run_metadata
53 rows where devstage_curation = "Undetermined" and experiment.library_strategy = "AMPLICON"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 40376 | 40376 | SRR3166964 | SRX1583817 | SRS1295580 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRA library 28d Calm4 | breed:AB|chain:alpha|index:26|sex:male|time point:28d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRa sequencing of zebrafish: whole zebrafish: Sample TCRA library 28d Calm4 | 116 28d Calm4 alpha | 116 28d Calm4 alpha | five prime RACE amplification of TCRa transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_116_28d_Calm4_alpha.fq.gz read2_116_28d_Calm4_alpha.fq.gz | fastq fastq | 12052440600.0 | 40174802.0 | 116 28d Calm4 alpha files | 0:150 1:150 | A:3274476247;C:2324807837;G:3578878507;T:2848354560;N:25923449 | 150 | 150 | 3274476247 | 2324807837 | 3578878507 | 2848354560 | 25923449 | SRX1583817 | SRS1295580 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.00096 | 0.22917 | 0.00017 | 0.19822 | 0.99906 | 0.99762 | 0.35172 | 0.6189 | 150 | 150 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40377 | 40377 | SRR3166963 | SRX1583816 | SRS1295581 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRA library 28d Calm2 | breed:AB|chain:alpha|index:25|sex:male|time point:28d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRa sequencing of zebrafish: whole zebrafish: Sample TCRA library 28d Calm2 | 114 28d Calm2 alpha | 114 28d Calm2 alpha | five prime RACE amplification of TCRa transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_114_28d_Calm2_alpha.fq.gz read2_114_28d_Calm2_alpha.fq.gz | fastq fastq | 4957122900.0 | 16523743.0 | 114 28d Calm2 alpha files | 0:150 1:150 | A:1398510544;C:988027281;G:1244120221;T:1316350204;N:10114650 | 150 | 150 | 1398510544 | 988027281 | 1244120221 | 1316350204 | 10114650 | SRX1583816 | SRS1295581 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.00167 | 0.03332 | 0.00146 | 0.028 | 0.99967 | 0.99896 | 0.15789 | 0.60731 | 150 | 150 | T | T | mates < 9% mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40378 | 40378 | SRR3166962 | SRX1583815 | SRS1295582 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRA library 28d KLH6 | breed:AB|chain:alpha|index:21|sex:male|time point:28d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRa sequencing of zebrafish: whole zebrafish: Sample TCRA library 28d KLH6 | 110 28d KLH6 alpha | 110 28d KLH6 alpha | five prime RACE amplification of TCRa transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_110_28d_KLH6_alpha.fq.gz read2_110_28d_KLH6_alpha.fq.gz | fastq fastq | 6270530700.0 | 20901769.0 | 110 28d KLH6 alpha files | 0:150 1:150 | A:1802311183;C:1236560108;G:1561615962;T:1659163742;N:10879705 | 150 | 150 | 1802311183 | 1236560108 | 1561615962 | 1659163742 | 10879705 | SRX1583815 | SRS1295582 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.00179 | 0.13512 | 0.00073 | 0.11592 | 0.99967 | 0.99855 | 0.21568 | 0.87835 | 150 | 150 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40379 | 40379 | SRR3166961 | SRX1583814 | SRS1295583 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRA library 28d PHA6 | breed:AB|chain:alpha|index:32|sex:male|time point:28d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRa sequencing of zebrafish: whole zebrafish: Sample TCRA library 28d PHA6 | 102 28d PHA6 alpha | 102 28d PHA6 alpha | five prime RACE amplification of TCRa transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_102_28d_PHA6_alpha.fq.gz read2_102_28d_PHA6_alpha.fq.gz | fastq fastq | 10067723700.0 | 33559079.0 | 102 28d PHA6 alpha files | 0:150 1:150 | A:2803515995;C:2027880463;G:2649055724;T:2566963260;N:20308258 | 150 | 150 | 2803515995 | 2027880463 | 2649055724 | 2566963260 | 20308258 | SRX1583814 | SRS1295583 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.00158 | 0.04576 | 0.00056 | 0.03839 | 0.99922 | 0.99831 | 0.3246 | 0.40078 | 150 | 150 | T | T | mates < 9% mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2016-02-14 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40380 | 40380 | SRR3166960 | SRX1583813 | SRS1295584 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRA library 7d KLH2 | breed:AB|chain:alpha|index:34|sex:male|time point:7d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRa sequencing of zebrafish: whole zebrafish: Sample TCRA library 7d KLH2 | 16 7d KLH2 alpha | 16 7d KLH2 alpha | five prime RACE amplification of TCRa transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_16_7d_KLH2_alpha.fq.gz read2_16_7d_KLH2_alpha.fq.gz | fastq fastq | 2783317500.0 | 9277725.0 | 16 7d KLH2 alpha files | 0:150 1:150 | A:761370556;C:556705024;G:719835894;T:727504605;N:17901421 | 150 | 150 | 761370556 | 556705024 | 719835894 | 727504605 | 17901421 | SRX1583813 | SRS1295584 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.00143 | 0.13658 | 0.0008 | 0.11879 | 0.99935 | 0.99876 | 0.25409 | 0.87567 | 150 | 150 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2016-02-14 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40381 | 40381 | SRR3166959 | SRX1583812 | SRS1295585 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRA library 21d KLH6 | breed:AB|chain:alpha|index:24|sex:male|time point:21d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRa sequencing of zebrafish: whole zebrafish: Sample TCRA library 21d KLH6 | 78 21d KLH6 alpha | 78 21d KLH6 alpha | five prime RACE amplification of TCRa transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_78_21d_KLH6_alpha.fq.gz read2_78_21d_KLH6_alpha.fq.gz | fastq fastq | 7720614900.0 | 25735383.0 | 78 21d KLH6 alpha files | 0:150 1:150 | A:2163229607;C:1591913203;G:1963558161;T:1998596363;N:3317566 | 150 | 150 | 2163229607 | 1591913203 | 1963558161 | 1998596363 | 3317566 | SRX1583812 | SRS1295585 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.00105 | 0.04913 | 0.00036 | 0.04186 | 0.99937 | 0.99835 | 0.14393 | 0.4819 | 150 | 150 | T | T | mates < 9% mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40382 | 40382 | SRR3166958 | SRX1583811 | SRS1295586 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRA library 7d Calm6 | breed:AB|chain:alpha|index:33|sex:male|time point:7d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRa sequencing of zebrafish: whole zebrafish: Sample TCRA library 7d Calm6 | 27 7d Calm6 alpha | 27 7d Calm6 alpha | five prime RACE amplification of TCRa transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_27_7d_Calm6_alpha.fq.gz read2_27_7d_Calm6_alpha.fq.gz | fastq fastq | 4337226600.0 | 14457422.0 | 27 7d Calm6 alpha files | 0:150 1:150 | A:1174401516;C:871068073;G:1145864920;T:1118174763;N:27717328 | 150 | 150 | 1174401516 | 871068073 | 1145864920 | 1118174763 | 27717328 | SRX1583811 | SRS1295586 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.002 | 0.032 | 0.0007 | 0.02494 | 0.99924 | 0.99912 | 0.38 | 0.38606 | 150 | 150 | T | T | mates < 9% mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2016-02-14 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40383 | 40383 | SRR3166957 | SRX1583810 | SRS1295587 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRA library 7d PHA7 | breed:AB|chain:alpha|index:36|sex:male|time point:7d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRa sequencing of zebrafish: whole zebrafish: Sample TCRA library 7d PHA7 | 14 7d PHA7 alpha | 14 7d PHA7 alpha | five prime RACE amplification of TCRa transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_14_7d_PHA7_alpha.fq.gz read2_14_7d_PHA7_alpha.fq.gz | fastq fastq | 3401366100.0 | 11337887.0 | 14 7d PHA7 alpha files | SRX1583810 | SRS1295587 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.00357 | 0.02242 | 0.00202 | 0.01952 | 0.99902 | 0.99811 | 0.35016 | 0.5424 | 150 | 150 | T | T | mates < 9% mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | |||||||||||||||||||||||||||||
| 40384 | 40384 | SRR3166956 | SRX1583809 | SRS1295588 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRA library 7d PHA3 | breed:AB|chain:alpha|index:35|sex:male|time point:7d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRa sequencing of zebrafish: whole zebrafish: Sample TCRA library 7d PHA3 | 10 7d PHA3 alpha | 10 7d PHA3 alpha | five prime RACE amplification of TCRa transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read2_10_7d_PHA3_alpha.fq.gz read1_10_7d_PHA3_alpha.fq.gz | fastq fastq | 4293459300.0 | 14311531.0 | 10 7d PHA3 alpha files | 0:150 1:150 | A:1208054755;C:855800391;G:1072212534;T:1129932131;N:27459489 | 150 | 150 | 1208054755 | 855800391 | 1072212534 | 1129932131 | 27459489 | SRX1583809 | SRS1295588 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.00174 | 0.05155 | 0.0009 | 0.0472 | 0.99937 | 0.9989 | 0.2256 | 0.60714 | 150 | 150 | T | T | mates < 9% mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40385 | 40385 | SRR3166955 | SRX1583808 | SRS1295589 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 28d Calm7 | breed:AB|chain:beta|index:56|sex:male|time point:28d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 28d Calm7 | 119 28d Calm7 beta | 119 28d Calm7 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_119_28d_Calm7_beta.fq.gz read2_119_28d_Calm7_beta.fq.gz | fastq fastq | 3494941800.0 | 11649806.0 | 119 28d Calm7 beta files | 0:150 1:150 | A:1262121526;C:602497563;G:790544892;T:738346792;N:101431027 | 150 | 150 | 1262121526 | 602497563 | 790544892 | 738346792 | 101431027 | SRX1583808 | SRS1295589 | SRA353254 | SRA | Bar-Ilan University | 2 | 3e-05 | 0.00179 | 0.0 | 7e-05 | 0.99997 | 0.99831 | 0.0 | 0.42009 | 150 | 150 | T | T | mates < 9% mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40386 | 40386 | SRR3166954 | SRX1583807 | SRS1295590 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 28d Calm5 | breed:AB|chain:beta|index:55|sex:male|time point:28d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 28d Calm5 | 117 28d Calm5 beta | 117 28d Calm5 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read2_117_28d_Calm5_beta.fq.gz read1_117_28d_Calm5_beta.fq.gz | fastq fastq | 2950876200.0 | 9836254.0 | 117 28d Calm5 beta files | 0:150 1:150 | A:1025845698;C:505599350;G:688977765;T:634738210;N:95715177 | 150 | 150 | 1025845698 | 505599350 | 688977765 | 634738210 | 95715177 | SRX1583807 | SRS1295590 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.0 | 0.00023 | 0.0 | 0.0 | 1.0 | 0.99987 | 0.07692 | 150 | 150 | T | T | mates < 9% mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2016-03-02 | Undetermined | Undetermined | Whole Organism | All anatomical structures | |||||||||||||||||||||
| 40387 | 40387 | SRR3166953 | SRX1583806 | SRS1295591 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 28d Calm3 | breed:AB|chain:beta|index:54|sex:male|time point:28d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 28d Calm3 | 115 28d Calm3 beta | 115 28d Calm3 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_115_28d_Calm3_beta.fq.gz read2_115_28d_Calm3_beta.fq.gz | fastq fastq | 1913218200.0 | 6377394.0 | 115 28d Calm3 beta files | 0:150 1:150 | A:637646003;C:349779874;G:435732113;T:430619528;N:59440682 | 150 | 150 | 637646003 | 349779874 | 435732113 | 430619528 | 59440682 | SRX1583806 | SRS1295591 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.0 | 0.02438 | 0.0 | 0.00184 | 1.0 | 0.99908 | 0.01511 | 150 | 150 | T | T | mates < 9% mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | |||||||||||||||||||||
| 40388 | 40388 | SRR3166952 | SRX1583805 | SRS1295592 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 28d KLH6 | breed:AB|chain:beta|index:27|sex:male|time point:28d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 28d KLH6 | 110 28d KLH6 beta | 110 28d KLH6 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_110_28d_KLH6_beta.fq.gz read2_110_28d_KLH6_beta.fq.gz | fastq fastq | 2689206600.0 | 8964022.0 | 110 28d KLH6 beta files | 0:150 1:150 | A:807762783;C:503825062;G:585283183;T:703818890;N:88516682 | 150 | 150 | 807762783 | 503825062 | 585283183 | 703818890 | 88516682 | SRX1583805 | SRS1295592 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.00014 | 0.3078 | 0.0 | 0.02202 | 0.99975 | 0.99095 | 0.38888 | 0.10297 | 150 | 150 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40389 | 40389 | SRR3166951 | SRX1583804 | SRS1295593 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 28d KLH2 | breed:AB|chain:beta|index:23|sex:male|time point:28d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 28d KLH2 | 106 28d KLH2 beta | 106 28d KLH2 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read2_106_28d_KLH2_beta.fq.gz read1_106_28d_KLH2_beta.fq.gz | fastq fastq | 2795086200.0 | 9316954.0 | 106 28d KLH2 beta files | 0:150 1:150 | A:897420089;C:470460508;G:621809014;T:712999451;N:92397138 | 150 | 150 | 897420089 | 470460508 | 621809014 | 712999451 | 92397138 | SRX1583804 | SRS1295593 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.0 | 0.05106 | 0.0 | 0.00859 | 1.0 | 0.99943 | 0.01388 | 150 | 150 | T | T | mates < 9% mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2016-03-02 | Undetermined | Undetermined | Whole Organism | All anatomical structures | |||||||||||||||||||||
| 40390 | 40390 | SRR3166950 | SRX1583803 | SRS1295594 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 28d KLH1 | breed:AB|chain:beta|index:22|sex:male|time point:28d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 28d KLH1 | 105 28d KLH1 beta | 105 28d KLH1 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_105_28d_KLH1_beta.fq.gz read2_105_28d_KLH1_beta.fq.gz | fastq fastq | 1768628700.0 | 5895429.0 | 105 28d KLH1 beta files | 0:150 1:150 | A:486366963;C:366398128;G:389871583;T:478235213;N:47756813 | 150 | 150 | 486366963 | 366398128 | 389871583 | 478235213 | 47756813 | SRX1583803 | SRS1295594 | SRA353254 | SRA | Bar-Ilan University | 2 | 4e-05 | 0.09054 | 3e-05 | 0.01597 | 1.0 | 0.99931 | 0.00767 | 150 | 150 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | |||||||||||||||||||||
| 40391 | 40391 | SRR3166949 | SRX1583802 | SRS1295595 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 28d PHA7 | breed:AB|chain:beta|index:30|sex:male|time point:28d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 28d PHA7 | 103 28d PHA7 beta | 103 28d PHA7 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_103_28d_PHA7_beta.fq.gz read2_103_28d_PHA7_beta.fq.gz | fastq fastq | 2234344500.0 | 7447815.0 | 103 28d PHA7 beta files | 0:150 1:150 | A:628358242;C:462371909;G:526170885;T:548473987;N:68969477 | 150 | 150 | 628358242 | 462371909 | 526170885 | 548473987 | 68969477 | SRX1583802 | SRS1295595 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.00104 | 0.68691 | 5e-05 | 0.01999 | 0.99894 | 0.97281 | 0.23076 | 0.44172 | 150 | 150 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2016-03-02 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40392 | 40392 | SRR3166948 | SRX1583801 | SRS1295596 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 28d PHA5 | breed:AB|chain:beta|index:29|sex:male|time point:28d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 28d PHA5 | 101 28d PHA5 beta | 101 28d PHA5 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_101_28d_PHA5_beta.fq.gz read2_101_28d_PHA5_beta.fq.gz | fastq fastq | 1356278400.0 | 4520928.0 | 101 28d PHA5 beta files | 0:150 1:150 | A:372190640;C:278464953;G:294268430;T:378226253;N:33128124 | 150 | 150 | 372190640 | 278464953 | 294268430 | 378226253 | 33128124 | SRX1583801 | SRS1295596 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.00254 | 0.10913 | 0.0001 | 0.01715 | 0.99995 | 0.99904 | 0.01106 | 0.01084 | 150 | 150 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40393 | 40393 | SRR3166947 | SRX1583800 | SRS1295597 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 28d PHA2 | breed:AB|chain:beta|index:28|sex:male|time point:28d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 28d PHA2 | 98 28d PHA2 beta | 98 28d PHA2 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read2_98_28d_PHA2_beta.fq.gz read1_98_28d_PHA2_beta.fq.gz | fastq fastq | 4533755400.0 | 15112518.0 | 98 28d PHA2 beta files | 0:150 1:150 | A:1508096116;C:749853448;G:1051562277;T:1142392486;N:81851073 | 150 | 150 | 1508096116 | 749853448 | 1051562277 | 1142392486 | 81851073 | SRX1583800 | SRS1295597 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.0 | 0.33493 | 0.0 | 0.02388 | 1.0 | 0.99758 | 0.15819 | 150 | 150 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | |||||||||||||||||||||
| 40394 | 40394 | SRR3166946 | SRX1583799 | SRS1295598 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 28d IFA 5 | breed:AB|chain:beta|index:11|sex:male|time point:28d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 28d IFA 5 | 93 28d IFA 5 beta | 93 28d IFA 5 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_93_28d_IFA_5_beta.fq.gz read2_93_28d_IFA_5_beta.fq.gz | fastq fastq | 1526394600.0 | 5087982.0 | 93 28d IFA 5 beta files | 0:150 1:150 | A:431910708;C:323148774;G:334806769;T:417586287;N:18942062 | 150 | 150 | 431910708 | 323148774 | 334806769 | 417586287 | 18942062 | SRX1583799 | SRS1295598 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.00039 | 0.31457 | 0.00015 | 0.00771 | 0.99963 | 0.98468 | 0.28947 | 0.16209 | 150 | 150 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40395 | 40395 | SRR3166945 | SRX1583798 | SRS1295599 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 28d IFA 2 | breed:AB|chain:beta|index:10|sex:male|time point:28d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 28d IFA 2 | 90 28d IFA 2 beta | 90 28d IFA 2 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_90_28d_IFA_2_beta.fq.gz read2_90_28d_IFA_2_beta.fq.gz | fastq fastq | 2345298300.0 | 7817661.0 | 90 28d IFA 2 beta files | 0:150 1:150 | A:753823005;C:419081900;G:516233583;T:613533931;N:42625881 | 150 | 150 | 753823005 | 419081900 | 516233583 | 613533931 | 42625881 | SRX1583798 | SRS1295599 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.00015 | 0.38592 | 3e-05 | 0.00508 | 0.99985 | 0.99385 | 0.33333 | 0.06202 | 150 | 150 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40396 | 40396 | SRR3166944 | SRX1583797 | SRS1295600 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 28d IFA 1 | breed:AB|chain:beta|index:28|sex:male|time point:28d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 28d IFA 1 | 89 28d IFA 1 beta | 89 28d IFA 1 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_89_28d_IFA_1_beta.fq.gz read2_89_28d_IFA_1_beta.fq.gz | fastq fastq | 2029349400.0 | 6764498.0 | 89 28d IFA 1 beta files | 0:150 1:150 | A:714287901;C:360307311;G:472841677;T:446872160;N:35040351 | 150 | 150 | 714287901 | 360307311 | 472841677 | 446872160 | 35040351 | SRX1583797 | SRS1295600 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.0 | 0.06313 | 0.0 | 0.01031 | 1.0 | 0.99703 | 0.15591 | 150 | 150 | T | T | mates < 9% mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | |||||||||||||||||||||
| 40397 | 40397 | SRR3166943 | SRX1583796 | SRS1295601 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 21d Calm6 | breed:AB|chain:beta|index:44|sex:male|time point:21d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 21d Calm6 | 86 21d Calm6 beta | 86 21d Calm6 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read2_86_21d_Calm6_beta.fq.gz read1_86_21d_Calm6_beta.fq.gz | fastq fastq | 2610499200.0 | 8701664.0 | 86 21d Calm6 beta files | 0:150 1:150 | A:764524163;C:544491001;G:601533912;T:654396223;N:45553901 | 150 | 150 | 764524163 | 544491001 | 601533912 | 654396223 | 45553901 | SRX1583796 | SRS1295601 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.00108 | 0.63356 | 0.00012 | 0.12284 | 0.99837 | 0.96193 | 0.21768 | 0.38237 | 150 | 150 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2016-03-02 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40398 | 40398 | SRR3166942 | SRX1583795 | SRS1295602 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 21d Calm5 | breed:AB|chain:beta|index:43|sex:male|time point:21d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 21d Calm5 | 85 21d Calm5 beta | 85 21d Calm5 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_85_21d_Calm5_beta.fq.gz read2_85_21d_Calm5_beta.fq.gz | fastq fastq | 2700056100.0 | 9000187.0 | 85 21d Calm5 beta files | 0:150 1:150 | A:755011216;C:593419169;G:623123170;T:688658373;N:39844172 | 150 | 150 | 755011216 | 593419169 | 623123170 | 688658373 | 39844172 | SRX1583795 | SRS1295602 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.00244 | 0.68155 | 0.00026 | 0.01492 | 0.99766 | 0.96597 | 0.24863 | 0.31823 | 150 | 150 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40399 | 40399 | SRR3166941 | SRX1583794 | SRS1295603 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 21d Calm1 | breed:AB|chain:beta|index:42|sex:male|time point:21d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 21d Calm1 | 81 21d Calm1 beta | 81 21d Calm1 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_81_21d_Calm1_beta.fq.gz read2_81_21d_Calm1_beta.fq.gz | fastq fastq | 2296683900.0 | 7655613.0 | 81 21d Calm1 beta files | 0:150 1:150 | A:776751441;C:430253074;G:528909259;T:525320137;N:35449989 | 150 | 150 | 776751441 | 430253074 | 528909259 | 525320137 | 35449989 | SRX1583794 | SRS1295603 | SRA353254 | SRA | Bar-Ilan University | 2 | 2e-05 | 0.0464 | 0.0 | 0.00091 | 0.99997 | 0.99882 | 0.0 | 0.0134 | 150 | 150 | T | T | mates < 9% mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2016-03-02 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40400 | 40400 | SRR3166940 | SRX1583793 | SRS1295604 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 21d KLH6 | breed:AB|chain:beta|index:50|sex:male|time point:21d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 21d KLH6 | 78 21d KLH6 beta | 78 21d KLH6 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_78_21d_KLH6_beta.fq.gz read2_78_21d_KLH6_beta.fq.gz | fastq fastq | 1500221100.0 | 5000737.0 | 78 21d KLH6 beta files | 0:150 1:150 | A:435807096;C:294707078;G:337922064;T:361615328;N:70169534 | 150 | 150 | 435807096 | 294707078 | 337922064 | 361615328 | 70169534 | SRX1583793 | SRS1295604 | SRA353254 | SRA | Bar-Ilan University | 2 | 5e-05 | 0.37212 | 3e-05 | 0.03128 | 0.99997 | 0.99358 | 0.0 | 0.11962 | 150 | 150 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40401 | 40401 | SRR3166939 | SRX1583792 | SRS1295605 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 21d KLH5 | breed:AB|chain:beta|index:49|sex:male|time point:21d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 21d KLH5 | 77 21d KLH5 beta | 77 21d KLH5 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_77_21d_KLH5_beta.fq.gz read2_77_21d_KLH5_beta.fq.gz | fastq fastq | 2106732600.0 | 7022442.0 | 77 21d KLH5 beta files | 0:150 1:150 | A:696373936;C:376059887;G:465978414;T:465485185;N:102835178 | 150 | 150 | 696373936 | 376059887 | 465978414 | 465485185 | 102835178 | SRX1583792 | SRS1295605 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.0 | 0.04625 | 0.0 | 0.00381 | 1.0 | 0.99979 | 0.00123 | 150 | 150 | T | T | mates < 9% mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | |||||||||||||||||||||
| 40402 | 40402 | SRR3166938 | SRX1583791 | SRS1295606 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 21d KLH1 | breed:AB|chain:beta|index:48|sex:male|time point:21d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 21d KLH1 | 73 21d KLH1 beta | 73 21d KLH1 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read2_73_21d_KLH1_beta.fq.gz read1_73_21d_KLH1_beta.fq.gz | fastq fastq | 3554391900.0 | 11847973.0 | 73 21d KLH1 beta files | 0:150 1:150 | A:1312477977;C:598886813;G:787337227;T:686894043;N:168795840 | 150 | 150 | 1312477977 | 598886813 | 787337227 | 686894043 | 168795840 | SRX1583791 | SRS1295606 | SRA353254 | SRA | Bar-Ilan University | 2 | 6e-05 | 0.00136 | 5e-05 | 0.00019 | 1.0 | 0.99983 | 0.0303 | 150 | 150 | T | T | mates < 9% mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | |||||||||||||||||||||
| 40403 | 40403 | SRR3166937 | SRX1583790 | SRS1295607 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 21d PHA6 | breed:AB|chain:beta|index:53|sex:male|time point:21d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 21d PHA6 | 70 21d PHA6 beta | 70 21d PHA6 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read2_70_21d_PHA6_beta.fq.gz read1_70_21d_PHA6_beta.fq.gz | fastq fastq | 4238076900.0 | 14126923.0 | 70 21d PHA6 beta files | 0:150 1:150 | A:1519543327;C:710498920;G:932091678;T:844220454;N:231722521 | 150 | 150 | 1519543327 | 710498920 | 932091678 | 844220454 | 231722521 | SRX1583790 | SRS1295607 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.00023 | 0.00772 | 7e-05 | 0.00068 | 0.99991 | 0.99851 | 0.25 | 0.08615 | 150 | 150 | T | T | mates < 9% mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40404 | 40404 | SRR3166936 | SRX1583789 | SRS1295608 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 21d PHA4 | breed:AB|chain:beta|index:52|sex:male|time point:21d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 21d PHA4 | 68 21d PHA4 beta | 68 21d PHA4 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_68_21d_PHA4_beta.fq.gz read2_68_21d_PHA4_beta.fq.gz | fastq fastq | 2030511600.0 | 6768372.0 | 68 21d PHA4 beta files | 0:150 1:150 | A:659873688;C:307551211;G:388669539;T:566328083;N:108089079 | 150 | 150 | 659873688 | 307551211 | 388669539 | 566328083 | 108089079 | SRX1583789 | SRS1295608 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.00029 | 0.24246 | 3e-05 | 0.05929 | 0.99971 | 0.99214 | 0.4 | 0.16492 | 150 | 150 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40405 | 40405 | SRR3166935 | SRX1583788 | SRS1295609 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 21d PHA1 | breed:AB|chain:beta|index:51|sex:male|time point:21d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 21d PHA1 | 65 21d PHA1 beta | 65 21d PHA1 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_65_21d_PHA1_beta.fq.gz read2_65_21d_PHA1_beta.fq.gz | fastq fastq | 930240600.0 | 3100802.0 | 65 21d PHA1 beta files | 0:150 1:150 | A:259486434;C:184043790;G:197463162;T:250422190;N:38825024 | 150 | 150 | 259486434 | 184043790 | 197463162 | 250422190 | 38825024 | SRX1583788 | SRS1295609 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.00012 | 0.14868 | 0.0 | 0.02051 | 0.99963 | 0.99111 | 0.36842 | 0.258 | 150 | 150 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40406 | 40406 | SRR3166934 | SRX1583787 | SRS1295610 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 21d IFA 8 | breed:AB|chain:beta|index:47|sex:male|time point:21d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 21d IFA 8 | 64 21d IFA 8 beta | 64 21d IFA 8 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_64_21d_IFA_8_beta.fq.gz read2_64_21d_IFA_8_beta.fq.gz | fastq fastq | 1461868800.0 | 4872896.0 | 64 21d IFA 8 beta files | 0:150 1:150 | A:462418747;C:247121586;G:284662907;T:394116911;N:73548649 | 150 | 150 | 462418747 | 247121586 | 284662907 | 394116911 | 73548649 | SRX1583787 | SRS1295610 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.0001 | 0.17532 | 0.0 | 0.04988 | 0.99983 | 0.99843 | 0.25 | 0.01908 | 150 | 150 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40407 | 40407 | SRR3166933 | SRX1583786 | SRS1295611 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 21d IFA 4 | breed:AB|chain:beta|index:46|sex:male|time point:21d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 21d IFA 4 | 60 21d IFA 4 beta | 60 21d IFA 4 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read2_60_21d_IFA_4_beta.fq.gz read1_60_21d_IFA_4_beta.fq.gz | fastq fastq | 4128399900.0 | 13761333.0 | 60 21d IFA 4 beta files | 0:150 1:150 | A:1332478795;C:800389451;G:937176538;T:950735272;N:107619844 | 150 | 150 | 1332478795 | 800389451 | 937176538 | 950735272 | 107619844 | SRX1583786 | SRS1295611 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.00043 | 0.19668 | 5e-05 | 0.00597 | 0.99953 | 0.9782 | 0.2647 | 0.35656 | 150 | 150 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40408 | 40408 | SRR3166932 | SRX1583785 | SRS1295612 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 21d IFA 2 | breed:AB|chain:beta|index:45|sex:male|time point:21d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 21d IFA 2 | 58 21d IFA 2 beta | 58 21d IFA 2 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read2_58_21d_IFA_2_beta.fq.gz read1_58_21d_IFA_2_beta.fq.gz | fastq fastq | 5035078800.0 | 16783596.0 | 58 21d IFA 2 beta files | 0:150 1:150 | A:1714919930;C:839542402;G:1121993893;T:1220614755;N:138007820 | 150 | 150 | 1714919930 | 839542402 | 1121993893 | 1220614755 | 138007820 | SRX1583785 | SRS1295612 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.0 | 0.17551 | 0.0 | 0.00318 | 1.0 | 0.99833 | 0.10802 | 150 | 150 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2016-03-02 | Undetermined | Undetermined | Whole Organism | All anatomical structures | |||||||||||||||||||||
| 40409 | 40409 | SRR3166931 | SRX1583784 | SRS1295613 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 14d Calm6 | breed:AB|chain:beta|index:37|sex:male|time point:14d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 14d Calm6 | 55 14d Calm6 beta | 55 14d Calm6 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_55_14d_Calm6_beta.fq.gz read2_55_14d_Calm6_beta.fq.gz | fastq fastq | 1028012700.0 | 3426709.0 | 55 14d Calm6 beta files | 0:150 1:150 | A:295958360;C:207583542;G:216651025;T:284035600;N:23784173 | 150 | 150 | 295958360 | 207583542 | 216651025 | 284035600 | 23784173 | SRX1583784 | SRS1295613 | SRA353254 | SRA | Bar-Ilan University | 2 | 5e-05 | 0.16498 | 0.0 | 0.01748 | 0.99989 | 0.99253 | 0.33333 | 0.12385 | 150 | 150 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2016-03-02 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40410 | 40410 | SRR3166930 | SRX1583783 | SRS1295614 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library Naive6 | breed:AB|chain:beta|index:31|sex:male|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library Naive6 | 126 Naive6 beta | 126 Naive6 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read2_126_Naive6_beta.fq.gz read1_126_Naive6_beta.fq.gz | fastq fastq | 1984909800.0 | 6616366.0 | 126 Naive6 beta files | 0:150 1:150 | A:574002364;C:411972224;G:452963561;T:493883048;N:52088603 | 150 | 150 | 574002364 | 411972224 | 452963561 | 493883048 | 52088603 | SRX1583783 | SRS1295614 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.0007 | 0.73767 | 5e-05 | 0.01562 | 0.99928 | 0.9754 | 0.16 | 0.44061 | 150 | 150 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40411 | 40411 | SRR3166929 | SRX1583782 | SRS1295615 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 14d IFA1 | breed:AB|chain:beta|index:38|sex:male|time point:14d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 14d IFA1 | 36 14d IFA1 beta | 36 14d IFA1 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read2_36_14d_IFA1_beta.fq.gz read1_36_14d_IFA1_beta.fq.gz | fastq fastq | 2641709400.0 | 8805698.0 | 36 14d IFA1 beta files | 0:150 1:150 | A:828430279;C:516389015;G:603137557;T:652458512;N:41294037 | 150 | 150 | 828430279 | 516389015 | 603137557 | 652458512 | 41294037 | SRX1583782 | SRS1295615 | SRA353254 | SRA | Bar-Ilan University | 2 | 6e-05 | 0.17777 | 1e-05 | 0.00441 | 0.99991 | 0.99243 | 0.5 | 0.07212 | 150 | 150 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40412 | 40412 | SRR3166928 | SRX1583781 | SRS1295616 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 14d PHA7 | breed:AB|chain:beta|index:41|sex:male|time point:14d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 14d PHA7 | 35 14d PHA7 beta | 35 14d PHA7 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read2_35_14d_PHA7_beta.fq.gz read1_35_14d_PHA7_beta.fq.gz | fastq fastq | 2481744900.0 | 8272483.0 | 35 14d PHA7 beta files | 0:150 1:150 | A:684148801;C:534638425;G:555073374;T:671216692;N:36667608 | 150 | 150 | 684148801 | 534638425 | 555073374 | 671216692 | 36667608 | SRX1583781 | SRS1295616 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.00054 | 0.3447 | 8e-05 | 0.03511 | 0.9991 | 0.97049 | 0.29411 | 0.37357 | 150 | 150 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2017-02-12 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40413 | 40413 | SRR3166927 | SRX1583780 | SRS1295617 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 14d PHA6 | breed:AB|chain:beta|index:40|sex:male|time point:14d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 14d PHA6 | 34 14d PHA6 beta | 34 14d PHA6 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_34_14d_PHA6_beta.fq.gz read2_34_14d_PHA6_beta.fq.gz | fastq fastq | 2149899000.0 | 7166330.0 | 34 14d PHA6 beta files | 0:150 1:150 | A:603640552;C:452244383;G:474826068;T:587177894;N:32010103 | 150 | 150 | 603640552 | 452244383 | 474826068 | 587177894 | 32010103 | SRX1583780 | SRS1295617 | SRA353254 | SRA | Bar-Ilan University | 2 | 4e-05 | 0.16994 | 0.0 | 0.14727 | 0.99991 | 0.99342 | 0.0 | 0.31047 | 150 | 150 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2016-03-02 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 40414 | 40414 | SRR3166926 | SRX1583779 | SRS1295618 | SRP070056 | PRJNA309588 | Analysis of the T cell response in Zebrafish | PRJNA309588 | Other | Our understanding of T cell receptor TCR repertoire diversity and response tochallenge is still incomplete. For example TCR clones shared by different individuals withminimal alteration to germline gene sequences public clones are detectable in all vertebrates but their significance is unknown. We exploited the experimental advantages offered by thezebrafish to analyze the complete TCR repertoire and its response to self and foreign antigens.We found that cross reactive public TCRs dominate the T cell response endowing the TCRrepertoire with the ability to cope with diverse antigenic challenges. These features of vertebratepublic TCRs provide a mechanism for the rapid generation of protective T cell immunityallowing a short temporal window for the development of more specific private T cell responses. | TCRB library 14d PHA5 | breed:AB|chain:beta|index:39|sex:male|time point:14d|tissue:whole fish|age:1y|BioSampleModel:Model organism or animal | TCRb sequencing of zebrafish: whole zebrafish: Sample TCRB library 14d PHA5 | 33 14d PHA5 beta | 33 14d PHA5 beta | five prime RACE amplification of TCRb transcript | AMPLICON | TRANSCRIPTOMIC | RACE | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>300</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>151</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP070056 | read1_33_14d_PHA5_beta.fq.gz read2_33_14d_PHA5_beta.fq.gz | fastq fastq | 4781329500.0 | 15937765.0 | 33 14d PHA5 beta files | 0:150 1:150 | A:1564269921;C:790001191;G:1015752339;T:1331170138;N:80135911 | 150 | 150 | 1564269921 | 790001191 | 1015752339 | 1331170138 | 80135911 | SRX1583779 | SRS1295618 | SRA353254 | SRA | Bar-Ilan University | 2 | 0.00034 | 0.20127 | 0.00018 | 0.00887 | 0.99989 | 0.99567 | 0.05263 | 0.08667 | 150 | 150 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Israel | 2016-03-02 | Undetermined | Undetermined | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 67908 | 67908 | SRR017341 | SRX003632 | SRS002067 | SRP000652 | PRJNA79415 | Zebrafish IgH Sequencing | Zebrafish IgH | Other | 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies. | pubmed:19423829 | Generic sample from Danio rerio | Fish N | Zebrafish IgH cDNA preparation | Zebrafish IgH cDNA FishN | Zebrafish IgH 454 | About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate. | IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP000652 | NonStandardReadNameUsed:true | N_fish.tar | fastq | 40231384.0 | 173756.0 | Zebrafish IgH cDNA FishN | 0:4 1:227.54 | A:10436935;C:8800020;G:9512025;T:11471941;N:10463 | 4 | 227 | 10436935 | 8800020 | 9512025 | 11471941 | 10463 | SRX003632 | SRS002067 | SRA008134 | Stanford University|Quake | Stanford University | 1 | 0.26487 | 0.0663 | 0.99304 | 0.01389 | 229 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-03-31 | Undetermined | Undetermined | BCR TCR repertoire | Hematopoietic System | |||||||||||||||||||||||
| 67909 | 67909 | SRR017340 | SRX003631 | SRS002066 | SRP000652 | PRJNA79415 | Zebrafish IgH Sequencing | Zebrafish IgH | Other | 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies. | pubmed:19423829 | Generic sample from Danio rerio | Fish M | Zebrafish IgH cDNA preparation | Zebrafish IgH cDNA FishM | Zebrafish IgH 454 | About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate. | IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP000652 | NonStandardReadNameUsed:true | M_fish.tar | fastq | 37492198.0 | 161639.0 | Zebrafish IgH cDNA FishM | 0:4 1:227.95 | A:9527141;C:8129088;G:9025760;T:10804127;N:6082 | 4 | 227 | 9527141 | 8129088 | 9025760 | 10804127 | 6082 | SRX003631 | SRS002066 | SRA008134 | Stanford University|Quake | Stanford University | 1 | 0.31521 | 0.11394 | 0.99823 | 0.00291 | 208 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-03-31 | Undetermined | Undetermined | BCR TCR repertoire | Hematopoietic System | |||||||||||||||||||||||
| 67910 | 67910 | SRR017339 | SRX003630 | SRS002065 | SRP000652 | PRJNA79415 | Zebrafish IgH Sequencing | Zebrafish IgH | Other | 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies. | pubmed:19423829 | Generic sample from Danio rerio | Fish L | Zebrafish IgH cDNA preparation | Zebrafish IgH cDNA FishL | Zebrafish IgH 454 | About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate. | IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP000652 | NonStandardReadNameUsed:true | L_fish.tar | fastq | 37971443.0 | 163701.0 | Zebrafish IgH cDNA FishL | 0:4 1:227.96 | A:9544875;C:8363123;G:9094601;T:10963684;N:5160 | 4 | 227 | 9544875 | 8363123 | 9094601 | 10963684 | 5160 | SRX003630 | SRS002065 | SRA008134 | Stanford University|Quake | Stanford University | 1 | 0.29057 | 0.07862 | 0.99636 | 0.00534 | 245 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-03-31 | Undetermined | Undetermined | BCR TCR repertoire | Hematopoietic System | |||||||||||||||||||||||
| 67911 | 67911 | SRR017338 | SRX003629 | SRS002064 | SRP000652 | PRJNA79415 | Zebrafish IgH Sequencing | Zebrafish IgH | Other | 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies. | pubmed:19423829 | Generic sample from Danio rerio | Fish K | Zebrafish IgH cDNA preparation | Zebrafish IgH cDNA FishK | Zebrafish IgH 454 | About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate. | IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP000652 | NonStandardReadNameUsed:true | K_fish.tar | fastq | 54201403.0 | 234266.0 | Zebrafish IgH cDNA FishK | 0:4 1:227.37 | A:13608677;C:11652239;G:12945164;T:15975205;N:20118 | 4 | 227 | 13608677 | 11652239 | 12945164 | 15975205 | 20118 | SRX003629 | SRS002064 | SRA008134 | Stanford University|Quake | Stanford University | 1 | 0.27218 | 0.07987 | 0.99275 | 0.01242 | 244 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-03-31 | Undetermined | Undetermined | BCR TCR repertoire | Hematopoietic System | |||||||||||||||||||||||
| 67912 | 67912 | SRR017337 | SRX003628 | SRS002063 | SRP000652 | PRJNA79415 | Zebrafish IgH Sequencing | Zebrafish IgH | Other | 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies. | pubmed:19423829 | Generic sample from Danio rerio | Fish J | Zebrafish IgH cDNA preparation | Zebrafish IgH cDNA FishJ | Zebrafish IgH 454 | About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate. | IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP000652 | NonStandardReadNameUsed:true | J_fish.tar | fastq | 51915342.0 | 224027.0 | Zebrafish IgH cDNA FishJ | 0:4 1:227.74 | A:12664582;C:12040983;G:12609762;T:14589770;N:10245 | 4 | 227 | 12664582 | 12040983 | 12609762 | 14589770 | 10245 | SRX003628 | SRS002063 | SRA008134 | Stanford University|Quake | Stanford University | 1 | 0.29028 | 0.10039 | 0.9964 | 0.00625 | 97 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-03-31 | Undetermined | Undetermined | BCR TCR repertoire | Hematopoietic System | |||||||||||||||||||||||
| 67913 | 67913 | SRR017336 | SRX003627 | SRS002062 | SRP000652 | PRJNA79415 | Zebrafish IgH Sequencing | Zebrafish IgH | Other | 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies. | pubmed:19423829 | Generic sample from Danio rerio | Fish I | Zebrafish IgH cDNA preparation | Zebrafish IgH cDNA FishI | Zebrafish IgH 454 | About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate. | IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP000652 | NonStandardReadNameUsed:true | I_fish.tar | fastq | 23436268.0 | 100120.0 | Zebrafish IgH cDNA FishI | 0:4 1:230.08 | A:5801823;C:5246438;G:5587169;T:6797624;N:3214 | 4 | 230 | 5801823 | 5246438 | 5587169 | 6797624 | 3214 | SRX003627 | SRS002062 | SRA008134 | Stanford University|Quake | Stanford University | 1 | 0.34362 | 0.0757 | 0.99241 | 0.02647 | 232 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-03-31 | Undetermined | Undetermined | BCR TCR repertoire | Hematopoietic System | |||||||||||||||||||||||
| 67914 | 67914 | SRR017335 | SRX003626 | SRS002061 | SRP000652 | PRJNA79415 | Zebrafish IgH Sequencing | Zebrafish IgH | Other | 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies. | pubmed:19423829 | Generic sample from Danio rerio | Fish H | Zebrafish IgH cDNA preparation | Zebrafish IgH cDNA FishH | Zebrafish IgH 454 | About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate. | IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP000652 | NonStandardReadNameUsed:true | H_fish.tar | fastq | 48443452.0 | 213531.0 | Zebrafish IgH cDNA FishH | 0:4 1:222.87 | A:12720681;C:10490855;G:11923926;T:13303989;N:4001 | 4 | 222 | 12720681 | 10490855 | 11923926 | 13303989 | 4001 | SRX003626 | SRS002061 | SRA008134 | Stanford University|Quake | Stanford University | 1 | 0.45847 | 0.04709 | 0.98754 | 0.0161 | 56 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-03-31 | Undetermined | Undetermined | BCR TCR repertoire | Hematopoietic System | |||||||||||||||||||||||
| 67915 | 67915 | SRR017334 | SRX003625 | SRS002060 | SRP000652 | PRJNA79415 | Zebrafish IgH Sequencing | Zebrafish IgH | Other | 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies. | pubmed:19423829 | Generic sample from Danio rerio | Fish G | Zebrafish IgH cDNA preparation | Zebrafish IgH cDNA FishG | Zebrafish IgH 454 | About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate. | IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP000652 | NonStandardReadNameUsed:true | G_fish.tar | fastq | 50095821.0 | 217866.0 | Zebrafish IgH cDNA FishG | 0:4 1:225.94 | A:13182103;C:11299206;G:11909574;T:13700817;N:4121 | 4 | 225 | 13182103 | 11299206 | 11909574 | 13700817 | 4121 | SRX003625 | SRS002060 | SRA008134 | Stanford University|Quake | Stanford University | 1 | 0.37294 | 0.09947 | 0.99034 | 0.02245 | 230 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-03-31 | Undetermined | Undetermined | BCR TCR repertoire | Hematopoietic System | |||||||||||||||||||||||
| 67916 | 67916 | SRR017333 | SRX003624 | SRS002059 | SRP000652 | PRJNA79415 | Zebrafish IgH Sequencing | Zebrafish IgH | Other | 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies. | pubmed:19423829 | Generic sample from Danio rerio | Fish F | Zebrafish IgH cDNA preparation | Zebrafish IgH cDNA FishF | Zebrafish IgH 454 | About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate. | IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP000652 | NonStandardReadNameUsed:true | F_fish.tar | fastq | 16577798.0 | 83387.0 | Zebrafish IgH cDNA FishF | 0:4 1:194.81 | A:4215316;C:3618457;G:4002690;T:4736893;N:4442 | 4 | 194 | 4215316 | 3618457 | 4002690 | 4736893 | 4442 | SRX003624 | SRS002059 | SRA008134 | Stanford University|Quake | Stanford University | 1 | 0.57361 | 0.0727 | 0.99965 | 0.00026 | 62 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-03-31 | Undetermined | Undetermined | BCR TCR repertoire | Hematopoietic System | |||||||||||||||||||||||
| 67917 | 67917 | SRR017332 | SRX003623 | SRS002058 | SRP000652 | PRJNA79415 | Zebrafish IgH Sequencing | Zebrafish IgH | Other | 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies. | pubmed:19423829 | Generic sample from Danio rerio | Fish E | Zebrafish IgH cDNA preparation | Zebrafish IgH cDNA FishE | Zebrafish IgH 454 | About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate. | IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP000652 | NonStandardReadNameUsed:true | E_fish.tar | fastq | 29705006.0 | 131553.0 | Zebrafish IgH cDNA FishE | 0:4 1:221.80 | A:7474430;C:6417563;G:7115572;T:8693543;N:3898 | 4 | 221 | 7474430 | 6417563 | 7115572 | 8693543 | 3898 | SRX003623 | SRS002058 | SRA008134 | Stanford University|Quake | Stanford University | 1 | 0.3099 | 0.09802 | 0.99904 | 0.00099 | 45 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-03-31 | Undetermined | Undetermined | BCR TCR repertoire | Hematopoietic System | |||||||||||||||||||||||
| 67918 | 67918 | SRR017331 | SRX003622 | SRS002057 | SRP000652 | PRJNA79415 | Zebrafish IgH Sequencing | Zebrafish IgH | Other | 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies. | pubmed:19423829 | Generic sample from Danio rerio | Fish D | Zebrafish IgH cDNA preparation | Zebrafish IgH cDNA FishD | Zebrafish IgH 454 | About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate. | IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP000652 | NonStandardReadNameUsed:true | D_fish.tar | fastq | 27611909.0 | 123468.0 | Zebrafish IgH cDNA FishD | 0:4 1:219.64 | A:6809564;C:6219469;G:6636933;T:7943112;N:2831 | 4 | 219 | 6809564 | 6219469 | 6636933 | 7943112 | 2831 | SRX003622 | SRS002057 | SRA008134 | Stanford University|Quake | Stanford University | 1 | 0.45962 | 0.09396 | 0.99941 | 0.00026 | 218 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-03-31 | Undetermined | Undetermined | BCR TCR repertoire | Hematopoietic System | |||||||||||||||||||||||
| 67919 | 67919 | SRR017330 | SRX003621 | SRS002056 | SRP000652 | PRJNA79415 | Zebrafish IgH Sequencing | Zebrafish IgH | Other | 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies. | pubmed:19423829 | Generic sample from Danio rerio | Fish C | Zebrafish IgH cDNA preparation | Zebrafish IgH cDNA FishC | Zebrafish IgH 454 | About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate. | IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP000652 | NonStandardReadNameUsed:true | C_fish.tar | fastq | 21845405.0 | 95733.0 | Zebrafish IgH cDNA FishC | 0:4 1:224.19 | A:5735195;C:4746747;G:5266352;T:6095066;N:2045 | 4 | 224 | 5735195 | 4746747 | 5266352 | 6095066 | 2045 | SRX003621 | SRS002056 | SRA008134 | Stanford University|Quake | Stanford University | 1 | 0.38908 | 0.20497 | 0.99967 | 0.00047 | 145 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-03-31 | Undetermined | Undetermined | BCR TCR repertoire | Hematopoietic System | |||||||||||||||||||||||
| 67920 | 67920 | SRR017329 | SRX003620 | SRS002055 | SRP000652 | PRJNA79415 | Zebrafish IgH Sequencing | Zebrafish IgH | Other | 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies. | pubmed:19423829 | Generic sample from Danio rerio | Fish B | Zebrafish IgH cDNA preparation | Zebrafish IgH cDNA FishB | Zebrafish IgH 454 | About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate. | IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP000652 | NonStandardReadNameUsed:true | B_fish.tar | fastq | 26680294.0 | 118385.0 | Zebrafish IgH cDNA FishB | 0:4 1:221.37 | A:6380496;C:6168810;G:6541530;T:7587018;N:2440 | 4 | 221 | 6380496 | 6168810 | 6541530 | 7587018 | 2440 | SRX003620 | SRS002055 | SRA008134 | Stanford University|Quake | Stanford University | 1 | 0.35498 | 0.14675 | 0.99906 | 0.00098 | 228 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-03-31 | Undetermined | Undetermined | BCR TCR repertoire | Hematopoietic System | |||||||||||||||||||||||
| 67921 | 67921 | SRR017328 | SRX003619 | SRS002054 | SRP000652 | PRJNA79415 | Zebrafish IgH Sequencing | Zebrafish IgH | Other | 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies. | pubmed:19423829 | Generic sample from Danio rerio | Fish A | Zebrafish IgH cDNA preparation | Zebrafish IgH cDNA FishA | Zebrafish IgH 454 | About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate. | IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP000652 | NonStandardReadNameUsed:true | A_fish.tar | fastq | 13497752.0 | 61111.0 | Zebrafish IgH cDNA FishA | 0:4 1:216.87 | A:3287411;C:3078068;G:3224467;T:3906026;N:1780 | 4 | 216 | 3287411 | 3078068 | 3224467 | 3906026 | 1780 | SRX003619 | SRS002054 | SRA008134 | Stanford University|Quake | Stanford University | 1 | 0.32333 | 0.14098 | 0.99937 | 0.00169 | 52 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-03-31 | Undetermined | Undetermined | BCR TCR repertoire | Hematopoietic System |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;