run_metadata
186 rows where devstage_curation = "Pharyngula" and tissue_curation_coarse = "Cardiovascular System"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 36641 | 36641 | SRR700539 | SRX233125 | SRS393099 | SRP018538 | PRJNA189226 | Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos | GSE44233 | Transcriptome Analysis | The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed. | pubmed:23850773 | Seq15 | GSM1081113 | tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant | Seq15 | Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel. | sorted cardiomyocytes | Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation. | RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol. | Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish. | developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant | GSM1081113 | GSM1081113: Seq15; Danio rerio; RNA Seq | GSM1081113 1 | 1 | GEO Accession:GSM1081113 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP018538 | 1505008521.0 | 29509971.0 | GSM1081113 r1 | 0:51 | A:394410844;C:370013758;G:356489603;T:384055071;N:39245 | 51 | 394410844 | 370013758 | 356489603 | 384055071 | 39245 | SRX233125 | SRS393099 | SRA066447 | GEO | Todd Evans Lab, Cell and Developmental Biology, Weill Cornell | 1 | 0.9123 | 0.07373 | 0.71346 | 0.47555 | 51 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | trueseq | bulk | bulk | bulk | United States | 2013-02-11 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||
| 36642 | 36642 | SRR700538 | SRX233124 | SRS393098 | SRP018538 | PRJNA189226 | Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos | GSE44233 | Transcriptome Analysis | The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed. | pubmed:23850773 | Seq14 | GSM1081112 | tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant | Seq14 | Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel. | sorted cardiomyocytes | Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation. | RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol. | Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish. | developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant | GSM1081112 | GSM1081112: Seq14; Danio rerio; RNA Seq | GSM1081112 1 | 1 | GEO Accession:GSM1081112 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP018538 | seq14.txt.gz | fastq | 3144425502.0 | 61655402.0 | GSM1081112 r1 | 0:51 | A:825172912;C:756354008;G:742919584;T:819897573;N:81425 | 51 | 825172912 | 756354008 | 742919584 | 819897573 | 81425 | SRX233124 | SRS393098 | SRA066447 | GEO | Todd Evans Lab, Cell and Developmental Biology, Weill Cornell | 1 | 0.93659 | 0.0806 | 0.73716 | 0.47614 | 51 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | trueseq | bulk | bulk | bulk | United States | 2013-02-11 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 36643 | 36643 | SRR700537 | SRX233123 | SRS393097 | SRP018538 | PRJNA189226 | Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos | GSE44233 | Transcriptome Analysis | The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed. | pubmed:23850773 | Seq11 | GSM1081111 | tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant | Seq11 | Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel. | sorted cardiomyocytes | Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation. | RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol. | Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish. | developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant | GSM1081111 | GSM1081111: Seq11; Danio rerio; RNA Seq | GSM1081111 1 | 1 | GEO Accession:GSM1081111 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | SRP018538 | 1364181264.0 | 37893924.0 | GSM1081111 r1 | 0:36 | A:362442341;C:297159061;G:406723961;T:297355968;N:499933 | 36 | 362442341 | 297159061 | 406723961 | 297355968 | 499933 | SRX233123 | SRS393097 | SRA066447 | GEO | Todd Evans Lab, Cell and Developmental Biology, Weill Cornell | 1 | 0.67174 | 0.07612 | 0.74416 | 0.48016 | 36 | B | usable mapping rate | illumina | early_illumina | full_length | random_priming | trueseq | bulk | bulk | bulk | United States | 2013-02-11 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||
| 36644 | 36644 | SRR700536 | SRX233122 | SRS393096 | SRP018538 | PRJNA189226 | Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos | GSE44233 | Transcriptome Analysis | The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed. | pubmed:23850773 | Seq13 | GSM1081110 | tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype | Seq13 | Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel. | sorted cardiomyocytes | Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation. | RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol. | Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish. | developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype | GSM1081110 | GSM1081110: Seq13; Danio rerio; RNA Seq | GSM1081110 1 | 1 | GEO Accession:GSM1081110 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP018538 | seq13.txt.gz | fastq | 1693675269.0 | 33209319.0 | GSM1081110 r1 | 0:51 | A:443719209;C:411369010;G:404182982;T:434361031;N:43037 | 51 | 443719209 | 411369010 | 404182982 | 434361031 | 43037 | SRX233122 | SRS393096 | SRA066447 | GEO | Todd Evans Lab, Cell and Developmental Biology, Weill Cornell | 1 | 0.91781 | 0.08107 | 0.74976 | 0.46528 | 51 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | trueseq | bulk | bulk | bulk | United States | 2013-02-11 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 36645 | 36645 | SRR700535 | SRX233121 | SRS393095 | SRP018538 | PRJNA189226 | Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos | GSE44233 | Transcriptome Analysis | The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed. | pubmed:23850773 | Seq5 | GSM1081109 | tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype | Seq5 | Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel. | sorted cardiomyocytes | Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation. | RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol. | Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish. | developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype | GSM1081109 | GSM1081109: Seq5; Danio rerio; RNA Seq | GSM1081109 1 | 1 | GEO Accession:GSM1081109 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | SRP018538 | seq5.txt.gz | fastq | 1245644280.0 | 34601230.0 | GSM1081109 r1 | 0:36 | A:334131135;C:287707996;G:288492153;T:334895459;N:417537 | 36 | 334131135 | 287707996 | 288492153 | 334895459 | 417537 | SRX233121 | SRS393095 | SRA066447 | GEO | Todd Evans Lab, Cell and Developmental Biology, Weill Cornell | 1 | 0.89495 | 0.1058 | 0.74247 | 0.46422 | 36 | B | usable mapping rate | illumina | early_illumina | full_length | random_priming | trueseq | bulk | bulk | bulk | United States | 2013-02-11 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 36646 | 36646 | SRR700534 | SRX233120 | SRS393094 | SRP018538 | PRJNA189226 | Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos | GSE44233 | Transcriptome Analysis | The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed. | pubmed:23850773 | Seq1 | GSM1081108 | tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype | Seq1 | Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel. | sorted cardiomyocytes | Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation. | RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol. | Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish. | developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype | GSM1081108 | GSM1081108: Seq1; Danio rerio; RNA Seq | GSM1081108 1 | 1 | GEO Accession:GSM1081108 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | SRP018538 | seq1.txt.gz | fastq | 929284704.0 | 25813464.0 | GSM1081108 r1 | 0:36 | A:244730361;C:220466820;G:213037296;T:250386569;N:663658 | 36 | 244730361 | 220466820 | 213037296 | 250386569 | 663658 | SRX233120 | SRS393094 | SRA066447 | GEO | Todd Evans Lab, Cell and Developmental Biology, Weill Cornell | 1 | 0.87436 | 0.11629 | 0.73302 | 0.46999 | 36 | B | usable mapping rate | illumina | early_illumina | full_length | random_priming | trueseq | bulk | bulk | bulk | United States | 2013-02-11 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 38364 | 38364 | SRR1793802 | SRX869237 | SRS840014 | SRP053359 | PRJNA274951 | Lymphatic vessels arise from a niche of multipotent angioblasts within the floor of the cardinal vein | GSE65751 | Transcriptome Analysis | How cells acquire their fate is a fundamental question in both developmental and regenerative biology. Multipotent progenitors undergo gradual cell fate restriction in response to temporal and positional cues from the microenvironment the nature of which is far from being clear. In the case of the lymphatic system venous endothelial cells are thought to give rise to lymphatic vessels through a process of trans differentiation. Upon expression of a set of transcription factors venous cells acquire a lymphatic fate and bud out to generate the lymphatic vasculature. In this work we challenge this view and show that while lymphatic endothelial cells LECs do arise in the Cardinal Vein CV they do so from a previously uncharacterized pool of multipotent angioblasts. Using lymphatic specific transgenic zebrafish in combination with endothelial photoconvertible reporters and long term live imaging we demonstrate that these multipotent angioblasts can generate not only lymphatic but also arterious and venous fates. We further reveal that the underlying endoderm serves as a source of Wnt5b which acts as a lymphatic inductive signal promoting the angioblast to lymphatic transition. Moreover Wnt5b induced lymphatic specification in human embryonic stem cells derived vascular progenitors suggesting that this process is evolutionary conserved. Our results uncover a novel mechanism of lymphatic vessel formation whereby multipotent angioblasts and not venous endothelial cells give rise to the lymphatic endothelium and provide the first characterization of their inductive niche. More broadly our findings highlight the CV as a plastic and heterogeneous structure containing different cell populations analogous to the hematopoietic niche in the aortic floor. Overall design: Following Kaede photoconversion of dorsal or ventral halves of the PCV in Tgfli1:gal4;uasKaede embryos at 24 hpf 6 embryos per group were used for FACS isolation of Kaede photconverted red ECs. | pubmed:25992545 | d red ZF sample 0012 | GSM1604058 | tissue:Dorsal endothelial cells|strain:Tgfli1:gal4; uasKaede|developmental stage:24hpf | d red ZF sample 0012 | Libraries were sequenced on the Illumina HiSeq2500 according to standard paired end sequencing protocols. Primary analysis done in RTA 1.17.20 1.13.48 Conversion from BCL to FASTQ and deumltiplexing using CASAVA 1.8 configureBclToFastq.pl fastq cluster count 1234567890 mismatches 0 use bases mask Y15n I6n Y35n Filter and read trimming barcode minimum quality of 20. trimming of read2 to 35 bases not required. CEL Seq Hashimshony et al. 2012 demultiplexing of second mate using first mate barcode allowing no mismatches in barcode. bowtie2 version 2.1.0 against Zv9 genome Read counting with htseq count version 0.5.4p3. Using on Ensemble Zv9 annotations. Reads with the same unique molecular identifiers UMIs were colapsed for transcript counting. Genome build: Zv9 Supplementary files format and content: Tabular expression matrix includes number of transcript molecules. | Dorsal endothelial cells | RNA was isolated using TRIzol with addition of ERCC spike ins and GenElute LPA Sigma The CEL Seq protocol Hashimshony et al. 2012 was used to amplify and sequence. CEL Seq multiplexing barocdes with slite modification were used. Each CEL Seq primer cointained a barcode and a unique moleculare identifier Teemu et al. 2011 | The vPCV vs dPCV endothelial cells were analyzed at 24hpf | strain:Tgfli1:gal4;uasKaede|developmental stage:24hpf | GSM1604058 | GSM1604058: d red ZF sample 0012; Danio rerio; RNA Seq | GSM1604058 | 1 | RNA was isolated using TRIzol with addition of ERCC spike ins and GenElute LPA Sigma The CEL Seq protocol Hashimshony et al. 2012 was used to amplify and sequence. CEL Seq multiplexing barocdes with slite modification were used. Each CEL Seq primer cointained a barcode and a unique moleculare identifier Teemu et al. 2011 | GEO Accession:GSM1604058 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP053359 | d_red_ZF_sample_0012.fastq.gz | fastq | 136949295.0 | 3912837.0 | GSM1604058 r1 | 0:35 | A:38967686;C:29235653;G:29781723;T:38764742;N:199491 | 35 | 38967686 | 29235653 | 29781723 | 38764742 | 199491 | SRX869237 | SRS840014 | SRA236924 | GEO | Itai Yanai, Biology, Technion - Israel Institute of Technology | 1 | 0.50546 | 0.22201 | 0.91524 | 0.49457 | 35 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | celseq | Israel | 2015-02-09 | Pharyngula | Embryo | Endothelium | Cardiovascular System | ||||||||||||||||||
| 38365 | 38365 | SRR1793801 | SRX869236 | SRS840015 | SRP053359 | PRJNA274951 | Lymphatic vessels arise from a niche of multipotent angioblasts within the floor of the cardinal vein | GSE65751 | Transcriptome Analysis | How cells acquire their fate is a fundamental question in both developmental and regenerative biology. Multipotent progenitors undergo gradual cell fate restriction in response to temporal and positional cues from the microenvironment the nature of which is far from being clear. In the case of the lymphatic system venous endothelial cells are thought to give rise to lymphatic vessels through a process of trans differentiation. Upon expression of a set of transcription factors venous cells acquire a lymphatic fate and bud out to generate the lymphatic vasculature. In this work we challenge this view and show that while lymphatic endothelial cells LECs do arise in the Cardinal Vein CV they do so from a previously uncharacterized pool of multipotent angioblasts. Using lymphatic specific transgenic zebrafish in combination with endothelial photoconvertible reporters and long term live imaging we demonstrate that these multipotent angioblasts can generate not only lymphatic but also arterious and venous fates. We further reveal that the underlying endoderm serves as a source of Wnt5b which acts as a lymphatic inductive signal promoting the angioblast to lymphatic transition. Moreover Wnt5b induced lymphatic specification in human embryonic stem cells derived vascular progenitors suggesting that this process is evolutionary conserved. Our results uncover a novel mechanism of lymphatic vessel formation whereby multipotent angioblasts and not venous endothelial cells give rise to the lymphatic endothelium and provide the first characterization of their inductive niche. More broadly our findings highlight the CV as a plastic and heterogeneous structure containing different cell populations analogous to the hematopoietic niche in the aortic floor. Overall design: Following Kaede photoconversion of dorsal or ventral halves of the PCV in Tgfli1:gal4;uasKaede embryos at 24 hpf 6 embryos per group were used for FACS isolation of Kaede photconverted red ECs. | pubmed:25992545 | d red ZF sample 0008 | GSM1604057 | tissue:Dorsal endothelial cells|strain:Tgfli1:gal4; uasKaede|developmental stage:24hpf | d red ZF sample 0008 | Libraries were sequenced on the Illumina HiSeq2500 according to standard paired end sequencing protocols. Primary analysis done in RTA 1.17.20 1.13.48 Conversion from BCL to FASTQ and deumltiplexing using CASAVA 1.8 configureBclToFastq.pl fastq cluster count 1234567890 mismatches 0 use bases mask Y15n I6n Y35n Filter and read trimming barcode minimum quality of 20. trimming of read2 to 35 bases not required. CEL Seq Hashimshony et al. 2012 demultiplexing of second mate using first mate barcode allowing no mismatches in barcode. bowtie2 version 2.1.0 against Zv9 genome Read counting with htseq count version 0.5.4p3. Using on Ensemble Zv9 annotations. Reads with the same unique molecular identifiers UMIs were colapsed for transcript counting. Genome build: Zv9 Supplementary files format and content: Tabular expression matrix includes number of transcript molecules. | Dorsal endothelial cells | RNA was isolated using TRIzol with addition of ERCC spike ins and GenElute LPA Sigma The CEL Seq protocol Hashimshony et al. 2012 was used to amplify and sequence. CEL Seq multiplexing barocdes with slite modification were used. Each CEL Seq primer cointained a barcode and a unique moleculare identifier Teemu et al. 2011 | The vPCV vs dPCV endothelial cells were analyzed at 24hpf | strain:Tgfli1:gal4;uasKaede|developmental stage:24hpf | GSM1604057 | GSM1604057: d red ZF sample 0008; Danio rerio; RNA Seq | GSM1604057 | 1 | RNA was isolated using TRIzol with addition of ERCC spike ins and GenElute LPA Sigma The CEL Seq protocol Hashimshony et al. 2012 was used to amplify and sequence. CEL Seq multiplexing barocdes with slite modification were used. Each CEL Seq primer cointained a barcode and a unique moleculare identifier Teemu et al. 2011 | GEO Accession:GSM1604057 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP053359 | d_red_ZF_sample_0008.fastq.gz | fastq | 230204380.0 | 6577268.0 | GSM1604057 r1 | 0:35 | A:63286154;C:49924891;G:50948035;T:65703538;N:341762 | 35 | 63286154 | 49924891 | 50948035 | 65703538 | 341762 | SRX869236 | SRS840015 | SRA236924 | GEO | Itai Yanai, Biology, Technion - Israel Institute of Technology | 1 | 0.59898 | 0.14092 | 0.89073 | 0.49292 | 35 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | celseq | Israel | 2015-02-09 | Pharyngula | Embryo | Endothelium | Cardiovascular System | ||||||||||||||||||
| 38366 | 38366 | SRR1793800 | SRX869235 | SRS840013 | SRP053359 | PRJNA274951 | Lymphatic vessels arise from a niche of multipotent angioblasts within the floor of the cardinal vein | GSE65751 | Transcriptome Analysis | How cells acquire their fate is a fundamental question in both developmental and regenerative biology. Multipotent progenitors undergo gradual cell fate restriction in response to temporal and positional cues from the microenvironment the nature of which is far from being clear. In the case of the lymphatic system venous endothelial cells are thought to give rise to lymphatic vessels through a process of trans differentiation. Upon expression of a set of transcription factors venous cells acquire a lymphatic fate and bud out to generate the lymphatic vasculature. In this work we challenge this view and show that while lymphatic endothelial cells LECs do arise in the Cardinal Vein CV they do so from a previously uncharacterized pool of multipotent angioblasts. Using lymphatic specific transgenic zebrafish in combination with endothelial photoconvertible reporters and long term live imaging we demonstrate that these multipotent angioblasts can generate not only lymphatic but also arterious and venous fates. We further reveal that the underlying endoderm serves as a source of Wnt5b which acts as a lymphatic inductive signal promoting the angioblast to lymphatic transition. Moreover Wnt5b induced lymphatic specification in human embryonic stem cells derived vascular progenitors suggesting that this process is evolutionary conserved. Our results uncover a novel mechanism of lymphatic vessel formation whereby multipotent angioblasts and not venous endothelial cells give rise to the lymphatic endothelium and provide the first characterization of their inductive niche. More broadly our findings highlight the CV as a plastic and heterogeneous structure containing different cell populations analogous to the hematopoietic niche in the aortic floor. Overall design: Following Kaede photoconversion of dorsal or ventral halves of the PCV in Tgfli1:gal4;uasKaede embryos at 24 hpf 6 embryos per group were used for FACS isolation of Kaede photconverted red ECs. | pubmed:25992545 | V red ZF sample 0011 | GSM1604056 | tissue:Ventral endothelial cells|strain:Tgfli1:gal4; uasKaede|developmental stage:24hpf | V red ZF sample 0011 | Libraries were sequenced on the Illumina HiSeq2500 according to standard paired end sequencing protocols. Primary analysis done in RTA 1.17.20 1.13.48 Conversion from BCL to FASTQ and deumltiplexing using CASAVA 1.8 configureBclToFastq.pl fastq cluster count 1234567890 mismatches 0 use bases mask Y15n I6n Y35n Filter and read trimming barcode minimum quality of 20. trimming of read2 to 35 bases not required. CEL Seq Hashimshony et al. 2012 demultiplexing of second mate using first mate barcode allowing no mismatches in barcode. bowtie2 version 2.1.0 against Zv9 genome Read counting with htseq count version 0.5.4p3. Using on Ensemble Zv9 annotations. Reads with the same unique molecular identifiers UMIs were colapsed for transcript counting. Genome build: Zv9 Supplementary files format and content: Tabular expression matrix includes number of transcript molecules. | Ventral endothelial cells | RNA was isolated using TRIzol with addition of ERCC spike ins and GenElute LPA Sigma The CEL Seq protocol Hashimshony et al. 2012 was used to amplify and sequence. CEL Seq multiplexing barocdes with slite modification were used. Each CEL Seq primer cointained a barcode and a unique moleculare identifier Teemu et al. 2011 | The vPCV vs dPCV endothelial cells were analyzed at 24hpf | strain:Tgfli1:gal4;uasKaede|developmental stage:24hpf | GSM1604056 | GSM1604056: V red ZF sample 0011; Danio rerio; RNA Seq | GSM1604056 | 1 | RNA was isolated using TRIzol with addition of ERCC spike ins and GenElute LPA Sigma The CEL Seq protocol Hashimshony et al. 2012 was used to amplify and sequence. CEL Seq multiplexing barocdes with slite modification were used. Each CEL Seq primer cointained a barcode and a unique moleculare identifier Teemu et al. 2011 | GEO Accession:GSM1604056 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP053359 | V_red_ZF_sample_0011.fastq.gz | fastq | 146319705.0 | 4180563.0 | GSM1604056 r1 | 0:35 | A:40991954;C:30892087;G:32112709;T:42103782;N:219173 | 35 | 40991954 | 30892087 | 32112709 | 42103782 | 219173 | SRX869235 | SRS840013 | SRA236924 | GEO | Itai Yanai, Biology, Technion - Israel Institute of Technology | 1 | 0.57038 | 0.16086 | 0.89014 | 0.53016 | 35 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | celseq | Israel | 2015-02-09 | Pharyngula | Embryo | Endothelium | Cardiovascular System | ||||||||||||||||||
| 38367 | 38367 | SRR1793799 | SRX869234 | SRS840016 | SRP053359 | PRJNA274951 | Lymphatic vessels arise from a niche of multipotent angioblasts within the floor of the cardinal vein | GSE65751 | Transcriptome Analysis | How cells acquire their fate is a fundamental question in both developmental and regenerative biology. Multipotent progenitors undergo gradual cell fate restriction in response to temporal and positional cues from the microenvironment the nature of which is far from being clear. In the case of the lymphatic system venous endothelial cells are thought to give rise to lymphatic vessels through a process of trans differentiation. Upon expression of a set of transcription factors venous cells acquire a lymphatic fate and bud out to generate the lymphatic vasculature. In this work we challenge this view and show that while lymphatic endothelial cells LECs do arise in the Cardinal Vein CV they do so from a previously uncharacterized pool of multipotent angioblasts. Using lymphatic specific transgenic zebrafish in combination with endothelial photoconvertible reporters and long term live imaging we demonstrate that these multipotent angioblasts can generate not only lymphatic but also arterious and venous fates. We further reveal that the underlying endoderm serves as a source of Wnt5b which acts as a lymphatic inductive signal promoting the angioblast to lymphatic transition. Moreover Wnt5b induced lymphatic specification in human embryonic stem cells derived vascular progenitors suggesting that this process is evolutionary conserved. Our results uncover a novel mechanism of lymphatic vessel formation whereby multipotent angioblasts and not venous endothelial cells give rise to the lymphatic endothelium and provide the first characterization of their inductive niche. More broadly our findings highlight the CV as a plastic and heterogeneous structure containing different cell populations analogous to the hematopoietic niche in the aortic floor. Overall design: Following Kaede photoconversion of dorsal or ventral halves of the PCV in Tgfli1:gal4;uasKaede embryos at 24 hpf 6 embryos per group were used for FACS isolation of Kaede photconverted red ECs. | pubmed:25992545 | V red ZF sample 0007 | GSM1604055 | tissue:Ventral endothelial cells|strain:Tgfli1:gal4; uasKaede|developmental stage:24hpf | V red ZF sample 0007 | Libraries were sequenced on the Illumina HiSeq2500 according to standard paired end sequencing protocols. Primary analysis done in RTA 1.17.20 1.13.48 Conversion from BCL to FASTQ and deumltiplexing using CASAVA 1.8 configureBclToFastq.pl fastq cluster count 1234567890 mismatches 0 use bases mask Y15n I6n Y35n Filter and read trimming barcode minimum quality of 20. trimming of read2 to 35 bases not required. CEL Seq Hashimshony et al. 2012 demultiplexing of second mate using first mate barcode allowing no mismatches in barcode. bowtie2 version 2.1.0 against Zv9 genome Read counting with htseq count version 0.5.4p3. Using on Ensemble Zv9 annotations. Reads with the same unique molecular identifiers UMIs were colapsed for transcript counting. Genome build: Zv9 Supplementary files format and content: Tabular expression matrix includes number of transcript molecules. | Ventral endothelial cells | RNA was isolated using TRIzol with addition of ERCC spike ins and GenElute LPA Sigma The CEL Seq protocol Hashimshony et al. 2012 was used to amplify and sequence. CEL Seq multiplexing barocdes with slite modification were used. Each CEL Seq primer cointained a barcode and a unique moleculare identifier Teemu et al. 2011 | The vPCV vs dPCV endothelial cells were analyzed at 24hpf | strain:Tgfli1:gal4;uasKaede|developmental stage:24hpf | GSM1604055 | GSM1604055: V red ZF sample 0007; Danio rerio; RNA Seq | GSM1604055 | 1 | RNA was isolated using TRIzol with addition of ERCC spike ins and GenElute LPA Sigma The CEL Seq protocol Hashimshony et al. 2012 was used to amplify and sequence. CEL Seq multiplexing barocdes with slite modification were used. Each CEL Seq primer cointained a barcode and a unique moleculare identifier Teemu et al. 2011 | GEO Accession:GSM1604055 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP053359 | V_red_ZF_sample_0007.fastq.gz | fastq | 219537045.0 | 6272487.0 | GSM1604055 r1 | 0:35 | A:61562432;C:46586451;G:48274564;T:62792331;N:321267 | 35 | 61562432 | 46586451 | 48274564 | 62792331 | 321267 | SRX869234 | SRS840016 | SRA236924 | GEO | Itai Yanai, Biology, Technion - Israel Institute of Technology | 1 | 0.57949 | 0.1659 | 0.88187 | 0.51446 | 35 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | celseq | Israel | 2015-02-09 | Pharyngula | Embryo | Endothelium | Cardiovascular System | ||||||||||||||||||
| 40971 | 40971 | SRR3498279 | SRX1756825 | SRS1433356 | SRP074847 | PRJNA321312 | mRNAs Establish and Maintain Uniform Cellular Phenotypes during the Architecture of Complex Tissues | GSE81335 | Transcriptome Analysis | Proper functioning of tissues requires cells to behave in uniform well organized ways. Conversely many diseases involve increased cellular heterogeneity due to genetic and epigenetic alterations. Defining the mechanisms that counteract phenotypic variability is therefore critical to understand how tissues sustain homeostasis. Here we carried out a single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single microRNA miRNA genes and multi gene miRNA families. We found that miRNA mutants exhibit a profound increase in cellular phenotypic variability of specific vascular traits. Genome wide analysis of endothelial miRNA target genes identified antagonistic regulatory nodes of vascular growth and morphogenesis signaling that allow variable cell behaviors when derepressed. Remarkably lack of such miRNA activity greatly sensitized the vascular system to microenvironmental changes induced by pharmacological stress. We uncover a previously unrecognized role of miRNAs as a widespread protective mechanism that limits variability in cellular phenotypes. This discovery marks an important advance in our comprehension of how miRNAs function in the physiology of higher organisms. Overall design: Analysis of differential genes expression in Zebrafish endothelial cells for 4 different developmental stages | parent bioproject:PRJNA321317 | pubmed:28350988;pubmed:33273096 | 24hpf E1 | GSM2150743 | source name:Endothelial cell|developmental stage:24 hpf|tissue:Endothelial|stain:GFP | 24hpf E1 | Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to Zv9 whole genome using STAR v2.3.0 Fragments Per Kilobase Of Exon Per Million Fragments Mapped FPKM were calculated using Cufflink software Annotation gtf for Zv9 Genome build: Zv9 Supplementary files format and content: tab delimited text files include FPKM values for each Sample . | Endothelial cell | Transgenic fish were treated with Liberase to dissociate the cells. post FACS sorting the GFP positive RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols | Zebrafish embryos were raised according standard protocols at 28˚C and according to protocols approved by Yale University Institutional Animal Care and Use Committee # 2015 11473. | developmental stage:24 hpf|tissue:Endothelial|stain:GFP | GSM2150743 | GSM2150743: 24hpf E1; Danio rerio; RNA Seq | GSM2150743 | 1 | Transgenic fish were treated with Liberase to dissociate the cells. post FACS sorting the GFP positive RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM2150743 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer | SRP074847 | EF_033_001_ATCACG_L002_R1.fastq.gz | fastq | 426238476.0 | 5608401.0 | GSM2150743 r1 | 0:76 | A:113332066;C:95045840;G:93307502;T:118935708;N:5617360 | 76 | 113332066 | 95045840 | 93307502 | 118935708 | 5617360 | SRX1756825 | SRS1433356 | SRA424807 | GEO | Internal Medicine, Yale University | 1 | 0.88651 | 0.15752 | 0.72805 | 0.48414 | 76 | B | usable mapping rate | illumina | early_illumina | unknown | small_rna | trueseq | bulk | unknown | unknown | United States | 2016-05-11 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||||||||||
| 40977 | 40977 | SRR3498289 | SRX1756835 | SRS1433366 | SRP074848 | PRJNA321321 | microRNAs Establish and Maintain Uniform Cellular Phenotypes during the Architecture of Complex Tissues | GSE81340 | Transcriptome Analysis | Proper functioning of tissues requires cells to behave in uniform well organized ways. Conversely many diseases involve increased cellular heterogeneity due to genetic and epigenetic alterations. Defining the mechanisms that counteract phenotypic variability is therefore critical to understand how tissues sustain homeostasis. Here we carried out a single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single microRNA miRNA genes and multi gene miRNA families. We found that miRNA mutants exhibit a profound increase in cellular phenotypic variability of specific vascular traits. Genome wide analysis of endothelial miRNA target genes identified antagonistic regulatory nodes of vascular growth and morphogenesis signaling that allow variable cell behaviors when derepressed. Remarkably lack of such miRNA activity greatly sensitized the vascular system to microenvironmental changes induced by pharmacological stress. We uncover a previously unrecognized role of miRNAs as a widespread protective mechanism that limits variability in cellular phenotypes. This discovery marks an important advance in our comprehension of how miRNAs function in the physiology of higher organisms. Overall design: Analysis of differential genes expression in Zebrafish endothelial cells for 4 different developmental stages in duplicate | parent bioproject:PRJNA321317 | pubmed:28350988;pubmed:33273096 | NoEndo 24hpf E1 | GSM2150814 | source name:Endothelial cell|developmental stage:24hpf|tissue:Endothelial|stain:GFP | NoEndo 24hpf E1 | Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to Zv9 whole genome using STAR v2.3.0 Fragments Per Kilobase Of Exon Per Million Fragments Mapped FPKM were calculated using Cufflink software Annotation gtf for Zv9 Genome build: Zv9 Supplementary files format and content: tab delimited text files include RPKM values for each Sample ... | Endothelial cell | Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols | Zebrafish embryos were raised according standard protocols at 28˚C and according to protocols approved by Yale University Institutional Animal Care and Use Committee # 2015 11473. | developmental stage:24hpf|tissue:Endothelial|stain:GFP | GSM2150814 | GSM2150814: NoEndo 24hpf E1; Danio rerio; miRNA Seq | GSM2150814 | 1 | Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM2150814 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer | SRP074848 | NoEndo_24hpf_E1.fastq.gz | fastq | 1422085704.0 | 18711654.0 | GSM2150814 r1 | 0:76 | A:347700492;C:356065333;G:376424133;T:341806001;N:89745 | 76 | 347700492 | 356065333 | 376424133 | 341806001 | 89745 | SRX1756835 | SRS1433366 | SRA424808 | GEO | Internal Medicine, Yale University | 1 | 0.0 | 0.0 | 1.0 | 76 | T | under 1.2% mapping rate | illumina | early_illumina | unknown | size_fractionation | trueseq | bulk | unknown | unknown | United States | 2016-05-11 | Pharyngula | Embryo | Endothelium | Cardiovascular System | ||||||||||||||||||
| 40983 | 40983 | SRR3498283 | SRX1756829 | SRS1433360 | SRP074848 | PRJNA321321 | microRNAs Establish and Maintain Uniform Cellular Phenotypes during the Architecture of Complex Tissues | GSE81340 | Transcriptome Analysis | Proper functioning of tissues requires cells to behave in uniform well organized ways. Conversely many diseases involve increased cellular heterogeneity due to genetic and epigenetic alterations. Defining the mechanisms that counteract phenotypic variability is therefore critical to understand how tissues sustain homeostasis. Here we carried out a single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single microRNA miRNA genes and multi gene miRNA families. We found that miRNA mutants exhibit a profound increase in cellular phenotypic variability of specific vascular traits. Genome wide analysis of endothelial miRNA target genes identified antagonistic regulatory nodes of vascular growth and morphogenesis signaling that allow variable cell behaviors when derepressed. Remarkably lack of such miRNA activity greatly sensitized the vascular system to microenvironmental changes induced by pharmacological stress. We uncover a previously unrecognized role of miRNAs as a widespread protective mechanism that limits variability in cellular phenotypes. This discovery marks an important advance in our comprehension of how miRNAs function in the physiology of higher organisms. Overall design: Analysis of differential genes expression in Zebrafish endothelial cells for 4 different developmental stages in duplicate | parent bioproject:PRJNA321317 | pubmed:28350988;pubmed:33273096 | Endo 24hpf E1 | GSM2150808 | source name:Endothelial cell|developmental stage:24hpf|tissue:Endothelial|stain:GFP | Endo 24hpf E1 | Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to Zv9 whole genome using STAR v2.3.0 Fragments Per Kilobase Of Exon Per Million Fragments Mapped FPKM were calculated using Cufflink software Annotation gtf for Zv9 Genome build: Zv9 Supplementary files format and content: tab delimited text files include RPKM values for each Sample ... | Endothelial cell | Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols | Zebrafish embryos were raised according standard protocols at 28˚C and according to protocols approved by Yale University Institutional Animal Care and Use Committee # 2015 11473. | developmental stage:24hpf|tissue:Endothelial|stain:GFP | GSM2150808 | GSM2150808: Endo 24hpf E1; Danio rerio; miRNA Seq | GSM2150808 | 1 | Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM2150808 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer | SRP074848 | Endo_24hpf_E1.fastq.gz | fastq | 1527500440.0 | 20098690.0 | GSM2150808 r1 | 0:76 | A:356712587;C:354608109;G:432977038;T:383106520;N:96186 | 76 | 356712587 | 354608109 | 432977038 | 383106520 | 96186 | SRX1756829 | SRS1433360 | SRA424808 | GEO | Internal Medicine, Yale University | 1 | 0.0 | 0.0 | 1.0 | 76 | T | under 1.2% mapping rate | illumina | early_illumina | unknown | size_fractionation | trueseq | bulk | unknown | unknown | United States | 2016-05-11 | Pharyngula | Embryo | Endothelium | Cardiovascular System | ||||||||||||||||||
| 41146 | 41146 | SRR3742564 | SRX1896783 | SRS1539775 | SRP077871 | PRJNA327749 | Gene expression profiles of endothelial cells from mutants and siblings of tsu3994 | GSE83987 | Transcriptome Analysis | Through RNA seq we report endothelial cells from mutants had 1063 up regulated and 132 down regulated genes >2.0 fold with false discovery rate <0.001 when compared to siblings. Overall design: Examination of gene exprssion profiles of endothelial cells from siblings and mutants of tsu3994 | pubmed:28003365 | Mt | GSM2224910 | tissue:kdrl:GFP+ Endothelial cells|genetic background:tsu3994;Tgkdrl;GFP cross|genotype/variation:Morphologically mutant embryo|Stage:44 hpf type:Endothelial cells | Mt | HCS3.3.20 RTA 2.5.2 and bcl2fastq2 v2.16 were used for basecalling. Sequenced reads were remove reads with adaptors and remove reads in which unknown bases are more than 10% remove reads in which unknown bases are more than 10%.We use Bowtie2 with parameters q phred64 sensitive dpad 0 gbar 99999999 mp 1 1 np 1 score min L 0 0.1 p 16 k 200 to map clean reads to reference gene and use BWA with parameters o 1 e 50 i 50 L k 2 l 31 t 4 q 10 to reference genome Danio rerio.GRCz10.dna.toplevel.fa . RSEM is a quantification tool that computed Maximum likelihood abundance estimates using the Expectation Maximization EM algorithm for its statistical model . FPKM fragment Per Kilobase of gene per Megabase of library size method is used in calculated expression level. Genome build: Zv10 Supplementary files format and content: tab delimited text files include FPKM values for each Sample | kdrl:GFP+ Endothelial cells | Morphologically normal siblings and mutant embryos from crosses of Tgkdrl:GFP; gbf1tsu3994/+ at 44 hpf were dechorionated and disintegrated completely to prepare single cell suspension. Then kdrl:GFP+ ECs were sorted by flow cytomer FACSAria BD and MoFlo XDP BeckMan and positive cells were confirmed by microscopy. Total mRNAs were extracted with RNeasy Mini Kit QIAGEN. The total RNA samples are first treated with DNase I to degrade any possible DNA contamination. Then the mRNA is enriched by using the oligo dT magnetic beads. Mixed with the fragmentation buffer the mRNA is fragmented into short fragments. Then the first strand of cDNA is synthesized by using random hexamer primer. Buffer dNTPs RNase H and DNA polymerase I are added to synthesize the second strand. The double strand cDNA is purified with magnetic beads. End reparation and 3’ end single nucleotide A adenine addition is then performed. Finally sequencing adaptors are ligated to the fragments. The fragments are enriched by PCR amplification.During the QC step Agilent 2100 Bioanaylzer and ABI StepOnePlus Real Time PCR System are used to qualify and quantify of the sample library. The library products are ready for sequencing via Illumina HiSeqTM 2000 or other sequencer when necessary. | genetic background:tsu3994;Tgkdrl;GFP cross|genotype/variation:Morphologically mutant embryo|Stage:44 hpf type:Endothelial cells | GSM2224910 | GSM2224910: Mt; Danio rerio; RNA Seq | GSM2224910 | 1 | Morphologically normal siblings and mutant embryos from crosses of Tgkdrl:GFP; gbf1tsu3994/+ at 44 hpf were dechorionated and disintegrated completely to prepare single cell suspension. Then kdrl:GFP+ ECs were sorted by flow cytomer FACSAria BD and MoFlo XDP BeckMan and positive cells were confirmed by microscopy. Total mRNAs were extracted with RNeasy Mini Kit QIAGEN. The total RNA samples are first treated with DNase I to degrade any possible DNA contamination. Then the mRNA is enriched by using the oligo dT magnetic beads. Mixed with the fragmentation buffer the mRNA is fragmented into short fragments. Then the first strand of cDNA is synthesized by using random hexamer primer. Buffer dNTPs RNase H and DNA polymerase I are added to synthesize the second strand. The double strand cDNA is purified with magnetic beads. End reparation and 3’ end single nucleotide A adenine addition is then performed. Finally sequencing adaptors are ligated to the fragments. The fragments are enriched by PCR amplification.During the QC step Agilent 2100 Bioanaylzer and ABI StepOnePlus Real Time PCR System are used to qualify and quantify of the sample library. The library products are ready for sequencing via Illumina HiSeqTM 2000 or other sequencer when necessary. | GEO Accession:GSM2224910 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 4000 | SRP077871 | 160123_I114_FCH52M2BBXX_L2_WHFISoiqRAABRAAPEI-144_1.fq.gz | fastq | 262444686.0 | 5356014.0 | GSM2224910 r1 | 0:49 | A:66548564;C:63544339;G:66582385;T:65755749;N:13649 | 49 | 66548564 | 63544339 | 66582385 | 65755749 | 13649 | SRX1896783 | SRS1539775 | SRA437681 | GEO | Anming Meng, School of Lifesciences, Tsinghua University | 1 | 0.92714 | 0.05568 | 0.73423 | 0.48371 | 49 | B | usable mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | China | 2016-07-04 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||||||||||||
| 41147 | 41147 | SRR3742565 | SRX1896783 | SRS1539775 | SRP077871 | PRJNA327749 | Gene expression profiles of endothelial cells from mutants and siblings of tsu3994 | GSE83987 | Transcriptome Analysis | Through RNA seq we report endothelial cells from mutants had 1063 up regulated and 132 down regulated genes >2.0 fold with false discovery rate <0.001 when compared to siblings. Overall design: Examination of gene exprssion profiles of endothelial cells from siblings and mutants of tsu3994 | pubmed:28003365 | Mt | GSM2224910 | tissue:kdrl:GFP+ Endothelial cells|genetic background:tsu3994;Tgkdrl;GFP cross|genotype/variation:Morphologically mutant embryo|Stage:44 hpf type:Endothelial cells | Mt | HCS3.3.20 RTA 2.5.2 and bcl2fastq2 v2.16 were used for basecalling. Sequenced reads were remove reads with adaptors and remove reads in which unknown bases are more than 10% remove reads in which unknown bases are more than 10%.We use Bowtie2 with parameters q phred64 sensitive dpad 0 gbar 99999999 mp 1 1 np 1 score min L 0 0.1 p 16 k 200 to map clean reads to reference gene and use BWA with parameters o 1 e 50 i 50 L k 2 l 31 t 4 q 10 to reference genome Danio rerio.GRCz10.dna.toplevel.fa . RSEM is a quantification tool that computed Maximum likelihood abundance estimates using the Expectation Maximization EM algorithm for its statistical model . FPKM fragment Per Kilobase of gene per Megabase of library size method is used in calculated expression level. Genome build: Zv10 Supplementary files format and content: tab delimited text files include FPKM values for each Sample | kdrl:GFP+ Endothelial cells | Morphologically normal siblings and mutant embryos from crosses of Tgkdrl:GFP; gbf1tsu3994/+ at 44 hpf were dechorionated and disintegrated completely to prepare single cell suspension. Then kdrl:GFP+ ECs were sorted by flow cytomer FACSAria BD and MoFlo XDP BeckMan and positive cells were confirmed by microscopy. Total mRNAs were extracted with RNeasy Mini Kit QIAGEN. The total RNA samples are first treated with DNase I to degrade any possible DNA contamination. Then the mRNA is enriched by using the oligo dT magnetic beads. Mixed with the fragmentation buffer the mRNA is fragmented into short fragments. Then the first strand of cDNA is synthesized by using random hexamer primer. Buffer dNTPs RNase H and DNA polymerase I are added to synthesize the second strand. The double strand cDNA is purified with magnetic beads. End reparation and 3’ end single nucleotide A adenine addition is then performed. Finally sequencing adaptors are ligated to the fragments. The fragments are enriched by PCR amplification.During the QC step Agilent 2100 Bioanaylzer and ABI StepOnePlus Real Time PCR System are used to qualify and quantify of the sample library. The library products are ready for sequencing via Illumina HiSeqTM 2000 or other sequencer when necessary. | genetic background:tsu3994;Tgkdrl;GFP cross|genotype/variation:Morphologically mutant embryo|Stage:44 hpf type:Endothelial cells | GSM2224910 | GSM2224910: Mt; Danio rerio; RNA Seq | GSM2224910 | 1 | Morphologically normal siblings and mutant embryos from crosses of Tgkdrl:GFP; gbf1tsu3994/+ at 44 hpf were dechorionated and disintegrated completely to prepare single cell suspension. Then kdrl:GFP+ ECs were sorted by flow cytomer FACSAria BD and MoFlo XDP BeckMan and positive cells were confirmed by microscopy. Total mRNAs were extracted with RNeasy Mini Kit QIAGEN. The total RNA samples are first treated with DNase I to degrade any possible DNA contamination. Then the mRNA is enriched by using the oligo dT magnetic beads. Mixed with the fragmentation buffer the mRNA is fragmented into short fragments. Then the first strand of cDNA is synthesized by using random hexamer primer. Buffer dNTPs RNase H and DNA polymerase I are added to synthesize the second strand. The double strand cDNA is purified with magnetic beads. End reparation and 3’ end single nucleotide A adenine addition is then performed. Finally sequencing adaptors are ligated to the fragments. The fragments are enriched by PCR amplification.During the QC step Agilent 2100 Bioanaylzer and ABI StepOnePlus Real Time PCR System are used to qualify and quantify of the sample library. The library products are ready for sequencing via Illumina HiSeqTM 2000 or other sequencer when necessary. | GEO Accession:GSM2224910 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 4000 | SRP077871 | 160204_I136_FCH55MNBBXX_L6_WHFISoiqRAABRAAPEI-144_1.fq.gz | fastq | 448147973.0 | 9145877.0 | GSM2224910 r2 | 0:49 | A:113623842;C:108767789;G:113689061;T:112055179;N:12102 | 49 | 113623842 | 108767789 | 113689061 | 112055179 | 12102 | SRX1896783 | SRS1539775 | SRA437681 | GEO | Anming Meng, School of Lifesciences, Tsinghua University | 1 | 0.91636 | 0.05377 | 0.73545 | 0.48441 | 49 | B | usable mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | China | 2016-07-04 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||||||||||||
| 41148 | 41148 | SRR3742562 | SRX1896782 | SRS1539774 | SRP077871 | PRJNA327749 | Gene expression profiles of endothelial cells from mutants and siblings of tsu3994 | GSE83987 | Transcriptome Analysis | Through RNA seq we report endothelial cells from mutants had 1063 up regulated and 132 down regulated genes >2.0 fold with false discovery rate <0.001 when compared to siblings. Overall design: Examination of gene exprssion profiles of endothelial cells from siblings and mutants of tsu3994 | pubmed:28003365 | Sib | GSM2224909 | tissue:kdrl:GFP+ Endothelial cells|genetic background:tsu3994;Tgkdrl;GFP cross|genotype/variation:Morphologically normal siblings embryo|Stage:44 hpf type:Endothelial cells | Sib | HCS3.3.20 RTA 2.5.2 and bcl2fastq2 v2.16 were used for basecalling. Sequenced reads were remove reads with adaptors and remove reads in which unknown bases are more than 10% remove reads in which unknown bases are more than 10%.We use Bowtie2 with parameters q phred64 sensitive dpad 0 gbar 99999999 mp 1 1 np 1 score min L 0 0.1 p 16 k 200 to map clean reads to reference gene and use BWA with parameters o 1 e 50 i 50 L k 2 l 31 t 4 q 10 to reference genome Danio rerio.GRCz10.dna.toplevel.fa . RSEM is a quantification tool that computed Maximum likelihood abundance estimates using the Expectation Maximization EM algorithm for its statistical model . FPKM fragment Per Kilobase of gene per Megabase of library size method is used in calculated expression level. Genome build: Zv10 Supplementary files format and content: tab delimited text files include FPKM values for each Sample | kdrl:GFP+ Endothelial cells | Morphologically normal siblings and mutant embryos from crosses of Tgkdrl:GFP; gbf1tsu3994/+ at 44 hpf were dechorionated and disintegrated completely to prepare single cell suspension. Then kdrl:GFP+ ECs were sorted by flow cytomer FACSAria BD and MoFlo XDP BeckMan and positive cells were confirmed by microscopy. Total mRNAs were extracted with RNeasy Mini Kit QIAGEN. The total RNA samples are first treated with DNase I to degrade any possible DNA contamination. Then the mRNA is enriched by using the oligo dT magnetic beads. Mixed with the fragmentation buffer the mRNA is fragmented into short fragments. Then the first strand of cDNA is synthesized by using random hexamer primer. Buffer dNTPs RNase H and DNA polymerase I are added to synthesize the second strand. The double strand cDNA is purified with magnetic beads. End reparation and 3’ end single nucleotide A adenine addition is then performed. Finally sequencing adaptors are ligated to the fragments. The fragments are enriched by PCR amplification.During the QC step Agilent 2100 Bioanaylzer and ABI StepOnePlus Real Time PCR System are used to qualify and quantify of the sample library. The library products are ready for sequencing via Illumina HiSeqTM 2000 or other sequencer when necessary. | genetic background:tsu3994;Tgkdrl;GFP cross|genotype/variation:Morphologically normal siblings embryo|Stage:44 hpf type:Endothelial cells | GSM2224909 | GSM2224909: Sib; Danio rerio; RNA Seq | GSM2224909 | 1 | Morphologically normal siblings and mutant embryos from crosses of Tgkdrl:GFP; gbf1tsu3994/+ at 44 hpf were dechorionated and disintegrated completely to prepare single cell suspension. Then kdrl:GFP+ ECs were sorted by flow cytomer FACSAria BD and MoFlo XDP BeckMan and positive cells were confirmed by microscopy. Total mRNAs were extracted with RNeasy Mini Kit QIAGEN. The total RNA samples are first treated with DNase I to degrade any possible DNA contamination. Then the mRNA is enriched by using the oligo dT magnetic beads. Mixed with the fragmentation buffer the mRNA is fragmented into short fragments. Then the first strand of cDNA is synthesized by using random hexamer primer. Buffer dNTPs RNase H and DNA polymerase I are added to synthesize the second strand. The double strand cDNA is purified with magnetic beads. End reparation and 3’ end single nucleotide A adenine addition is then performed. Finally sequencing adaptors are ligated to the fragments. The fragments are enriched by PCR amplification.During the QC step Agilent 2100 Bioanaylzer and ABI StepOnePlus Real Time PCR System are used to qualify and quantify of the sample library. The library products are ready for sequencing via Illumina HiSeqTM 2000 or other sequencer when necessary. | GEO Accession:GSM2224909 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 4000 | SRP077871 | 160123_I114_FCH52M2BBXX_L2_WHFISoiqRAAARAAPEI-100_1.fq.gz | fastq | 180708423.0 | 3687927.0 | GSM2224909 r1 | 0:49 | A:45675389;C:44261209;G:46002295;T:44768361;N:1169 | 49 | 45675389 | 44261209 | 46002295 | 44768361 | 1169 | SRX1896782 | SRS1539774 | SRA437681 | GEO | Anming Meng, School of Lifesciences, Tsinghua University | 1 | 0.93956 | 0.0479 | 0.75276 | 0.47889 | 49 | B | usable mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | China | 2016-07-04 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||||||||||||
| 41149 | 41149 | SRR3742563 | SRX1896782 | SRS1539774 | SRP077871 | PRJNA327749 | Gene expression profiles of endothelial cells from mutants and siblings of tsu3994 | GSE83987 | Transcriptome Analysis | Through RNA seq we report endothelial cells from mutants had 1063 up regulated and 132 down regulated genes >2.0 fold with false discovery rate <0.001 when compared to siblings. Overall design: Examination of gene exprssion profiles of endothelial cells from siblings and mutants of tsu3994 | pubmed:28003365 | Sib | GSM2224909 | tissue:kdrl:GFP+ Endothelial cells|genetic background:tsu3994;Tgkdrl;GFP cross|genotype/variation:Morphologically normal siblings embryo|Stage:44 hpf type:Endothelial cells | Sib | HCS3.3.20 RTA 2.5.2 and bcl2fastq2 v2.16 were used for basecalling. Sequenced reads were remove reads with adaptors and remove reads in which unknown bases are more than 10% remove reads in which unknown bases are more than 10%.We use Bowtie2 with parameters q phred64 sensitive dpad 0 gbar 99999999 mp 1 1 np 1 score min L 0 0.1 p 16 k 200 to map clean reads to reference gene and use BWA with parameters o 1 e 50 i 50 L k 2 l 31 t 4 q 10 to reference genome Danio rerio.GRCz10.dna.toplevel.fa . RSEM is a quantification tool that computed Maximum likelihood abundance estimates using the Expectation Maximization EM algorithm for its statistical model . FPKM fragment Per Kilobase of gene per Megabase of library size method is used in calculated expression level. Genome build: Zv10 Supplementary files format and content: tab delimited text files include FPKM values for each Sample | kdrl:GFP+ Endothelial cells | Morphologically normal siblings and mutant embryos from crosses of Tgkdrl:GFP; gbf1tsu3994/+ at 44 hpf were dechorionated and disintegrated completely to prepare single cell suspension. Then kdrl:GFP+ ECs were sorted by flow cytomer FACSAria BD and MoFlo XDP BeckMan and positive cells were confirmed by microscopy. Total mRNAs were extracted with RNeasy Mini Kit QIAGEN. The total RNA samples are first treated with DNase I to degrade any possible DNA contamination. Then the mRNA is enriched by using the oligo dT magnetic beads. Mixed with the fragmentation buffer the mRNA is fragmented into short fragments. Then the first strand of cDNA is synthesized by using random hexamer primer. Buffer dNTPs RNase H and DNA polymerase I are added to synthesize the second strand. The double strand cDNA is purified with magnetic beads. End reparation and 3’ end single nucleotide A adenine addition is then performed. Finally sequencing adaptors are ligated to the fragments. The fragments are enriched by PCR amplification.During the QC step Agilent 2100 Bioanaylzer and ABI StepOnePlus Real Time PCR System are used to qualify and quantify of the sample library. The library products are ready for sequencing via Illumina HiSeqTM 2000 or other sequencer when necessary. | genetic background:tsu3994;Tgkdrl;GFP cross|genotype/variation:Morphologically normal siblings embryo|Stage:44 hpf type:Endothelial cells | GSM2224909 | GSM2224909: Sib; Danio rerio; RNA Seq | GSM2224909 | 1 | Morphologically normal siblings and mutant embryos from crosses of Tgkdrl:GFP; gbf1tsu3994/+ at 44 hpf were dechorionated and disintegrated completely to prepare single cell suspension. Then kdrl:GFP+ ECs were sorted by flow cytomer FACSAria BD and MoFlo XDP BeckMan and positive cells were confirmed by microscopy. Total mRNAs were extracted with RNeasy Mini Kit QIAGEN. The total RNA samples are first treated with DNase I to degrade any possible DNA contamination. Then the mRNA is enriched by using the oligo dT magnetic beads. Mixed with the fragmentation buffer the mRNA is fragmented into short fragments. Then the first strand of cDNA is synthesized by using random hexamer primer. Buffer dNTPs RNase H and DNA polymerase I are added to synthesize the second strand. The double strand cDNA is purified with magnetic beads. End reparation and 3’ end single nucleotide A adenine addition is then performed. Finally sequencing adaptors are ligated to the fragments. The fragments are enriched by PCR amplification.During the QC step Agilent 2100 Bioanaylzer and ABI StepOnePlus Real Time PCR System are used to qualify and quantify of the sample library. The library products are ready for sequencing via Illumina HiSeqTM 2000 or other sequencer when necessary. | GEO Accession:GSM2224909 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 4000 | SRP077871 | 160204_I136_FCH55MNBBXX_L6_WHFISoiqRAAARAAPEI-100_1.fq.gz | fastq | 454459418.0 | 9274682.0 | GSM2224909 r2 | 0:49 | A:114982478;C:111450118;G:115561207;T:112452344;N:13271 | 49 | 114982478 | 111450118 | 115561207 | 112452344 | 13271 | SRX1896782 | SRS1539774 | SRA437681 | GEO | Anming Meng, School of Lifesciences, Tsinghua University | 1 | 0.92536 | 0.04644 | 0.75103 | 0.47559 | 49 | B | usable mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | China | 2016-07-04 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||||||||||||
| 41532 | 41532 | SRR5006039 | SRX2337867 | SRS1791085 | SRP092952 | PRJNA352869 | The Biotagging toolkit for analysis of specific cell populations in zebrafish reveals gene regulatory logic encoded in the nuclear transcriptome | GSE89670 | Other | Interrogation of gene regulatory circuits in complex organisms requires precise tools for the selection of individual cell types as well as robust methods for tissue specific labeling and biochemical profiling of target proteins. By exploiting multiple transgenesis strategies we have developed a tissue specific binary in vivo biotinylation system in zebrafish termed "biotagging" a versatile methodology that uses genetically encoded components to biotinylate target proteins enabling in depth genome wide analyses of their molecular interactions. Using tissue specific transgenic drivers and individual cell compartment effector lines from our "biotagging" toolkit we demonstrate the specificity of our approach at the biochemical cellular and transcriptional levels. By characterizing the in vivo transcriptional landscape of migratory neural crest and myocardial cells in two different cellular compartments ribosomes and nucleus we identify a comprehensive network of protein coding and non coding RNAs and uncover cis regulatory modules and regulatory logic conferring cell specific identity embedded in the complexity of the non coding nuclear transcriptomes. Our study demonstrates that "biotagging" eliminates background inherent to complex embryonic environments and allows analyses of molecular interactions in any cellular context at highest resolution. Overall design: Examination of RNA seq and ATAC seq using in vivo biotinylated nuclei and polysomes. | pubmed:28402863 | Myl7 RNASeq Nuclear 26hpf 2 | GSM2386502 | source name:Myl7 RNASeq Nuclear 26hpf|strain/background:AB/TU|tissue:myocardium|developmental stage:26hpf|assay:RNA seq stranded|cellular comp1nt:nuclear|ribodepleted:ribodepleted|isolation method:InVivoBiotinylatedNuclei|strand:reverse | Myl7 RNASeq Nuclear 26hpf 2 | ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using an enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a. BAM files incorporating reads belonging to either DNA strand were generated using custom python script. Genome build: danRer7 Zv9 Supplementary files format and content: bigWig files | Myl7 RNASeq Nuclear 26hpf | Nuclei isolation using biotin tagged outer nuclear envelope adapted from INTACT procedure. Polyribosome isolation using biotin tagged Rpl10 protein adapted from TRAP procedure. FACS procedure using cell specific fluorescent marker following gentle dissociation of embryonic tissue. ATAC procedure adapted from Buenostro et al. 2013 adapted for FACS sorted embryonic cells. RNA pools extracted using RNAqueous Micro Scale Total RNA Isolation Kit. Non directional sequencing libraries post polyA selection of RNA transcripts NEBNext® PolyA mRNA Magnetic Isolation Module NEB were built using NEBnext Ultra RNA library kit for Illumina NEB. Following ribodepletion using Ribo ZeroTM Magnetic Kit Epicentre directional RNA seq libraries were constructed using Stranded RNA Seq Library Preparation Kit KAPABiosystems. | strain/background:AB/TU|tissue:myocardium|developmental stage:26hpf|assay:RNA seq stranded|cellular comp1nt:nuclear|ribodepleted:ribodepleted|isolation method:InVivoBiotinylatedNuclei|strand:reverse | GSM2386502 | GSM2386502: Myl7 RNASeq Nuclear 26hpf 2; Danio rerio; RNA Seq | GSM2386502 | 1 | Nuclei isolation using biotin tagged outer nuclear envelope adapted from INTACT procedure. Polyribosome isolation using biotin tagged Rpl10 protein adapted from TRAP procedure. FACS procedure using cell specific fluorescent marker following gentle dissociation of embryonic tissue. ATAC procedure adapted from Buenostro et al. 2013 adapted for FACS sorted embryonic cells. RNA pools extracted using RNAqueous Micro Scale Total RNA Isolation Kit. Non directional sequencing libraries post polyA selection of RNA transcripts NEBNext® PolyA mRNA Magnetic Isolation Module NEB were built using NEBnext Ultra RNA library kit for Illumina NEB. Following ribodepletion using Ribo ZeroTM Magnetic Kit Epicentre directional RNA seq libraries were constructed using Stranded RNA Seq Library Preparation Kit KAPABiosystems. | GEO Accession:GSM2386502 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP092952 | Myl7_RNASeq_Nuclear_26hpf_2_R1.fastq.gz Myl7_RNASeq_Nuclear_26hpf_2_R2.fastq.gz | fastq fastq | 5163276312.0 | 50620356.0 | GSM2386502 r1 | 0:51 1:51 | A:1144341926;C:1402381884;G:1460666304;T:1155627236;N:258962 | 51 | 51 | 1144341926 | 1402381884 | 1460666304 | 1155627236 | 258962 | SRX2337867 | SRS1791085 | SRA491940 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 2 | 0.79148 | 0.79923 | 0.1676 | 0.16851 | 0.74501 | 0.74395 | 0.44104 | 0.45239 | 51 | 51 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United Kingdom | 2016-11-08 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||
| 41533 | 41533 | SRR5006038 | SRX2337866 | SRS1791086 | SRP092952 | PRJNA352869 | The Biotagging toolkit for analysis of specific cell populations in zebrafish reveals gene regulatory logic encoded in the nuclear transcriptome | GSE89670 | Other | Interrogation of gene regulatory circuits in complex organisms requires precise tools for the selection of individual cell types as well as robust methods for tissue specific labeling and biochemical profiling of target proteins. By exploiting multiple transgenesis strategies we have developed a tissue specific binary in vivo biotinylation system in zebrafish termed "biotagging" a versatile methodology that uses genetically encoded components to biotinylate target proteins enabling in depth genome wide analyses of their molecular interactions. Using tissue specific transgenic drivers and individual cell compartment effector lines from our "biotagging" toolkit we demonstrate the specificity of our approach at the biochemical cellular and transcriptional levels. By characterizing the in vivo transcriptional landscape of migratory neural crest and myocardial cells in two different cellular compartments ribosomes and nucleus we identify a comprehensive network of protein coding and non coding RNAs and uncover cis regulatory modules and regulatory logic conferring cell specific identity embedded in the complexity of the non coding nuclear transcriptomes. Our study demonstrates that "biotagging" eliminates background inherent to complex embryonic environments and allows analyses of molecular interactions in any cellular context at highest resolution. Overall design: Examination of RNA seq and ATAC seq using in vivo biotinylated nuclei and polysomes. | pubmed:28402863 | Myl7 RNASeq Nuclear 26hpf 1 | GSM2386501 | source name:Myl7 RNASeq Nuclear 26hpf|strain/background:AB/TU|tissue:myocardium|developmental stage:26hpf|assay:RNA seq stranded|cellular comp1nt:nuclear|ribodepleted:ribodepleted|isolation method:InVivoBiotinylatedNuclei|strand:reverse | Myl7 RNASeq Nuclear 26hpf 1 | ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using an enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a. BAM files incorporating reads belonging to either DNA strand were generated using custom python script. Genome build: danRer7 Zv9 Supplementary files format and content: bigWig files | Myl7 RNASeq Nuclear 26hpf | Nuclei isolation using biotin tagged outer nuclear envelope adapted from INTACT procedure. Polyribosome isolation using biotin tagged Rpl10 protein adapted from TRAP procedure. FACS procedure using cell specific fluorescent marker following gentle dissociation of embryonic tissue. ATAC procedure adapted from Buenostro et al. 2013 adapted for FACS sorted embryonic cells. RNA pools extracted using RNAqueous Micro Scale Total RNA Isolation Kit. Non directional sequencing libraries post polyA selection of RNA transcripts NEBNext® PolyA mRNA Magnetic Isolation Module NEB were built using NEBnext Ultra RNA library kit for Illumina NEB. Following ribodepletion using Ribo ZeroTM Magnetic Kit Epicentre directional RNA seq libraries were constructed using Stranded RNA Seq Library Preparation Kit KAPABiosystems. | strain/background:AB/TU|tissue:myocardium|developmental stage:26hpf|assay:RNA seq stranded|cellular comp1nt:nuclear|ribodepleted:ribodepleted|isolation method:InVivoBiotinylatedNuclei|strand:reverse | GSM2386501 | GSM2386501: Myl7 RNASeq Nuclear 26hpf 1; Danio rerio; RNA Seq | GSM2386501 | 1 | Nuclei isolation using biotin tagged outer nuclear envelope adapted from INTACT procedure. Polyribosome isolation using biotin tagged Rpl10 protein adapted from TRAP procedure. FACS procedure using cell specific fluorescent marker following gentle dissociation of embryonic tissue. ATAC procedure adapted from Buenostro et al. 2013 adapted for FACS sorted embryonic cells. RNA pools extracted using RNAqueous Micro Scale Total RNA Isolation Kit. Non directional sequencing libraries post polyA selection of RNA transcripts NEBNext® PolyA mRNA Magnetic Isolation Module NEB were built using NEBnext Ultra RNA library kit for Illumina NEB. Following ribodepletion using Ribo ZeroTM Magnetic Kit Epicentre directional RNA seq libraries were constructed using Stranded RNA Seq Library Preparation Kit KAPABiosystems. | GEO Accession:GSM2386501 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP092952 | Myl7_RNASeq_Nuclear_26hpf_1_R1.fastq.gz Myl7_RNASeq_Nuclear_26hpf_1_R2.fastq.gz | fastq fastq | 4985333334.0 | 48875817.0 | GSM2386501 r1 | 0:51 1:51 | A:1030896260;C:1411954598;G:1508330460;T:1033900255;N:251761 | 51 | 51 | 1030896260 | 1411954598 | 1508330460 | 1033900255 | 251761 | SRX2337866 | SRS1791086 | SRA491940 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 2 | 0.7362 | 0.7434 | 0.12786 | 0.12837 | 0.75952 | 0.76065 | 0.47917 | 0.48384 | 51 | 51 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United Kingdom | 2016-11-08 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||
| 43729 | 43729 | SRR6039675 | SRX3187839 | SRS2515287 | SRP117696 | PRJNA407368 | RNA seq timecourse analysis during zebrafish heart looping morphogenesis | PRJNA407368 | Other | During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis. | B30 | time point hpf group:B|multiplex group:2|strain:cmlc2::gfp reporter line|dev stage:30 hpf organism or animal | RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf | B30 | B30 | For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP117696 | 9499X9_130405_SN141_0668_AD2154ACXX_8.txt.gz | fastq | 1120008050.0 | 22400161.0 | 9499X9 130405 SN141 0668 AD2154ACXX 8.txt.gz | 0:50 | A:276093341;C:277073909;G:281519716;T:285221666;N:99418 | 50 | 276093341 | 277073909 | 281519716 | 285221666 | 99418 | SRX3187839 | SRS2515287 | SRA608458 | University of Utah|Neurobiology and Anatomy | University of Utah | 1 | 0.88679 | 0.20435 | 0.77185 | 0.58996 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2017-09-14 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||||||||
| 43730 | 43730 | SRR6039676 | SRX3187838 | SRS2515286 | SRP117696 | PRJNA407368 | RNA seq timecourse analysis during zebrafish heart looping morphogenesis | PRJNA407368 | Other | During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis. | B36 | time point hpf group:B|multiplex group:2|strain:cmlc2::gfp reporter line|dev stage:36 hpf organism or animal | RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf | B36 | B36 | For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP117696 | 9499X10_130405_SN141_0668_AD2154ACXX_8.txt.gz | fastq | 1568417300.0 | 31368346.0 | 9499X10 130405 SN141 0668 AD2154ACXX 8.txt.gz | 0:50 | A:387419891;C:388387212;G:394030807;T:398440283;N:139107 | 50 | 387419891 | 388387212 | 394030807 | 398440283 | 139107 | SRX3187838 | SRS2515286 | SRA608458 | University of Utah|Neurobiology and Anatomy | University of Utah | 1 | 0.89157 | 0.18037 | 0.76286 | 0.63654 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2017-09-14 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||||||||
| 43731 | 43731 | SRR6039677 | SRX3187837 | SRS2515285 | SRP117696 | PRJNA407368 | RNA seq timecourse analysis during zebrafish heart looping morphogenesis | PRJNA407368 | Other | During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis. | A30 | time point hpf group:A|multiplex group:1|strain:cmlc2::gfp reporter line|dev stage:30 hpf organism or animal | RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf | A30 | A30 | For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP117696 | 9499X1_130405_SN141_0668_AD2154ACXX_7.txt.gz | fastq | 1591462700.0 | 31829254.0 | 9499X1 130405 SN141 0668 AD2154ACXX 7.txt.gz | 0:50 | A:340306422;C:441595911;G:442592098;T:366852440;N:115829 | 50 | 340306422 | 441595911 | 442592098 | 366852440 | 115829 | SRX3187837 | SRS2515285 | SRA608458 | University of Utah|Neurobiology and Anatomy | University of Utah | 1 | 0.4932 | 0.13089 | 0.90962 | 0.7432 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2017-09-14 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||||||||
| 43732 | 43732 | SRR6039678 | SRX3187836 | SRS2515284 | SRP117696 | PRJNA407368 | RNA seq timecourse analysis during zebrafish heart looping morphogenesis | PRJNA407368 | Other | During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis. | A36 | time point hpf group:A|multiplex group:1|strain:cmlc2::gfp reporter line|dev stage:36 hpf organism or animal | RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf | A36 | A36 | For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP117696 | 9499X2_130405_SN141_0668_AD2154ACXX_7.txt.gz | fastq | 1328412500.0 | 26568250.0 | 9499X2 130405 SN141 0668 AD2154ACXX 7.txt.gz | 0:50 | A:307478316;C:349102549;G:350562927;T:321170451;N:98257 | 50 | 307478316 | 349102549 | 350562927 | 321170451 | 98257 | SRX3187836 | SRS2515284 | SRA608458 | University of Utah|Neurobiology and Anatomy | University of Utah | 1 | 0.51716 | 0.15839 | 0.86642 | 0.61201 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2017-09-14 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||||||||
| 43733 | 43733 | SRR6039679 | SRX3187835 | SRS2515283 | SRP117696 | PRJNA407368 | RNA seq timecourse analysis during zebrafish heart looping morphogenesis | PRJNA407368 | Other | During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis. | A42 | time point hpf group:A|multiplex group:1|strain:cmlc2::gfp reporter line|dev stage:42 hpf organism or animal | RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf | A42 | A42 | For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP117696 | 9499X3_130405_SN141_0668_AD2154ACXX_7.txt.gz | fastq | 1101079300.0 | 22021586.0 | 9499X3 130405 SN141 0668 AD2154ACXX 7.txt.gz | 0:50 | A:258171407;C:286688991;G:285879983;T:270258877;N:80042 | 50 | 258171407 | 286688991 | 285879983 | 270258877 | 80042 | SRX3187835 | SRS2515283 | SRA608458 | University of Utah|Neurobiology and Anatomy | University of Utah | 1 | 0.35588 | 0.10785 | 0.88116 | 0.69861 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2017-09-14 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||||||||
| 43739 | 43739 | SRR6039685 | SRX3187829 | SRS2515277 | SRP117696 | PRJNA407368 | RNA seq timecourse analysis during zebrafish heart looping morphogenesis | PRJNA407368 | Other | During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis. | C42 | time point hpf group:C|multiplex group:4|strain:cmlc2::gfp reporter line|dev stage:42 hpf organism or animal | RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf | C42 | C42 | For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP117696 | 9499X19_130410_SN141_0670_AD228RACXX_8.txt.gz | fastq | 1404005750.0 | 28080115.0 | 9499X19 130410 SN141 0670 AD228RACXX 8.txt.gz | 0:50 | A:363329939;C:325066287;G:334263296;T:381124430;N:221798 | 50 | 363329939 | 325066287 | 334263296 | 381124430 | 221798 | SRX3187829 | SRS2515277 | SRA608458 | University of Utah|Neurobiology and Anatomy | University of Utah | 1 | 0.84646 | 0.20569 | 0.75856 | 0.66427 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2017-09-14 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||||||||
| 43743 | 43743 | SRR6039689 | SRX3187825 | SRS2515273 | SRP117696 | PRJNA407368 | RNA seq timecourse analysis during zebrafish heart looping morphogenesis | PRJNA407368 | Other | During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis. | C30 | time point hpf group:C|multiplex group:3|strain:cmlc2::gfp reporter line|dev stage:30 hpf organism or animal | RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf | C30 | C30 | For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP117696 | 9499X17_130410_SN141_0670_AD228RACXX_7.txt.gz | fastq | 1261245200.0 | 25224904.0 | 9499X17 130410 SN141 0670 AD228RACXX 7.txt.gz | 0:50 | A:319419875;C:303300361;G:307895242;T:330428818;N:200904 | 50 | 319419875 | 303300361 | 307895242 | 330428818 | 200904 | SRX3187825 | SRS2515273 | SRA608458 | University of Utah|Neurobiology and Anatomy | University of Utah | 1 | 0.87549 | 0.23233 | 0.77325 | 0.65489 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2017-09-14 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||||||||
| 43744 | 43744 | SRR6039690 | SRX3187824 | SRS2515272 | SRP117696 | PRJNA407368 | RNA seq timecourse analysis during zebrafish heart looping morphogenesis | PRJNA407368 | Other | During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis. | C36 | time point hpf group:C|multiplex group:3|strain:cmlc2::gfp reporter line|dev stage:36 hpf organism or animal | RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf | C36 | C36 | For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP117696 | 9499X18_130410_SN141_0670_AD228RACXX_7.txt.gz | fastq | 1263613900.0 | 25272278.0 | 9499X18 130410 SN141 0670 AD228RACXX 7.txt.gz | 0:50 | A:310002055;C:309104393;G:317720866;T:326586067;N:200519 | 50 | 310002055 | 309104393 | 317720866 | 326586067 | 200519 | SRX3187824 | SRS2515272 | SRA608458 | University of Utah|Neurobiology and Anatomy | University of Utah | 1 | 0.84147 | 0.2007 | 0.78839 | 0.61872 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2017-09-14 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||||||||
| 43745 | 43745 | SRR6039691 | SRX3187823 | SRS2515271 | SRP117696 | PRJNA407368 | RNA seq timecourse analysis during zebrafish heart looping morphogenesis | PRJNA407368 | Other | During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis. | B42 | time point hpf group:B|multiplex group:2|strain:cmlc2::gfp reporter line|dev stage:42 hpf organism or animal | RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf | B42 | B42 | For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP117696 | 9499X11_130405_SN141_0668_AD2154ACXX_8.txt.gz | fastq | 1714029850.0 | 34280597.0 | 9499X11 130405 SN141 0668 AD2154ACXX 8.txt.gz | 0:50 | A:341571294;C:484054132;G:501201310;T:387056138;N:146976 | 50 | 341571294 | 484054132 | 501201310 | 387056138 | 146976 | SRX3187823 | SRS2515271 | SRA608458 | University of Utah|Neurobiology and Anatomy | University of Utah | 1 | 0.72224 | 0.18688 | 0.92151 | 0.71808 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2017-09-14 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||||||||
| 48231 | 48231 | SRR7119834 | SRX4041477 | SRS3259001 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 1dpf mut 9 | GSM3131225 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / | Danio rerio RNAseq singleHeart 1dpf mut 9 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / | GSM3131225 | GSM3131225: Danio rerio RNAseq singleHeart 1dpf mut 9; Danio rerio; RNA Seq | GSM3131225 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131225 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | mut_1_9_NDCII_sample_0023.fastq.gz | fastq | 57070136.0 | 762325.0 | GSM3131225 r1 | 0:74.86 | A:18605697;C:9652744;G:12793849;T:15973861;N:43985 | 74 | 18605697 | 9652744 | 12793849 | 15973861 | 43985 | SRX4041477 | SRS3259001 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.65648 | 0.53947 | 0.94448 | 0.46511 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48232 | 48232 | SRR7119833 | SRX4041476 | SRS3258954 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 1dpf mut 7 | GSM3131224 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / | Danio rerio RNAseq singleHeart 1dpf mut 7 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / | GSM3131224 | GSM3131224: Danio rerio RNAseq singleHeart 1dpf mut 7; Danio rerio; RNA Seq | GSM3131224 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131224 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | mut_1_7_NDCII_sample_0020.fastq.gz | fastq | 95756013.0 | 1278688.0 | GSM3131224 r1 | 0:74.89 | A:31571219;C:16875591;G:19112888;T:28125288;N:71027 | 74 | 31571219 | 16875591 | 19112888 | 28125288 | 71027 | SRX4041476 | SRS3258954 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.77787 | 0.38573 | 0.89491 | 0.52033 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48233 | 48233 | SRR7119832 | SRX4041475 | SRS3258953 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 1dpf mut 6 | GSM3131223 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / | Danio rerio RNAseq singleHeart 1dpf mut 6 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / | GSM3131223 | GSM3131223: Danio rerio RNAseq singleHeart 1dpf mut 6; Danio rerio; RNA Seq | GSM3131223 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131223 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | mut_1_6_NDCII_sample_0019.fastq.gz | fastq | 42326230.0 | 565166.0 | GSM3131223 r1 | 0:74.89 | A:13786789;C:7205959;G:8673068;T:12629903;N:30511 | 74 | 13786789 | 7205959 | 8673068 | 12629903 | 30511 | SRX4041475 | SRS3258953 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.81231 | 0.24386 | 0.91662 | 0.54902 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48234 | 48234 | SRR7119831 | SRX4041474 | SRS3258952 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 1dpf mut 5 | GSM3131222 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / | Danio rerio RNAseq singleHeart 1dpf mut 5 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / | GSM3131222 | GSM3131222: Danio rerio RNAseq singleHeart 1dpf mut 5; Danio rerio; RNA Seq | GSM3131222 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131222 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | mut_1_5_NDCII_sample_0018.fastq.gz | fastq | 19727283.0 | 263414.0 | GSM3131222 r1 | 0:74.89 | A:6628087;C:3386996;G:3817542;T:5879595;N:15063 | 74 | 6628087 | 3386996 | 3817542 | 5879595 | 15063 | SRX4041474 | SRS3258952 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.77937 | 0.38158 | 0.93681 | 0.49785 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48235 | 48235 | SRR7119830 | SRX4041473 | SRS3258951 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 1dpf mut 4 | GSM3131221 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / | Danio rerio RNAseq singleHeart 1dpf mut 4 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / | GSM3131221 | GSM3131221: Danio rerio RNAseq singleHeart 1dpf mut 4; Danio rerio; RNA Seq | GSM3131221 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131221 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | mut_1_4_NDCII_sample_0017.fastq.gz | fastq | 58279623.0 | 778471.0 | GSM3131221 r1 | 0:74.86 | A:18649049;C:9706373;G:12497900;T:17382327;N:43974 | 74 | 18649049 | 9706373 | 12497900 | 17382327 | 43974 | SRX4041473 | SRS3258951 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.7618 | 0.36032 | 0.91425 | 0.50881 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48236 | 48236 | SRR7119829 | SRX4041472 | SRS3258950 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 1dpf mut 3 | GSM3131220 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / | Danio rerio RNAseq singleHeart 1dpf mut 3 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / | GSM3131220 | GSM3131220: Danio rerio RNAseq singleHeart 1dpf mut 3; Danio rerio; RNA Seq | GSM3131220 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131220 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | mut_1_3_NDCII_sample_0016.fastq.gz | fastq | 76875810.0 | 1027192.0 | GSM3131220 r1 | 0:74.84 | A:25047740;C:13094049;G:17143346;T:21533451;N:57224 | 74 | 25047740 | 13094049 | 17143346 | 21533451 | 57224 | SRX4041472 | SRS3258950 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.73765 | 0.57489 | 0.91297 | 0.50116 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48237 | 48237 | SRR7119828 | SRX4041471 | SRS3258949 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 1dpf mut 2 | GSM3131219 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / | Danio rerio RNAseq singleHeart 1dpf mut 2 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / | GSM3131219 | GSM3131219: Danio rerio RNAseq singleHeart 1dpf mut 2; Danio rerio; RNA Seq | GSM3131219 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131219 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | mut_1_2_NDCII_sample_0015.fastq.gz | fastq | 279841644.0 | 3736395.0 | GSM3131219 r1 | 0:74.90 | A:89952643;C:48371385;G:56655773;T:84653645;N:208198 | 74 | 89952643 | 48371385 | 56655773 | 84653645 | 208198 | SRX4041471 | SRS3258949 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.83707 | 0.16537 | 0.8449 | 0.51435 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48238 | 48238 | SRR7119827 | SRX4041470 | SRS3258948 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 1dpf mut 1 | GSM3131218 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / | Danio rerio RNAseq singleHeart 1dpf mut 1 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / | GSM3131218 | GSM3131218: Danio rerio RNAseq singleHeart 1dpf mut 1; Danio rerio; RNA Seq | GSM3131218 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131218 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | mut_1_1_NDCII_sample_0014.fastq.gz | fastq | 11439626.0 | 152750.0 | GSM3131218 r1 | 0:74.89 | A:3900812;C:1903149;G:2137242;T:3490826;N:7597 | 74 | 3900812 | 1903149 | 2137242 | 3490826 | 7597 | SRX4041470 | SRS3258948 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.81522 | 0.22036 | 0.9427 | 0.50565 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48239 | 48239 | SRR7119826 | SRX4041469 | SRS3258947 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 1dpf wt 11 | GSM3131217 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ | Danio rerio RNAseq singleHeart 1dpf wt 11 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ | GSM3131217 | GSM3131217: Danio rerio RNAseq singleHeart 1dpf wt 11; Danio rerio; RNA Seq | GSM3131217 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131217 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | W_1_11_NDCII_sample_0013.fastq.gz | fastq | 42251524.0 | 564309.0 | GSM3131217 r1 | 0:74.87 | A:13857230;C:6932231;G:9360286;T:12071859;N:29918 | 74 | 13857230 | 6932231 | 9360286 | 12071859 | 29918 | SRX4041469 | SRS3258947 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.73137 | 0.44634 | 0.93196 | 0.46969 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48240 | 48240 | SRR7119825 | SRX4041468 | SRS3258946 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 1dpf wt 9 | GSM3131216 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ | Danio rerio RNAseq singleHeart 1dpf wt 9 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ | GSM3131216 | GSM3131216: Danio rerio RNAseq singleHeart 1dpf wt 9; Danio rerio; RNA Seq | GSM3131216 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131216 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | W_1_9_NDCII_sample_0010.fastq.gz | fastq | 140217783.0 | 1872511.0 | GSM3131216 r1 | 0:74.88 | A:48060012;C:23208078;G:28722039;T:40121038;N:106616 | 74 | 48060012 | 23208078 | 28722039 | 40121038 | 106616 | SRX4041468 | SRS3258946 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.80665 | 0.32237 | 0.86778 | 0.52038 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48241 | 48241 | SRR7119824 | SRX4041467 | SRS3258945 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 1dpf wt 7 | GSM3131215 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ | Danio rerio RNAseq singleHeart 1dpf wt 7 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ | GSM3131215 | GSM3131215: Danio rerio RNAseq singleHeart 1dpf wt 7; Danio rerio; RNA Seq | GSM3131215 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131215 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | W_1_7_NDCII_sample_0008.fastq.gz | fastq | 23549291.0 | 314631.0 | GSM3131215 r1 | 0:74.85 | A:8015580;C:3998401;G:4892477;T:6623855;N:18978 | 74 | 8015580 | 3998401 | 4892477 | 6623855 | 18978 | SRX4041467 | SRS3258945 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.71017 | 0.48929 | 0.94817 | 0.56724 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48242 | 48242 | SRR7119823 | SRX4041466 | SRS3258944 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 1dpf wt 6 | GSM3131214 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ | Danio rerio RNAseq singleHeart 1dpf wt 6 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ | GSM3131214 | GSM3131214: Danio rerio RNAseq singleHeart 1dpf wt 6; Danio rerio; RNA Seq | GSM3131214 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131214 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | W_1_6_NDCII_sample_0007.fastq.gz | fastq | 129689911.0 | 1732243.0 | GSM3131214 r1 | 0:74.87 | A:40869250;C:21297938;G:30638559;T:36786070;N:98094 | 74 | 40869250 | 21297938 | 30638559 | 36786070 | 98094 | SRX4041466 | SRS3258944 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.77101 | 0.59088 | 0.88824 | 0.5086 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48243 | 48243 | SRR7119822 | SRX4041465 | SRS3258943 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 1dpf wt 5 | GSM3131213 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ | Danio rerio RNAseq singleHeart 1dpf wt 5 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ | GSM3131213 | GSM3131213: Danio rerio RNAseq singleHeart 1dpf wt 5; Danio rerio; RNA Seq | GSM3131213 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131213 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | W_1_5_NDCII_sample_0006.fastq.gz | fastq | 24218974.0 | 323441.0 | GSM3131213 r1 | 0:74.88 | A:8220059;C:3989695;G:4906493;T:7085365;N:17362 | 74 | 8220059 | 3989695 | 4906493 | 7085365 | 17362 | SRX4041465 | SRS3258943 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.76586 | 0.49207 | 0.93501 | 0.55288 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48244 | 48244 | SRR7119821 | SRX4041464 | SRS3258942 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 1dpf wt 4 | GSM3131212 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ | Danio rerio RNAseq singleHeart 1dpf wt 4 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ | GSM3131212 | GSM3131212: Danio rerio RNAseq singleHeart 1dpf wt 4; Danio rerio; RNA Seq | GSM3131212 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131212 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | W_1_4_NDCII_sample_0005.fastq.gz | fastq | 22001311.0 | 293804.0 | GSM3131212 r1 | 0:74.88 | A:7350666;C:3795843;G:4584903;T:6252967;N:16932 | 74 | 7350666 | 3795843 | 4584903 | 6252967 | 16932 | SRX4041464 | SRS3258942 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.7875 | 0.22891 | 0.93835 | 0.52263 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48245 | 48245 | SRR7119820 | SRX4041463 | SRS3258941 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 1dpf wt 3 | GSM3131211 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ | Danio rerio RNAseq singleHeart 1dpf wt 3 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ | GSM3131211 | GSM3131211: Danio rerio RNAseq singleHeart 1dpf wt 3; Danio rerio; RNA Seq | GSM3131211 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131211 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | W_1_3_NDCII_sample_0004.fastq.gz | fastq | 113079916.0 | 1510783.0 | GSM3131211 r1 | 0:74.85 | A:37699535;C:19622685;G:23847263;T:31822581;N:87852 | 74 | 37699535 | 19622685 | 23847263 | 31822581 | 87852 | SRX4041463 | SRS3258941 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.76704 | 0.49567 | 0.89045 | 0.51015 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48246 | 48246 | SRR7119819 | SRX4041462 | SRS3258977 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 1dpf wt 2 | GSM3131210 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ | Danio rerio RNAseq singleHeart 1dpf wt 2 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ | GSM3131210 | GSM3131210: Danio rerio RNAseq singleHeart 1dpf wt 2; Danio rerio; RNA Seq | GSM3131210 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131210 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | W_1_2_NDCII_sample_0003.fastq.gz | fastq | 28758160.0 | 384087.0 | GSM3131210 r1 | 0:74.87 | A:9200574;C:4647591;G:6808365;T:8081607;N:20023 | 74 | 9200574 | 4647591 | 6808365 | 8081607 | 20023 | SRX4041462 | SRS3258977 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.749 | 0.43154 | 0.92498 | 0.50112 | 74 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48247 | 48247 | SRR7119818 | SRX4041461 | SRS3258961 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 1dpf wt 1 | GSM3131209 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ | Danio rerio RNAseq singleHeart 1dpf wt 1 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ | GSM3131209 | GSM3131209: Danio rerio RNAseq singleHeart 1dpf wt 1; Danio rerio; RNA Seq | GSM3131209 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131209 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | W_1_1_NDCII_sample_0002.fastq.gz | fastq | 115972945.0 | 1548390.0 | GSM3131209 r1 | 0:74.90 | A:39437412;C:19997472;G:22424748;T:34023469;N:89844 | 74 | 39437412 | 19997472 | 22424748 | 34023469 | 89844 | SRX4041461 | SRS3258961 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.81745 | 0.22051 | 0.87746 | 0.55768 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 50604 | 50604 | SRR8169175 | SRX4989831 | SRS4025849 | SRP168005 | PRJNA504385 | Endothelial transcriptome of 1dpf Zebrafish empryo | PRJNA504385 | Other | The study aimed to identify endothelial specific transcript isoforms in 24hpf zebrafish embryo. The polyA RNA sequencing was performed on Illumina GA II platform. | Endothelial cells | EC | strain:Tgfli1:EGFP gata1a: dsRed|age:1 dpf stage:1 dpf applicable|tissue:Endothelium|cell type:Endothelial|BioSampleModel:Model organism or animal | Endothelial cells | EC | EC | PolyA RNA Seq | RNA-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina Genome Analyzer IIx | SRP168005 | EC_R1.fastq EC_R2.fastq | fastq fastq | 3373890496.0 | 22196648.0 | EC R1.fastq | 0:76 1:76 | A:984631808;C:769706826;G:812424195;T:790813473;N:16314194 | 76 | 76 | 984631808 | 769706826 | 812424195 | 790813473 | 16314194 | SRX4989831 | SRS4025849 | SRA805845 | CSIR-Institute of Genomics and Integrative Biology|GN Ramachandran Knowledge Center | CSIR-Institute of Genomics and Integrative Biology | 2 | 0.92323 | 0.92543 | 0.07989 | 0.0849 | 0.76842 | 0.77964 | 0.46181 | 0.47429 | 76 | 76 | B | B | biological fallback assumption | illumina | early_illumina | unknown | poly_a | unknown | bulk | unknown | unknown | India | 2019-12-06 | Pharyngula | Embryo | Endothelium | Cardiovascular System | ||||||||||||||||||||
| 50605 | 50605 | SRR8169176 | SRX4989830 | SRS4025850 | SRP168005 | PRJNA504385 | Endothelial transcriptome of 1dpf Zebrafish empryo | PRJNA504385 | Other | The study aimed to identify endothelial specific transcript isoforms in 24hpf zebrafish embryo. The polyA RNA sequencing was performed on Illumina GA II platform. | Non endothelial cells | NEC | strain:Tgfli1:EGFP gata1a: dsRed|age:1 dpf stage:1 dpf applicable|tissue:Whole organism devoid of endothelium|BioSampleModel:Model organism or animal | Non endothelial cells | NEC | NEC | PolyA RNA Seq | RNA-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina Genome Analyzer IIx | SRP168005 | NEC_R2.fastq NEC_R1.fastq | fastq fastq | 3903685432.0 | 25682141.0 | NEC R1.fastq | 0:76 1:76 | A:1078599801;C:913868400;G:942281029;T:950473482;N:18462720 | 76 | 76 | 1078599801 | 913868400 | 942281029 | 950473482 | 18462720 | SRX4989830 | SRS4025850 | SRA805845 | CSIR-Institute of Genomics and Integrative Biology|GN Ramachandran Knowledge Center | CSIR-Institute of Genomics and Integrative Biology | 2 | 0.93037 | 0.92641 | 0.10373 | 0.11231 | 0.72644 | 0.74081 | 0.48329 | 0.48409 | 76 | 76 | B | B | biological fallback assumption | illumina | early_illumina | unknown | poly_a | unknown | bulk | unknown | unknown | India | 2019-12-06 | Pharyngula | Embryo | Endothelium | Cardiovascular System | ||||||||||||||||||||
| 51190 | 51190 | SRR8592250 | SRX5392462 | SRS4380285 | SRP186305 | PRJNA522917 | Pbx4 limits vertebrate heart size and promotes pharyngeal arch artery development through partitioning progenitor fates within the second heart field and restricting proliferation | GSE126647 | Transcriptome Analysis | Development of the vertebrate heart requires the appropriate integration of temporally distinct differentiating progenitor populations. While factors that promote accrual of later differentiating second heart field SHF derived cells to the outflow tract OFT have been intensively investigated few signals are understood that specifically restrict the size of the vertebrate OFT. Here we show that improper specification and proliferation of SHF progenitors in zebrafish lazarus lzr mutants which lack the transcription factor Pbx4 produces enlarged hearts with a specific increase in ventricular cardiomyocytes and smooth muscle cells within the OFT. Specifically optogenetic lineage tracing demonstrates Pbx4 initially promotes the proper partitioning of the SHF into anterior progenitors which contribute to the OFT and adjacent endothelial cell progenitors which contribute to posterior pharyngeal arch arteries. Subsequently Pbx4 also limits the size of the SHF through repressing SHF progenitor proliferation. Single cell RNA sequencing of nkx2.5+ cells revealed that the enlarged SHF progenitor population within Pbx4 deficient embryos assimilates characteristics of normally distinct proliferative and more anterior differentiated cardiomyocyte populations. Therefore the generation of proper OFT size and great arteries in vertebrates requires Pbx dependent stratification of unique progenitor differentiation states to facilitate homeotic like transformations and limit progenitor production within the SHF. Overall design: To determine the effects of Pbx4 loss on cardiac progenitors and differentiated cardiomyocytes we utilized single cell RNA Seq scRNA Seq data sets collected from control and Pbx4 depleted embryos nkx2.5:ZsYellow+ cells at 28 hours post ferlilization. The 10x Genomics platform was used for these studies version 2 library chemistry. | pubmed:32094112 | Pbx4 depleted nkx2.5:ZsYellow+ cells 10X Genomics single cell RNA Seq | GSM3610371 | source name:Pbx4 depleted nkx2.5:ZsYellow+ cells|strain background:AB/TU|age:28 hpf depleted|tissue:cardiac progenitors and cardiomyocytes|cell type:nkx2.5:ZsYellow+ cells | Pbx4 depleted nkx2.5:ZsYellow+ cells 10X Genomics single cell RNA Seq | Illumina HiSeq2500 used for basecalling CellRanger software package used for alignment filtering barcode reading prior to post processing with ICGS in AltAnalyze. Genome build: GRCz10/danRer10 Supplementary files format and content: 10X Genomics Chromium Raw Gene BC Cellular Barcodes barcode.tsv Genes genes.tsv and Matrix matrix.mtx | Pbx4 depleted nkx2.5:ZsYellow+ cells | Nkx2.5:ZsYellow+ cells from control and Pbx4 depleted embryos were isolated via FACS at 28 hpf. Dissociation of embryos was performed as described by Stachura and Traver 2016 with the following modifications approximately 180 embryos per condition were manually dechorionated and rinsed in ice cold Hank’s Balance Salt Solution HBSS containing Ca2+ and Mg2+. Embryos were subsequently transferred to 1.5ml tubes in 500 µl HBSS and dissociation was initiated by adding 60 µl Liberase Roche. Embryos were deyolked by pipetting up and down first with a p1000 tip and subsequently with a p100 tip as described by Samsa et al. 2016. Following yolk removal embryos were incubated at 32.5°C. To facilitate dissociation embryos were gently homogenized using a handheld pestle homogenizer 5 10 seconds and returned to 32.5°C. This process was repeated until complete dissociation was achieved which took approximately 15 minutes. Dissociation of embryos was monitored using a dissecting microscope. Following dissociation cell suspensions were centrifuged for 5 minutes at 13 000 rpm at 4°C. The supernatant was discarded and the resulting pellets were resuspended in 500 µl of FACS medium consisting of 0.9X PBS and 2% fetal bovine serum FBS. Samples were filtered twice through a 40 µm strainer and collected in a FACs tube. FACS sorting was performed by the CCHMC Research Flow Cytometry Core using a 70 µm nozzle and a gating strategy as described by Samsa et al. 2016. The 10X Genomics Chromium Instrument and cDNA synthesis kit 10x Genomics was used by the CCHMC Genomics core to generate a barcoded cDNA library for single cell RNA sequencing from approximately 4 000 cells. cDNA library quality was determined using an Agilent Bioanalyzer. Using this library we performed one full lane sequence on two paired end 75bp Flow Cells using on an Illumina HiSeq2500. 10X Genomics Chromium v2 chemistry | strain background:AB/TU|age:28 hpf depleted|tissue:cardiac progenitors and cardiomyocytes|cell type:nkx2.5:ZsYellow+ cells | GSM3610371 | GSM3610371: Pbx4 depleted nkx2.5:ZsYellow+ cells 10X Genomics single cell RNA Seq; Danio rerio; RNA Seq | GSM3610371 | 1 | Nkx2.5:ZsYellow+ cells from control and Pbx4 depleted embryos were isolated via FACS at 28 hpf. Dissociation of embryos was performed as described by Stachura and Traver 2016 with the following modifications approximately 180 embryos per condition were manually dechorionated and rinsed in ice cold Hank's Balance Salt Solution HBSS containing Ca2+ and Mg2+. Embryos were subsequently transferred to 1.5ml tubes in 500 µl HBSS and dissociation was initiated by adding 60 µl Liberase Roche. Embryos were deyolked by pipetting up and down first with a p1000 tip and subsequently with a p100 tip as described by Samsa et al. 2016. Following yolk removal embryos were incubated at 32.5°C. To facilitate dissociation embryos were gently homogenized using a handheld pestle homogenizer 5 10 seconds and returned to 32.5°C. This process was repeated until complete dissociation was achieved which took approximately 15 minutes. Dissociation of embryos was monitored using a dissecting microscope. Following dissociation cell suspensions were centrifuged for 5 minutes at 13 000 rpm at 4°C. The supernatant was discarded and the resulting pellets were resuspended in 500 µl of FACS medium consisting of 0.9X PBS and 2% fetal bovine serum FBS. Samples were filtered twice through a 40 µm strainer and collected in a FACs tube. FACS sorting was performed by the CCHMC Research Flow Cytometry Core using a 70 µm nozzle and a gating strategy as described by Samsa et al. 2016. The 10X Genomics Chromium Instrument and cDNA synthesis kit 10x Genomics was used by the CCHMC Genomics core to generate a barcoded cDNA library for single cell RNA sequencing from approximately 4 000 cells. cDNA library quality was determined using an Agilent Bioanalyzer. Using this library we performed one full lane sequence on two paired end 75bp Flow Cells using on an Illumina HiSeq2500. 10X Genomics Chromium v2 chemistry | GEO Accession:GSM3610371 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP186305 | loader:fastq load.py|options: platform=Illumina readTypes=TTB read1PairFiles=10X PBX4 mo injected 3zf S2 L001 I1 001.fastq.gz read2PairFiles=10X PBX4 mo injected 3zf S2 L001 R1 001.fastq.gz read3PairFiles=10X PBX4 mo injected 3zf S2 L001 R2 001.fastq.gz | 10X_PBX4_mo_injected_3zf_S2_L001_I1_001.fastq.gz 10X_PBX4_mo_injected_3zf_S2_L001_R1_001.fastq.gz 10X_PBX4_mo_injected_3zf_S2_L001_R2_001.fastq.gz | fastq fastq fastq | 13771731610.0 | 75668855.0 | GSM3610371 r1 | 0:8 1:27 2:147 | A:3868981340;C:3004344480;G:3173242889;T:3705905113;N:19257788 | 8 | 27 | 147 | 3868981340 | 3004344480 | 3173242889 | 3705905113 | 19257788 | SRX5392462 | SRS4380285 | SRA850447 | GEO | Nathan Salomonis, Biomedical Informatics, Cincinnati Children's Hospital | 1 | 0.91532 | 0.07049 | 0.82722 | 0.50962 | 147 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2019-02-15 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||
| 51191 | 51191 | SRR8592251 | SRX5392462 | SRS4380285 | SRP186305 | PRJNA522917 | Pbx4 limits vertebrate heart size and promotes pharyngeal arch artery development through partitioning progenitor fates within the second heart field and restricting proliferation | GSE126647 | Transcriptome Analysis | Development of the vertebrate heart requires the appropriate integration of temporally distinct differentiating progenitor populations. While factors that promote accrual of later differentiating second heart field SHF derived cells to the outflow tract OFT have been intensively investigated few signals are understood that specifically restrict the size of the vertebrate OFT. Here we show that improper specification and proliferation of SHF progenitors in zebrafish lazarus lzr mutants which lack the transcription factor Pbx4 produces enlarged hearts with a specific increase in ventricular cardiomyocytes and smooth muscle cells within the OFT. Specifically optogenetic lineage tracing demonstrates Pbx4 initially promotes the proper partitioning of the SHF into anterior progenitors which contribute to the OFT and adjacent endothelial cell progenitors which contribute to posterior pharyngeal arch arteries. Subsequently Pbx4 also limits the size of the SHF through repressing SHF progenitor proliferation. Single cell RNA sequencing of nkx2.5+ cells revealed that the enlarged SHF progenitor population within Pbx4 deficient embryos assimilates characteristics of normally distinct proliferative and more anterior differentiated cardiomyocyte populations. Therefore the generation of proper OFT size and great arteries in vertebrates requires Pbx dependent stratification of unique progenitor differentiation states to facilitate homeotic like transformations and limit progenitor production within the SHF. Overall design: To determine the effects of Pbx4 loss on cardiac progenitors and differentiated cardiomyocytes we utilized single cell RNA Seq scRNA Seq data sets collected from control and Pbx4 depleted embryos nkx2.5:ZsYellow+ cells at 28 hours post ferlilization. The 10x Genomics platform was used for these studies version 2 library chemistry. | pubmed:32094112 | Pbx4 depleted nkx2.5:ZsYellow+ cells 10X Genomics single cell RNA Seq | GSM3610371 | source name:Pbx4 depleted nkx2.5:ZsYellow+ cells|strain background:AB/TU|age:28 hpf depleted|tissue:cardiac progenitors and cardiomyocytes|cell type:nkx2.5:ZsYellow+ cells | Pbx4 depleted nkx2.5:ZsYellow+ cells 10X Genomics single cell RNA Seq | Illumina HiSeq2500 used for basecalling CellRanger software package used for alignment filtering barcode reading prior to post processing with ICGS in AltAnalyze. Genome build: GRCz10/danRer10 Supplementary files format and content: 10X Genomics Chromium Raw Gene BC Cellular Barcodes barcode.tsv Genes genes.tsv and Matrix matrix.mtx | Pbx4 depleted nkx2.5:ZsYellow+ cells | Nkx2.5:ZsYellow+ cells from control and Pbx4 depleted embryos were isolated via FACS at 28 hpf. Dissociation of embryos was performed as described by Stachura and Traver 2016 with the following modifications approximately 180 embryos per condition were manually dechorionated and rinsed in ice cold Hank’s Balance Salt Solution HBSS containing Ca2+ and Mg2+. Embryos were subsequently transferred to 1.5ml tubes in 500 µl HBSS and dissociation was initiated by adding 60 µl Liberase Roche. Embryos were deyolked by pipetting up and down first with a p1000 tip and subsequently with a p100 tip as described by Samsa et al. 2016. Following yolk removal embryos were incubated at 32.5°C. To facilitate dissociation embryos were gently homogenized using a handheld pestle homogenizer 5 10 seconds and returned to 32.5°C. This process was repeated until complete dissociation was achieved which took approximately 15 minutes. Dissociation of embryos was monitored using a dissecting microscope. Following dissociation cell suspensions were centrifuged for 5 minutes at 13 000 rpm at 4°C. The supernatant was discarded and the resulting pellets were resuspended in 500 µl of FACS medium consisting of 0.9X PBS and 2% fetal bovine serum FBS. Samples were filtered twice through a 40 µm strainer and collected in a FACs tube. FACS sorting was performed by the CCHMC Research Flow Cytometry Core using a 70 µm nozzle and a gating strategy as described by Samsa et al. 2016. The 10X Genomics Chromium Instrument and cDNA synthesis kit 10x Genomics was used by the CCHMC Genomics core to generate a barcoded cDNA library for single cell RNA sequencing from approximately 4 000 cells. cDNA library quality was determined using an Agilent Bioanalyzer. Using this library we performed one full lane sequence on two paired end 75bp Flow Cells using on an Illumina HiSeq2500. 10X Genomics Chromium v2 chemistry | strain background:AB/TU|age:28 hpf depleted|tissue:cardiac progenitors and cardiomyocytes|cell type:nkx2.5:ZsYellow+ cells | GSM3610371 | GSM3610371: Pbx4 depleted nkx2.5:ZsYellow+ cells 10X Genomics single cell RNA Seq; Danio rerio; RNA Seq | GSM3610371 | 1 | Nkx2.5:ZsYellow+ cells from control and Pbx4 depleted embryos were isolated via FACS at 28 hpf. Dissociation of embryos was performed as described by Stachura and Traver 2016 with the following modifications approximately 180 embryos per condition were manually dechorionated and rinsed in ice cold Hank's Balance Salt Solution HBSS containing Ca2+ and Mg2+. Embryos were subsequently transferred to 1.5ml tubes in 500 µl HBSS and dissociation was initiated by adding 60 µl Liberase Roche. Embryos were deyolked by pipetting up and down first with a p1000 tip and subsequently with a p100 tip as described by Samsa et al. 2016. Following yolk removal embryos were incubated at 32.5°C. To facilitate dissociation embryos were gently homogenized using a handheld pestle homogenizer 5 10 seconds and returned to 32.5°C. This process was repeated until complete dissociation was achieved which took approximately 15 minutes. Dissociation of embryos was monitored using a dissecting microscope. Following dissociation cell suspensions were centrifuged for 5 minutes at 13 000 rpm at 4°C. The supernatant was discarded and the resulting pellets were resuspended in 500 µl of FACS medium consisting of 0.9X PBS and 2% fetal bovine serum FBS. Samples were filtered twice through a 40 µm strainer and collected in a FACs tube. FACS sorting was performed by the CCHMC Research Flow Cytometry Core using a 70 µm nozzle and a gating strategy as described by Samsa et al. 2016. The 10X Genomics Chromium Instrument and cDNA synthesis kit 10x Genomics was used by the CCHMC Genomics core to generate a barcoded cDNA library for single cell RNA sequencing from approximately 4 000 cells. cDNA library quality was determined using an Agilent Bioanalyzer. Using this library we performed one full lane sequence on two paired end 75bp Flow Cells using on an Illumina HiSeq2500. 10X Genomics Chromium v2 chemistry | GEO Accession:GSM3610371 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP186305 | loader:fastq load.py|options: platform=Illumina readTypes=TTB read1PairFiles=10X PBX4 mo injected 3zf S2 L002 I1 001.fastq.gz read2PairFiles=10X PBX4 mo injected 3zf S2 L002 R1 001.fastq.gz read3PairFiles=10X PBX4 mo injected 3zf S2 L002 R2 001.fastq.gz | 10X_PBX4_mo_injected_3zf_S2_L002_I1_001.fastq.gz 10X_PBX4_mo_injected_3zf_S2_L002_R1_001.fastq.gz 10X_PBX4_mo_injected_3zf_S2_L002_R2_001.fastq.gz | fastq fastq fastq | 13960104704.0 | 76703872.0 | GSM3610371 r2 | 0:8 1:27 2:147 | A:3921736827;C:3045954411;G:3216708567;T:3758217760;N:17487139 | 8 | 27 | 147 | 3921736827 | 3045954411 | 3216708567 | 3758217760 | 17487139 | SRX5392462 | SRS4380285 | SRA850447 | GEO | Nathan Salomonis, Biomedical Informatics, Cincinnati Children's Hospital | 1 | 0.91469 | 0.06915 | 0.82747 | 0.49959 | 147 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2019-02-15 | Pharyngula | Embryo | Heart | Cardiovascular System | ||||||||||||||||
| 52764 | 52764 | SRR9207199 | SRX5978265 | SRS4884520 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq MO DP R1hi rep3 | GSM3855057 | source name:haemogenic endothelium|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:haemogenic endothelium|genotype/variation:runx1 morpholino injected | RNA seq MO DP R1hi rep3 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | haemogenic endothelium | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:haemogenic endothelium|genotype/variation:runx1 morpholino injected | GSM3855057 | GSM3855057: MO DP R1hi rep3; Danio rerio; RNA Seq | GSM3855057 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855057 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236896_268_1_pair.fq.gz WTCHG_236896_268_2_pair.fq.gz | fastq fastq | 1927186907.0 | 13135764.0 | GSM3855057 r1 | 0:74.85 1:71.86 | A:495349382;C:442938837;G:459765161;T:529104158;N:29369 | 74 | 71 | 495349382 | 442938837 | 459765161 | 529104158 | 29369 | SRX5978265 | SRS4884520 | SRA894667 | GEO | Oxford University | 2 | 0.9511 | 0.71957 | 0.05876 | 0.04975 | 0.80322 | 0.83463 | 0.41847 | 0.47909 | 75 | 64 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52765 | 52765 | SRR9207200 | SRX5978265 | SRS4884520 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq MO DP R1hi rep3 | GSM3855057 | source name:haemogenic endothelium|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:haemogenic endothelium|genotype/variation:runx1 morpholino injected | RNA seq MO DP R1hi rep3 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | haemogenic endothelium | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:haemogenic endothelium|genotype/variation:runx1 morpholino injected | GSM3855057 | GSM3855057: MO DP R1hi rep3; Danio rerio; RNA Seq | GSM3855057 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855057 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236897_268_1_pair.fq.gz WTCHG_236897_268_2_pair.fq.gz | fastq fastq | 1909528693.0 | 13017658.0 | GSM3855057 r2 | 0:74.82 1:71.87 | A:490710971;C:436487071;G:453444216;T:528853285;N:33150 | 74 | 71 | 490710971 | 436487071 | 453444216 | 528853285 | 33150 | SRX5978265 | SRS4884520 | SRA894667 | GEO | Oxford University | 2 | 0.94988 | 0.70903 | 0.05941 | 0.04918 | 0.80346 | 0.83597 | 0.42243 | 0.48127 | 74 | 69 | B | B | mate2-mate1 similar by mapping diff | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52766 | 52766 | SRR9207197 | SRX5978264 | SRS4884519 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq MO DP R1hi rep2 | GSM3855056 | source name:haemogenic endothelium|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:haemogenic endothelium|genotype/variation:runx1 morpholino injected | RNA seq MO DP R1hi rep2 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | haemogenic endothelium | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:haemogenic endothelium|genotype/variation:runx1 morpholino injected | GSM3855056 | GSM3855056: MO DP R1hi rep2; Danio rerio; RNA Seq | GSM3855056 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855056 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236896_253_2_pair.fq.gz WTCHG_236896_253_1_pair.fq.gz | fastq fastq | 2328318316.0 | 15846855.0 | GSM3855056 r1 | 0:74.86 1:72.07 | A:595900608;C:546479100;G:562297908;T:623605072;N:35628 | 74 | 72 | 595900608 | 546479100 | 562297908 | 623605072 | 35628 | SRX5978264 | SRS4884519 | SRA894667 | GEO | Oxford University | 2 | 0.95426 | 0.78099 | 0.04531 | 0.04107 | 0.79285 | 0.81738 | 0.47636 | 0.47393 | 74 | 74 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52767 | 52767 | SRR9207198 | SRX5978264 | SRS4884519 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq MO DP R1hi rep2 | GSM3855056 | source name:haemogenic endothelium|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:haemogenic endothelium|genotype/variation:runx1 morpholino injected | RNA seq MO DP R1hi rep2 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | haemogenic endothelium | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:haemogenic endothelium|genotype/variation:runx1 morpholino injected | GSM3855056 | GSM3855056: MO DP R1hi rep2; Danio rerio; RNA Seq | GSM3855056 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855056 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236897_253_1_pair.fq.gz WTCHG_236897_253_2_pair.fq.gz | fastq fastq | 2302889916.0 | 15678935.0 | GSM3855056 r2 | 0:74.83 1:72.05 | A:589414837;C:537423117;G:553631542;T:622379721;N:40699 | 74 | 72 | 589414837 | 537423117 | 553631542 | 622379721 | 40699 | SRX5978264 | SRS4884519 | SRA894667 | GEO | Oxford University | 2 | 0.95316 | 0.76729 | 0.04543 | 0.04 | 0.79368 | 0.81994 | 0.4793 | 0.45619 | 74 | 73 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52768 | 52768 | SRR9207195 | SRX5978263 | SRS4884518 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq MO DP R1hi rep1 | GSM3855055 | source name:haemogenic endothelium|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:haemogenic endothelium|genotype/variation:runx1 morpholino injected | RNA seq MO DP R1hi rep1 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | haemogenic endothelium | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:haemogenic endothelium|genotype/variation:runx1 morpholino injected | GSM3855055 | GSM3855055: MO DP R1hi rep1; Danio rerio; RNA Seq | GSM3855055 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855055 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236896_246_1_pair.fq.gz WTCHG_236896_246_2_pair.fq.gz | fastq fastq | 2117580563.0 | 14386411.0 | GSM3855055 r1 | 0:74.87 1:72.33 | A:541407670;C:500318189;G:514959635;T:560861522;N:33547 | 74 | 72 | 541407670 | 500318189 | 514959635 | 560861522 | 33547 | SRX5978263 | SRS4884518 | SRA894667 | GEO | Oxford University | 2 | 0.95698 | 0.79806 | 0.0412 | 0.03838 | 0.79683 | 0.82073 | 0.4361 | 0.47246 | 75 | 74 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52769 | 52769 | SRR9207196 | SRX5978263 | SRS4884518 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq MO DP R1hi rep1 | GSM3855055 | source name:haemogenic endothelium|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:haemogenic endothelium|genotype/variation:runx1 morpholino injected | RNA seq MO DP R1hi rep1 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | haemogenic endothelium | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:haemogenic endothelium|genotype/variation:runx1 morpholino injected | GSM3855055 | GSM3855055: MO DP R1hi rep1; Danio rerio; RNA Seq | GSM3855055 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855055 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236897_246_1_pair.fq.gz WTCHG_236897_246_2_pair.fq.gz | fastq fastq | 2093566860.0 | 14226227.0 | GSM3855055 r2 | 0:74.83 1:72.33 | A:535219614;C:492666345;G:507484718;T:558158640;N:37543 | 74 | 72 | 535219614 | 492666345 | 507484718 | 558158640 | 37543 | SRX5978263 | SRS4884518 | SRA894667 | GEO | Oxford University | 2 | 0.95586 | 0.7889 | 0.04114 | 0.03868 | 0.79689 | 0.82104 | 0.43998 | 0.46953 | 74 | 47 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52770 | 52770 | SRR9207193 | SRX5978262 | SRS4884517 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq MO DN rep3 | GSM3855054 | source name:non endothelial tissue|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:non endothelial tissue|genotype/variation:runx1 morpholino injected | RNA seq MO DN rep3 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | non endothelial tissue | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:non endothelial tissue|genotype/variation:runx1 morpholino injected | GSM3855054 | GSM3855054: MO DN rep3; Danio rerio; RNA Seq | GSM3855054 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855054 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236896_269_1_pair.fq.gz WTCHG_236896_269_2_pair.fq.gz | fastq fastq | 2046617161.0 | 13945847.0 | GSM3855054 r1 | 0:74.83 1:71.93 | A:534129043;C:466415284;G:478200001;T:567840465;N:32368 | 74 | 71 | 534129043 | 466415284 | 478200001 | 567840465 | 32368 | SRX5978262 | SRS4884517 | SRA894667 | GEO | Oxford University | 2 | 0.94896 | 0.77373 | 0.08658 | 0.07153 | 0.73519 | 0.76715 | 0.49305 | 0.48341 | 75 | 74 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52771 | 52771 | SRR9207194 | SRX5978262 | SRS4884517 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq MO DN rep3 | GSM3855054 | source name:non endothelial tissue|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:non endothelial tissue|genotype/variation:runx1 morpholino injected | RNA seq MO DN rep3 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | non endothelial tissue | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:non endothelial tissue|genotype/variation:runx1 morpholino injected | GSM3855054 | GSM3855054: MO DN rep3; Danio rerio; RNA Seq | GSM3855054 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855054 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236897_269_1_pair.fq.gz WTCHG_236897_269_2_pair.fq.gz | fastq fastq | 2013937570.0 | 13725739.0 | GSM3855054 r2 | 0:74.79 1:71.93 | A:525460437;C:456678849;G:468917277;T:562845673;N:35334 | 74 | 71 | 525460437 | 456678849 | 468917277 | 562845673 | 35334 | SRX5978262 | SRS4884517 | SRA894667 | GEO | Oxford University | 2 | 0.94917 | 0.76456 | 0.08857 | 0.07125 | 0.73541 | 0.76777 | 0.49906 | 0.49093 | 74 | 44 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52772 | 52772 | SRR9207191 | SRX5978261 | SRS4884516 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq MO DN rep2 | GSM3855053 | source name:non endothelial tissue|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:non endothelial tissue|genotype/variation:runx1 morpholino injected | RNA seq MO DN rep2 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | non endothelial tissue | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:non endothelial tissue|genotype/variation:runx1 morpholino injected | GSM3855053 | GSM3855053: MO DN rep2; Danio rerio; RNA Seq | GSM3855053 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855053 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236896_254_1_pair.fq.gz WTCHG_236896_254_2_pair.fq.gz | fastq fastq | 2491569443.0 | 17007413.0 | GSM3855053 r1 | 0:74.84 1:71.66 | A:650887336;C:562551977;G:579971830;T:698120812;N:37488 | 74 | 71 | 650887336 | 562551977 | 579971830 | 698120812 | 37488 | SRX5978261 | SRS4884516 | SRA894667 | GEO | Oxford University | 2 | 0.95058 | 0.74758 | 0.08565 | 0.06922 | 0.74817 | 0.78344 | 0.49706 | 0.48533 | 74 | 74 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52773 | 52773 | SRR9207192 | SRX5978261 | SRS4884516 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq MO DN rep2 | GSM3855053 | source name:non endothelial tissue|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:non endothelial tissue|genotype/variation:runx1 morpholino injected | RNA seq MO DN rep2 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | non endothelial tissue | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:non endothelial tissue|genotype/variation:runx1 morpholino injected | GSM3855053 | GSM3855053: MO DN rep2; Danio rerio; RNA Seq | GSM3855053 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855053 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236897_254_1_pair.fq.gz WTCHG_236897_254_2_pair.fq.gz | fastq fastq | 2467826388.0 | 16847563.0 | GSM3855053 r2 | 0:74.80 1:71.67 | A:644767348;C:554488060;G:572473532;T:696053759;N:43689 | 74 | 71 | 644767348 | 554488060 | 572473532 | 696053759 | 43689 | SRX5978261 | SRS4884516 | SRA894667 | GEO | Oxford University | 2 | 0.95097 | 0.73759 | 0.0857 | 0.0679 | 0.74805 | 0.78307 | 0.50597 | 0.48761 | 74 | 59 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52774 | 52774 | SRR9207189 | SRX5978260 | SRS4884515 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq MO DN rep1 | GSM3855052 | source name:non endothelial tissue|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:non endothelial tissue|genotype/variation:runx1 morpholino injected | RNA seq MO DN rep1 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | non endothelial tissue | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:non endothelial tissue|genotype/variation:runx1 morpholino injected | GSM3855052 | GSM3855052: MO DN rep1; Danio rerio; RNA Seq | GSM3855052 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855052 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236896_247_1_pair.fq.gz WTCHG_236896_247_2_pair.fq.gz | fastq fastq | 1764365530.0 | 12029530.0 | GSM3855052 r1 | 0:74.84 1:71.83 | A:466613214;C:395400217;G:407881798;T:494443051;N:27250 | 74 | 71 | 466613214 | 395400217 | 407881798 | 494443051 | 27250 | SRX5978260 | SRS4884515 | SRA894667 | GEO | Oxford University | 2 | 0.95055 | 0.76043 | 0.0868 | 0.07313 | 0.75436 | 0.79295 | 0.51961 | 0.5131 | 75 | 74 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52775 | 52775 | SRR9207190 | SRX5978260 | SRS4884515 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq MO DN rep1 | GSM3855052 | source name:non endothelial tissue|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:non endothelial tissue|genotype/variation:runx1 morpholino injected | RNA seq MO DN rep1 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | non endothelial tissue | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:non endothelial tissue|genotype/variation:runx1 morpholino injected | GSM3855052 | GSM3855052: MO DN rep1; Danio rerio; RNA Seq | GSM3855052 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855052 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236897_247_1_pair.fq.gz WTCHG_236897_247_2_pair.fq.gz | fastq fastq | 1746830974.0 | 11912737.0 | GSM3855052 r2 | 0:74.80 1:71.83 | A:461791276;C:389648653;G:402516938;T:492843307;N:30800 | 74 | 71 | 461791276 | 389648653 | 402516938 | 492843307 | 30800 | SRX5978260 | SRS4884515 | SRA894667 | GEO | Oxford University | 2 | 0.94945 | 0.75002 | 0.08645 | 0.07146 | 0.75564 | 0.79247 | 0.52424 | 0.51007 | 74 | 74 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52776 | 52776 | SRR9207187 | SRX5978259 | SRS4884514 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq Wt DP R1hi rep3 | GSM3855051 | source name:haemogenic endothelium|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:haemogenic endothelium|genotype/variation:non injected | RNA seq Wt DP R1hi rep3 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | haemogenic endothelium | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:haemogenic endothelium|genotype/variation:non injected | GSM3855051 | GSM3855051: Wt DP R1hi rep3; Danio rerio; RNA Seq | GSM3855051 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855051 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236896_256_1_pair.fq.gz WTCHG_236896_256_2_pair.fq.gz | fastq fastq | 2404346186.0 | 16361688.0 | GSM3855051 r1 | 0:74.85 1:72.10 | A:623840845;C:555338266;G:572145582;T:652983438;N:38055 | 74 | 72 | 623840845 | 555338266 | 572145582 | 652983438 | 38055 | SRX5978259 | SRS4884514 | SRA894667 | GEO | Oxford University | 2 | 0.95156 | 0.77737 | 0.06227 | 0.05592 | 0.78013 | 0.80811 | 0.47747 | 0.46476 | 75 | 74 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52777 | 52777 | SRR9207188 | SRX5978259 | SRS4884514 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq Wt DP R1hi rep3 | GSM3855051 | source name:haemogenic endothelium|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:haemogenic endothelium|genotype/variation:non injected | RNA seq Wt DP R1hi rep3 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | haemogenic endothelium | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:haemogenic endothelium|genotype/variation:non injected | GSM3855051 | GSM3855051: Wt DP R1hi rep3; Danio rerio; RNA Seq | GSM3855051 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855051 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236897_256_1_pair.fq.gz WTCHG_236897_256_2_pair.fq.gz | fastq fastq | 2376933896.0 | 16184470.0 | GSM3855051 r2 | 0:74.81 1:72.05 | A:616256503;C:545472678;G:562708331;T:652453993;N:42391 | 74 | 72 | 616256503 | 545472678 | 562708331 | 652453993 | 42391 | SRX5978259 | SRS4884514 | SRA894667 | GEO | Oxford University | 2 | 0.95009 | 0.76216 | 0.06391 | 0.05506 | 0.78131 | 0.81051 | 0.48169 | 0.4736 | 74 | 74 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52778 | 52778 | SRR9207185 | SRX5978258 | SRS4884513 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq Wt DP R1hi rep2 | GSM3855050 | source name:haemogenic endothelium|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:haemogenic endothelium|genotype/variation:non injected | RNA seq Wt DP R1hi rep2 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | haemogenic endothelium | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:haemogenic endothelium|genotype/variation:non injected | GSM3855050 | GSM3855050: Wt DP R1hi rep2; Danio rerio; RNA Seq | GSM3855050 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855050 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236896_249_1_pair.fq.gz WTCHG_236896_249_2_pair.fq.gz | fastq fastq | 2143701223.0 | 14577609.0 | GSM3855050 r1 | 0:74.85 1:72.21 | A:556710384;C:496467692;G:509166690;T:581322427;N:34030 | 74 | 72 | 556710384 | 496467692 | 509166690 | 581322427 | 34030 | SRX5978258 | SRS4884513 | SRA894667 | GEO | Oxford University | 2 | 0.94754 | 0.79028 | 0.06346 | 0.05688 | 0.7811 | 0.80754 | 0.47106 | 0.45364 | 75 | 74 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52779 | 52779 | SRR9207186 | SRX5978258 | SRS4884513 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq Wt DP R1hi rep2 | GSM3855050 | source name:haemogenic endothelium|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:haemogenic endothelium|genotype/variation:non injected | RNA seq Wt DP R1hi rep2 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | haemogenic endothelium | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:haemogenic endothelium|genotype/variation:non injected | GSM3855050 | GSM3855050: Wt DP R1hi rep2; Danio rerio; RNA Seq | GSM3855050 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855050 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236897_249_1_pair.fq.gz WTCHG_236897_249_2_pair.fq.gz | fastq fastq | 2117035142.0 | 14401911.0 | GSM3855050 r2 | 0:74.82 1:72.18 | A:549829321;C:487941130;G:501062541;T:578164319;N:37831 | 74 | 72 | 549829321 | 487941130 | 501062541 | 578164319 | 37831 | SRX5978258 | SRS4884513 | SRA894667 | GEO | Oxford University | 2 | 0.9478 | 0.78326 | 0.06392 | 0.05622 | 0.78271 | 0.80764 | 0.46978 | 0.44622 | 74 | 74 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52780 | 52780 | SRR9207183 | SRX5978257 | SRS4884512 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq Wt DP R1hi rep1 | GSM3855049 | source name:haemogenic endothelium|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:haemogenic endothelium|genotype/variation:non injected | RNA seq Wt DP R1hi rep1 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | haemogenic endothelium | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:haemogenic endothelium|genotype/variation:non injected | GSM3855049 | GSM3855049: Wt DP R1hi rep1; Danio rerio; RNA Seq | GSM3855049 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855049 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236896_242_1_pair.fq.gz WTCHG_236896_242_2_pair.fq.gz | fastq fastq | 2095674074.0 | 14243567.0 | GSM3855049 r1 | 0:74.85 1:72.28 | A:541444792;C:489580880;G:501484244;T:563130979;N:33179 | 74 | 72 | 541444792 | 489580880 | 501484244 | 563130979 | 33179 | SRX5978257 | SRS4884512 | SRA894667 | GEO | Oxford University | 2 | 0.95275 | 0.80515 | 0.0503 | 0.0447 | 0.78827 | 0.81028 | 0.47691 | 0.47164 | 74 | 74 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52781 | 52781 | SRR9207184 | SRX5978257 | SRS4884512 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq Wt DP R1hi rep1 | GSM3855049 | source name:haemogenic endothelium|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:haemogenic endothelium|genotype/variation:non injected | RNA seq Wt DP R1hi rep1 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | haemogenic endothelium | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:haemogenic endothelium|genotype/variation:non injected | GSM3855049 | GSM3855049: Wt DP R1hi rep1; Danio rerio; RNA Seq | GSM3855049 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855049 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236897_242_1_pair.fq.gz WTCHG_236897_242_2_pair.fq.gz | fastq fastq | 2063492969.0 | 14026048.0 | GSM3855049 r2 | 0:74.82 1:72.30 | A:533045811;C:480334040;G:492421855;T:557653783;N:37480 | 74 | 72 | 533045811 | 480334040 | 492421855 | 557653783 | 37480 | SRX5978257 | SRS4884512 | SRA894667 | GEO | Oxford University | 2 | 0.95243 | 0.79788 | 0.04971 | 0.04343 | 0.7878 | 0.81016 | 0.48035 | 0.46512 | 74 | 74 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52782 | 52782 | SRR9207181 | SRX5978256 | SRS4884511 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq Wt DP R1med rep3 | GSM3855048 | source name:aortic endothelium|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:aortic endothelium|genotype/variation:non injected | RNA seq Wt DP R1med rep3 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | aortic endothelium | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:aortic endothelium|genotype/variation:non injected | GSM3855048 | GSM3855048: Wt DP R1med rep3; Danio rerio; RNA Seq | GSM3855048 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855048 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236896_265_1_pair.fq.gz WTCHG_236896_265_2_pair.fq.gz | fastq fastq | 1745443128.0 | 11892304.0 | GSM3855048 r1 | 0:74.86 1:71.91 | A:453150216;C:403838492;G:414952890;T:473474634;N:26896 | 74 | 71 | 453150216 | 403838492 | 414952890 | 473474634 | 26896 | SRX5978256 | SRS4884511 | SRA894667 | GEO | Oxford University | 2 | 0.95301 | 0.78351 | 0.0658 | 0.06097 | 0.78368 | 0.80941 | 0.47251 | 0.4445 | 75 | 74 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52783 | 52783 | SRR9207182 | SRX5978256 | SRS4884511 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq Wt DP R1med rep3 | GSM3855048 | source name:aortic endothelium|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:aortic endothelium|genotype/variation:non injected | RNA seq Wt DP R1med rep3 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | aortic endothelium | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:aortic endothelium|genotype/variation:non injected | GSM3855048 | GSM3855048: Wt DP R1med rep3; Danio rerio; RNA Seq | GSM3855048 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855048 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236897_265_1_pair.fq.gz WTCHG_236897_265_2_pair.fq.gz | fastq fastq | 1728817726.0 | 11782024.0 | GSM3855048 r2 | 0:74.82 1:71.91 | A:448845759;C:398200726;G:409703125;T:472037424;N:30692 | 74 | 71 | 448845759 | 398200726 | 409703125 | 472037424 | 30692 | SRX5978256 | SRS4884511 | SRA894667 | GEO | Oxford University | 2 | 0.9518 | 0.77329 | 0.06602 | 0.05955 | 0.78423 | 0.81051 | 0.47776 | 0.46478 | 74 | 74 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52784 | 52784 | SRR9207179 | SRX5978255 | SRS4884510 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq Wt DP R1med rep2 | GSM3855047 | source name:aortic endothelium|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:aortic endothelium|genotype/variation:non injected | RNA seq Wt DP R1med rep2 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | aortic endothelium | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:aortic endothelium|genotype/variation:non injected | GSM3855047 | GSM3855047: Wt DP R1med rep2; Danio rerio; RNA Seq | GSM3855047 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855047 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236896_250_1_pair.fq.gz WTCHG_236896_250_2_pair.fq.gz | fastq fastq | 2096576707.0 | 14262609.0 | GSM3855047 r1 | 0:74.87 1:72.13 | A:536583711;C:491572815;G:509433296;T:558953949;N:32936 | 74 | 72 | 536583711 | 491572815 | 509433296 | 558953949 | 32936 | SRX5978255 | SRS4884510 | SRA894667 | GEO | Oxford University | 2 | 0.95719 | 0.76406 | 0.04256 | 0.03937 | 0.7989 | 0.82856 | 0.40968 | 0.4591 | 75 | 74 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52785 | 52785 | SRR9207180 | SRX5978255 | SRS4884510 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq Wt DP R1med rep2 | GSM3855047 | source name:aortic endothelium|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:aortic endothelium|genotype/variation:non injected | RNA seq Wt DP R1med rep2 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | aortic endothelium | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:aortic endothelium|genotype/variation:non injected | GSM3855047 | GSM3855047: Wt DP R1med rep2; Danio rerio; RNA Seq | GSM3855047 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855047 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236897_250_1_pair.fq.gz WTCHG_236897_250_2_pair.fq.gz | fastq fastq | 2081468598.0 | 14169082.0 | GSM3855047 r2 | 0:74.83 1:72.07 | A:532025059;C:484883611;G:503099767;T:561423564;N:36597 | 74 | 72 | 532025059 | 484883611 | 503099767 | 561423564 | 36597 | SRX5978255 | SRS4884510 | SRA894667 | GEO | Oxford University | 2 | 0.95742 | 0.74712 | 0.04275 | 0.03741 | 0.79922 | 0.82866 | 0.40398 | 0.46313 | 74 | 74 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52786 | 52786 | SRR9207177 | SRX5978254 | SRS4884509 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq Wt DP R1med rep1 | GSM3855046 | source name:aortic endothelium|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:aortic endothelium|genotype/variation:non injected | RNA seq Wt DP R1med rep1 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | aortic endothelium | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:aortic endothelium|genotype/variation:non injected | GSM3855046 | GSM3855046: Wt DP R1med rep1; Danio rerio; RNA Seq | GSM3855046 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855046 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236896_243_1_pair.fq.gz WTCHG_236896_243_2_pair.fq.gz | fastq fastq | 2011950216.0 | 13680917.0 | GSM3855046 r1 | 0:74.86 1:72.20 | A:511635564;C:476475475;G:489688294;T:534119393;N:31490 | 74 | 72 | 511635564 | 476475475 | 489688294 | 534119393 | 31490 | SRX5978254 | SRS4884509 | SRA894667 | GEO | Oxford University | 2 | 0.9571 | 0.78471 | 0.03658 | 0.03396 | 0.80247 | 0.8268 | 0.48025 | 0.46265 | 74 | 74 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52787 | 52787 | SRR9207178 | SRX5978254 | SRS4884509 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq Wt DP R1med rep1 | GSM3855046 | source name:aortic endothelium|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:aortic endothelium|genotype/variation:non injected | RNA seq Wt DP R1med rep1 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | aortic endothelium | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:aortic endothelium|genotype/variation:non injected | GSM3855046 | GSM3855046: Wt DP R1med rep1; Danio rerio; RNA Seq | GSM3855046 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855046 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236897_243_1_pair.fq.gz WTCHG_236897_243_2_pair.fq.gz | fastq fastq | 1979368927.0 | 13461179.0 | GSM3855046 r2 | 0:74.83 1:72.21 | A:503539205;C:467446638;G:480794441;T:527553577;N:35066 | 74 | 72 | 503539205 | 467446638 | 480794441 | 527553577 | 35066 | SRX5978254 | SRS4884509 | SRA894667 | GEO | Oxford University | 2 | 0.95558 | 0.78357 | 0.03711 | 0.03412 | 0.80318 | 0.82664 | 0.42185 | 0.46216 | 74 | 64 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52788 | 52788 | SRR9207175 | SRX5978253 | SRS4884508 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq Wt DP R1lo rep3 | GSM3855045 | source name:aortic endothelium|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:aortic endothelium|genotype/variation:non injected | RNA seq Wt DP R1lo rep3 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | aortic endothelium | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:aortic endothelium|genotype/variation:non injected | GSM3855045 | GSM3855045: Wt DP R1lo rep3; Danio rerio; RNA Seq | GSM3855045 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855045 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236896_266_1_pair.fq.gz WTCHG_236896_266_2_pair.fq.gz | fastq fastq | 2022090059.0 | 13752247.0 | GSM3855045 r1 | 0:74.84 1:72.20 | A:529671943;C:466470156;G:476864148;T:549051395;N:32417 | 74 | 72 | 529671943 | 466470156 | 476864148 | 549051395 | 32417 | SRX5978253 | SRS4884508 | SRA894667 | GEO | Oxford University | 2 | 0.94638 | 0.80375 | 0.07924 | 0.06889 | 0.76098 | 0.78636 | 0.4888 | 0.46168 | 74 | 74 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52789 | 52789 | SRR9207176 | SRX5978253 | SRS4884508 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq Wt DP R1lo rep3 | GSM3855045 | source name:aortic endothelium|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:aortic endothelium|genotype/variation:non injected | RNA seq Wt DP R1lo rep3 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | aortic endothelium | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:aortic endothelium|genotype/variation:non injected | GSM3855045 | GSM3855045: Wt DP R1lo rep3; Danio rerio; RNA Seq | GSM3855045 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855045 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236897_266_1_pair.fq.gz WTCHG_236897_266_2_pair.fq.gz | fastq fastq | 1996491732.0 | 13581226.0 | GSM3855045 r2 | 0:74.81 1:72.20 | A:522970179;C:458424995;G:469211257;T:545848558;N:36743 | 74 | 72 | 522970179 | 458424995 | 469211257 | 545848558 | 36743 | SRX5978253 | SRS4884508 | SRA894667 | GEO | Oxford University | 2 | 0.94571 | 0.7947 | 0.08062 | 0.06773 | 0.76116 | 0.78591 | 0.49549 | 0.46742 | 74 | 74 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52790 | 52790 | SRR9207173 | SRX5978252 | SRS4884507 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq Wt DP R1lo rep2 | GSM3855044 | source name:aortic endothelium|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:aortic endothelium|genotype/variation:non injected | RNA seq Wt DP R1lo rep2 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | aortic endothelium | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:aortic endothelium|genotype/variation:non injected | GSM3855044 | GSM3855044: Wt DP R1lo rep2; Danio rerio; RNA Seq | GSM3855044 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855044 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236896_251_1_pair.fq.gz WTCHG_236896_251_2_pair.fq.gz | fastq fastq | 2166575163.0 | 14709523.0 | GSM3855044 r1 | 0:74.86 1:72.43 | A:559933570;C:510454967;G:520888591;T:575264053;N:33982 | 74 | 72 | 559933570 | 510454967 | 520888591 | 575264053 | 33982 | SRX5978252 | SRS4884507 | SRA894667 | GEO | Oxford University | 2 | 0.95094 | 0.8211 | 0.0594 | 0.05292 | 0.76664 | 0.79253 | 0.4795 | 0.4638 | 74 | 74 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52791 | 52791 | SRR9207174 | SRX5978252 | SRS4884507 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq Wt DP R1lo rep2 | GSM3855044 | source name:aortic endothelium|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:aortic endothelium|genotype/variation:non injected | RNA seq Wt DP R1lo rep2 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | aortic endothelium | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:aortic endothelium|genotype/variation:non injected | GSM3855044 | GSM3855044: Wt DP R1lo rep2; Danio rerio; RNA Seq | GSM3855044 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855044 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236897_251_1_pair.fq.gz WTCHG_236897_251_2_pair.fq.gz | fastq fastq | 2148630324.0 | 14593830.0 | GSM3855044 r2 | 0:74.83 1:72.40 | A:555362600;C:503529612;G:514542689;T:575156489;N:38934 | 74 | 72 | 555362600 | 503529612 | 514542689 | 575156489 | 38934 | SRX5978252 | SRS4884507 | SRA894667 | GEO | Oxford University | 2 | 0.95053 | 0.81036 | 0.06102 | 0.05199 | 0.76897 | 0.79354 | 0.47523 | 0.46186 | 74 | 74 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52792 | 52792 | SRR9207171 | SRX5978251 | SRS4884506 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq Wt DP R1lo rep1 | GSM3855043 | source name:aortic endothelium|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:aortic endothelium|genotype/variation:non injected | RNA seq Wt DP R1lo rep1 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | aortic endothelium | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:aortic endothelium|genotype/variation:non injected | GSM3855043 | GSM3855043: Wt DP R1lo rep1; Danio rerio; RNA Seq | GSM3855043 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855043 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236896_244_1_pair.fq.gz WTCHG_236896_244_2_pair.fq.gz | fastq fastq | 1899807957.0 | 12921335.0 | GSM3855043 r1 | 0:74.85 1:72.17 | A:494455972;C:440267035;G:451386907;T:513668319;N:29724 | 74 | 72 | 494455972 | 440267035 | 451386907 | 513668319 | 29724 | SRX5978251 | SRS4884506 | SRA894667 | GEO | Oxford University | 2 | 0.94888 | 0.79567 | 0.06354 | 0.05518 | 0.77041 | 0.79837 | 0.48973 | 0.47834 | 75 | 73 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52793 | 52793 | SRR9207172 | SRX5978251 | SRS4884506 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq Wt DP R1lo rep1 | GSM3855043 | source name:aortic endothelium|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:aortic endothelium|genotype/variation:non injected | RNA seq Wt DP R1lo rep1 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | aortic endothelium | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:aortic endothelium|genotype/variation:non injected | GSM3855043 | GSM3855043: Wt DP R1lo rep1; Danio rerio; RNA Seq | GSM3855043 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855043 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236897_244_1_pair.fq.gz WTCHG_236897_244_2_pair.fq.gz | fastq fastq | 1882109620.0 | 12807285.0 | GSM3855043 r2 | 0:74.82 1:72.14 | A:489932533;C:433346981;G:444869178;T:513927823;N:33105 | 74 | 72 | 489932533 | 433346981 | 444869178 | 513927823 | 33105 | SRX5978251 | SRS4884506 | SRA894667 | GEO | Oxford University | 2 | 0.94837 | 0.78199 | 0.06553 | 0.05587 | 0.77068 | 0.79967 | 0.48984 | 0.47719 | 74 | 74 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52800 | 52800 | SRR9207163 | SRX5978247 | SRS4884502 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq Wt DN rep3 | GSM3855039 | source name:non endothelial tissue|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:non endothelial tissue|genotype/variation:non injected | RNA seq Wt DN rep3 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | non endothelial tissue | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:non endothelial tissue|genotype/variation:non injected | GSM3855039 | GSM3855039: Wt DN rep3; Danio rerio; RNA Seq | GSM3855039 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855039 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236896_267_1_pair.fq.gz WTCHG_236896_267_2_pair.fq.gz | fastq fastq | 1812059909.0 | 12410104.0 | GSM3855039 r1 | 0:74.81 1:71.21 | A:491620609;C:383394578;G:398030819;T:538985491;N:28412 | 74 | 71 | 491620609 | 383394578 | 398030819 | 538985491 | 28412 | SRX5978247 | SRS4884502 | SRA894667 | GEO | Oxford University | 2 | 0.93321 | 0.68178 | 0.15093 | 0.11867 | 0.75282 | 0.79468 | 0.51285 | 0.51101 | 75 | 74 | B | B | mate2-mate1 similar by mapping diff | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52801 | 52801 | SRR9207164 | SRX5978247 | SRS4884502 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq Wt DN rep3 | GSM3855039 | source name:non endothelial tissue|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:non endothelial tissue|genotype/variation:non injected | RNA seq Wt DN rep3 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | non endothelial tissue | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:non endothelial tissue|genotype/variation:non injected | GSM3855039 | GSM3855039: Wt DN rep3; Danio rerio; RNA Seq | GSM3855039 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855039 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236897_267_1_pair.fq.gz WTCHG_236897_267_2_pair.fq.gz | fastq fastq | 1798726377.0 | 12321488.0 | GSM3855039 r2 | 0:74.77 1:71.21 | A:487870380;C:378213454;G:393167780;T:539442882;N:31881 | 74 | 71 | 487870380 | 378213454 | 393167780 | 539442882 | 31881 | SRX5978247 | SRS4884502 | SRA894667 | GEO | Oxford University | 2 | 0.93183 | 0.67372 | 0.15009 | 0.11547 | 0.7555 | 0.79705 | 0.52465 | 0.50781 | 74 | 54 | B | B | mate2-mate1 similar by mapping diff | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52802 | 52802 | SRR9207161 | SRX5978246 | SRS4884501 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq Wt DN rep2 | GSM3855038 | source name:non endothelial tissue|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:non endothelial tissue|genotype/variation:non injected | RNA seq Wt DN rep2 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | non endothelial tissue | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:non endothelial tissue|genotype/variation:non injected | GSM3855038 | GSM3855038: Wt DN rep2; Danio rerio; RNA Seq | GSM3855038 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855038 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236896_252_1_pair.fq.gz WTCHG_236896_252_2_pair.fq.gz | fastq fastq | 2146316233.0 | 14628161.0 | GSM3855038 r1 | 0:74.84 1:71.88 | A:566578244;C:489485503;G:504442873;T:585776104;N:33509 | 74 | 71 | 566578244 | 489485503 | 504442873 | 585776104 | 33509 | SRX5978246 | SRS4884501 | SRA894667 | GEO | Oxford University | 2 | 0.94696 | 0.79752 | 0.10017 | 0.0872 | 0.74572 | 0.78165 | 0.50212 | 0.49488 | 74 | 74 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52803 | 52803 | SRR9207162 | SRX5978246 | SRS4884501 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq Wt DN rep2 | GSM3855038 | source name:non endothelial tissue|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:non endothelial tissue|genotype/variation:non injected | RNA seq Wt DN rep2 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | non endothelial tissue | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:non endothelial tissue|genotype/variation:non injected | GSM3855038 | GSM3855038: Wt DN rep2; Danio rerio; RNA Seq | GSM3855038 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855038 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236897_252_1_pair.fq.gz WTCHG_236897_252_2_pair.fq.gz | fastq fastq | 2135407349.0 | 14569323.0 | GSM3855038 r2 | 0:74.81 1:71.76 | A:563322304;C:482982247;G:498831126;T:590234332;N:37340 | 74 | 71 | 563322304 | 482982247 | 498831126 | 590234332 | 37340 | SRX5978246 | SRS4884501 | SRA894667 | GEO | Oxford University | 2 | 0.94623 | 0.77703 | 0.10192 | 0.08638 | 0.74582 | 0.78289 | 0.50539 | 0.48024 | 74 | 74 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52804 | 52804 | SRR9207159 | SRX5978245 | SRS4884500 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq Wt DN rep1 | GSM3855037 | source name:non endothelial tissue|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:non endothelial tissue|genotype/variation:non injected | RNA seq Wt DN rep1 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | non endothelial tissue | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:non endothelial tissue|genotype/variation:non injected | GSM3855037 | GSM3855037: Wt DN rep1; Danio rerio; RNA Seq | GSM3855037 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855037 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236896_245_2_pair.fq.gz WTCHG_236896_245_1_pair.fq.gz | fastq fastq | 1719181139.0 | 11738270.0 | GSM3855037 r1 | 0:74.81 1:71.65 | A:459579950;C:379670678;G:392006300;T:487897820;N:26391 | 74 | 71 | 459579950 | 379670678 | 392006300 | 487897820 | 26391 | SRX5978245 | SRS4884500 | SRA894667 | GEO | Oxford University | 2 | 0.93052 | 0.73058 | 0.11005 | 0.09187 | 0.7587 | 0.79375 | 0.50611 | 0.48538 | 75 | 73 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 52805 | 52805 | SRR9207160 | SRX5978245 | SRS4884500 | SRP200560 | PRJNA547066 | RNAseq of haemogenic and aortic endothelium in zebrafish embryos 28 hpf 20 hpf | GSE132259 | Transcriptome Analysis | The goal of this study is to perform RNAseq in different sub types of the zebrafish embryonic dorsal aorta DA at 28 hpf 30 hpf using TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. A min. of 3000 cells per population were collected via FACS. RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used to generate SMARTer libraries for low input RNA. Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. Overall design: Analysis of 5 different cell types; DN double negative SP kdrl single positive DP R1lo double positive runx1 low expression DP R1med runx1 medium expressionand and DP R1hi runx1 high expression in non injected Wt TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos. Analysis was also done of the DN and DP R1hi populations in runx1 morpholino MO injected embryos. | parent bioproject:PRJNA546805 | pubmed:31395869 | RNA seq Wt DN rep1 | GSM3855037 | source name:non endothelial tissue|age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:non endothelial tissue|genotype/variation:non injected | RNA seq Wt DN rep1 | Sequencing was performed on an Illumina HiSeq4000 machine with a 75 bp paired end protocol. Sequenced reads were checked for base qualities trimmed where 20% of the bases were below quality score 20 and filtered to exclude adapters using Trimmomatic Version 0.32. Sequences were aligned to the Zebrafish Genome Zv10 with STAR with default parameters. Aligned read features were counted using Subread tool: featureCounts method version 1.4.5 p1. To determine number of mapped reads we used the trimmed data. The alignment has been performed using STAR with default parameters. The number of mapped reads QC passed reads count has been obtain using Samtools mapping statistics flagstat tool. RAW data files represent the trimmed sequencing reads in separated lanes. Genome build: Zv10 Supplementary files format and content: Wt DP R1hi Wt DP R1lo Differential analysis between Wt DP R1hi and Wt DP R1lo cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DP R1hi MO DP R1hi Differential analysis between Wt DP R1hi and MO DP R1hi cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. Supplementary files format and content: Wt DN MO DN Differential analysis between Wt DN and MO DN cell type. The xlsx file contains edgeR normalisation and GLM estimation of dispersion. The file contains gene id Counts Per Million gene name end value of each sample log FC wt/mo P value and FDR value. | non endothelial tissue | double transgenic embryos were collected batches were split in half and were either injected or non injected with a runx1 morpholino | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | TgBACrunx1P2:Citrine;Tgkdrl:mCherry double transgenic zebrafish embryos were raised to 28 hpf 30 hpf. | age:28 hpf 30 hpf|cell isolation:FACS isolated cells|tissue:non endothelial tissue|genotype/variation:non injected | GSM3855037 | GSM3855037: Wt DN rep1; Danio rerio; RNA Seq | GSM3855037 | 1 | whole embryos were prepaired for FACsorting. A min. of 3000 cells were FACsorted directly into RLT buffer and RNA was isolated with the RNeasy Plus Micro Kit QIAGEN Cat No. 74034. High quality RNA RIN > 8.0 was sent for RNAseq to the Wellcome Trust Centre for Human Genetics WTCHG. 2.2 ng of total RNA was used for to generate SMARTer libraries for low input RNA. | GEO Accession:GSM3855037 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP200560 | WTCHG_236897_245_1_pair.fq.gz WTCHG_236897_245_2_pair.fq.gz | fastq fastq | 1710103502.0 | 11683422.0 | GSM3855037 r2 | 0:74.77 1:71.60 | A:456758769;C:375069094;G:387904698;T:490340725;N:30216 | 74 | 71 | 456758769 | 375069094 | 387904698 | 490340725 | 30216 | SRX5978245 | SRS4884500 | SRA894667 | GEO | Oxford University | 2 | 0.93089 | 0.71617 | 0.1094 | 0.08897 | 0.75879 | 0.79667 | 0.51735 | 0.49687 | 74 | 74 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | United Kingdom | 2019-06-05 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||
| 53021 | 53021 | SRR9662018 | SRX6422894 | SRS5079684 | SRP213938 | PRJNA553572 | A map of cis regulatory elements and 3D genome structures in zebrafish | GSE134055 | Other | The zebrafish has been widely used for the study of human disease and development as 70% of the protein coding genes are conserved between the two species. Annotation of functional control elements of the zebrafish genome however has lagged behind that of other model systems such as mouse and Drosophila. Based on multi omics approaches taken in the ENCODE and Roadmap Epigenomics projects we performed RNA seq ATAC seq ChIP seq and Hi C experiments in ten adult and two embryonic tissues to generate a comprehensive map of transcriptomes and regulatory elements in the zebrafish Tuebingen reference strain. Overall we have identified 235 596 cis regulatory elements which potentially shape the tissue specific and developmental stage specific gene expression in zebrafish. A comparison of zebrafish human and mouse regulatory elements allowed us to identify both evolutionarily conserved and species specific regulatory sequences. Furthermore through the analysis of Hi C data in zebrafish brain and muscle we observed different levels of 3D genome organization including compartment topological associating domains TADs and chromatin loops in zebrafish. A subset of TADs are deeply conserved between zebrafish and human. This work provides an additional epigenomic anchor for the functional annotation of vertebrate genomes and the study of evolutionally conserved elements of 3D genome organization. Overall design: 13 tissues from adult and embryonic stage were examined using ChIP Seq H3K27ac and H3K4me3 RNA Seq 11 of them were examined using ATAC seq WGBS and ChIP seq H3K9me3 and H3K9me2 and one scATAC seq in brain. Additionally we performed HiC experiments in adult muscle and brain. Please note that for the samples GSM4661977 GSM4662088 [1] each processed data generated from both replicates is linked to the corresponding *rep1 sample records [2] the input sample used for each ChIP sample is indicated in the description field in the corresponding input sample records. | pubmed:33239788;pubmed:35649578 | YueLab RNA Seq Heart rep2 | GSM3934886 | source name:Tissue|strain:Tuebingen|tissue:Heart | YueLab RNA Seq Heart rep2 | RNA seq reads were aligned to zv10 genome assembly using STAR; ChIP seq and ATAC seq reads were aligned to zv10 genome assembly using BWA HiC reads were aligned to zv10 genome assembly using Bowtie2 The TPM value of gene expression was caculated using RSEM ChIP seq and ATAC seq peaks were called using MACS2 with the following setting: ChIP seq q value <10e 2 p value<10e 5 Change>1 FC>2. ATAC seq: q value<10e 2 and p value<10e 5 HiC matrix was generated using HiC Pro Genome build: zv10 Supplementary files format and content: tab delimited text files include TPM values for each Sample; the narrowPeak files included the peaks for each Sample; The .hic file were the matrix of Hi C for each Sample.**All replicates were merged | Tissue | For each RNA seq experiment the same tissues combined from at least two Tuebingen fish were used as one replicate. For embryonic trunk ten 1 dpf fish were dechorionated with pronase and trunk were cut off for RNA seq. For embryonic neuron green cells from TgHuc:Kaede cells were sorted by FACS and approxinately 20 000 cells were used for one replicate. The tissue RNA was extracted from Trizol® according to the protocol Invitrogen. The cDNA libraries were performed using SureSelect Strand Specific RNA Library Preparation Kit Agilent according to the manufacturer’s protocol. Briefly polyA RNA was purified from 1000 ng of total RNA using oligo dT beads Invitrogen. Extracted RNA was first fragmented then followed by reverse transcription end repair adenylation adaptor ligation and subsequent PCR amplification. The final product was checked by size distribution and concentration using BioAnalyzer High Sensitivity DNA Kit Agilent and Kapa Library Quantification Kit Kapa Biosystems and then followed by pair end 2X 50 bp high throughput sequencing using HiSeq 2500 Illumina. | Embryonic and ault Tuebingen zebrafish were raised under standard laboratory conditions | strain:Tuebingen|tissue:Heart | GSM3934886 | GSM3934886: YueLab RNA Seq Heart rep2; Danio rerio; RNA Seq | GSM3934886 | 1 | For each RNA seq experiment the same tissues combined from at least two Tuebingen fish were used as one replicate. For embryonic trunk ten 1 dpf fish were dechorionated with pronase and trunk were cut off for RNA seq. For embryonic neuron green cells from TgHuc:Kaede cells were sorted by FACS and approxinately 20 000 cells were used for one replicate. The tissue RNA was extracted from Trizol® according to the protocol Invitrogen. The cDNA libraries were performed using SureSelect Strand Specific RNA Library Preparation Kit Agilent according to the manufacturer's protocol. Briefly polyA RNA was purified from 1000 ng of total RNA using oligo dT beads Invitrogen. Extracted RNA was first fragmented then followed by reverse transcription end repair adenylation adaptor ligation and subsequent PCR amplification. The final product was checked by size distribution and concentration using BioAnalyzer High Sensitivity DNA Kit Agilent and Kapa Library Quantification Kit Kapa Biosystems and then followed by pair end 2X 50 bp high throughput sequencing using HiSeq 2500 Illumina. | GEO Accession:GSM3934886 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina Genome Analyzer | SRP213938 | YueLab-RNA-Seq-Heart-rep2_1.fastq.gz YueLab-RNA-Seq-Heart-rep2_2.fastq.gz | fastq fastq | 3738852700.0 | 37388527.0 | GSM3934886 r1 | 0:50 1:50 | A:908524568;C:968345371;G:992587651;T:864823167;N:4571943 | 50 | 50 | 908524568 | 968345371 | 992587651 | 864823167 | 4571943 | SRX6422894 | SRS5079684 | SRA919194 | GEO | Feng Yue, Department of Biochemistry and Molecular Genetics, Northwestern University Feinberg School of Medicine | 2 | 0.8454 | 0.84237 | 0.22307 | 0.21683 | 0.84082 | 0.84053 | 0.63946 | 0.67201 | 50 | 50 | B | B | biological fallback assumption | illumina | early_illumina | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2019-07-09 | Pharyngula | Embryo | Heart | Cardiovascular System | |||||||||||
| 53022 | 53022 | SRR9662017 | SRX6422893 | SRS5079682 | SRP213938 | PRJNA553572 | A map of cis regulatory elements and 3D genome structures in zebrafish | GSE134055 | Other | The zebrafish has been widely used for the study of human disease and development as 70% of the protein coding genes are conserved between the two species. Annotation of functional control elements of the zebrafish genome however has lagged behind that of other model systems such as mouse and Drosophila. Based on multi omics approaches taken in the ENCODE and Roadmap Epigenomics projects we performed RNA seq ATAC seq ChIP seq and Hi C experiments in ten adult and two embryonic tissues to generate a comprehensive map of transcriptomes and regulatory elements in the zebrafish Tuebingen reference strain. Overall we have identified 235 596 cis regulatory elements which potentially shape the tissue specific and developmental stage specific gene expression in zebrafish. A comparison of zebrafish human and mouse regulatory elements allowed us to identify both evolutionarily conserved and species specific regulatory sequences. Furthermore through the analysis of Hi C data in zebrafish brain and muscle we observed different levels of 3D genome organization including compartment topological associating domains TADs and chromatin loops in zebrafish. A subset of TADs are deeply conserved between zebrafish and human. This work provides an additional epigenomic anchor for the functional annotation of vertebrate genomes and the study of evolutionally conserved elements of 3D genome organization. Overall design: 13 tissues from adult and embryonic stage were examined using ChIP Seq H3K27ac and H3K4me3 RNA Seq 11 of them were examined using ATAC seq WGBS and ChIP seq H3K9me3 and H3K9me2 and one scATAC seq in brain. Additionally we performed HiC experiments in adult muscle and brain. Please note that for the samples GSM4661977 GSM4662088 [1] each processed data generated from both replicates is linked to the corresponding *rep1 sample records [2] the input sample used for each ChIP sample is indicated in the description field in the corresponding input sample records. | pubmed:33239788;pubmed:35649578 | YueLab RNA Seq Heart rep1 | GSM3934885 | source name:Tissue|strain:Tuebingen|tissue:Heart | YueLab RNA Seq Heart rep1 | RNA seq reads were aligned to zv10 genome assembly using STAR; ChIP seq and ATAC seq reads were aligned to zv10 genome assembly using BWA HiC reads were aligned to zv10 genome assembly using Bowtie2 The TPM value of gene expression was caculated using RSEM ChIP seq and ATAC seq peaks were called using MACS2 with the following setting: ChIP seq q value <10e 2 p value<10e 5 Change>1 FC>2. ATAC seq: q value<10e 2 and p value<10e 5 HiC matrix was generated using HiC Pro Genome build: zv10 Supplementary files format and content: tab delimited text files include TPM values for each Sample; the narrowPeak files included the peaks for each Sample; The .hic file were the matrix of Hi C for each Sample.**All replicates were merged | Tissue | For each RNA seq experiment the same tissues combined from at least two Tuebingen fish were used as one replicate. For embryonic trunk ten 1 dpf fish were dechorionated with pronase and trunk were cut off for RNA seq. For embryonic neuron green cells from TgHuc:Kaede cells were sorted by FACS and approxinately 20 000 cells were used for one replicate. The tissue RNA was extracted from Trizol® according to the protocol Invitrogen. The cDNA libraries were performed using SureSelect Strand Specific RNA Library Preparation Kit Agilent according to the manufacturer’s protocol. Briefly polyA RNA was purified from 1000 ng of total RNA using oligo dT beads Invitrogen. Extracted RNA was first fragmented then followed by reverse transcription end repair adenylation adaptor ligation and subsequent PCR amplification. The final product was checked by size distribution and concentration using BioAnalyzer High Sensitivity DNA Kit Agilent and Kapa Library Quantification Kit Kapa Biosystems and then followed by pair end 2X 50 bp high throughput sequencing using HiSeq 2500 Illumina. | Embryonic and ault Tuebingen zebrafish were raised under standard laboratory conditions | strain:Tuebingen|tissue:Heart | GSM3934885 | GSM3934885: YueLab RNA Seq Heart rep1; Danio rerio; RNA Seq | GSM3934885 | 1 | For each RNA seq experiment the same tissues combined from at least two Tuebingen fish were used as one replicate. For embryonic trunk ten 1 dpf fish were dechorionated with pronase and trunk were cut off for RNA seq. For embryonic neuron green cells from TgHuc:Kaede cells were sorted by FACS and approxinately 20 000 cells were used for one replicate. The tissue RNA was extracted from Trizol® according to the protocol Invitrogen. The cDNA libraries were performed using SureSelect Strand Specific RNA Library Preparation Kit Agilent according to the manufacturer's protocol. Briefly polyA RNA was purified from 1000 ng of total RNA using oligo dT beads Invitrogen. Extracted RNA was first fragmented then followed by reverse transcription end repair adenylation adaptor ligation and subsequent PCR amplification. The final product was checked by size distribution and concentration using BioAnalyzer High Sensitivity DNA Kit Agilent and Kapa Library Quantification Kit Kapa Biosystems and then followed by pair end 2X 50 bp high throughput sequencing using HiSeq 2500 Illumina. | GEO Accession:GSM3934885 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina Genome Analyzer | SRP213938 | YueLab-RNA-Seq-Heart-rep1_1.fastq.gz YueLab-RNA-Seq-Heart-rep1_2.fastq.gz | fastq fastq | 3840548749.0 | 31797756.0 | GSM3934885 r1 | 0:60.46 1:60.32 | A:1037745400;C:853066216;G:864291073;T:1085389048;N:57012 | 60 | 60 | 1037745400 | 853066216 | 864291073 | 1085389048 | 57012 | SRX6422893 | SRS5079682 | SRA919194 | GEO | Feng Yue, Department of Biochemistry and Molecular Genetics, Northwestern University Feinberg School of Medicine | 2 | 0.97577 | 0.98167 | 0.10912 | 0.10881 | 0.76118 | 0.76526 | 0.54037 | 0.54676 | 60 | 60 | B | B | biological fallback assumption | illumina | early_illumina | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2019-07-09 | Pharyngula | Embryo | Heart | Cardiovascular System | |||||||||||
| 55379 | 55379 | SRR10323881 | SRX7034716 | SRS5554730 | SRP226614 | PRJNA578896 | Repetitive elements engage Rig I and Mda5 in interplay with Lgp2 to enhance hematopoietic stem cell emergence | PRJNA578896 | Other | In this study we examine the role of RIG I like receptors RLRs in hematopoietic stem and progenitor cell formation. We have performed extensive expression analysis and chromatin accessibility assays on endothelial and hemogenic endothelial cells in knockdown animals for all the RLR receptors. Additionally we did expression analysis on animals with knockdown of two receptors. Finally we examined the upregulation of repetitive elements in hemogenic endothelial cells post treatment with valproic acid VPA or decitabine. | danRer10 raw data | strain:AB/tu|age:not applicable|sex:pooled male and female|tissue:endothelial and hemogenic endothelial|BioSampleModel:Model organism or animal | RNA seq control for lgp2 morpholino injected endothelial hemogenic endothelial cell 26hpf replicate 2 | 10 | 10 | NEBNext Low Input RNA Library Prep Kit | RNA-Seq | TRANSCRIPTOMIC | size fractionation | PAIRED | ILLUMINA | Illumina HiSeq 3000 | SRP226614 | RNA_seq control for lgp2 morpholino injected endothelial_hemogenic endothelial cell 26hpf replicate 2_R1.fastq.gz RNA_seq control for lgp2 morpholino injected endothelial_hemogenic endothelial cell 26hpf replicate 2_R2.fastq.gz | fastq fastq | 3356658750.0 | 22377725.0 | RNA seq control for lgp2 morpholino injected endothelial hemogenic endothelial cell 26hpf replicate 2 R1.fastq.gz | 0:75 1:75 | A:875300673;C:782517555;G:796855605;T:901672776;N:312141 | 75 | 75 | 875300673 | 782517555 | 796855605 | 901672776 | 312141 | SRX7034716 | SRS5554730 | SRA983011 | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany|Department of Cellular and Molecular Immunology | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany | 2 | 0.68437 | 0.73326 | 0.04743 | 0.05194 | 0.80241 | 0.80517 | 0.51875 | 0.52196 | 75 | 75 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2019-10-24 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||||||||||||||
| 55380 | 55380 | SRR10323882 | SRX7034715 | SRS5554730 | SRP226614 | PRJNA578896 | Repetitive elements engage Rig I and Mda5 in interplay with Lgp2 to enhance hematopoietic stem cell emergence | PRJNA578896 | Other | In this study we examine the role of RIG I like receptors RLRs in hematopoietic stem and progenitor cell formation. We have performed extensive expression analysis and chromatin accessibility assays on endothelial and hemogenic endothelial cells in knockdown animals for all the RLR receptors. Additionally we did expression analysis on animals with knockdown of two receptors. Finally we examined the upregulation of repetitive elements in hemogenic endothelial cells post treatment with valproic acid VPA or decitabine. | danRer10 raw data | strain:AB/tu|age:not applicable|sex:pooled male and female|tissue:endothelial and hemogenic endothelial|BioSampleModel:Model organism or animal | RNA seq control for lgp2 morpholino injected endothelial hemogenic endothelial cell 26hpf replicate 1 | 9 | 9 | NEBNext Low Input RNA Library Prep Kit | RNA-Seq | TRANSCRIPTOMIC | size fractionation | PAIRED | ILLUMINA | Illumina HiSeq 3000 | SRP226614 | RNA_seq control for lgp2 morpholino injected endothelial_hemogenic endothelial cell 26hpf replicate 1_R2.fastq.gz RNA_seq control for lgp2 morpholino injected endothelial_hemogenic endothelial cell 26hpf replicate 1_R1.fastq.gz | fastq fastq | 3459242400.0 | 23061616.0 | RNA seq control for lgp2 morpholino injected endothelial hemogenic endothelial cell 26hpf replicate 1 R1.fastq.gz | 0:75 1:75 | A:924400584;C:762078140;G:779330250;T:993109509;N:323917 | 75 | 75 | 924400584 | 762078140 | 779330250 | 993109509 | 323917 | SRX7034715 | SRS5554730 | SRA983011 | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany|Department of Cellular and Molecular Immunology | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany | 2 | 0.67032 | 0.73764 | 0.07629 | 0.08303 | 0.80856 | 0.80748 | 0.52094 | 0.52695 | 75 | 75 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2019-10-24 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||||||||||||||
| 55381 | 55381 | SRR10323883 | SRX7034714 | SRS5554730 | SRP226614 | PRJNA578896 | Repetitive elements engage Rig I and Mda5 in interplay with Lgp2 to enhance hematopoietic stem cell emergence | PRJNA578896 | Other | In this study we examine the role of RIG I like receptors RLRs in hematopoietic stem and progenitor cell formation. We have performed extensive expression analysis and chromatin accessibility assays on endothelial and hemogenic endothelial cells in knockdown animals for all the RLR receptors. Additionally we did expression analysis on animals with knockdown of two receptors. Finally we examined the upregulation of repetitive elements in hemogenic endothelial cells post treatment with valproic acid VPA or decitabine. | danRer10 raw data | strain:AB/tu|age:not applicable|sex:pooled male and female|tissue:endothelial and hemogenic endothelial|BioSampleModel:Model organism or animal | RNA seq mda5 morpholino injected endothelial hemogenic endothelial cell 26hpf replicate 2 | 8 | 8 | NEBNext Low Input RNA Library Prep Kit | RNA-Seq | TRANSCRIPTOMIC | size fractionation | PAIRED | ILLUMINA | Illumina HiSeq 3000 | SRP226614 | RNA_seq mda5 morpholino injected endothelial_hemogenic endothelial cell 26hpf replicate 2_R1.fastq.gz RNA_seq mda5 morpholino injected endothelial_hemogenic endothelial cell 26hpf replicate 2_R2.fastq.gz | fastq fastq | 3238312500.0 | 21588750.0 | RNA seq mda5 morpholino injected endothelial hemogenic endothelial cell 26hpf replicate 2 R1.fastq.gz | 0:75 1:75 | A:881635390;C:656958401;G:673596788;T:1025824968;N:296953 | 75 | 75 | 881635390 | 656958401 | 673596788 | 1025824968 | 296953 | SRX7034714 | SRS5554730 | SRA983011 | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany|Department of Cellular and Molecular Immunology | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany | 2 | 0.59623 | 0.72377 | 0.07781 | 0.08944 | 0.80608 | 0.8016 | 0.53277 | 0.53095 | 75 | 75 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2019-10-24 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||||||||||||||
| 55382 | 55382 | SRR10323884 | SRX7034713 | SRS5554730 | SRP226614 | PRJNA578896 | Repetitive elements engage Rig I and Mda5 in interplay with Lgp2 to enhance hematopoietic stem cell emergence | PRJNA578896 | Other | In this study we examine the role of RIG I like receptors RLRs in hematopoietic stem and progenitor cell formation. We have performed extensive expression analysis and chromatin accessibility assays on endothelial and hemogenic endothelial cells in knockdown animals for all the RLR receptors. Additionally we did expression analysis on animals with knockdown of two receptors. Finally we examined the upregulation of repetitive elements in hemogenic endothelial cells post treatment with valproic acid VPA or decitabine. | danRer10 raw data | strain:AB/tu|age:not applicable|sex:pooled male and female|tissue:endothelial and hemogenic endothelial|BioSampleModel:Model organism or animal | RNA seq mda5 morpholino injected endothelial hemogenic endothelial cell 26hpf replicate 1 | 7 | 7 | NEBNext Low Input RNA Library Prep Kit | RNA-Seq | TRANSCRIPTOMIC | size fractionation | PAIRED | ILLUMINA | Illumina HiSeq 3000 | SRP226614 | RNA_seq mda5 morpholino injected endothelial_hemogenic endothelial cell 26hpf replicate 1_R1.fastq.gz RNA_seq mda5 morpholino injected endothelial_hemogenic endothelial cell 26hpf replicate 1_R2.fastq.gz | fastq fastq | 3255021150.0 | 21700141.0 | RNA seq mda5 morpholino injected endothelial hemogenic endothelial cell 26hpf replicate 1 R1.fastq.gz | 0:75 1:75 | A:858912760;C:733048670;G:750496371;T:912263495;N:299854 | 75 | 75 | 858912760 | 733048670 | 750496371 | 912263495 | 299854 | SRX7034713 | SRS5554730 | SRA983011 | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany|Department of Cellular and Molecular Immunology | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany | 2 | 0.65481 | 0.71883 | 0.05477 | 0.05995 | 0.7903 | 0.7921 | 0.51367 | 0.51188 | 75 | 75 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2019-10-24 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||||||||||||||
| 55383 | 55383 | SRR10323885 | SRX7034712 | SRS5554730 | SRP226614 | PRJNA578896 | Repetitive elements engage Rig I and Mda5 in interplay with Lgp2 to enhance hematopoietic stem cell emergence | PRJNA578896 | Other | In this study we examine the role of RIG I like receptors RLRs in hematopoietic stem and progenitor cell formation. We have performed extensive expression analysis and chromatin accessibility assays on endothelial and hemogenic endothelial cells in knockdown animals for all the RLR receptors. Additionally we did expression analysis on animals with knockdown of two receptors. Finally we examined the upregulation of repetitive elements in hemogenic endothelial cells post treatment with valproic acid VPA or decitabine. | danRer10 raw data | strain:AB/tu|age:not applicable|sex:pooled male and female|tissue:endothelial and hemogenic endothelial|BioSampleModel:Model organism or animal | RNA seq control for mda5 morpholino injected endothelial hemogenic endothelial cell 26hpf replicate 2 | 6 | 6 | NEBNext Low Input RNA Library Prep Kit | RNA-Seq | TRANSCRIPTOMIC | size fractionation | PAIRED | ILLUMINA | Illumina HiSeq 3000 | SRP226614 | RNA_seq control for mda5 morpholino injected endothelial_hemogenic endothelial cell 26hpf replicate 2_R2.fastq.gz RNA_seq control for mda5 morpholino injected endothelial_hemogenic endothelial cell 26hpf replicate 2_R1.fastq.gz | fastq fastq | 2413394850.0 | 16089299.0 | RNA seq control for mda5 morpholino injected endothelial hemogenic endothelial cell 26hpf replicate 2 R1.fastq.gz | 0:75 1:75 | A:660807483;C:490677840;G:505039519;T:756646234;N:223774 | 75 | 75 | 660807483 | 490677840 | 505039519 | 756646234 | 223774 | SRX7034712 | SRS5554730 | SRA983011 | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany|Department of Cellular and Molecular Immunology | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany | 2 | 0.60009 | 0.72319 | 0.09185 | 0.10528 | 0.82175 | 0.81815 | 0.5234 | 0.51725 | 75 | 75 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2019-10-24 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||||||||||||||
| 55384 | 55384 | SRR10323886 | SRX7034711 | SRS5554730 | SRP226614 | PRJNA578896 | Repetitive elements engage Rig I and Mda5 in interplay with Lgp2 to enhance hematopoietic stem cell emergence | PRJNA578896 | Other | In this study we examine the role of RIG I like receptors RLRs in hematopoietic stem and progenitor cell formation. We have performed extensive expression analysis and chromatin accessibility assays on endothelial and hemogenic endothelial cells in knockdown animals for all the RLR receptors. Additionally we did expression analysis on animals with knockdown of two receptors. Finally we examined the upregulation of repetitive elements in hemogenic endothelial cells post treatment with valproic acid VPA or decitabine. | danRer10 raw data | strain:AB/tu|age:not applicable|sex:pooled male and female|tissue:endothelial and hemogenic endothelial|BioSampleModel:Model organism or animal | RNA seq control for mda5 morpholino injected endothelial hemogenic endothelial cell 26hpf replicate 1 | 5 | 5 | NEBNext Low Input RNA Library Prep Kit | RNA-Seq | TRANSCRIPTOMIC | size fractionation | PAIRED | ILLUMINA | Illumina HiSeq 3000 | SRP226614 | RNA_seq control for mda5 morpholino injected endothelial_hemogenic endothelial cell 26hpf replicate 1_R1.fastq.gz RNA_seq control for mda5 morpholino injected endothelial_hemogenic endothelial cell 26hpf replicate 1_R2.fastq.gz | fastq fastq | 3124357200.0 | 20829048.0 | RNA seq control for mda5 morpholino injected endothelial hemogenic endothelial cell 26hpf replicate 1 R1.fastq.gz | 0:75 1:75 | A:844721216;C:673572690;G:689308705;T:916479849;N:274740 | 75 | 75 | 844721216 | 673572690 | 689308705 | 916479849 | 274740 | SRX7034711 | SRS5554730 | SRA983011 | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany|Department of Cellular and Molecular Immunology | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany | 2 | 0.66396 | 0.73861 | 0.09392 | 0.10351 | 0.80856 | 0.80797 | 0.53225 | 0.5369 | 75 | 75 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2019-10-24 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||||||||||||||
| 55385 | 55385 | SRR10323891 | SRX7034706 | SRS5554730 | SRP226614 | PRJNA578896 | Repetitive elements engage Rig I and Mda5 in interplay with Lgp2 to enhance hematopoietic stem cell emergence | PRJNA578896 | Other | In this study we examine the role of RIG I like receptors RLRs in hematopoietic stem and progenitor cell formation. We have performed extensive expression analysis and chromatin accessibility assays on endothelial and hemogenic endothelial cells in knockdown animals for all the RLR receptors. Additionally we did expression analysis on animals with knockdown of two receptors. Finally we examined the upregulation of repetitive elements in hemogenic endothelial cells post treatment with valproic acid VPA or decitabine. | danRer10 raw data | strain:AB/tu|age:not applicable|sex:pooled male and female|tissue:endothelial and hemogenic endothelial|BioSampleModel:Model organism or animal | RNA seq rig 1 morpholino injected endothelial hemogenic endothelial cell 26hpf replicate 2 | 4 | 4 | NEBNext Low Input RNA Library Prep Kit | RNA-Seq | TRANSCRIPTOMIC | size fractionation | PAIRED | ILLUMINA | Illumina HiSeq 3000 | SRP226614 | RNA_seq rig_1 morpholino injected endothelial_hemogenic endothelial cell 26hpf replicate 2_R2.fastq.gz RNA_seq rig_1 morpholino injected endothelial_hemogenic endothelial cell 26hpf replicate 2_R1.fastq.gz | fastq fastq | 2812593000.0 | 18750620.0 | RNA seq rig 1 morpholino injected endothelial hemogenic endothelial cell 26hpf replicate 2 R1.fastq.gz | 0:75 1:75 | A:759189725;C:611361876;G:625876145;T:815905469;N:259785 | 75 | 75 | 759189725 | 611361876 | 625876145 | 815905469 | 259785 | SRX7034706 | SRS5554730 | SRA983011 | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany|Department of Cellular and Molecular Immunology | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany | 2 | 0.63609 | 0.70403 | 0.08285 | 0.0932 | 0.79847 | 0.79959 | 0.52487 | 0.52941 | 75 | 75 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2019-10-24 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||||||||||||||
| 55386 | 55386 | SRR10323898 | SRX7034699 | SRS5554730 | SRP226614 | PRJNA578896 | Repetitive elements engage Rig I and Mda5 in interplay with Lgp2 to enhance hematopoietic stem cell emergence | PRJNA578896 | Other | In this study we examine the role of RIG I like receptors RLRs in hematopoietic stem and progenitor cell formation. We have performed extensive expression analysis and chromatin accessibility assays on endothelial and hemogenic endothelial cells in knockdown animals for all the RLR receptors. Additionally we did expression analysis on animals with knockdown of two receptors. Finally we examined the upregulation of repetitive elements in hemogenic endothelial cells post treatment with valproic acid VPA or decitabine. | danRer10 raw data | strain:AB/tu|age:not applicable|sex:pooled male and female|tissue:endothelial and hemogenic endothelial|BioSampleModel:Model organism or animal | RNA seq decitabine treatment in hemogenic endothelial cell 26hpf replicate 2 | 24 | 24 | NEBNext Low Input RNA Library Prep Kit | RNA-Seq | TRANSCRIPTOMIC | size fractionation | PAIRED | ILLUMINA | Illumina HiSeq 3000 | SRP226614 | RNA_seq decitabine treatment in hemogenic endothelial cell 26hpf replicate 2_R2.fastq.gz RNA_seq decitabine treatment in hemogenic endothelial cell 26hpf replicate 2_R1.fastq.gz | fastq fastq | 5849571450.0 | 38997143.0 | RNA seq decitabine treatment in hemogenic endothelial cell 26hpf replicate 2 R1.fastq.gz | 0:75 1:75 | A:1574421853;C:1316832574;G:1315527058;T:1642305644;N:484321 | 75 | 75 | 1574421853 | 1316832574 | 1315527058 | 1642305644 | 484321 | SRX7034699 | SRS5554730 | SRA983011 | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany|Department of Cellular and Molecular Immunology | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany | 2 | 0.78221 | 0.84034 | 0.0684 | 0.07089 | 0.76607 | 0.77025 | 0.50712 | 0.50772 | 75 | 75 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2019-10-24 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||||||||||||||
| 55387 | 55387 | SRR10323899 | SRX7034698 | SRS5554730 | SRP226614 | PRJNA578896 | Repetitive elements engage Rig I and Mda5 in interplay with Lgp2 to enhance hematopoietic stem cell emergence | PRJNA578896 | Other | In this study we examine the role of RIG I like receptors RLRs in hematopoietic stem and progenitor cell formation. We have performed extensive expression analysis and chromatin accessibility assays on endothelial and hemogenic endothelial cells in knockdown animals for all the RLR receptors. Additionally we did expression analysis on animals with knockdown of two receptors. Finally we examined the upregulation of repetitive elements in hemogenic endothelial cells post treatment with valproic acid VPA or decitabine. | danRer10 raw data | strain:AB/tu|age:not applicable|sex:pooled male and female|tissue:endothelial and hemogenic endothelial|BioSampleModel:Model organism or animal | RNA seq decitabine treatment in hemogenic endothelial cell 26hpf replicate 1 | 23 | 23 | NEBNext Low Input RNA Library Prep Kit | RNA-Seq | TRANSCRIPTOMIC | size fractionation | PAIRED | ILLUMINA | Illumina HiSeq 3000 | SRP226614 | RNA_seq decitabine treatment in hemogenic endothelial cell 26hpf replicate 1_R1.fastq.gz RNA_seq decitabine treatment in hemogenic endothelial cell 26hpf replicate 1_R2.fastq.gz | fastq fastq | 5656815000.0 | 37712100.0 | RNA seq decitabine treatment in hemogenic endothelial cell 26hpf replicate 1 R1.fastq.gz | 0:75 1:75 | A:1487198866;C:1332723090;G:1275197163;T:1514410765;N:47285116 | 75 | 75 | 1487198866 | 1332723090 | 1275197163 | 1514410765 | 47285116 | SRX7034698 | SRS5554730 | SRA983011 | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany|Department of Cellular and Molecular Immunology | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany | 2 | 0.86399 | 0.76012 | 0.0587 | 0.05779 | 0.76461 | 0.9105 | 0.49754 | 0.51037 | 75 | 75 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2019-10-24 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||||||||||||||
| 55388 | 55388 | SRR10323900 | SRX7034697 | SRS5554730 | SRP226614 | PRJNA578896 | Repetitive elements engage Rig I and Mda5 in interplay with Lgp2 to enhance hematopoietic stem cell emergence | PRJNA578896 | Other | In this study we examine the role of RIG I like receptors RLRs in hematopoietic stem and progenitor cell formation. We have performed extensive expression analysis and chromatin accessibility assays on endothelial and hemogenic endothelial cells in knockdown animals for all the RLR receptors. Additionally we did expression analysis on animals with knockdown of two receptors. Finally we examined the upregulation of repetitive elements in hemogenic endothelial cells post treatment with valproic acid VPA or decitabine. | danRer10 raw data | strain:AB/tu|age:not applicable|sex:pooled male and female|tissue:endothelial and hemogenic endothelial|BioSampleModel:Model organism or animal | RNA seq VPA treatment in hemogenic endothelial cell 26hpf replicate 2 | 22 | 22 | NEBNext Low Input RNA Library Prep Kit | RNA-Seq | TRANSCRIPTOMIC | size fractionation | PAIRED | ILLUMINA | Illumina HiSeq 3000 | SRP226614 | RNA_seq VPA treatment in hemogenic endothelial cell 26hpf replicate 2_R2.fastq.gz RNA_seq VPA treatment in hemogenic endothelial cell 26hpf replicate 2_R1.fastq.gz | fastq fastq | 5978780250.0 | 39858535.0 | RNA seq VPA treatment in hemogenic endothelial cell 26hpf replicate 2 R1.fastq.gz | 0:75 1:75 | A:1580804547;C:1404640964;G:1399714637;T:1593586843;N:33259 | 75 | 75 | 1580804547 | 1404640964 | 1399714637 | 1593586843 | 33259 | SRX7034697 | SRS5554730 | SRA983011 | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany|Department of Cellular and Molecular Immunology | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany | 2 | 0.92216 | 0.92477 | 0.04155 | 0.04126 | 0.74537 | 0.7512 | 0.48148 | 0.49049 | 75 | 75 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2019-10-24 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||||||||||||||
| 55389 | 55389 | SRR10323901 | SRX7034696 | SRS5554730 | SRP226614 | PRJNA578896 | Repetitive elements engage Rig I and Mda5 in interplay with Lgp2 to enhance hematopoietic stem cell emergence | PRJNA578896 | Other | In this study we examine the role of RIG I like receptors RLRs in hematopoietic stem and progenitor cell formation. We have performed extensive expression analysis and chromatin accessibility assays on endothelial and hemogenic endothelial cells in knockdown animals for all the RLR receptors. Additionally we did expression analysis on animals with knockdown of two receptors. Finally we examined the upregulation of repetitive elements in hemogenic endothelial cells post treatment with valproic acid VPA or decitabine. | danRer10 raw data | strain:AB/tu|age:not applicable|sex:pooled male and female|tissue:endothelial and hemogenic endothelial|BioSampleModel:Model organism or animal | RNA seq VPA or decitabine treatment in hemogenic endothelial cell 26hpf replicate 1 | 21 | 21 | NEBNext Low Input RNA Library Prep Kit | RNA-Seq | TRANSCRIPTOMIC | size fractionation | PAIRED | ILLUMINA | Illumina HiSeq 3000 | SRP226614 | RNA_seq VPA treatment in hemogenic endothelial cell 26hpf replicate 1_R1.fastq.gz RNA_seq VPA treatment in hemogenic endothelial cell 26hpf replicate 1_R2.fastq.gz | fastq fastq | 8777730900.0 | 58518206.0 | RNA seq VPA treatment in hemogenic endothelial cell 26hpf replicate 1 R1.fastq.gz | 0:75 1:75 | A:2331650285;C:2053244561;G:2042022053;T:2350762388;N:51613 | 75 | 75 | 2331650285 | 2053244561 | 2042022053 | 2350762388 | 51613 | SRX7034696 | SRS5554730 | SRA983011 | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany|Department of Cellular and Molecular Immunology | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany | 2 | 0.92143 | 0.92455 | 0.04604 | 0.04567 | 0.73361 | 0.73923 | 0.4802 | 0.48613 | 75 | 75 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2019-10-24 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||||||||||||||
| 55390 | 55390 | SRR10323902 | SRX7034695 | SRS5554730 | SRP226614 | PRJNA578896 | Repetitive elements engage Rig I and Mda5 in interplay with Lgp2 to enhance hematopoietic stem cell emergence | PRJNA578896 | Other | In this study we examine the role of RIG I like receptors RLRs in hematopoietic stem and progenitor cell formation. We have performed extensive expression analysis and chromatin accessibility assays on endothelial and hemogenic endothelial cells in knockdown animals for all the RLR receptors. Additionally we did expression analysis on animals with knockdown of two receptors. Finally we examined the upregulation of repetitive elements in hemogenic endothelial cells post treatment with valproic acid VPA or decitabine. | danRer10 raw data | strain:AB/tu|age:not applicable|sex:pooled male and female|tissue:endothelial and hemogenic endothelial|BioSampleModel:Model organism or animal | RNA seq rig 1 morpholino injected endothelial hemogenic endothelial cell 26hpf replicate 1 | 3 | 3 | NEBNext Low Input RNA Library Prep Kit | RNA-Seq | TRANSCRIPTOMIC | size fractionation | PAIRED | ILLUMINA | Illumina HiSeq 3000 | SRP226614 | RNA_seq rig_1 morpholino injected endothelial_hemogenic endothelial cell 26hpf replicate 1_R1.fastq.gz RNA_seq rig_1 morpholino injected endothelial_hemogenic endothelial cell 26hpf replicate 1_R2.fastq.gz | fastq fastq | 3613041150.0 | 24086941.0 | RNA seq rig 1 morpholino injected endothelial hemogenic endothelial cell 26hpf replicate 1 R1.fastq.gz | 0:75 1:75 | A:972417798;C:795483066;G:808300399;T:1036510724;N:329163 | 75 | 75 | 972417798 | 795483066 | 808300399 | 1036510724 | 329163 | SRX7034695 | SRS5554730 | SRA983011 | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany|Department of Cellular and Molecular Immunology | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany | 2 | 0.66853 | 0.7231 | 0.08329 | 0.0907 | 0.78953 | 0.79131 | 0.51481 | 0.52637 | 75 | 75 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2019-10-24 | Pharyngula | Embryo | Endothelium | Cardiovascular System | |||||||||||||||||||||
| 55391 | 55391 | SRR10323903 | SRX7034694 | SRS5554730 | SRP226614 | PRJNA578896 | Repetitive elements engage Rig I and Mda5 in interplay with Lgp2 to enhance hematopoietic stem cell emergence | PRJNA578896 | Other | In this study we examine the role of RIG I like receptors RLRs in hematopoietic stem and progenitor cell formation. We have performed extensive expression analysis and chromatin accessibility assays on endothelial and hemogenic endothelial cells in knockdown animals for all the RLR receptors. Additionally we did expression analysis on animals with knockdown of two receptors. Finally we examined the upregulation of repetitive elements in hemogenic endothelial cells post treatment with valproic acid VPA or decitabine. | danRer10 raw data | strain:AB/tu|age:not applicable|sex:pooled male and female|tissue:endothelial and hemogenic endothelial|BioSampleModel:Model organism or animal | RNA seq control for VPA or decitabine treatment in hemogenic endothelial cell 26hpf replicate 2 | 20 | 20 | NEBNext Low Input RNA Library Prep Kit | RNA-Seq | TRANSCRIPTOMIC | size fractionation | PAIRED | ILLUMINA | Illumina HiSeq 3000 | SRP226614 | RNA_seq control for VPA_or_decitabine treatment in hemogenic endothelial cell 26hpf replicate 2_R1.fastq.gz RNA_seq control for VPA_or_decitabine treatment in hemogenic endothelial cell 26hpf replicate 2_R2.fastq.gz | fastq fastq | 7211828100.0 | 48078854.0 | RNA seq control for VPA or decitabine treatment in hemogenic endothelial cell 26hpf replicate 2 R1.fastq.gz | 0:75 1:75 | A:1904350731;C:1693709371;G:1687946675;T:1925778331;N:42992 | 75 | 75 | 1904350731 | 1693709371 | 1687946675 | 1925778331 | 42992 | SRX7034694 | SRS5554730 | SRA983011 | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany|Department of Cellular and Molecular Immunology | Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany | 2 | 0.91819 | 0.92224 | 0.03958 | 0.03841 | 0.75584 | 0.76161 | 0.46923 | 0.46415 | 75 | 75 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Germany | 2019-10-24 | Pharyngula | Embryo | Endothelium | Cardiovascular System |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;