058718 SRS2404553 SRA596275 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.94224   1e-05   0.99793   0.60622   76   B   usable mapping rate illumina hiseq_era unknown small_rna unknown bulk unknown unknown   United States 2019-03-25 Undetermined Embryo Embryo Imprecise All anatomical structures
43162 43162 SRR8782104 SRX3058716 SRS2404554 SRP114782 PRJNA397065 mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis PRJNA397065 Other RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.       miniRESA 2h pA RNA B5 miniresa AG01729   strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|molecule:RNA|selection:pA|replicate group:25|replicate:5|BioSampleModel:Model organism or animal                 miniRESA 2h pA RNA B5 AG01729.1 AG01729.1 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP114782     SRR5893129_replace_R1.fastq.gz fastq 164152628.0 2159903.0 SRR5893129 replace R1.fastq.gz 0:76 A:44289887;C:30688789;G:32985693;T:56172026;N:16233 76       44289887 30688789 32985693 56172026 16233 SRX3058716 SRS2404554 SRA596275 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.9284   1e-05   0.9976   0.61504   76   B   usable mapping rate illumina hiseq_era unknown small_rna unknown bulk unknown unknown   United States 2019-03-25 Undetermined Embryo Embryo Imprecise All anatomical structures
43164 43164 SRR5893131 SRX3058714 SRS2404556 SRP114782 PRJNA397065 mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis PRJNA397065 Other RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.       DMS Seq IVT 64c B1 dmsseq AG01270   strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:1|BioSampleModel:Model organism or animal                 DMS Seq IVT 64c B1 AG01270.4 AG01270.4 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP114782     AG01270.4_R1.fastq.gz fastq 369232203.0 16423574.0 AG01270.4 R1.fastq.gz 0:22.48 1:0 A:96909706;C:86935520;G:96347195;T:89039251;N:531 22 0     96909706 86935520 96347195 89039251 531 SRX3058714 SRS2404556 SRA596275 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.61992   0.07599   0.78701   0.61408   22   B   usable mapping rate illumina hiseq_era unknown small_rna unknown bulk unknown unknown   United States 2018-06-07 Undetermined Embryo Embryo Imprecise All anatomical structures
43165 43165 SRR5893132 SRX3058713 SRS2404556 SRP114782 PRJNA397065 mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis PRJNA397065 Other RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.       DMS Seq IVT 64c B1 dmsseq AG01270   strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:1|BioSampleModel:Model organism or animal                 DMS Seq IVT 64c B1 AG01270.5 AG01270.5 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP114782     AG01270.5_R1.fastq.gz fastq 1209837988.0 53770802.0 AG01270.5 R1.fastq.gz 0:22.50 1:0 A:315203598;C:286991445;G:317405494;T:290233476;N:3975 22 0     315203598 286991445 317405494 290233476 3975 SRX3058713 SRS2404556 SRA596275 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.628   0.07601   0.78675   0.61598   27   B   usable mapping rate illumina hiseq_era unknown small_rna unknown bulk unknown unknown   United States 2018-06-07 Undetermined Embryo Embryo Imprecise All anatomical structures
43166 43166 SRR5893133 SRX3058712 SRS2404556 SRP114782 PRJNA397065 mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis PRJNA397065 Other RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.       DMS Seq IVT 64c B1 dmsseq AG01270   strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:1|BioSampleModel:Model organism or animal                 DMS Seq IVT 64c B1 AG01270.2 AG01270.2 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP114782     AG01270.2_R1.fastq.gz fastq 475556869.0 21124005.0 AG01270.2 R1.fastq.gz 0:22.51 1:0 A:125248500;C:112069047;G:123791782;T:114403721;N:43819 22 0     125248500 112069047 123791782 114403721 43819 SRX3058712 SRS2404556 SRA596275 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.62492   0.07783   0.78451   0.5998   22   B   usable mapping rate illumina hiseq_era unknown small_rna unknown bulk unknown unknown   United States 2018-06-07 Undetermined Embryo Embryo Imprecise All anatomical structures
43167 43167 SRR5893134 SRX3058711 SRS2404556 SRP114782 PRJNA397065 mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis PRJNA397065 Other RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.       DMS Seq IVT 64c B1 dmsseq AG01270   strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:1|BioSampleModel:Model organism or animal                 DMS Seq IVT 64c B1 AG01270.3 AG01270.3 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP114782     AG01270.3_R1.fastq.gz fastq 161875687.0 7179709.0 AG01270.3 R1.fastq.gz 0:22.55 1:0 A:42971355;C:37785152;G:42094982;T:39023778;N:420 22 0     42971355 37785152 42094982 39023778 420 SRX3058711 SRS2404556 SRA596275 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.62849   0.07622   0.78307   0.60361   27   B   usable mapping rate illumina hiseq_era unknown small_rna unknown bulk unknown unknown   United States 2018-06-07 Undetermined Embryo Embryo Imprecise All anatomical structures
43168 43168 SRR5893135 SRX3058710 SRS2404546 SRP114782 PRJNA397065 mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis PRJNA397065 Other RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.       DMS Seq IVT 64c B2 dmsseq AG01269   strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:2|BioSampleModel:Model organism or animal                 DMS Seq IVT 64c B2 AG01269.5 AG01269.5 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP114782     AG01269.5_R1.fastq.gz fastq 1563607961.0 69286414.0 AG01269.5 R1.fastq.gz 0:22.57 1:0 A:411693836;C:367369547;G:402702896;T:381836642;N:5040 22 0     411693836 367369547 402702896 381836642 5040 SRX3058710 SRS2404546 SRA596275 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.62646   0.07519   0.78332   0.60197   26   B   usable mapping rate illumina hiseq_era unknown small_rna unknown bulk unknown unknown   United States 2018-06-07 Undetermined Embryo Embryo Imprecise All anatomical structures
43169 43169 SRR5893136 SRX3058709 SRS2404556 SRP114782 PRJNA397065 mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis PRJNA397065 Other RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.       DMS Seq IVT 64c B1 dmsseq AG01270   strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:1|BioSampleModel:Model organism or animal                 DMS Seq IVT 64c B1 AG01270.1 AG01270.1 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP114782     AG01270.1_R1.fastq.gz fastq 355558938.0 15838601.0 AG01270.1 R1.fastq.gz 0:22.45 1:0 A:93238299;C:84024450;G:92763663;T:85527926;N:4600 22 0     93238299 84024450 92763663 85527926 4600 SRX3058709 SRS2404556 SRA596275 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.62041   0.07796   0.78526   0.60168   15   B   usable mapping rate illumina hiseq_era unknown small_rna unknown bulk unknown unknown   United States 2018-06-07 Undetermined Embryo Embryo Imprecise All anatomical structures
43170 43170 SRR5893137 SRX3058708 SRS2404546 SRP114782 PRJNA397065 mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis PRJNA397065 Other RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.       DMS Seq IVT 64c B2 dmsseq AG01269   strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:2|BioSampleModel:Model organism or animal                 DMS Seq IVT 64c B2 AG01269.3 AG01269.3 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP114782     AG01269.3_R1.fastq.gz fastq 212697329.0 9397171.0 AG01269.3 R1.fastq.gz 0:22.63 1:0 A:57025177;C:49118963;G:54415396;T:52137277;N:516 22 0     57025177 49118963 54415396 52137277 516 SRX3058708 SRS2404546 SRA596275 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.63192   0.07668   0.77983   0.6006   20   B   usable mapping rate illumina hiseq_era unknown small_rna unknown bulk unknown unknown   United States 2018-06-07 Undetermined Embryo Embryo Imprecise All anatomical structures
43171 43171 SRR5893138 SRX3058707 SRS2404546 SRP114782 PRJNA397065 mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis PRJNA397065 Other RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.       DMS Seq IVT 64c B2 dmsseq AG01269   strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:2|BioSampleModel:Model organism or animal                 DMS Seq IVT 64c B2 AG01269.4 AG01269.4 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP114782     AG01269.4_R1.fastq.gz fastq 474396378.0 21071500.0 AG01269.4 R1.fastq.gz 0:22.51 1:0 A:125988009;C:110649678;G:121336327;T:116421641;N:723 22 0     125988009 110649678 121336327 116421641 723 SRX3058707 SRS2404546 SRA596275 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.6211   0.07454   0.78612   0.60194   21   B   usable mapping rate illumina hiseq_era unknown small_rna unknown bulk unknown unknown   United States 2018-06-07 Undetermined Embryo Embryo Imprecise All anatomical structures
44015 44015 SRR6211474 SRX3320751 SRS2626325 SRP121343 PRJNA415636 Simultaneous lineage tracing and cell type identification using CRISPR/Cas9 induced genetic scars GSE106121 Other A key goal of developmental biology is to understand how a single cell transforms into a full grown organism consisting of many different cell types. Single cell RNA sequencing scRNA seq has become a widely used method due to its ability to identify all cell types in a tissue or organ in a systematic manner. However a major challenge is to organize the resulting taxonomy of cell types into lineage trees revealing the developmental origin of cells. Here we present a strategy for simultaneous lineage tracing and transcriptome profiling in thousands of single cells. By combining scRNA seq with computational analysis of lineage barcodes generated by genome editing of transgenic reporter genes we reconstruct developmental lineage trees in zebrafish larvae and adult fish. In future analyses LINNAEUS LINeage tracing by Nuclease Activated Editing of Ubiquitous Sequences can be used as a systematic approach for identifying the lineage origin of novel cell types or of known cell types under different conditions. Overall design: Combining scRNA seq with computational analysis of lineage barcodes generated by genome editing of transgenic reporter genes.   pubmed:29644996   Time course 10h24h mRNA GSM2830047   source name:Full organism|strain/background:Zebrabow M|tissue:Whole body|developmental stage:Embryo|time point:10h 24h Time course 10h24h mRNA Library strategy: Targeted amplification Embryos were injected with Cas9 and sgRNA at the 1 cell stage. post 1 2 3 4 6 8 10 and 24 hours 2 3 embryos were collected and RNA and/or DNA were extracted using TRIzol Reagent according to the manufacturer’s protocols. Bulk scar libraries were produced similarly to the bulk libraries for the scar probabilities. For each sample we calculated the percentage of unscarred RFP. We fit a negative exponential to this data assuming that the fraction of unscarred RFP at t=0 was one. Genome build: N/A Supplementary files format and content: List of scar sequences with CIGAR and cell barcode. Full organism   Trizol extraction of RNA. CEL seq   strain/background:Zebrabow M|tissue:Whole body|developmental stage:Embryo|time point:10h 24h GSM2830047 GSM2830047: Time course 10h24h mRNA; Danio rerio; OTHER GSM2830047   1 Trizol extraction of RNA. CEL seq GEO Accession:GSM2830047 OTHER TRANSCRIPTOMIC other PAIRED ILLUMINA NextSeq 500   SRP121343     dyn_RNA_10h24h_S13_R2_001.fastq.gz dyn_RNA_10h24h_S13_R1_001.fastq.gz fastq fastq 1456176300.0 9707842.0 GSM2830047 r1 0:100 1:50 A:216943159;C:398650961;G:516656316;T:323899428;N:26436 100 50     216943159 398650961 516656316 323899428 26436 SRX3320751 SRS2626325 SRA623333 GEO Max Delbrück Center 2 3e-05 0.00111 0.0 0.0011 0.99995 1.0 0.75   100 50 T T mates < 9% mapping rate illumina nextseq unknown other unknown sc single_cell_plate celseq   Germany 2017-10-24 Undetermined Embryo Trunk Surface Structure
44016 44016 SRR6211473 SRX3320750 SRS2626324 SRP121343 PRJNA415636 Simultaneous lineage tracing and cell type identification using CRISPR/Cas9 induced genetic scars GSE106121 Other A key goal of developmental biology is to understand how a single cell transforms into a full grown organism consisting of many different cell types. Single cell RNA sequencing scRNA seq has become a widely used method due to its ability to identify all cell types in a tissue or organ in a systematic manner. However a major challenge is to organize the resulting taxonomy of cell types into lineage trees revealing the developmental origin of cells. Here we present a strategy for simultaneous lineage tracing and transcriptome profiling in thousands of single cells. By combining scRNA seq with computational analysis of lineage barcodes generated by genome editing of transgenic reporter genes we reconstruct developmental lineage trees in zebrafish larvae and adult fish. In future analyses LINNAEUS LINeage tracing by Nuclease Activated Editing of Ubiquitous Sequences can be used as a systematic approach for identifying the lineage origin of novel cell types or of known cell types under different conditions. Overall design: Combining scRNA seq with computational analysis of lineage barcodes generated by genome editing of transgenic reporter genes.   pubmed:29644996   Time course 3h6h8h mRNA GSM2830046   source name:Full organism|strain/background:Zebrabow M|tissue:Whole body|developmental stage:Embryo|time point:3h 6h 8h Time course 3h6h8h mRNA Library strategy: Targeted amplification Embryos were injected with Cas9 and sgRNA at the 1 cell stage. post 1 2 3 4 6 8 10 and 24 hours 2 3 embryos were collected and RNA and/or DNA were extracted using TRIzol Reagent according to the manufacturer’s protocols. Bulk scar libraries were produced similarly to the bulk libraries for the scar probabilities. For each sample we calculated the percentage of unscarred RFP. We fit a negative exponential to this data assuming that the fraction of unscarred RFP at t=0 was one. Genome build: N/A Supplementary files format and content: List of scar sequences with CIGAR and cell barcode. Full organism   Trizol extraction of RNA. CEL seq   strain/background:Zebrabow M|tissue:Whole body|developmental stage:Embryo|time point:3h 6h 8h GSM2830046 GSM2830046: Time course 3h6h8h mRNA; Danio rerio; OTHER GSM2830046   1 Trizol extraction of RNA. CEL seq GEO Accession:GSM2830046 OTHER TRANSCRIPTOMIC other PAIRED ILLUMINA NextSeq 500   SRP121343     dyn_RNA_3h6h8h_S12_R1_001.fastq.gz dyn_RNA_3h6h8h_S12_R2_001.fastq.gz fastq fastq 1382400000.0 9216000.0 GSM2830046 r1 0:100 1:50 A:219040774;C:378529638;G:475287684;T:309516830;N:25074 100 50     219040774 378529638 475287684 309516830 25074 SRX3320750 SRS2626324 SRA623333 GEO Max Delbrück Center 2 5e-05 0.00116 0.0 0.00115 0.99987 1.0 0.5   100 50 T T mates < 9% mapping rate illumina nextseq unknown other unknown sc single_cell_plate celseq   Germany 2017-10-24 Undetermined Embryo Trunk Surface Structure
51336 51336 SRR8784147 SRX5574144 SRS4536704 SRP189389 PRJNA528980 Genome wide analysis of three prime UTR sequence elements and proteins regulating mRNA stability during maternal to zygotic transition in zebrafish: RESA PRJNA528980 Other Post transcriptional regulation plays a crucial role in shaping gene expression. During the Maternal to Zygotic Transition MZT thousands of maternal transcripts are regulated however how different cis elements and trans factors are integrated to determine mRNA stability is still poorly understood. Here we show that most transcripts are under combinatorial regulation by multiple decay pathways during zebrafish MZT. Using a massively parallel reporter assay we identified cis regulatory sequences in the three prime UTR including poly U motifs that are associated with mRNA stability. In contrast miR 430 target sequences UAUUUAUU AU rich elements ARE CCUC and CUGC elements emerged as destabilizing motifs with miR 430 and AREs causing mRNA deadenylation upon genome activation. We identified trans factors by profiling RNA protein interactions and found that poly U binding proteins are preferentially associated with three prime UTR sequences and stabilizing motifs. We demonstrate that this activity is antagonized by poly C motifs and correlated with protein binding. Finally we integrated these regulatory motifs into a machine learning model that predicts reporter mRNA stability in vivo.This is the RESA libraries part of the study.       RESA WT TinyLNA430 6h DL B2 RESA WT TinyLNA430 6h DL B2 AGN000468   strain:TU/AB|age:6|sex:pooled male and female|tissue:embryo|treatment:transcriptome 6h aAm AGN000129 injection tinyLNA miR 430|molecule:RNA|sample ref:AGS000445|replicate ref:AGN000468|replicate order:2|BioSampleModel:Model organism or animal                 RESA WT TinyLNA430 6h DL B2 AGR000602 AGR000602 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP189389     AGR000602_R1.fastq.gz fastq 2627525732.0 34572707.0 AGR000602 R1.fastq.gz 0:76 A:750015324;C:666424084;G:623763820;T:586999539;N:322965 76       750015324 666424084 623763820 586999539 322965 SRX5574144 SRS4536704 SRA865803 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.87853   0.06924   0.78255   0.55641   76   B   usable mapping rate illumina hiseq_era unknown unknown unknown bulk unknown unknown   United States 2019-05-31 Undetermined Embryo Embryo Imprecise All anatomical structures
51337 51337 SRR8784148 SRX5574143 SRS4536697 SRP189389 PRJNA528980 Genome wide analysis of three prime UTR sequence elements and proteins regulating mRNA stability during maternal to zygotic transition in zebrafish: RESA PRJNA528980 Other Post transcriptional regulation plays a crucial role in shaping gene expression. During the Maternal to Zygotic Transition MZT thousands of maternal transcripts are regulated however how different cis elements and trans factors are integrated to determine mRNA stability is still poorly understood. Here we show that most transcripts are under combinatorial regulation by multiple decay pathways during zebrafish MZT. Using a massively parallel reporter assay we identified cis regulatory sequences in the three prime UTR including poly U motifs that are associated with mRNA stability. In contrast miR 430 target sequences UAUUUAUU AU rich elements ARE CCUC and CUGC elements emerged as destabilizing motifs with miR 430 and AREs causing mRNA deadenylation upon genome activation. We identified trans factors by profiling RNA protein interactions and found that poly U binding proteins are preferentially associated with three prime UTR sequences and stabilizing motifs. We demonstrate that this activity is antagonized by poly C motifs and correlated with protein binding. Finally we integrated these regulatory motifs into a machine learning model that predicts reporter mRNA stability in vivo.This is the RESA libraries part of the study.       RESA WT TinyLNA430 6h DL B1 RESA WT TinyLNA430 6h DL B1 AGN000467   strain:TU/AB|age:6|sex:pooled male and female|tissue:embryo|treatment:transcriptome 6h aAm AGN000129 injection tinyLNA miR 430|molecule:RNA|sample ref:AGS000445|replicate ref:AGN000467|replicate order:1|BioSampleModel:Model organism or animal                 RESA WT TinyLNA430 6h DL B1 AGR000601 AGR000601 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP189389     AGR000601_R1.fastq.gz fastq 3663991464.0 48210414.0 AGR000601 R1.fastq.gz 0:76 A:1047383844;C:920761577;G:959252939;T:736380253;N:212851 76       1047383844 920761577 959252939 736380253 212851 SRX5574143 SRS4536697 SRA865803 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.00056   0.00017   0.99868   0.34782   76   T   under 1.2% mapping rate illumina hiseq_era unknown unknown unknown bulk unknown unknown   United States 2019-05-31 Undetermined Embryo Embryo Imprecise All anatomical structures
51339 51339 SRR8784150 SRX5574141 SRS4536704 SRP189389 PRJNA528980 Genome wide analysis of three prime UTR sequence elements and proteins regulating mRNA stability during maternal to zygotic transition in zebrafish: RESA PRJNA528980 Other Post transcriptional regulation plays a crucial role in shaping gene expression. During the Maternal to Zygotic Transition MZT thousands of maternal transcripts are regulated however how different cis elements and trans factors are integrated to determine mRNA stability is still poorly understood. Here we show that most transcripts are under combinatorial regulation by multiple decay pathways during zebrafish MZT. Using a massively parallel reporter assay we identified cis regulatory sequences in the three prime UTR including poly U motifs that are associated with mRNA stability. In contrast miR 430 target sequences UAUUUAUU AU rich elements ARE CCUC and CUGC elements emerged as destabilizing motifs with miR 430 and AREs causing mRNA deadenylation upon genome activation. We identified trans factors by profiling RNA protein interactions and found that poly U binding proteins are preferentially associated with three prime UTR sequences and stabilizing motifs. We demonstrate that this activity is antagonized by poly C motifs and correlated with protein binding. Finally we integrated these regulatory motifs into a machine learning model that predicts reporter mRNA stability in vivo.This is the RESA libraries part of the study.       RESA WT TinyLNA430 6h DL B2 RESA WT TinyLNA430 6h DL B2 AGN000468   strain:TU/AB|age:6|sex:pooled male and female|tissue:embryo|treatment:transcriptome 6h aAm AGN000129 injection tinyLNA miR 430|molecule:RNA|sample ref:AGS000445|replicate ref:AGN000468|replicate order:2|BioSampleModel:Model organism or animal                 RESA WT TinyLNA430 6h DL B2 AGR000603 AGR000603 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP189389     AGR000603_R1.fastq.gz fastq 3393300668.0 44648693.0 AGR000603 R1.fastq.gz 0:76 A:969581621;C:868752008;G:809775803;T:744990313;N:200923 76       969581621 868752008 809775803 744990313 200923 SRX5574141 SRS4536704 SRA865803 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.87891   0.06856   0.78317   0.55832   76   B   usable mapping rate illumina hiseq_era unknown unknown unknown bulk unknown unknown   United States 2019-05-31 Undetermined Embryo Embryo Imprecise All anatomical structures
51354 51354 SRR8784165 SRX5574126 SRS4536688 SRP189389 PRJNA528980 Genome wide analysis of three prime UTR sequence elements and proteins regulating mRNA stability during maternal to zygotic transition in zebrafish: RESA PRJNA528980 Other Post transcriptional regulation plays a crucial role in shaping gene expression. During the Maternal to Zygotic Transition MZT thousands of maternal transcripts are regulated however how different cis elements and trans factors are integrated to determine mRNA stability is still poorly understood. Here we show that most transcripts are under combinatorial regulation by multiple decay pathways during zebrafish MZT. Using a massively parallel reporter assay we identified cis regulatory sequences in the three prime UTR including poly U motifs that are associated with mRNA stability. In contrast miR 430 target sequences UAUUUAUU AU rich elements ARE CCUC and CUGC elements emerged as destabilizing motifs with miR 430 and AREs causing mRNA deadenylation upon genome activation. We identified trans factors by profiling RNA protein interactions and found that poly U binding proteins are preferentially associated with three prime UTR sequences and stabilizing motifs. We demonstrate that this activity is antagonized by poly C motifs and correlated with protein binding. Finally we integrated these regulatory motifs into a machine learning model that predicts reporter mRNA stability in vivo.This is the RESA libraries part of the study.       RESA WT a Am 6h DL B2 RESA WT a Am 6h DL B2 AGN000466   strain:TU/AB|age:6|sex:pooled male and female|tissue:embryo|treatment:transcriptome 6h aAm AGN000129 injection alpha am|molecule:RNA|sample ref:AGS000444|replicate ref:AGN000466|replicate order:2|BioSampleModel:Model organism or animal                 RESA WT a Am 6h DL B2 AGR000599 AGR000599 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP189389     AGR000599_R1.fastq.gz fastq 598577064.0 7876014.0 AGR000599 R1.fastq.gz 0:76 A:173027792;C:152514326;G:149669126;T:123341073;N:24747 76       173027792 152514326 149669126 123341073 24747 SRX5574126 SRS4536688 SRA865803 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.00013   1e-05   0.99963   0.52631   76   T   under 1.2% mapping rate illumina hiseq_era unknown unknown unknown bulk unknown unknown   United States 2019-05-31 Undetermined Embryo Embryo Imprecise All anatomical structures
51355 51355 SRR8784166 SRX5574125 SRS4536697 SRP189389 PRJNA528980 Genome wide analysis of three prime UTR sequence elements and proteins regulating mRNA stability during maternal to zygotic transition in zebrafish: RESA PRJNA528980 Other Post transcriptional regulation plays a crucial role in shaping gene expression. During the Maternal to Zygotic Transition MZT thousands of maternal transcripts are regulated however how different cis elements and trans factors are integrated to determine mRNA stability is still poorly understood. Here we show that most transcripts are under combinatorial regulation by multiple decay pathways during zebrafish MZT. Using a massively parallel reporter assay we identified cis regulatory sequences in the three prime UTR including poly U motifs that are associated with mRNA stability. In contrast miR 430 target sequences UAUUUAUU AU rich elements ARE CCUC and CUGC elements emerged as destabilizing motifs with miR 430 and AREs causing mRNA deadenylation upon genome activation. We identified trans factors by profiling RNA protein interactions and found that poly U binding proteins are preferentially associated with three prime UTR sequences and stabilizing motifs. We demonstrate that this activity is antagonized by poly C motifs and correlated with protein binding. Finally we integrated these regulatory motifs into a machine learning model that predicts reporter mRNA stability in vivo.This is the RESA libraries part of the study.       RESA WT TinyLNA430 6h DL B1 RESA WT TinyLNA430 6h DL B1 AGN000467   strain:TU/AB|age:6|sex:pooled male and female|tissue:embryo|treatment:transcriptome 6h aAm AGN000129 injection tinyLNA miR 430|molecule:RNA|sample ref:AGS000445|replicate ref:AGN000467|replicate order:1|BioSampleModel:Model organism or animal                 RESA WT TinyLNA430 6h DL B1 AGR000600 AGR000600 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP189389     AGR000600_R1.fastq.gz fastq 2926686508.0 38509033.0 AGR000600 R1.fastq.gz 0:76 A:834684269;C:728545827;G:762223876;T:600884916;N:347620 76       834684269 728545827 762223876 600884916 347620 SRX5574125 SRS4536697 SRA865803 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.00012   1e-05   0.99969   0.6   76   T   under 1.2% mapping rate illumina hiseq_era unknown unknown unknown bulk unknown unknown   United States 2019-05-31 Undetermined Embryo Embryo Imprecise All anatomical structures
51363 51363 SRR8784174 SRX5574117 SRS4536690 SRP189389 PRJNA528980 Genome wide analysis of three prime UTR sequence elements and proteins regulating mRNA stability during maternal to zygotic transition in zebrafish: RESA PRJNA528980 Other Post transcriptional regulation plays a crucial role in shaping gene expression. During the Maternal to Zygotic Transition MZT thousands of maternal transcripts are regulated however how different cis elements and trans factors are integrated to determine mRNA stability is still poorly understood. Here we show that most transcripts are under combinatorial regulation by multiple decay pathways during zebrafish MZT. Using a massively parallel reporter assay we identified cis regulatory sequences in the three prime UTR including poly U motifs that are associated with mRNA stability. In contrast miR 430 target sequences UAUUUAUU AU rich elements ARE CCUC and CUGC elements emerged as destabilizing motifs with miR 430 and AREs causing mRNA deadenylation upon genome activation. We identified trans factors by profiling RNA protein interactions and found that poly U binding proteins are preferentially associated with three prime UTR sequences and stabilizing motifs. We demonstrate that this activity is antagonized by poly C motifs and correlated with protein binding. Finally we integrated these regulatory motifs into a machine learning model that predicts reporter mRNA stability in vivo.This is the RESA libraries part of the study.       RESA WT a Am 6h DL B1 RESA WT a Am 6h DL B1 AGN000465   strain:TU/AB|age:6|sex:pooled male and female|tissue:embryo|treatment:transcriptome 6h aAm AGN000129 injection alpha am|molecule:RNA|sample ref:AGS000444|replicate ref:AGN000465|replicate order:1|BioSampleModel:Model organism or animal                 RESA WT a Am 6h DL B1 AGR000593 AGR000593 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP189389     AGR000593_R1.fastq.gz fastq 169214000.0 2226500.0 AGR000593 R1.fastq.gz 0:76 A:48502801;C:44879333;G:42196735;T:33629068;N:6063 76       48502801 44879333 42196735 33629068 6063 SRX5574117 SRS4536690 SRA865803 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.75523   0.05708   0.79868   0.56487   76   B   usable mapping rate illumina hiseq_era unknown unknown unknown bulk unknown unknown   United States 2019-05-31 Undetermined Embryo Embryo Imprecise All anatomical structures
51364 51364 SRR8784175 SRX5574116 SRS4536690 SRP189389 PRJNA528980 Genome wide analysis of three prime UTR sequence elements and proteins regulating mRNA stability during maternal to zygotic transition in zebrafish: RESA PRJNA528980 Other Post transcriptional regulation plays a crucial role in shaping gene expression. During the Maternal to Zygotic Transition MZT thousands of maternal transcripts are regulated however how different cis elements and trans factors are integrated to determine mRNA stability is still poorly understood. Here we show that most transcripts are under combinatorial regulation by multiple decay pathways during zebrafish MZT. Using a massively parallel reporter assay we identified cis regulatory sequences in the three prime UTR including poly U motifs that are associated with mRNA stability. In contrast miR 430 target sequences UAUUUAUU AU rich elements ARE CCUC and CUGC elements emerged as destabilizing motifs with miR 430 and AREs causing mRNA deadenylation upon genome activation. We identified trans factors by profiling RNA protein interactions and found that poly U binding proteins are preferentially associated with three prime UTR sequences and stabilizing motifs. We demonstrate that this activity is antagonized by poly C motifs and correlated with protein binding. Finally we integrated these regulatory motifs into a machine learning model that predicts reporter mRNA stability in vivo.This is the RESA libraries part of the study.       RESA WT a Am 6h DL B1 RESA WT a Am 6h DL B1 AGN000465   strain:TU/AB|age:6|sex:pooled male and female|tissue:embryo|treatment:transcriptome 6h aAm AGN000129 injection alpha am|molecule:RNA|sample ref:AGS000444|replicate ref:AGN000465|replicate order:1|BioSampleModel:Model organism or animal                 RESA WT a Am 6h DL B1 AGR000594 AGR000594 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP189389     AGR000594_R1.fastq.gz fastq 2077622488.0 27337138.0 AGR000594 R1.fastq.gz 0:76 A:611435382;C:538245690;G:522186419;T:402325956;N:3429041 76       611435382 538245690 522186419 402325956 3429041 SRX5574116 SRS4536690 SRA865803 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.00012   1e-05   0.99965   0.58823   76   T   under 1.2% mapping rate illumina hiseq_era unknown unknown unknown bulk unknown unknown   United States 2019-03-25 Undetermined Embryo Embryo Imprecise All anatomical structures
51365 51365 SRR8784176 SRX5574115 SRS4536690 SRP189389 PRJNA528980 Genome wide analysis of three prime UTR sequence elements and proteins regulating mRNA stability during maternal to zygotic transition in zebrafish: RESA PRJNA528980 Other Post transcriptional regulation plays a crucial role in shaping gene expression. During the Maternal to Zygotic Transition MZT thousands of maternal transcripts are regulated however how different cis elements and trans factors are integrated to determine mRNA stability is still poorly understood. Here we show that most transcripts are under combinatorial regulation by multiple decay pathways during zebrafish MZT. Using a massively parallel reporter assay we identified cis regulatory sequences in the three prime UTR including poly U motifs that are associated with mRNA stability. In contrast miR 430 target sequences UAUUUAUU AU rich elements ARE CCUC and CUGC elements emerged as destabilizing motifs with miR 430 and AREs causing mRNA deadenylation upon genome activation. We identified trans factors by profiling RNA protein interactions and found that poly U binding proteins are preferentially associated with three prime UTR sequences and stabilizing motifs. We demonstrate that this activity is antagonized by poly C motifs and correlated with protein binding. Finally we integrated these regulatory motifs into a machine learning model that predicts reporter mRNA stability in vivo.This is the RESA libraries part of the study.       RESA WT a Am 6h DL B1 RESA WT a Am 6h DL B1 AGN000465   strain:TU/AB|age:6|sex:pooled male and female|tissue:embryo|treatment:transcriptome 6h aAm AGN000129 injection alpha am|molecule:RNA|sample ref:AGS000444|replicate ref:AGN000465|replicate order:1|BioSampleModel:Model organism or animal                 RESA WT a Am 6h DL B1 AGR000592 AGR000592 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP189389     AGR000592_R1.fastq.gz fastq 3782773916.0 49773341.0 AGR000592 R1.fastq.gz 0:76 A:1114409153;C:956769643;G:933746978;T:777498217;N:349925 76       1114409153 956769643 933746978 777498217 349925 SRX5574115 SRS4536690 SRA865803 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.88163   0.07197   0.78376   0.48999   76   B   usable mapping rate illumina hiseq_era unknown unknown unknown bulk unknown unknown   United States 2019-05-31 Undetermined Embryo Embryo Imprecise All anatomical structures
51366 51366 SRR8784177 SRX5574114 SRS4536688 SRP189389 PRJNA528980 Genome wide analysis of three prime UTR sequence elements and proteins regulating mRNA stability during maternal to zygotic transition in zebrafish: RESA PRJNA528980 Other Post transcriptional regulation plays a crucial role in shaping gene expression. During the Maternal to Zygotic Transition MZT thousands of maternal transcripts are regulated however how different cis elements and trans factors are integrated to determine mRNA stability is still poorly understood. Here we show that most transcripts are under combinatorial regulation by multiple decay pathways during zebrafish MZT. Using a massively parallel reporter assay we identified cis regulatory sequences in the three prime UTR including poly U motifs that are associated with mRNA stability. In contrast miR 430 target sequences UAUUUAUU AU rich elements ARE CCUC and CUGC elements emerged as destabilizing motifs with miR 430 and AREs causing mRNA deadenylation upon genome activation. We identified trans factors by profiling RNA protein interactions and found that poly U binding proteins are preferentially associated with three prime UTR sequences and stabilizing motifs. We demonstrate that this activity is antagonized by poly C motifs and correlated with protein binding. Finally we integrated these regulatory motifs into a machine learning model that predicts reporter mRNA stability in vivo.This is the RESA libraries part of the study.       RESA WT a Am 6h DL B2 RESA WT a Am 6h DL B2 AGN000466   strain:TU/AB|age:6|sex:pooled male and female|tissue:embryo|treatment:transcriptome 6h aAm AGN000129 injection alpha am|molecule:RNA|sample ref:AGS000444|replicate ref:AGN000466|replicate order:2|BioSampleModel:Model organism or animal                 RESA WT a Am 6h DL B2 AGR000595 AGR000595 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP189389     AGR000595_R1.fastq.gz fastq 3181198120.0 41857870.0 AGR000595 R1.fastq.gz 0:76 A:916117551;C:764906267;G:794289368;T:705583699;N:301235 76       916117551 764906267 794289368 705583699 301235 SRX5574114 SRS4536688 SRA865803 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.0001   1e-05   0.99969   0.53333   76   T   under 1.2% mapping rate illumina hiseq_era unknown unknown unknown bulk unknown unknown   United States 2019-05-31 Undetermined Embryo Embryo Imprecise All anatomical structures
51367 51367 SRR8784178 SRX5574113 SRS4536688 SRP189389 PRJNA528980 Genome wide analysis of three prime UTR sequence elements and proteins regulating mRNA stability during maternal to zygotic transition in zebrafish: RESA PRJNA528980 Other Post transcriptional regulation plays a crucial role in shaping gene expression. During the Maternal to Zygotic Transition MZT thousands of maternal transcripts are regulated however how different cis elements and trans factors are integrated to determine mRNA stability is still poorly understood. Here we show that most transcripts are under combinatorial regulation by multiple decay pathways during zebrafish MZT. Using a massively parallel reporter assay we identified cis regulatory sequences in the three prime UTR including poly U motifs that are associated with mRNA stability. In contrast miR 430 target sequences UAUUUAUU AU rich elements ARE CCUC and CUGC elements emerged as destabilizing motifs with miR 430 and AREs causing mRNA deadenylation upon genome activation. We identified trans factors by profiling RNA protein interactions and found that poly U binding proteins are preferentially associated with three prime UTR sequences and stabilizing motifs. We demonstrate that this activity is antagonized by poly C motifs and correlated with protein binding. Finally we integrated these regulatory motifs into a machine learning model that predicts reporter mRNA stability in vivo.This is the RESA libraries part of the study.       RESA WT a Am 6h DL B2 RESA WT a Am 6h DL B2 AGN000466   strain:TU/AB|age:6|sex:pooled male and female|tissue:embryo|treatment:transcriptome 6h aAm AGN000129 injection alpha am|molecule:RNA|sample ref:AGS000444|replicate ref:AGN000466|replicate order:2|BioSampleModel:Model organism or animal                 RESA WT a Am 6h DL B2 AGR000596 AGR000596 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP189389     AGR000596_R1.fastq.gz fastq 379188776.0 4989326.0 AGR000596 R1.fastq.gz 0:76 A:110241873;C:94609649;G:95730118;T:78592018;N:15118 76       110241873 94609649 95730118 78592018 15118 SRX5574113 SRS4536688 SRA865803 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.00012   0.0   0.99963   0.55555   76   T   under 1.2% mapping rate illumina hiseq_era unknown unknown unknown bulk unknown unknown   United States 2019-05-31 Undetermined Embryo Embryo Imprecise All anatomical structures
51368 51368 SRR8784179 SRX5574112 SRS4536688 SRP189389 PRJNA528980 Genome wide analysis of three prime UTR sequence elements and proteins regulating mRNA stability during maternal to zygotic transition in zebrafish: RESA PRJNA528980 Other Post transcriptional regulation plays a crucial role in shaping gene expression. During the Maternal to Zygotic Transition MZT thousands of maternal transcripts are regulated however how different cis elements and trans factors are integrated to determine mRNA stability is still poorly understood. Here we show that most transcripts are under combinatorial regulation by multiple decay pathways during zebrafish MZT. Using a massively parallel reporter assay we identified cis regulatory sequences in the three prime UTR including poly U motifs that are associated with mRNA stability. In contrast miR 430 target sequences UAUUUAUU AU rich elements ARE CCUC and CUGC elements emerged as destabilizing motifs with miR 430 and AREs causing mRNA deadenylation upon genome activation. We identified trans factors by profiling RNA protein interactions and found that poly U binding proteins are preferentially associated with three prime UTR sequences and stabilizing motifs. We demonstrate that this activity is antagonized by poly C motifs and correlated with protein binding. Finally we integrated these regulatory motifs into a machine learning model that predicts reporter mRNA stability in vivo.This is the RESA libraries part of the study.       RESA WT a Am 6h DL B2 RESA WT a Am 6h DL B2 AGN000466   strain:TU/AB|age:6|sex:pooled male and female|tissue:embryo|treatment:transcriptome 6h aAm AGN000129 injection alpha am|molecule:RNA|sample ref:AGS000444|replicate ref:AGN000466|replicate order:2|BioSampleModel:Model organism or animal                 RESA WT a Am 6h DL B2 AGR000597 AGR000597 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP189389     AGR000597_R1.fastq.gz fastq 685459276.0 9019201.0 AGR000597 R1.fastq.gz 0:76 A:197858582;C:171590312;G:173902727;T:142090788;N:16867 76       197858582 171590312 173902727 142090788 16867 SRX5574112 SRS4536688 SRA865803 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 0.00018   4e-05   0.99957   0.31818   76   T   under 1.2% mapping rate illumina hiseq_era unknown unknown unknown bulk unknown unknown   United States 2019-05-31 Undetermined Embryo Embryo Imprecise All anatomical structures
51369 51369 SRR8784180 SRX5574111 SRS4536688 SRP189389 PRJNA528980 Genome wide analysis of three prime UTR sequence elements and proteins regulating mRNA stability during maternal to zygotic transition in zebrafish: RESA PRJNA528980 Other Post transcriptional regulation plays a crucial role in shaping gene expression. During the Maternal to Zygotic Transition MZT thousands of maternal transcripts are regulated however how different cis elements and trans factors are integrated to determine mRNA stability is still poorly understood. Here we show that most transcripts are under combinatorial regulation by multiple decay pathways during zebrafish MZT. Using a massively parallel reporter assay we identified cis regulatory sequences in the three prime UTR including poly U motifs that are associated with mRNA stability. In contrast miR 430 target sequences UAUUUAUU AU rich elements ARE CCUC and CUGC elements emerged as destabilizing motifs with miR 430 and AREs causing mRNA deadenylation upon genome activation. We identified trans factors by profiling RNA protein interactions and found that poly U binding proteins are preferentially associated with three prime UTR sequences and stabilizing motifs. We demonstrate that this activity is antagonized by poly C motifs and correlated with protein binding. Finally we integrated these regulatory motifs into a machine learning model that predicts reporter mRNA stability in vivo.This is the RESA libraries part of the study.       RESA WT a Am 6h DL B2 RESA WT a Am 6h DL B2 AGN000466   strain:TU/AB|age:6|sex:pooled male and female|tissue:embryo|treatment:transcriptome 6h aAm AGN000129 injection alpha am|molecule:RNA|sample ref:AGS000444|replicate ref:AGN000466|replicate order:2|BioSampleModel:Model organism or animal                 RESA WT a Am 6h DL B2 AGR000598 AGR000598 RNA     OTHER TRANSCRIPTOMIC unspecified SINGLE ILLUMINA Illumina HiSeq 2000   SRP189389     AGR000598_R1.fastq.gz fastq 83271604.0 1095679.0 AGR000598 R1.fastq.gz 0:76 A:24099348;C:20368786;G:21051352;T:17745573;N:6545 76       24099348 20368786 21051352 17745573 6545 SRX5574111 SRS4536688 SRA865803 Yale_Giraldez|Genetics Yale_Giraldez_Group 1 8e-05   3e-05   0.99983   0.5   76   T   under 1.2% mapping rate illumina hiseq_era unknown unknown unknown bulk unknown unknown   United States 2019-05-31 Undetermined Embryo Embryo Imprecise All anatomical structures
70582 70582 SRR20001185 SRX16042033 SRS13721701 SRP385134 PRJNA856272 Synonymous codon massive reporter library in zebrafish embryos GSE207584 Transcriptome Analysis Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse human frog and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore iCodon will benefit basic biological research as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1 iCodon 2 iCodon 3 iCodon 4 and iCodon 5 from less to more stable mRNA predictions. Additionally 5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered in vitro synthetized mRNA was injected…   pubmed:35840631   zf library 8h 3 GSM6300339   source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:8h|genotype:WT|treatment:Injected zebrafish embryos zf library 8h 3 Paired end reads were merged with FLASH using default parameters reads that could not be merged were discarded. Next using Cutadapt the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then reads were separated by length read length = 297 expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then the reads that were not mapped read length = 297 nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297 insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing Zebrafish embryo 10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle injection mix and breeding. 25 embryos were collected at 2 5 and 8 hours post injection Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer’s protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.    tissue:Zebrafish embryo|time point:8h|genotype:WT|treatment:Injected zebrafish embryos GSM6300339 GSM6300339: zf library 8h 3; Danio rerio; OTHER GSM6300339 r1 GSM6300339 1 Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer's protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.   OTHER TRANSCRIPTOMIC other PAIRED ILLUMINA Illumina MiSeq   SRP385134     zf_library_8h_3_1.fastq.gz zf_library_8h_3_2.fastq.gz fastq fastq 885299088.0 1763544.0 GSM6300339 r1 0:251 1:251 A:222214043;C:219331579;G:228248922;T:215275916;N:228628 251 251     222214043 219331579 228248922 215275916 228628 SRX16042033 SRS13721701 SRA1449828 Stowers Institute for Medical Research Stowers Institute for Medical Research 2 0.0 0.0 0.0 0.0 1.0 1.0     251 251 T T mates < 9% mapping rate illumina miseq unknown poly_a unknown bulk unknown unknown   United States 2022-07-06 Undetermined Embryo Embryo Imprecise All anatomical structures
70583 70583 SRR20001186 SRX16042032 SRS13721700 SRP385134 PRJNA856272 Synonymous codon massive reporter library in zebrafish embryos GSE207584 Transcriptome Analysis Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse human frog and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore iCodon will benefit basic biological research as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1 iCodon 2 iCodon 3 iCodon 4 and iCodon 5 from less to more stable mRNA predictions. Additionally 5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered in vitro synthetized mRNA was injected…   pubmed:35840631   zf library 8h 2 GSM6300338   source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:8h|genotype:WT|treatment:Injected zebrafish embryos zf library 8h 2 Paired end reads were merged with FLASH using default parameters reads that could not be merged were discarded. Next using Cutadapt the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then reads were separated by length read length = 297 expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then the reads that were not mapped read length = 297 nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297 insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing Zebrafish embryo 10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle injection mix and breeding. 25 embryos were collected at 2 5 and 8 hours post injection Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer’s protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.    tissue:Zebrafish embryo|time point:8h|genotype:WT|treatment:Injected zebrafish embryos GSM6300338 GSM6300338: zf library 8h 2; Danio rerio; OTHER GSM6300338 r1 GSM6300338 1 Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer's protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.   OTHER TRANSCRIPTOMIC other PAIRED ILLUMINA Illumina MiSeq   SRP385134     zf_library_8h_2_1.fastq.gz zf_library_8h_2_2.fastq.gz fastq fastq 869922828.0 1732914.0 GSM6300338 r1 0:251 1:251 A:218951651;C:214394584;G:224473321;T:211879293;N:223979 251 251     218951651 214394584 224473321 211879293 223979 SRX16042032 SRS13721700 SRA1449828 Stowers Institute for Medical Research Stowers Institute for Medical Research 2 0.0 0.0 0.0 0.0 1.0 1.0     251 251 T T mates < 9% mapping rate illumina miseq unknown poly_a unknown bulk unknown unknown   United States 2022-07-06 Undetermined Embryo Embryo Imprecise All anatomical structures
70584 70584 SRR20001187 SRX16042031 SRS13721699 SRP385134 PRJNA856272 Synonymous codon massive reporter library in zebrafish embryos GSE207584 Transcriptome Analysis Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse human frog and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore iCodon will benefit basic biological research as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1 iCodon 2 iCodon 3 iCodon 4 and iCodon 5 from less to more stable mRNA predictions. Additionally 5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered in vitro synthetized mRNA was injected…   pubmed:35840631   zf library 8h 1 GSM6300337   source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:8h|genotype:WT|treatment:Injected zebrafish embryos zf library 8h 1 Paired end reads were merged with FLASH using default parameters reads that could not be merged were discarded. Next using Cutadapt the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then reads were separated by length read length = 297 expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then the reads that were not mapped read length = 297 nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297 insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing Zebrafish embryo 10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle injection mix and breeding. 25 embryos were collected at 2 5 and 8 hours post injection Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer’s protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.    tissue:Zebrafish embryo|time point:8h|genotype:WT|treatment:Injected zebrafish embryos GSM6300337 GSM6300337: zf library 8h 1; Danio rerio; OTHER GSM6300337 r1 GSM6300337 1 Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer's protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.   OTHER TRANSCRIPTOMIC other PAIRED ILLUMINA Illumina MiSeq   SRP385134     zf_library_8h_1_1.fastq.gz zf_library_8h_1_2.fastq.gz fastq fastq 895219612.0 1783306.0 GSM6300337 r1 0:251 1:251 A:224849175;C:221105420;G:230877700;T:218157114;N:230203 251 251     224849175 221105420 230877700 218157114 230203 SRX16042031 SRS13721699 SRA1449828 Stowers Institute for Medical Research Stowers Institute for Medical Research 2 0.0 0.0 0.0 0.0 1.0 1.0     251 251 T T mates < 9% mapping rate illumina miseq unknown poly_a unknown bulk unknown unknown   United States 2022-07-06 Undetermined Embryo Embryo Imprecise All anatomical structures
70585 70585 SRR20001188 SRX16042030 SRS13721698 SRP385134 PRJNA856272 Synonymous codon massive reporter library in zebrafish embryos GSE207584 Transcriptome Analysis Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse human frog and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore iCodon will benefit basic biological research as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1 iCodon 2 iCodon 3 iCodon 4 and iCodon 5 from less to more stable mRNA predictions. Additionally 5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered in vitro synthetized mRNA was injected…   pubmed:35840631   zf library 5h 3 GSM6300336   source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:5h|genotype:WT|treatment:Injected zebrafish embryos zf library 5h 3 Paired end reads were merged with FLASH using default parameters reads that could not be merged were discarded. Next using Cutadapt the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then reads were separated by length read length = 297 expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then the reads that were not mapped read length = 297 nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297 insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing Zebrafish embryo 10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle injection mix and breeding. 25 embryos were collected at 2 5 and 8 hours post injection Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer’s protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.    tissue:Zebrafish embryo|time point:5h|genotype:WT|treatment:Injected zebrafish embryos GSM6300336 GSM6300336: zf library 5h 3; Danio rerio; OTHER GSM6300336 r1 GSM6300336 1 Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer's protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.   OTHER TRANSCRIPTOMIC other PAIRED ILLUMINA Illumina MiSeq   SRP385134     zf_library_5h_3_1.fastq.gz zf_library_5h_3_2.fastq.gz fastq fastq 872893162.0 1738831.0 GSM6300336 r1 0:251 1:251 A:220087290;C:215314493;G:223004894;T:214259861;N:226624 251 251     220087290 215314493 223004894 214259861 226624 SRX16042030 SRS13721698 SRA1449828 Stowers Institute for Medical Research Stowers Institute for Medical Research 2 0.0 0.0 0.0 0.0 1.0 1.0     251 251 T T mates < 9% mapping rate illumina miseq unknown poly_a unknown bulk unknown unknown   United States 2022-07-06 Undetermined Embryo Embryo Imprecise All anatomical structures
70586 70586 SRR20001189 SRX16042029 SRS13721697 SRP385134 PRJNA856272 Synonymous codon massive reporter library in zebrafish embryos GSE207584 Transcriptome Analysis Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse human frog and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore iCodon will benefit basic biological research as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1 iCodon 2 iCodon 3 iCodon 4 and iCodon 5 from less to more stable mRNA predictions. Additionally 5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered in vitro synthetized mRNA was injected…   pubmed:35840631   zf library 5h 2 GSM6300335   source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:5h|genotype:WT|treatment:Injected zebrafish embryos zf library 5h 2 Paired end reads were merged with FLASH using default parameters reads that could not be merged were discarded. Next using Cutadapt the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then reads were separated by length read length = 297 expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then the reads that were not mapped read length = 297 nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297 insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing Zebrafish embryo 10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle injection mix and breeding. 25 embryos were collected at 2 5 and 8 hours post injection Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer’s protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.    tissue:Zebrafish embryo|time point:5h|genotype:WT|treatment:Injected zebrafish embryos GSM6300335 GSM6300335: zf library 5h 2; Danio rerio; OTHER GSM6300335 r1 GSM6300335 1 Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer's protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.   OTHER TRANSCRIPTOMIC other PAIRED ILLUMINA Illumina MiSeq   SRP385134     zf_library_5h_2_1.fastq.gz zf_library_5h_2_2.fastq.gz fastq fastq 842675272.0 1678636.0 GSM6300335 r1 0:251 1:251 A:212323691;C:207621938;G:216058999;T:206458094;N:212550 251 251     212323691 207621938 216058999 206458094 212550 SRX16042029 SRS13721697 SRA1449828 Stowers Institute for Medical Research Stowers Institute for Medical Research 2 0.0 0.0 0.0 0.0 1.0 1.0     251 251 T T mates < 9% mapping rate illumina miseq unknown poly_a unknown bulk unknown unknown   United States 2022-07-06 Undetermined Embryo Embryo Imprecise All anatomical structures
70587 70587 SRR20001190 SRX16042028 SRS13721696 SRP385134 PRJNA856272 Synonymous codon massive reporter library in zebrafish embryos GSE207584 Transcriptome Analysis Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse human frog and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore iCodon will benefit basic biological research as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1 iCodon 2 iCodon 3 iCodon 4 and iCodon 5 from less to more stable mRNA predictions. Additionally 5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered in vitro synthetized mRNA was injected…   pubmed:35840631   zf library 5h 1 GSM6300334   source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:5h|genotype:WT|treatment:Injected zebrafish embryos zf library 5h 1 Paired end reads were merged with FLASH using default parameters reads that could not be merged were discarded. Next using Cutadapt the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then reads were separated by length read length = 297 expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then the reads that were not mapped read length = 297 nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297 insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing Zebrafish embryo 10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle injection mix and breeding. 25 embryos were collected at 2 5 and 8 hours post injection Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer’s protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.    tissue:Zebrafish embryo|time point:5h|genotype:WT|treatment:Injected zebrafish embryos GSM6300334 GSM6300334: zf library 5h 1; Danio rerio; OTHER GSM6300334 r1 GSM6300334 1 Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer's protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.   OTHER TRANSCRIPTOMIC other PAIRED ILLUMINA Illumina MiSeq   SRP385134     zf_library_5h_1_1.fastq.gz zf_library_5h_1_2.fastq.gz fastq fastq 851971810.0 1697155.0 GSM6300334 r1 0:251 1:251 A:214612692;C:209910896;G:219013172;T:208215928;N:219122 251 251     214612692 209910896 219013172 208215928 219122 SRX16042028 SRS13721696 SRA1449828 Stowers Institute for Medical Research Stowers Institute for Medical Research 2 0.0 0.0 0.0 0.0 1.0 1.0     251 251 T T mates < 9% mapping rate illumina miseq unknown poly_a unknown bulk unknown unknown   United States 2022-07-06 Undetermined Embryo Embryo Imprecise All anatomical structures
70588 70588 SRR20001191 SRX16042027 SRS13721695 SRP385134 PRJNA856272 Synonymous codon massive reporter library in zebrafish embryos GSE207584 Transcriptome Analysis Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse human frog and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore iCodon will benefit basic biological research as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1 iCodon 2 iCodon 3 iCodon 4 and iCodon 5 from less to more stable mRNA predictions. Additionally 5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered in vitro synthetized mRNA was injected…   pubmed:35840631   zf library 2h 3 GSM6300333   source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:2h|genotype:WT|treatment:Injected zebrafish embryos zf library 2h 3 Paired end reads were merged with FLASH using default parameters reads that could not be merged were discarded. Next using Cutadapt the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then reads were separated by length read length = 297 expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then the reads that were not mapped read length = 297 nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297 insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing Zebrafish embryo 10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle injection mix and breeding. 25 embryos were collected at 2 5 and 8 hours post injection Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer’s protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.    tissue:Zebrafish embryo|time point:2h|genotype:WT|treatment:Injected zebrafish embryos GSM6300333 GSM6300333: zf library 2h 3; Danio rerio; OTHER GSM6300333 r1 GSM6300333 1 Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer's protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.   OTHER TRANSCRIPTOMIC other PAIRED ILLUMINA Illumina MiSeq   SRP385134     zf_library_2h_3_1.fastq.gz zf_library_2h_3_2.fastq.gz fastq fastq 1056027782.0 2103641.0 GSM6300333 r1 0:251 1:251 A:266201946;C:259901869;G:270474572;T:259174077;N:275318 251 251     266201946 259901869 270474572 259174077 275318 SRX16042027 SRS13721695 SRA1449828 Stowers Institute for Medical Research Stowers Institute for Medical Research 2 0.0 0.0 0.0 0.0 1.0 1.0     251 251 T T mates < 9% mapping rate illumina miseq unknown poly_a unknown bulk unknown unknown   United States 2022-07-06 Undetermined Embryo Embryo Imprecise All anatomical structures
70589 70589 SRR20001192 SRX16042026 SRS13721694 SRP385134 PRJNA856272 Synonymous codon massive reporter library in zebrafish embryos GSE207584 Transcriptome Analysis Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse human frog and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore iCodon will benefit basic biological research as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1 iCodon 2 iCodon 3 iCodon 4 and iCodon 5 from less to more stable mRNA predictions. Additionally 5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered in vitro synthetized mRNA was injected…   pubmed:35840631   zf library 2h 2 GSM6300332   source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:2h|genotype:WT|treatment:Injected zebrafish embryos zf library 2h 2 Paired end reads were merged with FLASH using default parameters reads that could not be merged were discarded. Next using Cutadapt the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then reads were separated by length read length = 297 expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then the reads that were not mapped read length = 297 nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297 insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing Zebrafish embryo 10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle injection mix and breeding. 25 embryos were collected at 2 5 and 8 hours post injection Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer’s protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.    tissue:Zebrafish embryo|time point:2h|genotype:WT|treatment:Injected zebrafish embryos GSM6300332 GSM6300332: zf library 2h 2; Danio rerio; OTHER GSM6300332 r1 GSM6300332 1 Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer's protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.   OTHER TRANSCRIPTOMIC other PAIRED ILLUMINA Illumina MiSeq   SRP385134     zf_library_2h_2_1.fastq.gz zf_library_2h_2_2.fastq.gz fastq fastq 947154022.0 1886761.0 GSM6300332 r1 0:251 1:251 A:238912401;C:233180719;G:242163235;T:232651663;N:246004 251 251     238912401 233180719 242163235 232651663 246004 SRX16042026 SRS13721694 SRA1449828 Stowers Institute for Medical Research Stowers Institute for Medical Research 2 1e-05 0.0 0.0 0.0 0.99997 1.0 1.0   251 251 T T mates < 9% mapping rate illumina miseq unknown poly_a unknown bulk unknown unknown   United States 2022-07-06 Undetermined Embryo Embryo Imprecise All anatomical structures
70590 70590 SRR20001193 SRX16042025 SRS13721693 SRP385134 PRJNA856272 Synonymous codon massive reporter library in zebrafish embryos GSE207584 Transcriptome Analysis Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse human frog and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore iCodon will benefit basic biological research as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1 iCodon 2 iCodon 3 iCodon 4 and iCodon 5 from less to more stable mRNA predictions. Additionally 5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered in vitro synthetized mRNA was injected…   pubmed:35840631   zf library 2h 1 GSM6300331   source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:2h|genotype:WT|treatment:Injected zebrafish embryos zf library 2h 1 Paired end reads were merged with FLASH using default parameters reads that could not be merged were discarded. Next using Cutadapt the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then reads were separated by length read length = 297 expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then the reads that were not mapped read length = 297 nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297 insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing Zebrafish embryo 10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle injection mix and breeding. 25 embryos were collected at 2 5 and 8 hours post injection Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer’s protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.    tissue:Zebrafish embryo|time point:2h|genotype:WT|treatment:Injected zebrafish embryos GSM6300331 GSM6300331: zf library 2h 1; Danio rerio; OTHER GSM6300331 r1 GSM6300331 1 Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer's protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.   OTHER TRANSCRIPTOMIC other PAIRED ILLUMINA Illumina MiSeq   SRP385134     zf_library_2h_1_1.fastq.gz zf_library_2h_1_2.fastq.gz fastq fastq 896725612.0 1786306.0 GSM6300331 r1 0:251 1:251 A:225772798;C:221066817;G:229953803;T:219699756;N:232438 251 251     225772798 221066817 229953803 219699756 232438 SRX16042025 SRS13721693 SRA1449828 Stowers Institute for Medical Research Stowers Institute for Medical Research 2 0.0 0.0 0.0 0.0 1.0 1.0     251 251 T T mates < 9% mapping rate illumina miseq unknown poly_a unknown bulk unknown unknown   United States 2022-07-06 Undetermined Embryo Embryo Imprecise All anatomical structures
71064 71064 SRR21218373 SRX17229104 SRS14795570 SRP394145 PRJNA872137 The Translation Initiation Factor Homolog eif4e1c Regulates Cardiomyocyte Metabolism and Proliferation During Heart Regeneration. GSE211793 Other The?eIF4E family of translation initiation factors bind five prime methylated caps and act as the limiting step for mRNA translation. The canonical eIF4E1A is required for cell viability yet other related families exist and are all utilized in specific contexts or tissues. Here we describe a new family called Eif4e1c that is ancestral to the canonical eIF4E1A in vertebrates and for which we find roles during heart development and regeneration in zebrafish.?The Eif4e1c family is present in all aquatic vertebrates but has been lost in all terrestrial species. A core group of amino acids shared over 500 million yrs of evolution from?ray finned fish to sharks?forms an evolutionarily conserved binding interface along the surface of the protein suggesting Eif4e1c functions in a novel pathway.? Deletion of eif4e1c?in zebrafish caused growth deficits and impaired survival in juveniles.?Mutants surviving to maturity had fewer cardiomyocytes while also showing reduced proliferative responses to cardiac injury. Ribosome profiling of mutant hearts demonstrated changes in translation efficiency of mRNA for genes known to regulate cardiomyocyte proliferation. Although?eif4e1c?is expressed in many tissues and is the predominant cap binding initiation homolog in embryos its disruption had most notable impact on the heart and at juvenile stages. ?Our findings reveal context dependent requirements for translation initiation regulators during heart regeneration. Overall design: Ribosome profiling of adult uninjured eif4e1c zebrafish mutant hearts and adult uninjured EK zebrafish wildtype hearts.   pubmed:37306388   zebrafish Ribo seq Eif4e1c / rep2 [r mR2] GSM6502516   source name:heart|tissue:heart|cell line:Mutant|genotype:Eif4e1c / zebrafish Ribo seq Eif4e1c / rep2 [r mR2] Fastq files were processed using FastQC v0.11.8; RRID:SCR 014583 for quality control QC analysis. Pre processing of sequencing reads was based on the QC report using the FASTQ Quality Filter module in the FASTX Toolkit RRID:SCR 019035. This was used to filter the bases with 99% accuracy based on Q Score. Reads were removed that showed less than 70% of nucleotides with an accuracy of at least 99%. The sequences were collapsed according to their by Unique Molecular Identifiers UMIs. Cutadapt RRID:SCR 011841 was used to trim 21 nt adaptor before the first nt and the last 4 nt from the reads to remove the UMI. The processed reads were aligned to GRCz11/danRer11 assembly of the zebrafish genome; Genome Reference Consortium using STAR v2.5.3a RRID:SCR 004463. Generated bam files were processed with RiboProfiling package v1.2.2. Coverage counts on the coding regions CDS were obtained for each sample based on RiboProfiling function modules TxDb.Drerio.UCSC.danRer11.refGene v3.4.6; Annotation package for TxDb objects; Team BC 2019 and GenomicFeatures package v1.46.1. Differential expression analysis was performed using the DESeq2 pipeline version 1.26.0 based on the expressed raw reads. Assembly: GRCz11/danRer11 Library strategy: Ribo seq heart   The hearts were lysed on ice with 100ul of lysis buffer with 53 mg/ml cycloheximide using mechanical homogenization with a pestle for thirty seconds. Cells were lysed further by trituration of the sample using a 27.5 gauge needle syringe 20x on ice. Cell extracts average OD 7 were treated with MNase NEB CaCl2 5mM final concentration and Turbo DNAse I Invitrogen at 25°C for 30 minutes. MNase digestion was stopped with SUPERase inhibitor incubation on ice. 80S ribosomes were isolated using SH400 spin columns Cytiva. Columns were prepared according to the manufacturer’s instructions. 100 µls of MNase treated sample was loaded per column and centrifuged for 2 min at 600 RCF. The flow through was isolated and incubated for 5 min. with 3x volume of Trizol LS Ambion. 200 µl of chloroform was added and incubated for 2 min. Samples were centrifuged for 15 min. at 12 000 rpm 4°C. The aqueous phase was extracted and precipitated overnight at 20°C using glycoblue ThermoFisher and isopropanol followed by centrifugation for 30 minutes at 4C at 10 000 RPM. Pellets were washed with 75% Ethanol and resuspended into RNase free water. Next Flex smRNA seq kit v3 Zebrafish used for ribosome profiling were grown together under normal conditions and were genotyped upon reaching maturity. tissue:heart|cell line:Mutant|genotype:Eif4e1c / GSM6502516 GSM6502516: zebrafish Ribo seq Eif4e1c / rep2 [r mR2]; Danio rerio; OTHER GSM6502516 r1 GSM6502516 1 The hearts were lysed on ice with 100ul of lysis buffer with 53 mg/ml cycloheximide using mechanical homogenization with a pestle for thirty seconds. Cells were lysed further by trituration of the sample using a 27.5 gauge needle syringe 20x on ice. Cell extracts average OD 7 were treated with MNase NEB CaCl2 5mM final concentration and Turbo DNAse I Invitrogen at 25°C for 30 minutes. MNase digestion was stopped with SUPERase inhibitor incubation on ice. 80S ribosomes were isolated using SH400 spin columns Cytiva. Columns were prepared according to the manufacturer's instructions. 100 µls of MNase treated sample was loaded per column and centrifuged for 2 min at 600 RCF. The flow through was isolated and incubated for 5 min. with 3x volume of Trizol LS Ambion. 200 µl of chloroform was added and incubated for 2 min. Samples were centrifuged for 15 min. at 12 000 rpm 4°C. The aqueous phase was extracted and precipitated overnight at 20°C using glycoblue ThermoFisher and isopropanol followed by centrifugation for 30 minutes at 4C at 10 000 RPM. Pellets were washed with 75% Ethanol and resuspended into RNase free water. Next Flex smRNA seq kit v3   OTHER TRANSCRIPTOMIC other SINGLE ILLUMINA NextSeq 550   SRP394145     rS4_mR2.fastq.gz fastq 6611131472.0 86988572.0 GSM6502516 r1 0:76 1:0 A:1748359123;C:1658689534;G:1706027528;T:1497702781;N:352506 76 0     1748359123 1658689534 1706027528 1497702781 352506 SRX17229104 SRS14795570 SRA1485233 Biological Chemistry and Pharmacology, The Ohio State University Biological Chemistry and Pharmacology, The Ohio State University 1 0.0   0.0   1.0       76   T   under 1.2% mapping rate illumina nextseq unknown other unknown bulk unknown unknown   United States 2022-08-22 Undetermined Multi-stage Heart Cardiovascular System
71065 71065 SRR21218374 SRX17229103 SRS14795569 SRP394145 PRJNA872137 The Translation Initiation Factor Homolog eif4e1c Regulates Cardiomyocyte Metabolism and Proliferation During Heart Regeneration. GSE211793 Other The?eIF4E family of translation initiation factors bind five prime methylated caps and act as the limiting step for mRNA translation. The canonical eIF4E1A is required for cell viability yet other related families exist and are all utilized in specific contexts or tissues. Here we describe a new family called Eif4e1c that is ancestral to the canonical eIF4E1A in vertebrates and for which we find roles during heart development and regeneration in zebrafish.?The Eif4e1c family is present in all aquatic vertebrates but has been lost in all terrestrial species. A core group of amino acids shared over 500 million yrs of evolution from?ray finned fish to sharks?forms an evolutionarily conserved binding interface along the surface of the protein suggesting Eif4e1c functions in a novel pathway.? Deletion of eif4e1c?in zebrafish caused growth deficits and impaired survival in juveniles.?Mutants surviving to maturity had fewer cardiomyocytes while also showing reduced proliferative responses to cardiac injury. Ribosome profiling of mutant hearts demonstrated changes in translation efficiency of mRNA for genes known to regulate cardiomyocyte proliferation. Although?eif4e1c?is expressed in many tissues and is the predominant cap binding initiation homolog in embryos its disruption had most notable impact on the heart and at juvenile stages. ?Our findings reveal context dependent requirements for translation initiation regulators during heart regeneration. Overall design: Ribosome profiling of adult uninjured eif4e1c zebrafish mutant hearts and adult uninjured EK zebrafish wildtype hearts.   pubmed:37306388   zebrafish Ribo seq Eif4e1c / rep 1 [r mR1] GSM6502515   source name:heart|tissue:heart|cell line:Mutant|genotype:Eif4e1c / zebrafish Ribo seq Eif4e1c / rep 1 [r mR1] Fastq files were processed using FastQC v0.11.8; RRID:SCR 014583 for quality control QC analysis. Pre processing of sequencing reads was based on the QC report using the FASTQ Quality Filter module in the FASTX Toolkit RRID:SCR 019035. This was used to filter the bases with 99% accuracy based on Q Score. Reads were removed that showed less than 70% of nucleotides with an accuracy of at least 99%. The sequences were collapsed according to their by Unique Molecular Identifiers UMIs. Cutadapt RRID:SCR 011841 was used to trim 21 nt adaptor before the first nt and the last 4 nt from the reads to remove the UMI. The processed reads were aligned to GRCz11/danRer11 assembly of the zebrafish genome; Genome Reference Consortium using STAR v2.5.3a RRID:SCR 004463. Generated bam files were processed with RiboProfiling package v1.2.2. Coverage counts on the coding regions CDS were obtained for each sample based on RiboProfiling function modules TxDb.Drerio.UCSC.danRer11.refGene v3.4.6; Annotation package for TxDb objects; Team BC 2019 and GenomicFeatures package v1.46.1. Differential expression analysis was performed using the DESeq2 pipeline version 1.26.0 based on the expressed raw reads. Assembly: GRCz11/danRer11 Library strategy: Ribo seq heart   The hearts were lysed on ice with 100ul of lysis buffer with 53 mg/ml cycloheximide using mechanical homogenization with a pestle for thirty seconds. Cells were lysed further by trituration of the sample using a 27.5 gauge needle syringe 20x on ice. Cell extracts average OD 7 were treated with MNase NEB CaCl2 5mM final concentration and Turbo DNAse I Invitrogen at 25°C for 30 minutes. MNase digestion was stopped with SUPERase inhibitor incubation on ice. 80S ribosomes were isolated using SH400 spin columns Cytiva. Columns were prepared according to the manufacturer’s instructions. 100 µls of MNase treated sample was loaded per column and centrifuged for 2 min at 600 RCF. The flow through was isolated and incubated for 5 min. with 3x volume of Trizol LS Ambion. 200 µl of chloroform was added and incubated for 2 min. Samples were centrifuged for 15 min. at 12 000 rpm 4°C. The aqueous phase was extracted and precipitated overnight at 20°C using glycoblue ThermoFisher and isopropanol followed by centrifugation for 30 minutes at 4C at 10 000 RPM. Pellets were washed with 75% Ethanol and resuspended into RNase free water. Next Flex smRNA seq kit v3 Zebrafish used for ribosome profiling were grown together under normal conditions and were genotyped upon reaching maturity. tissue:heart|cell line:Mutant|genotype:Eif4e1c / GSM6502515 GSM6502515: zebrafish Ribo seq Eif4e1c / rep 1 [r mR1]; Danio rerio; OTHER GSM6502515 r1 GSM6502515 1 The hearts were lysed on ice with 100ul of lysis buffer with 53 mg/ml cycloheximide using mechanical homogenization with a pestle for thirty seconds. Cells were lysed further by trituration of the sample using a 27.5 gauge needle syringe 20x on ice. Cell extracts average OD 7 were treated with MNase NEB CaCl2 5mM final concentration and Turbo DNAse I Invitrogen at 25°C for 30 minutes. MNase digestion was stopped with SUPERase inhibitor incubation on ice. 80S ribosomes were isolated using SH400 spin columns Cytiva. Columns were prepared according to the manufacturer's instructions. 100 µls of MNase treated sample was loaded per column and centrifuged for 2 min at 600 RCF. The flow through was isolated and incubated for 5 min. with 3x volume of Trizol LS Ambion. 200 µl of chloroform was added and incubated for 2 min. Samples were centrifuged for 15 min. at 12 000 rpm 4°C. The aqueous phase was extracted and precipitated overnight at 20°C using glycoblue ThermoFisher and isopropanol followed by centrifugation for 30 minutes at 4C at 10 000 RPM. Pellets were washed with 75% Ethanol and resuspended into RNase free water. Next Flex smRNA seq kit v3   OTHER TRANSCRIPTOMIC other SINGLE ILLUMINA NextSeq 550   SRP394145     rS3_mR1.fastq.gz fastq 13677356644.0 179965219.0 GSM6502515 r1 0:76 1:0 A:3346749848;C:3412648254;G:3629003006;T:3288222747;N:732789 76 0     3346749848 3412648254 3629003006 3288222747 732789 SRX17229103 SRS14795569 SRA1485233 Biological Chemistry and Pharmacology, The Ohio State University Biological Chemistry and Pharmacology, The Ohio State University 1 0.0   0.0   1.0       76   T   under 1.2% mapping rate illumina nextseq unknown other unknown bulk unknown unknown   United States 2022-08-22 Undetermined Multi-stage Heart Cardiovascular System
71066 71066 SRR21218377 SRX17229102 SRS14795568 SRP394145 PRJNA872137 The Translation Initiation Factor Homolog eif4e1c Regulates Cardiomyocyte Metabolism and Proliferation During Heart Regeneration. GSE211793 Other The?eIF4E family of translation initiation factors bind five prime methylated caps and act as the limiting step for mRNA translation. The canonical eIF4E1A is required for cell viability yet other related families exist and are all utilized in specific contexts or tissues. Here we describe a new family called Eif4e1c that is ancestral to the canonical eIF4E1A in vertebrates and for which we find roles during heart development and regeneration in zebrafish.?The Eif4e1c family is present in all aquatic vertebrates but has been lost in all terrestrial species. A core group of amino acids shared over 500 million yrs of evolution from?ray finned fish to sharks?forms an evolutionarily conserved binding interface along the surface of the protein suggesting Eif4e1c functions in a novel pathway.? Deletion of eif4e1c?in zebrafish caused growth deficits and impaired survival in juveniles.?Mutants surviving to maturity had fewer cardiomyocytes while also showing reduced proliferative responses to cardiac injury. Ribosome profiling of mutant hearts demonstrated changes in translation efficiency of mRNA for genes known to regulate cardiomyocyte proliferation. Although?eif4e1c?is expressed in many tissues and is the predominant cap binding initiation homolog in embryos its disruption had most notable impact on the heart and at juvenile stages. ?Our findings reveal context dependent requirements for translation initiation regulators during heart regeneration. Overall design: Ribosome profiling of adult uninjured eif4e1c zebrafish mutant hearts and adult uninjured EK zebrafish wildtype hearts.   pubmed:37306388   zebrafish Ribo seq Eif4e1c +/+ rep 2 [r pR2] GSM6502514   source name:heart|tissue:heart|cell line:Wt|genotype:Eif4e1c +/+ zebrafish Ribo seq Eif4e1c +/+ rep 2 [r pR2] Fastq files were processed using FastQC v0.11.8; RRID:SCR 014583 for quality control QC analysis. Pre processing of sequencing reads was based on the QC report using the FASTQ Quality Filter module in the FASTX Toolkit RRID:SCR 019035. This was used to filter the bases with 99% accuracy based on Q Score. Reads were removed that showed less than 70% of nucleotides with an accuracy of at least 99%. The sequences were collapsed according to their by Unique Molecular Identifiers UMIs. Cutadapt RRID:SCR 011841 was used to trim 21 nt adaptor before the first nt and the last 4 nt from the reads to remove the UMI. The processed reads were aligned to GRCz11/danRer11 assembly of the zebrafish genome; Genome Reference Consortium using STAR v2.5.3a RRID:SCR 004463. Generated bam files were processed with RiboProfiling package v1.2.2. Coverage counts on the coding regions CDS were obtained for each sample based on RiboProfiling function modules TxDb.Drerio.UCSC.danRer11.refGene v3.4.6; Annotation package for TxDb objects; Team BC 2019 and GenomicFeatures package v1.46.1. Differential expression analysis was performed using the DESeq2 pipeline version 1.26.0 based on the expressed raw reads. Assembly: GRCz11/danRer11 Library strategy: Ribo seq heart   The hearts were lysed on ice with 100ul of lysis buffer with 53 mg/ml cycloheximide using mechanical homogenization with a pestle for thirty seconds. Cells were lysed further by trituration of the sample using a 27.5 gauge needle syringe 20x on ice. Cell extracts average OD 7 were treated with MNase NEB CaCl2 5mM final concentration and Turbo DNAse I Invitrogen at 25°C for 30 minutes. MNase digestion was stopped with SUPERase inhibitor incubation on ice. 80S ribosomes were isolated using SH400 spin columns Cytiva. Columns were prepared according to the manufacturer’s instructions. 100 µls of MNase treated sample was loaded per column and centrifuged for 2 min at 600 RCF. The flow through was isolated and incubated for 5 min. with 3x volume of Trizol LS Ambion. 200 µl of chloroform was added and incubated for 2 min. Samples were centrifuged for 15 min. at 12 000 rpm 4°C. The aqueous phase was extracted and precipitated overnight at 20°C using glycoblue ThermoFisher and isopropanol followed by centrifugation for 30 minutes at 4C at 10 000 RPM. Pellets were washed with 75% Ethanol and resuspended into RNase free water. Next Flex smRNA seq kit v3 Zebrafish used for ribosome profiling were grown together under normal conditions and were genotyped upon reaching maturity. tissue:heart|cell line:Wt|genotype:Eif4e1c +/+ GSM6502514 GSM6502514: zebrafish Ribo seq Eif4e1c +/+ rep 2 [r pR2]; Danio rerio; OTHER GSM6502514 r1 GSM6502514 1 The hearts were lysed on ice with 100ul of lysis buffer with 53 mg/ml cycloheximide using mechanical homogenization with a pestle for thirty seconds. Cells were lysed further by trituration of the sample using a 27.5 gauge needle syringe 20x on ice. Cell extracts average OD 7 were treated with MNase NEB CaCl2 5mM final concentration and Turbo DNAse I Invitrogen at 25°C for 30 minutes. MNase digestion was stopped with SUPERase inhibitor incubation on ice. 80S ribosomes were isolated using SH400 spin columns Cytiva. Columns were prepared according to the manufacturer's instructions. 100 µls of MNase treated sample was loaded per column and centrifuged for 2 min at 600 RCF. The flow through was isolated and incubated for 5 min. with 3x volume of Trizol LS Ambion. 200 µl of chloroform was added and incubated for 2 min. Samples were centrifuged for 15 min. at 12 000 rpm 4°C. The aqueous phase was extracted and precipitated overnight at 20°C using glycoblue ThermoFisher and isopropanol followed by centrifugation for 30 minutes at 4C at 10 000 RPM. Pellets were washed with 75% Ethanol and resuspended into RNase free water. Next Flex smRNA seq kit v3   OTHER TRANSCRIPTOMIC other SINGLE ILLUMINA NextSeq 550   SRP394145     rS2_pR2.fastq.gz fastq 8919983048.0 117368198.0 GSM6502514 r1 0:76 1:0 A:2208663451;C:2257902067;G:2371468879;T:2081476473;N:472178 76 0     2208663451 2257902067 2371468879 2081476473 472178 SRX17229102 SRS14795568 SRA1485233 Biological Chemistry and Pharmacology, The Ohio State University Biological Chemistry and Pharmacology, The Ohio State University 1 1e-05   0.0   0.99997   1.0   76   T   under 1.2% mapping rate illumina nextseq unknown other unknown bulk unknown unknown   United States 2022-08-22 Undetermined Multi-stage Heart Cardiovascular System
71067 71067 SRR21218378 SRX17229101 SRS14795567 SRP394145 PRJNA872137 The Translation Initiation Factor Homolog eif4e1c Regulates Cardiomyocyte Metabolism and Proliferation During Heart Regeneration. GSE211793 Other The?eIF4E family of translation initiation factors bind five prime methylated caps and act as the limiting step for mRNA translation. The canonical eIF4E1A is required for cell viability yet other related families exist and are all utilized in specific contexts or tissues. Here we describe a new family called Eif4e1c that is ancestral to the canonical eIF4E1A in vertebrates and for which we find roles during heart development and regeneration in zebrafish.?The Eif4e1c family is present in all aquatic vertebrates but has been lost in all terrestrial species. A core group of amino acids shared over 500 million yrs of evolution from?ray finned fish to sharks?forms an evolutionarily conserved binding interface along the surface of the protein suggesting Eif4e1c functions in a novel pathway.? Deletion of eif4e1c?in zebrafish caused growth deficits and impaired survival in juveniles.?Mutants surviving to maturity had fewer cardiomyocytes while also showing reduced proliferative responses to cardiac injury. Ribosome profiling of mutant hearts demonstrated changes in translation efficiency of mRNA for genes known to regulate cardiomyocyte proliferation. Although?eif4e1c?is expressed in many tissues and is the predominant cap binding initiation homolog in embryos its disruption had most notable impact on the heart and at juvenile stages. ?Our findings reveal context dependent requirements for translation initiation regulators during heart regeneration. Overall design: Ribosome profiling of adult uninjured eif4e1c zebrafish mutant hearts and adult uninjured EK zebrafish wildtype hearts.   pubmed:37306388   zebrafish Ribo seq Eif4e1c +/+ rep 1 [r pR1] GSM6502513   source name:heart|tissue:heart|cell line:Wt|genotype:Eif4e1c +/+ zebrafish Ribo seq Eif4e1c +/+ rep 1 [r pR1] Fastq files were processed using FastQC v0.11.8; RRID:SCR 014583 for quality control QC analysis. Pre processing of sequencing reads was based on the QC report using the FASTQ Quality Filter module in the FASTX Toolkit RRID:SCR 019035. This was used to filter the bases with 99% accuracy based on Q Score. Reads were removed that showed less than 70% of nucleotides with an accuracy of at least 99%. The sequences were collapsed according to their by Unique Molecular Identifiers UMIs. Cutadapt RRID:SCR 011841 was used to trim 21 nt adaptor before the first nt and the last 4 nt from the reads to remove the UMI. The processed reads were aligned to GRCz11/danRer11 assembly of the zebrafish genome; Genome Reference Consortium using STAR v2.5.3a RRID:SCR 004463. Generated bam files were processed with RiboProfiling package v1.2.2. Coverage counts on the coding regions CDS were obtained for each sample based on RiboProfiling function modules TxDb.Drerio.UCSC.danRer11.refGene v3.4.6; Annotation package for TxDb objects; Team BC 2019 and GenomicFeatures package v1.46.1. Differential expression analysis was performed using the DESeq2 pipeline version 1.26.0 based on the expressed raw reads. Assembly: GRCz11/danRer11 Library strategy: Ribo seq heart   The hearts were lysed on ice with 100ul of lysis buffer with 53 mg/ml cycloheximide using mechanical homogenization with a pestle for thirty seconds. Cells were lysed further by trituration of the sample using a 27.5 gauge needle syringe 20x on ice. Cell extracts average OD 7 were treated with MNase NEB CaCl2 5mM final concentration and Turbo DNAse I Invitrogen at 25°C for 30 minutes. MNase digestion was stopped with SUPERase inhibitor incubation on ice. 80S ribosomes were isolated using SH400 spin columns Cytiva. Columns were prepared according to the manufacturer’s instructions. 100 µls of MNase treated sample was loaded per column and centrifuged for 2 min at 600 RCF. The flow through was isolated and incubated for 5 min. with 3x volume of Trizol LS Ambion. 200 µl of chloroform was added and incubated for 2 min. Samples were centrifuged for 15 min. at 12 000 rpm 4°C. The aqueous phase was extracted and precipitated overnight at 20°C using glycoblue ThermoFisher and isopropanol followed by centrifugation for 30 minutes at 4C at 10 000 RPM. Pellets were washed with 75% Ethanol and resuspended into RNase free water. Next Flex smRNA seq kit v3 Zebrafish used for ribosome profiling were grown together under normal conditions and were genotyped upon reaching maturity. tissue:heart|cell line:Wt|genotype:Eif4e1c +/+ GSM6502513 GSM6502513: zebrafish Ribo seq Eif4e1c +/+ rep 1 [r pR1]; Danio rerio; OTHER GSM6502513 r1 GSM6502513 1 The hearts were lysed on ice with 100ul of lysis buffer with 53 mg/ml cycloheximide using mechanical homogenization with a pestle for thirty seconds. Cells were lysed further by trituration of the sample using a 27.5 gauge needle syringe 20x on ice. Cell extracts average OD 7 were treated with MNase NEB CaCl2 5mM final concentration and Turbo DNAse I Invitrogen at 25°C for 30 minutes. MNase digestion was stopped with SUPERase inhibitor incubation on ice. 80S ribosomes were isolated using SH400 spin columns Cytiva. Columns were prepared according to the manufacturer's instructions. 100 µls of MNase treated sample was loaded per column and centrifuged for 2 min at 600 RCF. The flow through was isolated and incubated for 5 min. with 3x volume of Trizol LS Ambion. 200 µl of chloroform was added and incubated for 2 min. Samples were centrifuged for 15 min. at 12 000 rpm 4°C. The aqueous phase was extracted and precipitated overnight at 20°C using glycoblue ThermoFisher and isopropanol followed by centrifugation for 30 minutes at 4C at 10 000 RPM. Pellets were washed with 75% Ethanol and resuspended into RNase free water. Next Flex smRNA seq kit v3   OTHER TRANSCRIPTOMIC other SINGLE ILLUMINA NextSeq 550   SRP394145     rS1_pR1.fastq.gz fastq 8551941876.0 112525551.0 GSM6502513 r1 0:76 1:0 A:2015417703;C:2191682962;G:2364697448;T:1979683824;N:459939 76 0     2015417703 2191682962 2364697448 1979683824 459939 SRX17229101 SRS14795567 SRA1485233 Biological Chemistry and Pharmacology, The Ohio State University Biological Chemistry and Pharmacology, The Ohio State University 1 1e-05   0.0   0.99997   0.0   76   T   under 1.2% mapping rate illumina nextseq unknown other unknown bulk unknown unknown   United States 2022-08-22 Undetermined Multi-stage Heart Cardiovascular System

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;