RNAquarium Metadata Server
Institute Website Terms of Use Privacy Policy

run_metadata

60 rows where devstage_curation = "Pharyngula" and tissue_curation = "Heart"

✎ View and edit SQL

This data as json, CSV (advanced)

technology 5

experiment.library_layout 2

tissue_curation_coarse 1

tissue_curation 1

  • Heart · 60 ✖

experiment.platform 1

experiment.library_strategy 1

experiment.library_source 1

experiment.library_selection 1

devstage_curation_coarse 1

devstage_curation 1

  • Pharyngula · 60 ✖
Link rowid ▼ run.accession experiment.accession sample.accession study.accession bioproject study.title study.alias study.type study.abstract study.attributes study.PMIDs sample.description sample.title sample.alias sample.centername sample.attributes GEOsample.title GEOsample.dataprocessing GEOsample.source GEOsample.treatmentprotocol GEOsample.extractprotocol GEOsample.growthprotocol GEOsample.characteristics GEOsample.accession experiment.title experiment.alias experiment.library_name experiment.design_description experiment.library_construction_protocol experiment.attributes experiment.library_strategy experiment.library_source experiment.library_selection experiment.library_layout experiment.platform experiment.instrument_model experiment.spot_descriptor experiment.study_ref run.title run.attributes run.filename run.semantic_name run.total_bases run.total_spots run.alias run.read_lengths run.base_counts run.r1_length run.r2_length run.r3_length run.r4_length run.Acount run.Ccount run.Gcount run.Tcount run.Ncount run.experiment run.pool_member submission.accession submission.srasource submission.bioprojectsource seqdetective.n_mates seqdetective.mapping_rate.mate1 seqdetective.mapping_rate.mate2 seqdetective.nofeature_rate.mate1 seqdetective.nofeature_rate.mate2 seqdetective.sparsity.mate1 seqdetective.sparsity.mate2 seqdetective.pos_strand_rate.mate1 seqdetective.pos_strand_rate.mate2 seqdetective.readlen.mate1 seqdetective.readlen.mate2 seqdetective.judgement.mate1 seqdetective.judgement.mate2 seqdetective.judgement.reason platform_family instrument_generation read_bias selection_class prep_kit sc_or_bulk tech_class technology tech_variant submission.bioprojectsource.country earliest_date devstage_curation devstage_curation_coarse tissue_curation tissue_curation_coarse
36641 36641 SRR700539 SRX233125 SRS393099 SRP018538 PRJNA189226 Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos GSE44233 Transcriptome Analysis The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed.   pubmed:23850773   Seq15 GSM1081113   tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant Seq15 Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel. sorted cardiomyocytes Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation. RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol. Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish. developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant GSM1081113 GSM1081113: Seq15; Danio rerio; RNA Seq GSM1081113 1   1   GEO Accession:GSM1081113 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP018538         1505008521.0 29509971.0 GSM1081113 r1 0:51 A:394410844;C:370013758;G:356489603;T:384055071;N:39245 51       394410844 370013758 356489603 384055071 39245 SRX233125 SRS393099 SRA066447 GEO Todd Evans Lab, Cell and Developmental Biology, Weill Cornell 1 0.9123   0.07373   0.71346   0.47555   51   B   usable mapping rate illumina hiseq_era full_length random_priming trueseq bulk bulk bulk   United States 2013-02-11 Pharyngula Embryo Heart Cardiovascular System
36642 36642 SRR700538 SRX233124 SRS393098 SRP018538 PRJNA189226 Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos GSE44233 Transcriptome Analysis The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed.   pubmed:23850773   Seq14 GSM1081112   tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant Seq14 Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel. sorted cardiomyocytes Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation. RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol. Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish. developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant GSM1081112 GSM1081112: Seq14; Danio rerio; RNA Seq GSM1081112 1   1   GEO Accession:GSM1081112 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP018538     seq14.txt.gz fastq 3144425502.0 61655402.0 GSM1081112 r1 0:51 A:825172912;C:756354008;G:742919584;T:819897573;N:81425 51       825172912 756354008 742919584 819897573 81425 SRX233124 SRS393098 SRA066447 GEO Todd Evans Lab, Cell and Developmental Biology, Weill Cornell 1 0.93659   0.0806   0.73716   0.47614   51   B   usable mapping rate illumina hiseq_era full_length random_priming trueseq bulk bulk bulk   United States 2013-02-11 Pharyngula Embryo Heart Cardiovascular System
36643 36643 SRR700537 SRX233123 SRS393097 SRP018538 PRJNA189226 Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos GSE44233 Transcriptome Analysis The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed.   pubmed:23850773   Seq11 GSM1081111   tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant Seq11 Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel. sorted cardiomyocytes Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation. RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol. Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish. developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant GSM1081111 GSM1081111: Seq11; Danio rerio; RNA Seq GSM1081111 1   1   GEO Accession:GSM1081111 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II   SRP018538         1364181264.0 37893924.0 GSM1081111 r1 0:36 A:362442341;C:297159061;G:406723961;T:297355968;N:499933 36       362442341 297159061 406723961 297355968 499933 SRX233123 SRS393097 SRA066447 GEO Todd Evans Lab, Cell and Developmental Biology, Weill Cornell 1 0.67174   0.07612   0.74416   0.48016   36   B   usable mapping rate illumina early_illumina full_length random_priming trueseq bulk bulk bulk   United States 2013-02-11 Pharyngula Embryo Heart Cardiovascular System
36644 36644 SRR700536 SRX233122 SRS393096 SRP018538 PRJNA189226 Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos GSE44233 Transcriptome Analysis The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed.   pubmed:23850773   Seq13 GSM1081110   tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype Seq13 Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel. sorted cardiomyocytes Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation. RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol. Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish. developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype GSM1081110 GSM1081110: Seq13; Danio rerio; RNA Seq GSM1081110 1   1   GEO Accession:GSM1081110 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP018538     seq13.txt.gz fastq 1693675269.0 33209319.0 GSM1081110 r1 0:51 A:443719209;C:411369010;G:404182982;T:434361031;N:43037 51       443719209 411369010 404182982 434361031 43037 SRX233122 SRS393096 SRA066447 GEO Todd Evans Lab, Cell and Developmental Biology, Weill Cornell 1 0.91781   0.08107   0.74976   0.46528   51   B   usable mapping rate illumina hiseq_era full_length random_priming trueseq bulk bulk bulk   United States 2013-02-11 Pharyngula Embryo Heart Cardiovascular System
36645 36645 SRR700535 SRX233121 SRS393095 SRP018538 PRJNA189226 Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos GSE44233 Transcriptome Analysis The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed.   pubmed:23850773   Seq5 GSM1081109   tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype Seq5 Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel. sorted cardiomyocytes Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation. RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol. Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish. developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype GSM1081109 GSM1081109: Seq5; Danio rerio; RNA Seq GSM1081109 1   1   GEO Accession:GSM1081109 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II   SRP018538     seq5.txt.gz fastq 1245644280.0 34601230.0 GSM1081109 r1 0:36 A:334131135;C:287707996;G:288492153;T:334895459;N:417537 36       334131135 287707996 288492153 334895459 417537 SRX233121 SRS393095 SRA066447 GEO Todd Evans Lab, Cell and Developmental Biology, Weill Cornell 1 0.89495   0.1058   0.74247   0.46422   36   B   usable mapping rate illumina early_illumina full_length random_priming trueseq bulk bulk bulk   United States 2013-02-11 Pharyngula Embryo Heart Cardiovascular System
36646 36646 SRR700534 SRX233120 SRS393094 SRP018538 PRJNA189226 Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos GSE44233 Transcriptome Analysis The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed.   pubmed:23850773   Seq1 GSM1081108   tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype Seq1 Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel. sorted cardiomyocytes Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation. RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol. Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish. developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype GSM1081108 GSM1081108: Seq1; Danio rerio; RNA Seq GSM1081108 1   1   GEO Accession:GSM1081108 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II   SRP018538     seq1.txt.gz fastq 929284704.0 25813464.0 GSM1081108 r1 0:36 A:244730361;C:220466820;G:213037296;T:250386569;N:663658 36       244730361 220466820 213037296 250386569 663658 SRX233120 SRS393094 SRA066447 GEO Todd Evans Lab, Cell and Developmental Biology, Weill Cornell 1 0.87436   0.11629   0.73302   0.46999   36   B   usable mapping rate illumina early_illumina full_length random_priming trueseq bulk bulk bulk   United States 2013-02-11 Pharyngula Embryo Heart Cardiovascular System
41532 41532 SRR5006039 SRX2337867 SRS1791085 SRP092952 PRJNA352869 The Biotagging toolkit for analysis of specific cell populations in zebrafish reveals gene regulatory logic encoded in the nuclear transcriptome GSE89670 Other Interrogation of gene regulatory circuits in complex organisms requires precise tools for the selection of individual cell types as well as robust methods for tissue specific labeling and biochemical profiling of target proteins. By exploiting multiple transgenesis strategies we have developed a tissue specific binary in vivo biotinylation system in zebrafish termed "biotagging" a versatile methodology that uses genetically encoded components to biotinylate target proteins enabling in depth genome wide analyses of their molecular interactions. Using tissue specific transgenic drivers and individual cell compartment effector lines from our "biotagging" toolkit we demonstrate the specificity of our approach at the biochemical cellular and transcriptional levels. By characterizing the in vivo transcriptional landscape of migratory neural crest and myocardial cells in two different cellular compartments ribosomes and nucleus we identify a comprehensive network of protein coding and non coding RNAs and uncover cis regulatory modules and regulatory logic conferring cell specific identity embedded in the complexity of the non coding nuclear transcriptomes. Our study demonstrates that "biotagging" eliminates background inherent to complex embryonic environments and allows analyses of molecular interactions in any cellular context at highest resolution. Overall design: Examination of RNA seq and ATAC seq using in vivo biotinylated nuclei and polysomes.   pubmed:28402863   Myl7 RNASeq Nuclear 26hpf 2 GSM2386502   source name:Myl7 RNASeq Nuclear 26hpf|strain/background:AB/TU|tissue:myocardium|developmental stage:26hpf|assay:RNA seq stranded|cellular comp1nt:nuclear|ribodepleted:ribodepleted|isolation method:InVivoBiotinylatedNuclei|strand:reverse Myl7 RNASeq Nuclear 26hpf 2 ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using an enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a. BAM files incorporating reads belonging to either DNA strand were generated using custom python script. Genome build: danRer7 Zv9 Supplementary files format and content: bigWig files Myl7 RNASeq Nuclear 26hpf   Nuclei isolation using biotin tagged outer nuclear envelope adapted from INTACT procedure. Polyribosome isolation using biotin tagged Rpl10 protein adapted from TRAP procedure. FACS procedure using cell specific fluorescent marker following gentle dissociation of embryonic tissue. ATAC procedure adapted from Buenostro et al. 2013 adapted for FACS sorted embryonic cells. RNA pools extracted using RNAqueous Micro Scale Total RNA Isolation Kit. Non directional sequencing libraries post polyA selection of RNA transcripts NEBNext® PolyA mRNA Magnetic Isolation Module NEB were built using NEBnext Ultra RNA library kit for Illumina NEB. Following ribodepletion using Ribo ZeroTM Magnetic Kit Epicentre directional RNA seq libraries were constructed using Stranded RNA Seq Library Preparation Kit KAPABiosystems.   strain/background:AB/TU|tissue:myocardium|developmental stage:26hpf|assay:RNA seq stranded|cellular comp1nt:nuclear|ribodepleted:ribodepleted|isolation method:InVivoBiotinylatedNuclei|strand:reverse GSM2386502 GSM2386502: Myl7 RNASeq Nuclear 26hpf 2; Danio rerio; RNA Seq GSM2386502   1 Nuclei isolation using biotin tagged outer nuclear envelope adapted from INTACT procedure. Polyribosome isolation using biotin tagged Rpl10 protein adapted from TRAP procedure. FACS procedure using cell specific fluorescent marker following gentle dissociation of embryonic tissue. ATAC procedure adapted from Buenostro et al. 2013 adapted for FACS sorted embryonic cells. RNA pools extracted using RNAqueous Micro Scale Total RNA Isolation Kit. Non directional sequencing libraries post polyA selection of RNA transcripts NEBNext® PolyA mRNA Magnetic Isolation Module NEB were built using NEBnext Ultra RNA library kit for Illumina NEB. Following ribodepletion using Ribo ZeroTM Magnetic Kit Epicentre directional RNA seq libraries were constructed using Stranded RNA Seq Library Preparation Kit KAPABiosystems. GEO Accession:GSM2386502 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP092952     Myl7_RNASeq_Nuclear_26hpf_2_R1.fastq.gz Myl7_RNASeq_Nuclear_26hpf_2_R2.fastq.gz fastq fastq 5163276312.0 50620356.0 GSM2386502 r1 0:51 1:51 A:1144341926;C:1402381884;G:1460666304;T:1155627236;N:258962 51 51     1144341926 1402381884 1460666304 1155627236 258962 SRX2337867 SRS1791085 SRA491940 GEO Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine 2 0.79148 0.79923 0.1676 0.16851 0.74501 0.74395 0.44104 0.45239 51 51 B B biological fallback assumption illumina hiseq_era unknown poly_a nebnext bulk unknown unknown   United Kingdom 2016-11-08 Pharyngula Embryo Heart Cardiovascular System
41533 41533 SRR5006038 SRX2337866 SRS1791086 SRP092952 PRJNA352869 The Biotagging toolkit for analysis of specific cell populations in zebrafish reveals gene regulatory logic encoded in the nuclear transcriptome GSE89670 Other Interrogation of gene regulatory circuits in complex organisms requires precise tools for the selection of individual cell types as well as robust methods for tissue specific labeling and biochemical profiling of target proteins. By exploiting multiple transgenesis strategies we have developed a tissue specific binary in vivo biotinylation system in zebrafish termed "biotagging" a versatile methodology that uses genetically encoded components to biotinylate target proteins enabling in depth genome wide analyses of their molecular interactions. Using tissue specific transgenic drivers and individual cell compartment effector lines from our "biotagging" toolkit we demonstrate the specificity of our approach at the biochemical cellular and transcriptional levels. By characterizing the in vivo transcriptional landscape of migratory neural crest and myocardial cells in two different cellular compartments ribosomes and nucleus we identify a comprehensive network of protein coding and non coding RNAs and uncover cis regulatory modules and regulatory logic conferring cell specific identity embedded in the complexity of the non coding nuclear transcriptomes. Our study demonstrates that "biotagging" eliminates background inherent to complex embryonic environments and allows analyses of molecular interactions in any cellular context at highest resolution. Overall design: Examination of RNA seq and ATAC seq using in vivo biotinylated nuclei and polysomes.   pubmed:28402863   Myl7 RNASeq Nuclear 26hpf 1 GSM2386501   source name:Myl7 RNASeq Nuclear 26hpf|strain/background:AB/TU|tissue:myocardium|developmental stage:26hpf|assay:RNA seq stranded|cellular comp1nt:nuclear|ribodepleted:ribodepleted|isolation method:InVivoBiotinylatedNuclei|strand:reverse Myl7 RNASeq Nuclear 26hpf 1 ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using an enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a. BAM files incorporating reads belonging to either DNA strand were generated using custom python script. Genome build: danRer7 Zv9 Supplementary files format and content: bigWig files Myl7 RNASeq Nuclear 26hpf   Nuclei isolation using biotin tagged outer nuclear envelope adapted from INTACT procedure. Polyribosome isolation using biotin tagged Rpl10 protein adapted from TRAP procedure. FACS procedure using cell specific fluorescent marker following gentle dissociation of embryonic tissue. ATAC procedure adapted from Buenostro et al. 2013 adapted for FACS sorted embryonic cells. RNA pools extracted using RNAqueous Micro Scale Total RNA Isolation Kit. Non directional sequencing libraries post polyA selection of RNA transcripts NEBNext® PolyA mRNA Magnetic Isolation Module NEB were built using NEBnext Ultra RNA library kit for Illumina NEB. Following ribodepletion using Ribo ZeroTM Magnetic Kit Epicentre directional RNA seq libraries were constructed using Stranded RNA Seq Library Preparation Kit KAPABiosystems.   strain/background:AB/TU|tissue:myocardium|developmental stage:26hpf|assay:RNA seq stranded|cellular comp1nt:nuclear|ribodepleted:ribodepleted|isolation method:InVivoBiotinylatedNuclei|strand:reverse GSM2386501 GSM2386501: Myl7 RNASeq Nuclear 26hpf 1; Danio rerio; RNA Seq GSM2386501   1 Nuclei isolation using biotin tagged outer nuclear envelope adapted from INTACT procedure. Polyribosome isolation using biotin tagged Rpl10 protein adapted from TRAP procedure. FACS procedure using cell specific fluorescent marker following gentle dissociation of embryonic tissue. ATAC procedure adapted from Buenostro et al. 2013 adapted for FACS sorted embryonic cells. RNA pools extracted using RNAqueous Micro Scale Total RNA Isolation Kit. Non directional sequencing libraries post polyA selection of RNA transcripts NEBNext® PolyA mRNA Magnetic Isolation Module NEB were built using NEBnext Ultra RNA library kit for Illumina NEB. Following ribodepletion using Ribo ZeroTM Magnetic Kit Epicentre directional RNA seq libraries were constructed using Stranded RNA Seq Library Preparation Kit KAPABiosystems. GEO Accession:GSM2386501 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP092952     Myl7_RNASeq_Nuclear_26hpf_1_R1.fastq.gz Myl7_RNASeq_Nuclear_26hpf_1_R2.fastq.gz fastq fastq 4985333334.0 48875817.0 GSM2386501 r1 0:51 1:51 A:1030896260;C:1411954598;G:1508330460;T:1033900255;N:251761 51 51     1030896260 1411954598 1508330460 1033900255 251761 SRX2337866 SRS1791086 SRA491940 GEO Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine 2 0.7362 0.7434 0.12786 0.12837 0.75952 0.76065 0.47917 0.48384 51 51 B B biological fallback assumption illumina hiseq_era unknown poly_a nebnext bulk unknown unknown   United Kingdom 2016-11-08 Pharyngula Embryo Heart Cardiovascular System
43729 43729 SRR6039675 SRX3187839 SRS2515287 SRP117696 PRJNA407368 RNA seq timecourse analysis during zebrafish heart looping morphogenesis PRJNA407368 Other During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis.         B30   time point hpf group:B|multiplex group:2|strain:cmlc2::gfp reporter line|dev stage:30 hpf organism or animal                 RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf B30 B30 For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.     RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP117696     9499X9_130405_SN141_0668_AD2154ACXX_8.txt.gz fastq 1120008050.0 22400161.0 9499X9 130405 SN141 0668 AD2154ACXX 8.txt.gz 0:50 A:276093341;C:277073909;G:281519716;T:285221666;N:99418 50       276093341 277073909 281519716 285221666 99418 SRX3187839 SRS2515287 SRA608458 University of Utah|Neurobiology and Anatomy University of Utah 1 0.88679   0.20435   0.77185   0.58996   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United States 2017-09-14 Pharyngula Embryo Heart Cardiovascular System
43730 43730 SRR6039676 SRX3187838 SRS2515286 SRP117696 PRJNA407368 RNA seq timecourse analysis during zebrafish heart looping morphogenesis PRJNA407368 Other During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis.         B36   time point hpf group:B|multiplex group:2|strain:cmlc2::gfp reporter line|dev stage:36 hpf organism or animal                 RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf B36 B36 For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.     RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP117696     9499X10_130405_SN141_0668_AD2154ACXX_8.txt.gz fastq 1568417300.0 31368346.0 9499X10 130405 SN141 0668 AD2154ACXX 8.txt.gz 0:50 A:387419891;C:388387212;G:394030807;T:398440283;N:139107 50       387419891 388387212 394030807 398440283 139107 SRX3187838 SRS2515286 SRA608458 University of Utah|Neurobiology and Anatomy University of Utah 1 0.89157   0.18037   0.76286   0.63654   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United States 2017-09-14 Pharyngula Embryo Heart Cardiovascular System
43731 43731 SRR6039677 SRX3187837 SRS2515285 SRP117696 PRJNA407368 RNA seq timecourse analysis during zebrafish heart looping morphogenesis PRJNA407368 Other During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis.         A30   time point hpf group:A|multiplex group:1|strain:cmlc2::gfp reporter line|dev stage:30 hpf organism or animal                 RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf A30 A30 For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.     RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP117696     9499X1_130405_SN141_0668_AD2154ACXX_7.txt.gz fastq 1591462700.0 31829254.0 9499X1 130405 SN141 0668 AD2154ACXX 7.txt.gz 0:50 A:340306422;C:441595911;G:442592098;T:366852440;N:115829 50       340306422 441595911 442592098 366852440 115829 SRX3187837 SRS2515285 SRA608458 University of Utah|Neurobiology and Anatomy University of Utah 1 0.4932   0.13089   0.90962   0.7432   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United States 2017-09-14 Pharyngula Embryo Heart Cardiovascular System
43732 43732 SRR6039678 SRX3187836 SRS2515284 SRP117696 PRJNA407368 RNA seq timecourse analysis during zebrafish heart looping morphogenesis PRJNA407368 Other During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis.         A36   time point hpf group:A|multiplex group:1|strain:cmlc2::gfp reporter line|dev stage:36 hpf organism or animal                 RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf A36 A36 For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.     RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP117696     9499X2_130405_SN141_0668_AD2154ACXX_7.txt.gz fastq 1328412500.0 26568250.0 9499X2 130405 SN141 0668 AD2154ACXX 7.txt.gz 0:50 A:307478316;C:349102549;G:350562927;T:321170451;N:98257 50       307478316 349102549 350562927 321170451 98257 SRX3187836 SRS2515284 SRA608458 University of Utah|Neurobiology and Anatomy University of Utah 1 0.51716   0.15839   0.86642   0.61201   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United States 2017-09-14 Pharyngula Embryo Heart Cardiovascular System
43733 43733 SRR6039679 SRX3187835 SRS2515283 SRP117696 PRJNA407368 RNA seq timecourse analysis during zebrafish heart looping morphogenesis PRJNA407368 Other During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis.         A42   time point hpf group:A|multiplex group:1|strain:cmlc2::gfp reporter line|dev stage:42 hpf organism or animal                 RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf A42 A42 For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.     RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP117696     9499X3_130405_SN141_0668_AD2154ACXX_7.txt.gz fastq 1101079300.0 22021586.0 9499X3 130405 SN141 0668 AD2154ACXX 7.txt.gz 0:50 A:258171407;C:286688991;G:285879983;T:270258877;N:80042 50       258171407 286688991 285879983 270258877 80042 SRX3187835 SRS2515283 SRA608458 University of Utah|Neurobiology and Anatomy University of Utah 1 0.35588   0.10785   0.88116   0.69861   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United States 2017-09-14 Pharyngula Embryo Heart Cardiovascular System
43739 43739 SRR6039685 SRX3187829 SRS2515277 SRP117696 PRJNA407368 RNA seq timecourse analysis during zebrafish heart looping morphogenesis PRJNA407368 Other During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis.         C42   time point hpf group:C|multiplex group:4|strain:cmlc2::gfp reporter line|dev stage:42 hpf organism or animal                 RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf C42 C42 For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.     RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP117696     9499X19_130410_SN141_0670_AD228RACXX_8.txt.gz fastq 1404005750.0 28080115.0 9499X19 130410 SN141 0670 AD228RACXX 8.txt.gz 0:50 A:363329939;C:325066287;G:334263296;T:381124430;N:221798 50       363329939 325066287 334263296 381124430 221798 SRX3187829 SRS2515277 SRA608458 University of Utah|Neurobiology and Anatomy University of Utah 1 0.84646   0.20569   0.75856   0.66427   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United States 2017-09-14 Pharyngula Embryo Heart Cardiovascular System
43743 43743 SRR6039689 SRX3187825 SRS2515273 SRP117696 PRJNA407368 RNA seq timecourse analysis during zebrafish heart looping morphogenesis PRJNA407368 Other During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis.         C30   time point hpf group:C|multiplex group:3|strain:cmlc2::gfp reporter line|dev stage:30 hpf organism or animal                 RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf C30 C30 For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.     RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP117696     9499X17_130410_SN141_0670_AD228RACXX_7.txt.gz fastq 1261245200.0 25224904.0 9499X17 130410 SN141 0670 AD228RACXX 7.txt.gz 0:50 A:319419875;C:303300361;G:307895242;T:330428818;N:200904 50       319419875 303300361 307895242 330428818 200904 SRX3187825 SRS2515273 SRA608458 University of Utah|Neurobiology and Anatomy University of Utah 1 0.87549   0.23233   0.77325   0.65489   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United States 2017-09-14 Pharyngula Embryo Heart Cardiovascular System
43744 43744 SRR6039690 SRX3187824 SRS2515272 SRP117696 PRJNA407368 RNA seq timecourse analysis during zebrafish heart looping morphogenesis PRJNA407368 Other During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis.         C36   time point hpf group:C|multiplex group:3|strain:cmlc2::gfp reporter line|dev stage:36 hpf organism or animal                 RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf C36 C36 For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.     RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP117696     9499X18_130410_SN141_0670_AD228RACXX_7.txt.gz fastq 1263613900.0 25272278.0 9499X18 130410 SN141 0670 AD228RACXX 7.txt.gz 0:50 A:310002055;C:309104393;G:317720866;T:326586067;N:200519 50       310002055 309104393 317720866 326586067 200519 SRX3187824 SRS2515272 SRA608458 University of Utah|Neurobiology and Anatomy University of Utah 1 0.84147   0.2007   0.78839   0.61872   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United States 2017-09-14 Pharyngula Embryo Heart Cardiovascular System
43745 43745 SRR6039691 SRX3187823 SRS2515271 SRP117696 PRJNA407368 RNA seq timecourse analysis during zebrafish heart looping morphogenesis PRJNA407368 Other During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis.         B42   time point hpf group:B|multiplex group:2|strain:cmlc2::gfp reporter line|dev stage:42 hpf organism or animal                 RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf B42 B42 For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.     RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP117696     9499X11_130405_SN141_0668_AD2154ACXX_8.txt.gz fastq 1714029850.0 34280597.0 9499X11 130405 SN141 0668 AD2154ACXX 8.txt.gz 0:50 A:341571294;C:484054132;G:501201310;T:387056138;N:146976 50       341571294 484054132 501201310 387056138 146976 SRX3187823 SRS2515271 SRA608458 University of Utah|Neurobiology and Anatomy University of Utah 1 0.72224   0.18688   0.92151   0.71808   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United States 2017-09-14 Pharyngula Embryo Heart Cardiovascular System
48231 48231 SRR7119834 SRX4041477 SRS3259001 SRP144601 PRJNA459724 The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis GSE114038 Other Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively   pubmed:30867528   Danio rerio RNAseq singleHeart 1dpf mut 9 GSM3131225   tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / Danio rerio RNAseq singleHeart 1dpf mut 9 RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format heart   RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / GSM3131225 GSM3131225: Danio rerio RNAseq singleHeart 1dpf mut 9; Danio rerio; RNA Seq GSM3131225   1 RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation GEO Accession:GSM3131225 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP144601     mut_1_9_NDCII_sample_0023.fastq.gz fastq 57070136.0 762325.0 GSM3131225 r1 0:74.86 A:18605697;C:9652744;G:12793849;T:15973861;N:43985 74       18605697 9652744 12793849 15973861 43985 SRX4041477 SRS3259001 SRA699717 GEO Molecular Biology, Radboud University 1 0.65648   0.53947   0.94448   0.46511   75   B   usable mapping rate illumina nextseq unknown rrna_depletion ribozero sc single_cell_plate celseq   Netherlands 2018-05-04 Pharyngula Embryo Heart Cardiovascular System
48232 48232 SRR7119833 SRX4041476 SRS3258954 SRP144601 PRJNA459724 The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis GSE114038 Other Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively   pubmed:30867528   Danio rerio RNAseq singleHeart 1dpf mut 7 GSM3131224   tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / Danio rerio RNAseq singleHeart 1dpf mut 7 RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format heart   RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / GSM3131224 GSM3131224: Danio rerio RNAseq singleHeart 1dpf mut 7; Danio rerio; RNA Seq GSM3131224   1 RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation GEO Accession:GSM3131224 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP144601     mut_1_7_NDCII_sample_0020.fastq.gz fastq 95756013.0 1278688.0 GSM3131224 r1 0:74.89 A:31571219;C:16875591;G:19112888;T:28125288;N:71027 74       31571219 16875591 19112888 28125288 71027 SRX4041476 SRS3258954 SRA699717 GEO Molecular Biology, Radboud University 1 0.77787   0.38573   0.89491   0.52033   75   B   usable mapping rate illumina nextseq unknown rrna_depletion ribozero sc single_cell_plate celseq   Netherlands 2018-05-04 Pharyngula Embryo Heart Cardiovascular System
48233 48233 SRR7119832 SRX4041475 SRS3258953 SRP144601 PRJNA459724 The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis GSE114038 Other Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively   pubmed:30867528   Danio rerio RNAseq singleHeart 1dpf mut 6 GSM3131223   tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / Danio rerio RNAseq singleHeart 1dpf mut 6 RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format heart   RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / GSM3131223 GSM3131223: Danio rerio RNAseq singleHeart 1dpf mut 6; Danio rerio; RNA Seq GSM3131223   1 RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation GEO Accession:GSM3131223 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP144601     mut_1_6_NDCII_sample_0019.fastq.gz fastq 42326230.0 565166.0 GSM3131223 r1 0:74.89 A:13786789;C:7205959;G:8673068;T:12629903;N:30511 74       13786789 7205959 8673068 12629903 30511 SRX4041475 SRS3258953 SRA699717 GEO Molecular Biology, Radboud University 1 0.81231   0.24386   0.91662   0.54902   75   B   usable mapping rate illumina nextseq unknown rrna_depletion ribozero sc single_cell_plate celseq   Netherlands 2018-05-04 Pharyngula Embryo Heart Cardiovascular System
48234 48234 SRR7119831 SRX4041474 SRS3258952 SRP144601 PRJNA459724 The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis GSE114038 Other Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively   pubmed:30867528   Danio rerio RNAseq singleHeart 1dpf mut 5 GSM3131222   tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / Danio rerio RNAseq singleHeart 1dpf mut 5 RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format heart   RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / GSM3131222 GSM3131222: Danio rerio RNAseq singleHeart 1dpf mut 5; Danio rerio; RNA Seq GSM3131222   1 RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation GEO Accession:GSM3131222 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP144601     mut_1_5_NDCII_sample_0018.fastq.gz fastq 19727283.0 263414.0 GSM3131222 r1 0:74.89 A:6628087;C:3386996;G:3817542;T:5879595;N:15063 74       6628087 3386996 3817542 5879595 15063 SRX4041474 SRS3258952 SRA699717 GEO Molecular Biology, Radboud University 1 0.77937   0.38158   0.93681   0.49785   75   B   usable mapping rate illumina nextseq unknown rrna_depletion ribozero sc single_cell_plate celseq   Netherlands 2018-05-04 Pharyngula Embryo Heart Cardiovascular System
48235 48235 SRR7119830 SRX4041473 SRS3258951 SRP144601 PRJNA459724 The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis GSE114038 Other Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively   pubmed:30867528   Danio rerio RNAseq singleHeart 1dpf mut 4 GSM3131221   tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / Danio rerio RNAseq singleHeart 1dpf mut 4 RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format heart   RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / GSM3131221 GSM3131221: Danio rerio RNAseq singleHeart 1dpf mut 4; Danio rerio; RNA Seq GSM3131221   1 RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation GEO Accession:GSM3131221 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP144601     mut_1_4_NDCII_sample_0017.fastq.gz fastq 58279623.0 778471.0 GSM3131221 r1 0:74.86 A:18649049;C:9706373;G:12497900;T:17382327;N:43974 74       18649049 9706373 12497900 17382327 43974 SRX4041473 SRS3258951 SRA699717 GEO Molecular Biology, Radboud University 1 0.7618   0.36032   0.91425   0.50881   75   B   usable mapping rate illumina nextseq unknown rrna_depletion ribozero sc single_cell_plate celseq   Netherlands 2018-05-04 Pharyngula Embryo Heart Cardiovascular System
48236 48236 SRR7119829 SRX4041472 SRS3258950 SRP144601 PRJNA459724 The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis GSE114038 Other Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively   pubmed:30867528   Danio rerio RNAseq singleHeart 1dpf mut 3 GSM3131220   tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / Danio rerio RNAseq singleHeart 1dpf mut 3 RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format heart   RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / GSM3131220 GSM3131220: Danio rerio RNAseq singleHeart 1dpf mut 3; Danio rerio; RNA Seq GSM3131220   1 RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation GEO Accession:GSM3131220 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP144601     mut_1_3_NDCII_sample_0016.fastq.gz fastq 76875810.0 1027192.0 GSM3131220 r1 0:74.84 A:25047740;C:13094049;G:17143346;T:21533451;N:57224 74       25047740 13094049 17143346 21533451 57224 SRX4041472 SRS3258950 SRA699717 GEO Molecular Biology, Radboud University 1 0.73765   0.57489   0.91297   0.50116   75   B   usable mapping rate illumina nextseq unknown rrna_depletion ribozero sc single_cell_plate celseq   Netherlands 2018-05-04 Pharyngula Embryo Heart Cardiovascular System
48237 48237 SRR7119828 SRX4041471 SRS3258949 SRP144601 PRJNA459724 The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis GSE114038 Other Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively   pubmed:30867528   Danio rerio RNAseq singleHeart 1dpf mut 2 GSM3131219   tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / Danio rerio RNAseq singleHeart 1dpf mut 2 RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format heart   RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / GSM3131219 GSM3131219: Danio rerio RNAseq singleHeart 1dpf mut 2; Danio rerio; RNA Seq GSM3131219   1 RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation GEO Accession:GSM3131219 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP144601     mut_1_2_NDCII_sample_0015.fastq.gz fastq 279841644.0 3736395.0 GSM3131219 r1 0:74.90 A:89952643;C:48371385;G:56655773;T:84653645;N:208198 74       89952643 48371385 56655773 84653645 208198 SRX4041471 SRS3258949 SRA699717 GEO Molecular Biology, Radboud University 1 0.83707   0.16537   0.8449   0.51435   75   B   usable mapping rate illumina nextseq unknown rrna_depletion ribozero sc single_cell_plate celseq   Netherlands 2018-05-04 Pharyngula Embryo Heart Cardiovascular System
48238 48238 SRR7119827 SRX4041470 SRS3258948 SRP144601 PRJNA459724 The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis GSE114038 Other Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively   pubmed:30867528   Danio rerio RNAseq singleHeart 1dpf mut 1 GSM3131218   tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / Danio rerio RNAseq singleHeart 1dpf mut 1 RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format heart   RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2 / GSM3131218 GSM3131218: Danio rerio RNAseq singleHeart 1dpf mut 1; Danio rerio; RNA Seq GSM3131218   1 RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation GEO Accession:GSM3131218 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP144601     mut_1_1_NDCII_sample_0014.fastq.gz fastq 11439626.0 152750.0 GSM3131218 r1 0:74.89 A:3900812;C:1903149;G:2137242;T:3490826;N:7597 74       3900812 1903149 2137242 3490826 7597 SRX4041470 SRS3258948 SRA699717 GEO Molecular Biology, Radboud University 1 0.81522   0.22036   0.9427   0.50565   75   B   usable mapping rate illumina nextseq unknown rrna_depletion ribozero sc single_cell_plate celseq   Netherlands 2018-05-04 Pharyngula Embryo Heart Cardiovascular System
48239 48239 SRR7119826 SRX4041469 SRS3258947 SRP144601 PRJNA459724 The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis GSE114038 Other Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively   pubmed:30867528   Danio rerio RNAseq singleHeart 1dpf wt 11 GSM3131217   tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ Danio rerio RNAseq singleHeart 1dpf wt 11 RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format heart   RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ GSM3131217 GSM3131217: Danio rerio RNAseq singleHeart 1dpf wt 11; Danio rerio; RNA Seq GSM3131217   1 RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation GEO Accession:GSM3131217 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP144601     W_1_11_NDCII_sample_0013.fastq.gz fastq 42251524.0 564309.0 GSM3131217 r1 0:74.87 A:13857230;C:6932231;G:9360286;T:12071859;N:29918 74       13857230 6932231 9360286 12071859 29918 SRX4041469 SRS3258947 SRA699717 GEO Molecular Biology, Radboud University 1 0.73137   0.44634   0.93196   0.46969   75   B   usable mapping rate illumina nextseq unknown rrna_depletion ribozero sc single_cell_plate celseq   Netherlands 2018-05-04 Pharyngula Embryo Heart Cardiovascular System
48240 48240 SRR7119825 SRX4041468 SRS3258946 SRP144601 PRJNA459724 The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis GSE114038 Other Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively   pubmed:30867528   Danio rerio RNAseq singleHeart 1dpf wt 9 GSM3131216   tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ Danio rerio RNAseq singleHeart 1dpf wt 9 RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format heart   RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ GSM3131216 GSM3131216: Danio rerio RNAseq singleHeart 1dpf wt 9; Danio rerio; RNA Seq GSM3131216   1 RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation GEO Accession:GSM3131216 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP144601     W_1_9_NDCII_sample_0010.fastq.gz fastq 140217783.0 1872511.0 GSM3131216 r1 0:74.88 A:48060012;C:23208078;G:28722039;T:40121038;N:106616 74       48060012 23208078 28722039 40121038 106616 SRX4041468 SRS3258946 SRA699717 GEO Molecular Biology, Radboud University 1 0.80665   0.32237   0.86778   0.52038   75   B   usable mapping rate illumina nextseq unknown rrna_depletion ribozero sc single_cell_plate celseq   Netherlands 2018-05-04 Pharyngula Embryo Heart Cardiovascular System
48241 48241 SRR7119824 SRX4041467 SRS3258945 SRP144601 PRJNA459724 The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis GSE114038 Other Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively   pubmed:30867528   Danio rerio RNAseq singleHeart 1dpf wt 7 GSM3131215   tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ Danio rerio RNAseq singleHeart 1dpf wt 7 RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format heart   RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ GSM3131215 GSM3131215: Danio rerio RNAseq singleHeart 1dpf wt 7; Danio rerio; RNA Seq GSM3131215   1 RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation GEO Accession:GSM3131215 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP144601     W_1_7_NDCII_sample_0008.fastq.gz fastq 23549291.0 314631.0 GSM3131215 r1 0:74.85 A:8015580;C:3998401;G:4892477;T:6623855;N:18978 74       8015580 3998401 4892477 6623855 18978 SRX4041467 SRS3258945 SRA699717 GEO Molecular Biology, Radboud University 1 0.71017   0.48929   0.94817   0.56724   75   B   usable mapping rate illumina nextseq unknown rrna_depletion ribozero sc single_cell_plate celseq   Netherlands 2018-05-04 Pharyngula Embryo Heart Cardiovascular System
48242 48242 SRR7119823 SRX4041466 SRS3258944 SRP144601 PRJNA459724 The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis GSE114038 Other Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively   pubmed:30867528   Danio rerio RNAseq singleHeart 1dpf wt 6 GSM3131214   tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ Danio rerio RNAseq singleHeart 1dpf wt 6 RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format heart   RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ GSM3131214 GSM3131214: Danio rerio RNAseq singleHeart 1dpf wt 6; Danio rerio; RNA Seq GSM3131214   1 RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation GEO Accession:GSM3131214 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP144601     W_1_6_NDCII_sample_0007.fastq.gz fastq 129689911.0 1732243.0 GSM3131214 r1 0:74.87 A:40869250;C:21297938;G:30638559;T:36786070;N:98094 74       40869250 21297938 30638559 36786070 98094 SRX4041466 SRS3258944 SRA699717 GEO Molecular Biology, Radboud University 1 0.77101   0.59088   0.88824   0.5086   75   B   usable mapping rate illumina nextseq unknown rrna_depletion ribozero sc single_cell_plate celseq   Netherlands 2018-05-04 Pharyngula Embryo Heart Cardiovascular System
48243 48243 SRR7119822 SRX4041465 SRS3258943 SRP144601 PRJNA459724 The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis GSE114038 Other Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively   pubmed:30867528   Danio rerio RNAseq singleHeart 1dpf wt 5 GSM3131213   tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ Danio rerio RNAseq singleHeart 1dpf wt 5 RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format heart   RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ GSM3131213 GSM3131213: Danio rerio RNAseq singleHeart 1dpf wt 5; Danio rerio; RNA Seq GSM3131213   1 RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation GEO Accession:GSM3131213 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP144601     W_1_5_NDCII_sample_0006.fastq.gz fastq 24218974.0 323441.0 GSM3131213 r1 0:74.88 A:8220059;C:3989695;G:4906493;T:7085365;N:17362 74       8220059 3989695 4906493 7085365 17362 SRX4041465 SRS3258943 SRA699717 GEO Molecular Biology, Radboud University 1 0.76586   0.49207   0.93501   0.55288   75   B   usable mapping rate illumina nextseq unknown rrna_depletion ribozero sc single_cell_plate celseq   Netherlands 2018-05-04 Pharyngula Embryo Heart Cardiovascular System
48244 48244 SRR7119821 SRX4041464 SRS3258942 SRP144601 PRJNA459724 The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis GSE114038 Other Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively   pubmed:30867528   Danio rerio RNAseq singleHeart 1dpf wt 4 GSM3131212   tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ Danio rerio RNAseq singleHeart 1dpf wt 4 RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format heart   RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ GSM3131212 GSM3131212: Danio rerio RNAseq singleHeart 1dpf wt 4; Danio rerio; RNA Seq GSM3131212   1 RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation GEO Accession:GSM3131212 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP144601     W_1_4_NDCII_sample_0005.fastq.gz fastq 22001311.0 293804.0 GSM3131212 r1 0:74.88 A:7350666;C:3795843;G:4584903;T:6252967;N:16932 74       7350666 3795843 4584903 6252967 16932 SRX4041464 SRS3258942 SRA699717 GEO Molecular Biology, Radboud University 1 0.7875   0.22891   0.93835   0.52263   75   B   usable mapping rate illumina nextseq unknown rrna_depletion ribozero sc single_cell_plate celseq   Netherlands 2018-05-04 Pharyngula Embryo Heart Cardiovascular System
48245 48245 SRR7119820 SRX4041463 SRS3258941 SRP144601 PRJNA459724 The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis GSE114038 Other Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively   pubmed:30867528   Danio rerio RNAseq singleHeart 1dpf wt 3 GSM3131211   tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ Danio rerio RNAseq singleHeart 1dpf wt 3 RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format heart   RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ GSM3131211 GSM3131211: Danio rerio RNAseq singleHeart 1dpf wt 3; Danio rerio; RNA Seq GSM3131211   1 RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation GEO Accession:GSM3131211 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP144601     W_1_3_NDCII_sample_0004.fastq.gz fastq 113079916.0 1510783.0 GSM3131211 r1 0:74.85 A:37699535;C:19622685;G:23847263;T:31822581;N:87852 74       37699535 19622685 23847263 31822581 87852 SRX4041463 SRS3258941 SRA699717 GEO Molecular Biology, Radboud University 1 0.76704   0.49567   0.89045   0.51015   75   B   usable mapping rate illumina nextseq unknown rrna_depletion ribozero sc single_cell_plate celseq   Netherlands 2018-05-04 Pharyngula Embryo Heart Cardiovascular System
48246 48246 SRR7119819 SRX4041462 SRS3258977 SRP144601 PRJNA459724 The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis GSE114038 Other Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively   pubmed:30867528   Danio rerio RNAseq singleHeart 1dpf wt 2 GSM3131210   tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ Danio rerio RNAseq singleHeart 1dpf wt 2 RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format heart   RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ GSM3131210 GSM3131210: Danio rerio RNAseq singleHeart 1dpf wt 2; Danio rerio; RNA Seq GSM3131210   1 RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation GEO Accession:GSM3131210 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP144601     W_1_2_NDCII_sample_0003.fastq.gz fastq 28758160.0 384087.0 GSM3131210 r1 0:74.87 A:9200574;C:4647591;G:6808365;T:8081607;N:20023 74       9200574 4647591 6808365 8081607 20023 SRX4041462 SRS3258977 SRA699717 GEO Molecular Biology, Radboud University 1 0.749   0.43154   0.92498   0.50112   74   B   usable mapping rate illumina nextseq unknown rrna_depletion ribozero sc single_cell_plate celseq   Netherlands 2018-05-04 Pharyngula Embryo Heart Cardiovascular System
48247 48247 SRR7119818 SRX4041461 SRS3258961 SRP144601 PRJNA459724 The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis GSE114038 Other Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively   pubmed:30867528   Danio rerio RNAseq singleHeart 1dpf wt 1 GSM3131209   tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ Danio rerio RNAseq singleHeart 1dpf wt 1 RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format heart   RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. strain:TU/TLF mixed background|cell type:heart|age:1 dpf|genotype:myl7:GFP rnf2+/+ GSM3131209 GSM3131209: Danio rerio RNAseq singleHeart 1dpf wt 1; Danio rerio; RNA Seq GSM3131209   1 RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation GEO Accession:GSM3131209 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP144601     W_1_1_NDCII_sample_0002.fastq.gz fastq 115972945.0 1548390.0 GSM3131209 r1 0:74.90 A:39437412;C:19997472;G:22424748;T:34023469;N:89844 74       39437412 19997472 22424748 34023469 89844 SRX4041461 SRS3258961 SRA699717 GEO Molecular Biology, Radboud University 1 0.81745   0.22051   0.87746   0.55768   75   B   usable mapping rate illumina nextseq unknown rrna_depletion ribozero sc single_cell_plate celseq   Netherlands 2018-05-04 Pharyngula Embryo Heart Cardiovascular System
51190 51190 SRR8592250 SRX5392462 SRS4380285 SRP186305 PRJNA522917 Pbx4 limits vertebrate heart size and promotes pharyngeal arch artery development through partitioning progenitor fates within the second heart field and restricting proliferation GSE126647 Transcriptome Analysis Development of the vertebrate heart requires the appropriate integration of temporally distinct differentiating progenitor populations. While factors that promote accrual of later differentiating second heart field SHF derived cells to the outflow tract OFT have been intensively investigated few signals are understood that specifically restrict the size of the vertebrate OFT. Here we show that improper specification and proliferation of SHF progenitors in zebrafish lazarus lzr mutants which lack the transcription factor Pbx4 produces enlarged hearts with a specific increase in ventricular cardiomyocytes and smooth muscle cells within the OFT. Specifically optogenetic lineage tracing demonstrates Pbx4 initially promotes the proper partitioning of the SHF into anterior progenitors which contribute to the OFT and adjacent endothelial cell progenitors which contribute to posterior pharyngeal arch arteries. Subsequently Pbx4 also limits the size of the SHF through repressing SHF progenitor proliferation. Single cell RNA sequencing of nkx2.5+ cells revealed that the enlarged SHF progenitor population within Pbx4 deficient embryos assimilates characteristics of normally distinct proliferative and more anterior differentiated cardiomyocyte populations. Therefore the generation of proper OFT size and great arteries in vertebrates requires Pbx dependent stratification of unique progenitor differentiation states to facilitate homeotic like transformations and limit progenitor production within the SHF. Overall design: To determine the effects of Pbx4 loss on cardiac progenitors and differentiated cardiomyocytes we utilized single cell RNA Seq scRNA Seq data sets collected from control and Pbx4 depleted embryos nkx2.5:ZsYellow+ cells at 28 hours post ferlilization. The 10x Genomics platform was used for these studies version 2 library chemistry.   pubmed:32094112   Pbx4 depleted nkx2.5:ZsYellow+ cells 10X Genomics single cell RNA Seq GSM3610371   source name:Pbx4 depleted nkx2.5:ZsYellow+ cells|strain background:AB/TU|age:28 hpf depleted|tissue:cardiac progenitors and cardiomyocytes|cell type:nkx2.5:ZsYellow+ cells Pbx4 depleted nkx2.5:ZsYellow+ cells 10X Genomics single cell RNA Seq Illumina HiSeq2500 used for basecalling CellRanger software package used for alignment filtering barcode reading prior to post processing with ICGS in AltAnalyze. Genome build: GRCz10/danRer10 Supplementary files format and content: 10X Genomics Chromium Raw Gene BC Cellular Barcodes barcode.tsv Genes genes.tsv and Matrix matrix.mtx Pbx4 depleted nkx2.5:ZsYellow+ cells   Nkx2.5:ZsYellow+ cells from control and Pbx4 depleted embryos were isolated via FACS at 28 hpf. Dissociation of embryos was performed as described by Stachura and Traver 2016 with the following modifications approximately 180 embryos per condition were manually dechorionated and rinsed in ice cold Hank’s Balance Salt Solution HBSS containing Ca2+ and Mg2+. Embryos were subsequently transferred to 1.5ml tubes in 500 µl HBSS and dissociation was initiated by adding 60 µl Liberase Roche. Embryos were deyolked by pipetting up and down first with a p1000 tip and subsequently with a p100 tip as described by Samsa et al. 2016. Following yolk removal embryos were incubated at 32.5°C. To facilitate dissociation embryos were gently homogenized using a handheld pestle homogenizer 5 10 seconds and returned to 32.5°C. This process was repeated until complete dissociation was achieved which took approximately 15 minutes. Dissociation of embryos was monitored using a dissecting microscope. Following dissociation cell suspensions were centrifuged for 5 minutes at 13 000 rpm at 4°C. The supernatant was discarded and the resulting pellets were resuspended in 500 µl of FACS medium consisting of 0.9X PBS and 2% fetal bovine serum FBS. Samples were filtered twice through a 40 µm strainer and collected in a FACs tube. FACS sorting was performed by the CCHMC Research Flow Cytometry Core using a 70 µm nozzle and a gating strategy as described by Samsa et al. 2016. The 10X Genomics Chromium Instrument and cDNA synthesis kit 10x Genomics was used by the CCHMC Genomics core to generate a barcoded cDNA library for single cell RNA sequencing from approximately 4 000 cells. cDNA library quality was determined using an Agilent Bioanalyzer. Using this library we performed one full lane sequence on two paired end 75bp Flow Cells using on an Illumina HiSeq2500. 10X Genomics Chromium v2 chemistry   strain background:AB/TU|age:28 hpf depleted|tissue:cardiac progenitors and cardiomyocytes|cell type:nkx2.5:ZsYellow+ cells GSM3610371 GSM3610371: Pbx4 depleted nkx2.5:ZsYellow+ cells 10X Genomics single cell RNA Seq; Danio rerio; RNA Seq GSM3610371   1 Nkx2.5:ZsYellow+ cells from control and Pbx4 depleted embryos were isolated via FACS at 28 hpf. Dissociation of embryos was performed as described by Stachura and Traver 2016 with the following modifications approximately 180 embryos per condition were manually dechorionated and rinsed in ice cold Hank's Balance Salt Solution HBSS containing Ca2+ and Mg2+. Embryos were subsequently transferred to 1.5ml tubes in 500 µl HBSS and dissociation was initiated by adding 60 µl Liberase Roche. Embryos were deyolked by pipetting up and down first with a p1000 tip and subsequently with a p100 tip as described by Samsa et al. 2016. Following yolk removal embryos were incubated at 32.5°C. To facilitate dissociation embryos were gently homogenized using a handheld pestle homogenizer 5 10 seconds and returned to 32.5°C. This process was repeated until complete dissociation was achieved which took approximately 15 minutes. Dissociation of embryos was monitored using a dissecting microscope. Following dissociation cell suspensions were centrifuged for 5 minutes at 13 000 rpm at 4°C. The supernatant was discarded and the resulting pellets were resuspended in 500 µl of FACS medium consisting of 0.9X PBS and 2% fetal bovine serum FBS. Samples were filtered twice through a 40 µm strainer and collected in a FACs tube. FACS sorting was performed by the CCHMC Research Flow Cytometry Core using a 70 µm nozzle and a gating strategy as described by Samsa et al. 2016. The 10X Genomics Chromium Instrument and cDNA synthesis kit 10x Genomics was used by the CCHMC Genomics core to generate a barcoded cDNA library for single cell RNA sequencing from approximately 4 000 cells. cDNA library quality was determined using an Agilent Bioanalyzer. Using this library we performed one full lane sequence on two paired end 75bp Flow Cells using on an Illumina HiSeq2500. 10X Genomics Chromium v2 chemistry GEO Accession:GSM3610371 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP186305   loader:fastq load.py|options: platform=Illumina readTypes=TTB read1PairFiles=10X PBX4 mo injected 3zf S2 L001 I1 001.fastq.gz read2PairFiles=10X PBX4 mo injected 3zf S2 L001 R1 001.fastq.gz read3PairFiles=10X PBX4 mo injected 3zf S2 L001 R2 001.fastq.gz 10X_PBX4_mo_injected_3zf_S2_L001_I1_001.fastq.gz 10X_PBX4_mo_injected_3zf_S2_L001_R1_001.fastq.gz 10X_PBX4_mo_injected_3zf_S2_L001_R2_001.fastq.gz fastq fastq fastq 13771731610.0 75668855.0 GSM3610371 r1 0:8 1:27 2:147 A:3868981340;C:3004344480;G:3173242889;T:3705905113;N:19257788 8 27 147   3868981340 3004344480 3173242889 3705905113 19257788 SRX5392462 SRS4380285 SRA850447 GEO Nathan Salomonis, Biomedical Informatics, Cincinnati Children's Hospital 1 0.91532   0.07049   0.82722   0.50962   147   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown sc single_cell_droplet 10x   United States 2019-02-15 Pharyngula Embryo Heart Cardiovascular System
51191 51191 SRR8592251 SRX5392462 SRS4380285 SRP186305 PRJNA522917 Pbx4 limits vertebrate heart size and promotes pharyngeal arch artery development through partitioning progenitor fates within the second heart field and restricting proliferation GSE126647 Transcriptome Analysis Development of the vertebrate heart requires the appropriate integration of temporally distinct differentiating progenitor populations. While factors that promote accrual of later differentiating second heart field SHF derived cells to the outflow tract OFT have been intensively investigated few signals are understood that specifically restrict the size of the vertebrate OFT. Here we show that improper specification and proliferation of SHF progenitors in zebrafish lazarus lzr mutants which lack the transcription factor Pbx4 produces enlarged hearts with a specific increase in ventricular cardiomyocytes and smooth muscle cells within the OFT. Specifically optogenetic lineage tracing demonstrates Pbx4 initially promotes the proper partitioning of the SHF into anterior progenitors which contribute to the OFT and adjacent endothelial cell progenitors which contribute to posterior pharyngeal arch arteries. Subsequently Pbx4 also limits the size of the SHF through repressing SHF progenitor proliferation. Single cell RNA sequencing of nkx2.5+ cells revealed that the enlarged SHF progenitor population within Pbx4 deficient embryos assimilates characteristics of normally distinct proliferative and more anterior differentiated cardiomyocyte populations. Therefore the generation of proper OFT size and great arteries in vertebrates requires Pbx dependent stratification of unique progenitor differentiation states to facilitate homeotic like transformations and limit progenitor production within the SHF. Overall design: To determine the effects of Pbx4 loss on cardiac progenitors and differentiated cardiomyocytes we utilized single cell RNA Seq scRNA Seq data sets collected from control and Pbx4 depleted embryos nkx2.5:ZsYellow+ cells at 28 hours post ferlilization. The 10x Genomics platform was used for these studies version 2 library chemistry.   pubmed:32094112   Pbx4 depleted nkx2.5:ZsYellow+ cells 10X Genomics single cell RNA Seq GSM3610371   source name:Pbx4 depleted nkx2.5:ZsYellow+ cells|strain background:AB/TU|age:28 hpf depleted|tissue:cardiac progenitors and cardiomyocytes|cell type:nkx2.5:ZsYellow+ cells Pbx4 depleted nkx2.5:ZsYellow+ cells 10X Genomics single cell RNA Seq Illumina HiSeq2500 used for basecalling CellRanger software package used for alignment filtering barcode reading prior to post processing with ICGS in AltAnalyze. Genome build: GRCz10/danRer10 Supplementary files format and content: 10X Genomics Chromium Raw Gene BC Cellular Barcodes barcode.tsv Genes genes.tsv and Matrix matrix.mtx Pbx4 depleted nkx2.5:ZsYellow+ cells   Nkx2.5:ZsYellow+ cells from control and Pbx4 depleted embryos were isolated via FACS at 28 hpf. Dissociation of embryos was performed as described by Stachura and Traver 2016 with the following modifications approximately 180 embryos per condition were manually dechorionated and rinsed in ice cold Hank’s Balance Salt Solution HBSS containing Ca2+ and Mg2+. Embryos were subsequently transferred to 1.5ml tubes in 500 µl HBSS and dissociation was initiated by adding 60 µl Liberase Roche. Embryos were deyolked by pipetting up and down first with a p1000 tip and subsequently with a p100 tip as described by Samsa et al. 2016. Following yolk removal embryos were incubated at 32.5°C. To facilitate dissociation embryos were gently homogenized using a handheld pestle homogenizer 5 10 seconds and returned to 32.5°C. This process was repeated until complete dissociation was achieved which took approximately 15 minutes. Dissociation of embryos was monitored using a dissecting microscope. Following dissociation cell suspensions were centrifuged for 5 minutes at 13 000 rpm at 4°C. The supernatant was discarded and the resulting pellets were resuspended in 500 µl of FACS medium consisting of 0.9X PBS and 2% fetal bovine serum FBS. Samples were filtered twice through a 40 µm strainer and collected in a FACs tube. FACS sorting was performed by the CCHMC Research Flow Cytometry Core using a 70 µm nozzle and a gating strategy as described by Samsa et al. 2016. The 10X Genomics Chromium Instrument and cDNA synthesis kit 10x Genomics was used by the CCHMC Genomics core to generate a barcoded cDNA library for single cell RNA sequencing from approximately 4 000 cells. cDNA library quality was determined using an Agilent Bioanalyzer. Using this library we performed one full lane sequence on two paired end 75bp Flow Cells using on an Illumina HiSeq2500. 10X Genomics Chromium v2 chemistry   strain background:AB/TU|age:28 hpf depleted|tissue:cardiac progenitors and cardiomyocytes|cell type:nkx2.5:ZsYellow+ cells GSM3610371 GSM3610371: Pbx4 depleted nkx2.5:ZsYellow+ cells 10X Genomics single cell RNA Seq; Danio rerio; RNA Seq GSM3610371   1 Nkx2.5:ZsYellow+ cells from control and Pbx4 depleted embryos were isolated via FACS at 28 hpf. Dissociation of embryos was performed as described by Stachura and Traver 2016 with the following modifications approximately 180 embryos per condition were manually dechorionated and rinsed in ice cold Hank's Balance Salt Solution HBSS containing Ca2+ and Mg2+. Embryos were subsequently transferred to 1.5ml tubes in 500 µl HBSS and dissociation was initiated by adding 60 µl Liberase Roche. Embryos were deyolked by pipetting up and down first with a p1000 tip and subsequently with a p100 tip as described by Samsa et al. 2016. Following yolk removal embryos were incubated at 32.5°C. To facilitate dissociation embryos were gently homogenized using a handheld pestle homogenizer 5 10 seconds and returned to 32.5°C. This process was repeated until complete dissociation was achieved which took approximately 15 minutes. Dissociation of embryos was monitored using a dissecting microscope. Following dissociation cell suspensions were centrifuged for 5 minutes at 13 000 rpm at 4°C. The supernatant was discarded and the resulting pellets were resuspended in 500 µl of FACS medium consisting of 0.9X PBS and 2% fetal bovine serum FBS. Samples were filtered twice through a 40 µm strainer and collected in a FACs tube. FACS sorting was performed by the CCHMC Research Flow Cytometry Core using a 70 µm nozzle and a gating strategy as described by Samsa et al. 2016. The 10X Genomics Chromium Instrument and cDNA synthesis kit 10x Genomics was used by the CCHMC Genomics core to generate a barcoded cDNA library for single cell RNA sequencing from approximately 4 000 cells. cDNA library quality was determined using an Agilent Bioanalyzer. Using this library we performed one full lane sequence on two paired end 75bp Flow Cells using on an Illumina HiSeq2500. 10X Genomics Chromium v2 chemistry GEO Accession:GSM3610371 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP186305   loader:fastq load.py|options: platform=Illumina readTypes=TTB read1PairFiles=10X PBX4 mo injected 3zf S2 L002 I1 001.fastq.gz read2PairFiles=10X PBX4 mo injected 3zf S2 L002 R1 001.fastq.gz read3PairFiles=10X PBX4 mo injected 3zf S2 L002 R2 001.fastq.gz 10X_PBX4_mo_injected_3zf_S2_L002_I1_001.fastq.gz 10X_PBX4_mo_injected_3zf_S2_L002_R1_001.fastq.gz 10X_PBX4_mo_injected_3zf_S2_L002_R2_001.fastq.gz fastq fastq fastq 13960104704.0 76703872.0 GSM3610371 r2 0:8 1:27 2:147 A:3921736827;C:3045954411;G:3216708567;T:3758217760;N:17487139 8 27 147   3921736827 3045954411 3216708567 3758217760 17487139 SRX5392462 SRS4380285 SRA850447 GEO Nathan Salomonis, Biomedical Informatics, Cincinnati Children's Hospital 1 0.91469   0.06915   0.82747   0.49959   147   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown sc single_cell_droplet 10x   United States 2019-02-15 Pharyngula Embryo Heart Cardiovascular System
53021 53021 SRR9662018 SRX6422894 SRS5079684 SRP213938 PRJNA553572 A map of cis regulatory elements and 3D genome structures in zebrafish GSE134055 Other The zebrafish has been widely used for the study of human disease and development as 70% of the protein coding genes are conserved between the two species. Annotation of functional control elements of the zebrafish genome however has lagged behind that of other model systems such as mouse and Drosophila. Based on multi omics approaches taken in the ENCODE and Roadmap Epigenomics projects we performed RNA seq ATAC seq ChIP seq and Hi C experiments in ten adult and two embryonic tissues to generate a comprehensive map of transcriptomes and regulatory elements in the zebrafish Tuebingen reference strain. Overall we have identified 235 596 cis regulatory elements which potentially shape the tissue specific and developmental stage specific gene expression in zebrafish. A comparison of zebrafish human and mouse regulatory elements allowed us to identify both evolutionarily conserved and species specific regulatory sequences. Furthermore through the analysis of Hi C data in zebrafish brain and muscle we observed different levels of 3D genome organization including compartment topological associating domains TADs and chromatin loops in zebrafish. A subset of TADs are deeply conserved between zebrafish and human. This work provides an additional epigenomic anchor for the functional annotation of vertebrate genomes and the study of evolutionally conserved elements of 3D genome organization. Overall design: 13 tissues from adult and embryonic stage were examined using ChIP Seq H3K27ac and H3K4me3 RNA Seq 11 of them were examined using ATAC seq WGBS and ChIP seq H3K9me3 and H3K9me2 and one scATAC seq in brain. Additionally we performed HiC experiments in adult muscle and brain. Please note that for the samples GSM4661977 GSM4662088 [1] each processed data generated from both replicates is linked to the corresponding *rep1 sample records [2] the input sample used for each ChIP sample is indicated in the description field in the corresponding input sample records.   pubmed:33239788;pubmed:35649578   YueLab RNA Seq Heart rep2 GSM3934886   source name:Tissue|strain:Tuebingen|tissue:Heart YueLab RNA Seq Heart rep2 RNA seq reads were aligned to zv10 genome assembly using STAR; ChIP seq and ATAC seq reads were aligned to zv10 genome assembly using BWA HiC reads were aligned to zv10 genome assembly using Bowtie2 The TPM value of gene expression was caculated using RSEM ChIP seq and ATAC seq peaks were called using MACS2 with the following setting: ChIP seq q value <10e 2 p value<10e 5 Change>1 FC>2. ATAC seq: q value<10e 2 and p value<10e 5 HiC matrix was generated using HiC Pro Genome build: zv10 Supplementary files format and content: tab delimited text files include TPM values for each Sample; the narrowPeak files included the peaks for each Sample; The .hic file were the matrix of Hi C for each Sample.**All replicates were merged Tissue   For each RNA seq experiment the same tissues combined from at least two Tuebingen fish were used as one replicate. For embryonic trunk ten 1 dpf fish were dechorionated with pronase and trunk were cut off for RNA seq. For embryonic neuron green cells from TgHuc:Kaede cells were sorted by FACS and approxinately 20 000 cells were used for one replicate. The tissue RNA was extracted from Trizol® according to the protocol Invitrogen. The cDNA libraries were performed using SureSelect Strand Specific RNA Library Preparation Kit Agilent according to the manufacturer’s protocol. Briefly polyA RNA was purified from 1000 ng of total RNA using oligo dT beads Invitrogen. Extracted RNA was first fragmented then followed by reverse transcription end repair adenylation adaptor ligation and subsequent PCR amplification. The final product was checked by size distribution and concentration using BioAnalyzer High Sensitivity DNA Kit Agilent and Kapa Library Quantification Kit Kapa Biosystems and then followed by pair end 2X 50 bp high throughput sequencing using HiSeq 2500 Illumina. Embryonic and ault Tuebingen zebrafish were raised under standard laboratory conditions strain:Tuebingen|tissue:Heart GSM3934886 GSM3934886: YueLab RNA Seq Heart rep2; Danio rerio; RNA Seq GSM3934886   1 For each RNA seq experiment the same tissues combined from at least two Tuebingen fish were used as one replicate. For embryonic trunk ten 1 dpf fish were dechorionated with pronase and trunk were cut off for RNA seq. For embryonic neuron green cells from TgHuc:Kaede cells were sorted by FACS and approxinately 20 000 cells were used for one replicate. The tissue RNA was extracted from Trizol® according to the protocol Invitrogen. The cDNA libraries were performed using SureSelect Strand Specific RNA Library Preparation Kit Agilent according to the manufacturer's protocol. Briefly polyA RNA was purified from 1000 ng of total RNA using oligo dT beads Invitrogen. Extracted RNA was first fragmented then followed by reverse transcription end repair adenylation adaptor ligation and subsequent PCR amplification. The final product was checked by size distribution and concentration using BioAnalyzer High Sensitivity DNA Kit Agilent and Kapa Library Quantification Kit Kapa Biosystems and then followed by pair end 2X 50 bp high throughput sequencing using HiSeq 2500 Illumina. GEO Accession:GSM3934886 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina Genome Analyzer   SRP213938     YueLab-RNA-Seq-Heart-rep2_1.fastq.gz YueLab-RNA-Seq-Heart-rep2_2.fastq.gz fastq fastq 3738852700.0 37388527.0 GSM3934886 r1 0:50 1:50 A:908524568;C:968345371;G:992587651;T:864823167;N:4571943 50 50     908524568 968345371 992587651 864823167 4571943 SRX6422894 SRS5079684 SRA919194 GEO Feng Yue, Department of Biochemistry and Molecular Genetics, Northwestern University Feinberg School of Medicine 2 0.8454 0.84237 0.22307 0.21683 0.84082 0.84053 0.63946 0.67201 50 50 B B biological fallback assumption illumina early_illumina unknown poly_a unknown bulk unknown unknown   United States 2019-07-09 Pharyngula Embryo Heart Cardiovascular System
53022 53022 SRR9662017 SRX6422893 SRS5079682 SRP213938 PRJNA553572 A map of cis regulatory elements and 3D genome structures in zebrafish GSE134055 Other The zebrafish has been widely used for the study of human disease and development as 70% of the protein coding genes are conserved between the two species. Annotation of functional control elements of the zebrafish genome however has lagged behind that of other model systems such as mouse and Drosophila. Based on multi omics approaches taken in the ENCODE and Roadmap Epigenomics projects we performed RNA seq ATAC seq ChIP seq and Hi C experiments in ten adult and two embryonic tissues to generate a comprehensive map of transcriptomes and regulatory elements in the zebrafish Tuebingen reference strain. Overall we have identified 235 596 cis regulatory elements which potentially shape the tissue specific and developmental stage specific gene expression in zebrafish. A comparison of zebrafish human and mouse regulatory elements allowed us to identify both evolutionarily conserved and species specific regulatory sequences. Furthermore through the analysis of Hi C data in zebrafish brain and muscle we observed different levels of 3D genome organization including compartment topological associating domains TADs and chromatin loops in zebrafish. A subset of TADs are deeply conserved between zebrafish and human. This work provides an additional epigenomic anchor for the functional annotation of vertebrate genomes and the study of evolutionally conserved elements of 3D genome organization. Overall design: 13 tissues from adult and embryonic stage were examined using ChIP Seq H3K27ac and H3K4me3 RNA Seq 11 of them were examined using ATAC seq WGBS and ChIP seq H3K9me3 and H3K9me2 and one scATAC seq in brain. Additionally we performed HiC experiments in adult muscle and brain. Please note that for the samples GSM4661977 GSM4662088 [1] each processed data generated from both replicates is linked to the corresponding *rep1 sample records [2] the input sample used for each ChIP sample is indicated in the description field in the corresponding input sample records.   pubmed:33239788;pubmed:35649578   YueLab RNA Seq Heart rep1 GSM3934885   source name:Tissue|strain:Tuebingen|tissue:Heart YueLab RNA Seq Heart rep1 RNA seq reads were aligned to zv10 genome assembly using STAR; ChIP seq and ATAC seq reads were aligned to zv10 genome assembly using BWA HiC reads were aligned to zv10 genome assembly using Bowtie2 The TPM value of gene expression was caculated using RSEM ChIP seq and ATAC seq peaks were called using MACS2 with the following setting: ChIP seq q value <10e 2 p value<10e 5 Change>1 FC>2. ATAC seq: q value<10e 2 and p value<10e 5 HiC matrix was generated using HiC Pro Genome build: zv10 Supplementary files format and content: tab delimited text files include TPM values for each Sample; the narrowPeak files included the peaks for each Sample; The .hic file were the matrix of Hi C for each Sample.**All replicates were merged Tissue   For each RNA seq experiment the same tissues combined from at least two Tuebingen fish were used as one replicate. For embryonic trunk ten 1 dpf fish were dechorionated with pronase and trunk were cut off for RNA seq. For embryonic neuron green cells from TgHuc:Kaede cells were sorted by FACS and approxinately 20 000 cells were used for one replicate. The tissue RNA was extracted from Trizol® according to the protocol Invitrogen. The cDNA libraries were performed using SureSelect Strand Specific RNA Library Preparation Kit Agilent according to the manufacturer’s protocol. Briefly polyA RNA was purified from 1000 ng of total RNA using oligo dT beads Invitrogen. Extracted RNA was first fragmented then followed by reverse transcription end repair adenylation adaptor ligation and subsequent PCR amplification. The final product was checked by size distribution and concentration using BioAnalyzer High Sensitivity DNA Kit Agilent and Kapa Library Quantification Kit Kapa Biosystems and then followed by pair end 2X 50 bp high throughput sequencing using HiSeq 2500 Illumina. Embryonic and ault Tuebingen zebrafish were raised under standard laboratory conditions strain:Tuebingen|tissue:Heart GSM3934885 GSM3934885: YueLab RNA Seq Heart rep1; Danio rerio; RNA Seq GSM3934885   1 For each RNA seq experiment the same tissues combined from at least two Tuebingen fish were used as one replicate. For embryonic trunk ten 1 dpf fish were dechorionated with pronase and trunk were cut off for RNA seq. For embryonic neuron green cells from TgHuc:Kaede cells were sorted by FACS and approxinately 20 000 cells were used for one replicate. The tissue RNA was extracted from Trizol® according to the protocol Invitrogen. The cDNA libraries were performed using SureSelect Strand Specific RNA Library Preparation Kit Agilent according to the manufacturer's protocol. Briefly polyA RNA was purified from 1000 ng of total RNA using oligo dT beads Invitrogen. Extracted RNA was first fragmented then followed by reverse transcription end repair adenylation adaptor ligation and subsequent PCR amplification. The final product was checked by size distribution and concentration using BioAnalyzer High Sensitivity DNA Kit Agilent and Kapa Library Quantification Kit Kapa Biosystems and then followed by pair end 2X 50 bp high throughput sequencing using HiSeq 2500 Illumina. GEO Accession:GSM3934885 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina Genome Analyzer   SRP213938     YueLab-RNA-Seq-Heart-rep1_1.fastq.gz YueLab-RNA-Seq-Heart-rep1_2.fastq.gz fastq fastq 3840548749.0 31797756.0 GSM3934885 r1 0:60.46 1:60.32 A:1037745400;C:853066216;G:864291073;T:1085389048;N:57012 60 60     1037745400 853066216 864291073 1085389048 57012 SRX6422893 SRS5079682 SRA919194 GEO Feng Yue, Department of Biochemistry and Molecular Genetics, Northwestern University Feinberg School of Medicine 2 0.97577 0.98167 0.10912 0.10881 0.76118 0.76526 0.54037 0.54676 60 60 B B biological fallback assumption illumina early_illumina unknown poly_a unknown bulk unknown unknown   United States 2019-07-09 Pharyngula Embryo Heart Cardiovascular System
68780 68780 SRR18192263 SRX14338908 SRS12152837 SRP362184 PRJNA812001 scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish GSE197757 Transcriptome Analysis In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion and then performed scRNA sequencing. These single ECs were isolated at two different time points 21 hpf and 28 hpf when the lumen of the DA is established and the EHT begins respectively. Overall design: Spatial photoconversion DA roof versus DA floor cell dissociation and mannual picking of photoconverted ECs   pubmed:35333649   ventral EC 28hpf D12D23 1 GSM5929627   source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs ventral EC 28hpf D12D23 1 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore q 20 phred33 stringency 5 length 20 e 0.1 paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample Trunk DA endothelium   Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs GSM5929627 GSM5929627: ventral EC 28hpf D12D23 1; Danio rerio; RNA Seq GSM5929627 r1 GSM5929627 1 Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP362184   loader:fastq load.py M12D23_1_1.fq.gz M12D23_1_2.fq.gz fastq fastq 3170077200.0 10566924.0 GSM5929627 r1 0:150 1:150 A:895284956;C:687951853;G:714718914;T:872030334;N:91143 150 150     895284956 687951853 714718914 872030334 91143 SRX14338908 SRS12152837     Wen's lab, LIFS, HKUST 2 0.86937 0.859 0.06355 0.0627 0.87663 0.87969 0.54768 0.54015 150 150 B B biological fallback assumption illumina hiseq_era full_length poly_a unknown sc single_cell_plate smartseq   China 2022-03-02 Pharyngula Embryo Heart Cardiovascular System
68781 68781 SRR18192264 SRX14338907 SRS12152836 SRP362184 PRJNA812001 scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish GSE197757 Transcriptome Analysis In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion and then performed scRNA sequencing. These single ECs were isolated at two different time points 21 hpf and 28 hpf when the lumen of the DA is established and the EHT begins respectively. Overall design: Spatial photoconversion DA roof versus DA floor cell dissociation and mannual picking of photoconverted ECs   pubmed:35333649   ventral EC 28hpf M12D9 2 GSM5929626   source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs ventral EC 28hpf M12D9 2 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore q 20 phred33 stringency 5 length 20 e 0.1 paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample Trunk DA endothelium   Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs GSM5929626 GSM5929626: ventral EC 28hpf M12D9 2; Danio rerio; RNA Seq GSM5929626 r1 GSM5929626 1 Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP362184   loader:fastq load.py M12D9_2_1.fq.gz M12D9_2_2.fq.gz fastq fastq 2821946100.0 9406487.0 GSM5929626 r1 0:150 1:150 A:833459321;C:543141040;G:577507179;T:867795846;N:42714 150 150     833459321 543141040 577507179 867795846 42714 SRX14338907 SRS12152836     Wen's lab, LIFS, HKUST 2 0.73514 0.75198 0.03754 0.03907 0.89838 0.89558 0.47184 0.47431 150 150 B B biological fallback assumption illumina hiseq_era full_length poly_a unknown sc single_cell_plate smartseq   China 2022-03-02 Pharyngula Embryo Heart Cardiovascular System
68782 68782 SRR18192268 SRX14338906 SRS12152835 SRP362184 PRJNA812001 scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish GSE197757 Transcriptome Analysis In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion and then performed scRNA sequencing. These single ECs were isolated at two different time points 21 hpf and 28 hpf when the lumen of the DA is established and the EHT begins respectively. Overall design: Spatial photoconversion DA roof versus DA floor cell dissociation and mannual picking of photoconverted ECs   pubmed:35333649   ventral EC 28hpf M12D24 1 GSM5929625   source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs ventral EC 28hpf M12D24 1 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore q 20 phred33 stringency 5 length 20 e 0.1 paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample Trunk DA endothelium   Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs GSM5929625 GSM5929625: ventral EC 28hpf M12D24 1; Danio rerio; RNA Seq GSM5929625 r1 GSM5929625 1 Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP362184   loader:fastq load.py M12D24_1_1.fq.gz M12D24_1_2.fq.gz fastq fastq 3437508900.0 11458363.0 GSM5929625 r1 0:150 1:150 A:949393206;C:771172192;G:792724386;T:924119993;N:99123 150 150     949393206 771172192 792724386 924119993 99123 SRX14338906 SRS12152835     Wen's lab, LIFS, HKUST 2 0.8808 0.87092 0.05011 0.04935 0.89451 0.89593 0.51071 0.5107 150 150 B B biological fallback assumption illumina hiseq_era full_length poly_a unknown sc single_cell_plate smartseq   China 2022-03-02 Pharyngula Embryo Heart Cardiovascular System
68783 68783 SRR18192265 SRX14338905 SRS12152834 SRP362184 PRJNA812001 scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish GSE197757 Transcriptome Analysis In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion and then performed scRNA sequencing. These single ECs were isolated at two different time points 21 hpf and 28 hpf when the lumen of the DA is established and the EHT begins respectively. Overall design: Spatial photoconversion DA roof versus DA floor cell dissociation and mannual picking of photoconverted ECs   pubmed:35333649   ventral EC 28hpf M12D22 7 GSM5929624   source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs ventral EC 28hpf M12D22 7 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore q 20 phred33 stringency 5 length 20 e 0.1 paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample Trunk DA endothelium   Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs GSM5929624 GSM5929624: ventral EC 28hpf M12D22 7; Danio rerio; RNA Seq GSM5929624 r1 GSM5929624 1 Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP362184   loader:fastq load.py M12D22_7_1.fq.gz M12D22_7_2.fq.gz fastq fastq 3353765100.0 11179217.0 GSM5929624 r1 0:150 1:150 A:912815682;C:764078293;G:783280096;T:893499532;N:91497 150 150     912815682 764078293 783280096 893499532 91497 SRX14338905 SRS12152834     Wen's lab, LIFS, HKUST 2 0.92895 0.92193 0.06189 0.05719 0.95674 0.95751 0.43458 0.48713 150 150 B B biological fallback assumption illumina hiseq_era full_length poly_a unknown sc single_cell_plate smartseq   China 2022-03-02 Pharyngula Embryo Heart Cardiovascular System
68784 68784 SRR18192266 SRX14338904 SRS12152833 SRP362184 PRJNA812001 scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish GSE197757 Transcriptome Analysis In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion and then performed scRNA sequencing. These single ECs were isolated at two different time points 21 hpf and 28 hpf when the lumen of the DA is established and the EHT begins respectively. Overall design: Spatial photoconversion DA roof versus DA floor cell dissociation and mannual picking of photoconverted ECs   pubmed:35333649   ventral EC 28hpf M12D22 5 GSM5929623   source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs ventral EC 28hpf M12D22 5 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore q 20 phred33 stringency 5 length 20 e 0.1 paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample Trunk DA endothelium   Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs GSM5929623 GSM5929623: ventral EC 28hpf M12D22 5; Danio rerio; RNA Seq GSM5929623 r1 GSM5929623 1 Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP362184   loader:fastq load.py M12D22_5_1.fq.gz M12D22_5_2.fq.gz fastq fastq 2976989100.0 9923297.0 GSM5929623 r1 0:150 1:150 A:827316613;C:664047061;G:674937107;T:810600886;N:87433 150 150     827316613 664047061 674937107 810600886 87433 SRX14338904 SRS12152833     Wen's lab, LIFS, HKUST 2 0.93146 0.93345 0.06672 0.0674 0.8788 0.87988 0.5154 0.53867 150 150 B B biological fallback assumption illumina hiseq_era full_length poly_a unknown sc single_cell_plate smartseq   China 2022-03-02 Pharyngula Embryo Heart Cardiovascular System
68785 68785 SRR18192267 SRX14338903 SRS12152832 SRP362184 PRJNA812001 scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish GSE197757 Transcriptome Analysis In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion and then performed scRNA sequencing. These single ECs were isolated at two different time points 21 hpf and 28 hpf when the lumen of the DA is established and the EHT begins respectively. Overall design: Spatial photoconversion DA roof versus DA floor cell dissociation and mannual picking of photoconverted ECs   pubmed:35333649   ventral EC 28hpf M12D2 2 GSM5929622   source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs ventral EC 28hpf M12D2 2 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore q 20 phred33 stringency 5 length 20 e 0.1 paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample Trunk DA endothelium   Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs GSM5929622 GSM5929622: ventral EC 28hpf M12D2 2; Danio rerio; RNA Seq GSM5929622 r1 GSM5929622 1 Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP362184   loader:fastq load.py M12D2_2_1.fq.gz M12D2_2_2.fq.gz fastq fastq 3372720300.0 11242401.0 GSM5929622 r1 0:150 1:150 A:988221703;C:669226615;G:703188465;T:1012044907;N:38610 150 150     988221703 669226615 703188465 1012044907 38610 SRX14338903 SRS12152832     Wen's lab, LIFS, HKUST 2 0.86571 0.86595 0.0657 0.06575 0.87564 0.87614 0.53669 0.53356 150 150 B B biological fallback assumption illumina hiseq_era full_length poly_a unknown sc single_cell_plate smartseq   China 2022-03-02 Pharyngula Embryo Heart Cardiovascular System
68786 68786 SRR18192269 SRX14338902 SRS12152831 SRP362184 PRJNA812001 scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish GSE197757 Transcriptome Analysis In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion and then performed scRNA sequencing. These single ECs were isolated at two different time points 21 hpf and 28 hpf when the lumen of the DA is established and the EHT begins respectively. Overall design: Spatial photoconversion DA roof versus DA floor cell dissociation and mannual picking of photoconverted ECs   pubmed:35333649   ventral EC 28hpf M11D13 2 GSM5929621   source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs ventral EC 28hpf M11D13 2 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore q 20 phred33 stringency 5 length 20 e 0.1 paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample Trunk DA endothelium   Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs GSM5929621 GSM5929621: ventral EC 28hpf M11D13 2; Danio rerio; RNA Seq GSM5929621 r1 GSM5929621 1 Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP362184   loader:fastq load.py M11D13_2_1.fq.gz M11D13_2_2.fq.gz fastq fastq 2967463200.0 9891544.0 GSM5929621 r1 0:150 1:150 A:856598489;C:601958772;G:626644284;T:882214582;N:47073 150 150     856598489 601958772 626644284 882214582 47073 SRX14338902 SRS12152831     Wen's lab, LIFS, HKUST 2 0.67923 0.67722 0.03277 0.03284 0.93003 0.93008 0.48316 0.47991 150 150 B B biological fallback assumption illumina hiseq_era full_length poly_a unknown sc single_cell_plate smartseq   China 2022-03-02 Pharyngula Embryo Heart Cardiovascular System
68787 68787 SRR18192270 SRX14338901 SRS12152830 SRP362184 PRJNA812001 scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish GSE197757 Transcriptome Analysis In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion and then performed scRNA sequencing. These single ECs were isolated at two different time points 21 hpf and 28 hpf when the lumen of the DA is established and the EHT begins respectively. Overall design: Spatial photoconversion DA roof versus DA floor cell dissociation and mannual picking of photoconverted ECs   pubmed:35333649   ventral EC 28hpf M10D6 1 GSM5929620   source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs ventral EC 28hpf M10D6 1 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore q 20 phred33 stringency 5 length 20 e 0.1 paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample Trunk DA endothelium   Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs GSM5929620 GSM5929620: ventral EC 28hpf M10D6 1; Danio rerio; RNA Seq GSM5929620 r1 GSM5929620 1 Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP362184   loader:fastq load.py M10D6_1_1.fq.gz M10D6_1_2.fq.gz fastq fastq 2572394700.0 8574649.0 GSM5929620 r1 0:150 1:150 A:768771743;C:493332801;G:503375064;T:806902578;N:12514 150 150     768771743 493332801 503375064 806902578 12514 SRX14338901 SRS12152830     Wen's lab, LIFS, HKUST 2 0.84169 0.84187 0.07814 0.07802 0.87547 0.87495 0.51691 0.50228 150 150 B B biological fallback assumption illumina hiseq_era full_length poly_a unknown sc single_cell_plate smartseq   China 2022-03-02 Pharyngula Embryo Heart Cardiovascular System
68788 68788 SRR18192271 SRX14338900 SRS12152829 SRP362184 PRJNA812001 scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish GSE197757 Transcriptome Analysis In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion and then performed scRNA sequencing. These single ECs were isolated at two different time points 21 hpf and 28 hpf when the lumen of the DA is established and the EHT begins respectively. Overall design: Spatial photoconversion DA roof versus DA floor cell dissociation and mannual picking of photoconverted ECs   pubmed:35333649   ventral EC 28hpf M9D15 5 GSM5929619   source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs ventral EC 28hpf M9D15 5 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore q 20 phred33 stringency 5 length 20 e 0.1 paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample Trunk DA endothelium   Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs GSM5929619 GSM5929619: ventral EC 28hpf M9D15 5; Danio rerio; RNA Seq GSM5929619 r1 GSM5929619 1 Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP362184   loader:fastq load.py M9D15_5_1.fq.gz M9D15_5_2.fq.gz fastq fastq 2850079800.0 9500266.0 GSM5929619 r1 0:150 1:150 A:810682308;C:581612893;G:631575261;T:826195519;N:13819 150 150     810682308 581612893 631575261 826195519 13819 SRX14338900 SRS12152829     Wen's lab, LIFS, HKUST 2 0.89187 0.89677 0.07626 0.07735 0.94953 0.9499 0.52273 0.51981 150 150 B B biological fallback assumption illumina hiseq_era full_length poly_a unknown sc single_cell_plate smartseq   China 2022-03-02 Pharyngula Embryo Heart Cardiovascular System
68789 68789 SRR18192272 SRX14338899 SRS12152828 SRP362184 PRJNA812001 scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish GSE197757 Transcriptome Analysis In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion and then performed scRNA sequencing. These single ECs were isolated at two different time points 21 hpf and 28 hpf when the lumen of the DA is established and the EHT begins respectively. Overall design: Spatial photoconversion DA roof versus DA floor cell dissociation and mannual picking of photoconverted ECs   pubmed:35333649   ventral EC 28hpf M9D9 4 GSM5929618   source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs ventral EC 28hpf M9D9 4 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore q 20 phred33 stringency 5 length 20 e 0.1 paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample Trunk DA endothelium   Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs GSM5929618 GSM5929618: ventral EC 28hpf M9D9 4; Danio rerio; RNA Seq GSM5929618 r1 GSM5929618 1 Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP362184   loader:fastq load.py M9D9_4_1.fq.gz M9D9_4_2.fq.gz fastq fastq 2479911300.0 8266371.0 GSM5929618 r1 0:150 1:150 A:708753950;C:500666505;G:524945871;T:745538353;N:6621 150 150     708753950 500666505 524945871 745538353 6621 SRX14338899 SRS12152828     Wen's lab, LIFS, HKUST 2 0.87067 0.87069 0.03121 0.0308 0.93012 0.93003 0.46455 0.48374 150 150 B B biological fallback assumption illumina hiseq_era full_length poly_a unknown sc single_cell_plate smartseq   China 2022-03-02 Pharyngula Embryo Heart Cardiovascular System
68790 68790 SRR18192276 SRX14338898 SRS12152827 SRP362184 PRJNA812001 scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish GSE197757 Transcriptome Analysis In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion and then performed scRNA sequencing. These single ECs were isolated at two different time points 21 hpf and 28 hpf when the lumen of the DA is established and the EHT begins respectively. Overall design: Spatial photoconversion DA roof versus DA floor cell dissociation and mannual picking of photoconverted ECs   pubmed:35333649   ventral EC 28hpf M8D26 7 GSM5929617   source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs ventral EC 28hpf M8D26 7 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore q 20 phred33 stringency 5 length 20 e 0.1 paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample Trunk DA endothelium   Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs GSM5929617 GSM5929617: ventral EC 28hpf M8D26 7; Danio rerio; RNA Seq GSM5929617 r1 GSM5929617 1 Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP362184   loader:fastq load.py M8D26_7_1.fq.gz M8D26_7_2.fq.gz fastq fastq 2345052000.0 7816840.0 GSM5929617 r1 0:150 1:150 A:688980894;C:460051627;G:493463648;T:702534414;N:21417 150 150     688980894 460051627 493463648 702534414 21417 SRX14338898 SRS12152827     Wen's lab, LIFS, HKUST 2 0.86279 0.86348 0.08038 0.08074 0.89254 0.89221 0.55795 0.55419 150 150 B B biological fallback assumption illumina hiseq_era full_length poly_a unknown sc single_cell_plate smartseq   China 2022-03-02 Pharyngula Embryo Heart Cardiovascular System
68791 68791 SRR18192273 SRX14338897 SRS12152826 SRP362184 PRJNA812001 scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish GSE197757 Transcriptome Analysis In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion and then performed scRNA sequencing. These single ECs were isolated at two different time points 21 hpf and 28 hpf when the lumen of the DA is established and the EHT begins respectively. Overall design: Spatial photoconversion DA roof versus DA floor cell dissociation and mannual picking of photoconverted ECs   pubmed:35333649   ventral EC 28hpf M8D19 6 GSM5929616   source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs ventral EC 28hpf M8D19 6 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore q 20 phred33 stringency 5 length 20 e 0.1 paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample Trunk DA endothelium   Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA floor|cell type:endothelial cells ECs GSM5929616 GSM5929616: ventral EC 28hpf M8D19 6; Danio rerio; RNA Seq GSM5929616 r1 GSM5929616 1 Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP362184   loader:fastq load.py M8D19_6_1.fq.gz M8D19_6_2.fq.gz fastq fastq 2798831400.0 9329438.0 GSM5929616 r1 0:150 1:150 A:805491779;C:569610640;G:603975629;T:819132101;N:621251 150 150     805491779 569610640 603975629 819132101 621251 SRX14338897 SRS12152826     Wen's lab, LIFS, HKUST 2 0.91139 0.91351 0.08225 0.08186 0.94284 0.94302 0.5336 0.44266 150 150 B B biological fallback assumption illumina hiseq_era full_length poly_a unknown sc single_cell_plate smartseq   China 2022-03-02 Pharyngula Embryo Heart Cardiovascular System
68792 68792 SRR18192274 SRX14338896 SRS12152825 SRP362184 PRJNA812001 scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish GSE197757 Transcriptome Analysis In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion and then performed scRNA sequencing. These single ECs were isolated at two different time points 21 hpf and 28 hpf when the lumen of the DA is established and the EHT begins respectively. Overall design: Spatial photoconversion DA roof versus DA floor cell dissociation and mannual picking of photoconverted ECs   pubmed:35333649   dorsal EC 28hpf 3 8 GSM5929615   source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs dorsal EC 28hpf 3 8 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore q 20 phred33 stringency 5 length 20 e 0.1 paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample Trunk DA endothelium   Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs GSM5929615 GSM5929615: dorsal EC 28hpf 3 8; Danio rerio; RNA Seq GSM5929615 r1 GSM5929615 1 Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP362184   loader:fastq load.py s3-8_FRRS190258335-1a_1.fq.gz s3-8_FRRS190258335-1a_2.fq.gz fastq fastq 2604747900.0 8682493.0 GSM5929615 r1 0:150 1:150 A:736722719;C:533523721;G:576469454;T:757971426;N:60580 150 150     736722719 533523721 576469454 757971426 60580 SRX14338896 SRS12152825     Wen's lab, LIFS, HKUST 2 0.91825 0.91828 0.10627 0.1087 0.89599 0.89729 0.51202 0.50855 150 150 B B biological fallback assumption illumina hiseq_era full_length poly_a unknown sc single_cell_plate smartseq   China 2022-03-02 Pharyngula Embryo Heart Cardiovascular System
68793 68793 SRR18192275 SRX14338895 SRS12152824 SRP362184 PRJNA812001 scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish GSE197757 Transcriptome Analysis In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion and then performed scRNA sequencing. These single ECs were isolated at two different time points 21 hpf and 28 hpf when the lumen of the DA is established and the EHT begins respectively. Overall design: Spatial photoconversion DA roof versus DA floor cell dissociation and mannual picking of photoconverted ECs   pubmed:35333649   dorsal EC 28hpf 3 6 GSM5929614   source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs dorsal EC 28hpf 3 6 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore q 20 phred33 stringency 5 length 20 e 0.1 paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample Trunk DA endothelium   Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs GSM5929614 GSM5929614: dorsal EC 28hpf 3 6; Danio rerio; RNA Seq GSM5929614 r1 GSM5929614 1 Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP362184   loader:fastq load.py s3-6_FRRS190258334-1a_1.fq.gz s3-6_FRRS190258334-1a_2.fq.gz fastq fastq 2910067200.0 9700224.0 GSM5929614 r1 0:150 1:150 A:836341596;C:579661336;G:634991448;T:859065707;N:7113 150 150     836341596 579661336 634991448 859065707 7113 SRX14338895 SRS12152824     Wen's lab, LIFS, HKUST 2 0.90842 0.91323 0.11388 0.11761 0.87657 0.87771 0.5409 0.44794 150 150 B B biological fallback assumption illumina hiseq_era full_length poly_a unknown sc single_cell_plate smartseq   China 2022-03-02 Pharyngula Embryo Heart Cardiovascular System
68794 68794 SRR18192277 SRX14338894 SRS12152823 SRP362184 PRJNA812001 scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish GSE197757 Transcriptome Analysis In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion and then performed scRNA sequencing. These single ECs were isolated at two different time points 21 hpf and 28 hpf when the lumen of the DA is established and the EHT begins respectively. Overall design: Spatial photoconversion DA roof versus DA floor cell dissociation and mannual picking of photoconverted ECs   pubmed:35333649   dorsal EC 28hpf 3 5 GSM5929613   source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs dorsal EC 28hpf 3 5 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore q 20 phred33 stringency 5 length 20 e 0.1 paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample Trunk DA endothelium   Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs GSM5929613 GSM5929613: dorsal EC 28hpf 3 5; Danio rerio; RNA Seq GSM5929613 r1 GSM5929613 1 Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP362184   loader:fastq load.py s3-5_FRRS190258333-1a_1.fq.gz s3-5_FRRS190258333-1a_2.fq.gz fastq fastq 2586321600.0 8621072.0 GSM5929613 r1 0:150 1:150 A:764349209;C:481474676;G:551762215;T:788729235;N:6265 150 150     764349209 481474676 551762215 788729235 6265 SRX14338894 SRS12152823     Wen's lab, LIFS, HKUST 2 0.85465 0.86431 0.14932 0.14961 0.88024 0.8803 0.45329 0.44805 150 150 B B biological fallback assumption illumina hiseq_era full_length poly_a unknown sc single_cell_plate smartseq   China 2022-03-02 Pharyngula Embryo Heart Cardiovascular System
68795 68795 SRR18192278 SRX14338893 SRS12152822 SRP362184 PRJNA812001 scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish GSE197757 Transcriptome Analysis In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion and then performed scRNA sequencing. These single ECs were isolated at two different time points 21 hpf and 28 hpf when the lumen of the DA is established and the EHT begins respectively. Overall design: Spatial photoconversion DA roof versus DA floor cell dissociation and mannual picking of photoconverted ECs   pubmed:35333649   dorsal EC 28hpf 3 4 GSM5929612   source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs dorsal EC 28hpf 3 4 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore q 20 phred33 stringency 5 length 20 e 0.1 paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample Trunk DA endothelium   Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs GSM5929612 GSM5929612: dorsal EC 28hpf 3 4; Danio rerio; RNA Seq GSM5929612 r1 GSM5929612 1 Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP362184   loader:fastq load.py s3-4_FRRS190258332-1a_1.fq.gz s3-4_FRRS190258332-1a_2.fq.gz fastq fastq 2674832100.0 8916107.0 GSM5929612 r1 0:150 1:150 A:777258461;C:511597382;G:583618812;T:802350928;N:6517 150 150     777258461 511597382 583618812 802350928 6517 SRX14338893 SRS12152822     Wen's lab, LIFS, HKUST 2 0.8804 0.89063 0.15365 0.15632 0.91309 0.91467 0.54094 0.5416 150 150 B B biological fallback assumption illumina hiseq_era full_length poly_a unknown sc single_cell_plate smartseq   China 2022-03-02 Pharyngula Embryo Heart Cardiovascular System
68796 68796 SRR18192279 SRX14338892 SRS12152821 SRP362184 PRJNA812001 scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish GSE197757 Transcriptome Analysis In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion and then performed scRNA sequencing. These single ECs were isolated at two different time points 21 hpf and 28 hpf when the lumen of the DA is established and the EHT begins respectively. Overall design: Spatial photoconversion DA roof versus DA floor cell dissociation and mannual picking of photoconverted ECs   pubmed:35333649   dorsal EC 28hpf 3 3 GSM5929611   source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs dorsal EC 28hpf 3 3 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore q 20 phred33 stringency 5 length 20 e 0.1 paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample Trunk DA endothelium   Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs GSM5929611 GSM5929611: dorsal EC 28hpf 3 3; Danio rerio; RNA Seq GSM5929611 r1 GSM5929611 1 Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP362184   loader:fastq load.py s3-3_FRRS190258331-1a_1.fq.gz s3-3_FRRS190258331-1a_2.fq.gz fastq fastq 2488293600.0 8294312.0 GSM5929611 r1 0:150 1:150 A:719382089;C:479754756;G:546445571;T:742705113;N:6071 150 150     719382089 479754756 546445571 742705113 6071 SRX14338892 SRS12152821     Wen's lab, LIFS, HKUST 2 0.8796 0.88849 0.12956 0.13203 0.90343 0.90418 0.57666 0.57396 150 150 B B biological fallback assumption illumina hiseq_era full_length poly_a unknown sc single_cell_plate smartseq   China 2022-03-02 Pharyngula Embryo Heart Cardiovascular System
68797 68797 SRR18192280 SRX14338891 SRS12152820 SRP362184 PRJNA812001 scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish GSE197757 Transcriptome Analysis In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion and then performed scRNA sequencing. These single ECs were isolated at two different time points 21 hpf and 28 hpf when the lumen of the DA is established and the EHT begins respectively. Overall design: Spatial photoconversion DA roof versus DA floor cell dissociation and mannual picking of photoconverted ECs   pubmed:35333649   dorsal EC 28hpf 2 8 GSM5929610   source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs dorsal EC 28hpf 2 8 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore q 20 phred33 stringency 5 length 20 e 0.1 paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample Trunk DA endothelium   Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs GSM5929610 GSM5929610: dorsal EC 28hpf 2 8; Danio rerio; RNA Seq GSM5929610 r1 GSM5929610 1 Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP362184   loader:fastq load.py s2-8_FRRS190258330-1a_1.fq.gz s2-8_FRRS190258330-1a_2.fq.gz fastq fastq 2582877000.0 8609590.0 GSM5929610 r1 0:150 1:150 A:729178468;C:509541231;G:591991165;T:752108619;N:57517 150 150     729178468 509541231 591991165 752108619 57517 SRX14338891 SRS12152820     Wen's lab, LIFS, HKUST 2 0.86946 0.88482 0.13171 0.13542 0.8999 0.90011 0.56683 0.57631 150 150 B B biological fallback assumption illumina hiseq_era full_length poly_a unknown sc single_cell_plate smartseq   China 2022-03-02 Pharyngula Embryo Heart Cardiovascular System
68798 68798 SRR18192281 SRX14338890 SRS12152819 SRP362184 PRJNA812001 scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish GSE197757 Transcriptome Analysis In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion and then performed scRNA sequencing. These single ECs were isolated at two different time points 21 hpf and 28 hpf when the lumen of the DA is established and the EHT begins respectively. Overall design: Spatial photoconversion DA roof versus DA floor cell dissociation and mannual picking of photoconverted ECs   pubmed:35333649   dorsal EC 28hpf 2 7 GSM5929609   source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs dorsal EC 28hpf 2 7 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore q 20 phred33 stringency 5 length 20 e 0.1 paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample Trunk DA endothelium   Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs GSM5929609 GSM5929609: dorsal EC 28hpf 2 7; Danio rerio; RNA Seq GSM5929609 r1 GSM5929609 1 Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP362184   loader:fastq load.py s2-7_FRRS190258329-1a_1.fq.gz s2-7_FRRS190258329-1a_2.fq.gz fastq fastq 2490208800.0 8300696.0 GSM5929609 r1 0:150 1:150 A:720296065;C:474166353;G:564479960;T:731209983;N:56439 150 150     720296065 474166353 564479960 731209983 56439 SRX14338890 SRS12152819     Wen's lab, LIFS, HKUST 2 0.83746 0.85625 0.15921 0.1621 0.90339 0.90524 0.62165 0.63076 150 150 B B biological fallback assumption illumina hiseq_era full_length poly_a unknown sc single_cell_plate smartseq   China 2022-03-02 Pharyngula Embryo Heart Cardiovascular System
68799 68799 SRR18192282 SRX14338889 SRS12152818 SRP362184 PRJNA812001 scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish GSE197757 Transcriptome Analysis In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion and then performed scRNA sequencing. These single ECs were isolated at two different time points 21 hpf and 28 hpf when the lumen of the DA is established and the EHT begins respectively. Overall design: Spatial photoconversion DA roof versus DA floor cell dissociation and mannual picking of photoconverted ECs   pubmed:35333649   dorsal EC 28hpf 2 5 GSM5929608   source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs dorsal EC 28hpf 2 5 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore q 20 phred33 stringency 5 length 20 e 0.1 paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample Trunk DA endothelium   Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs GSM5929608 GSM5929608: dorsal EC 28hpf 2 5; Danio rerio; RNA Seq GSM5929608 r1 GSM5929608 1 Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP362184   loader:fastq load.py s2-5_FRRS190258327-1a_1.fq.gz s2-5_FRRS190258327-1a_2.fq.gz fastq fastq 2749806000.0 9166020.0 GSM5929608 r1 0:150 1:150 A:784223138;C:532982851;G:625789164;T:806748588;N:62259 150 150     784223138 532982851 625789164 806748588 62259 SRX14338889 SRS12152818     Wen's lab, LIFS, HKUST 2 0.85224 0.86654 0.14294 0.14701 0.92583 0.92632 0.61496 0.6108 150 150 B B biological fallback assumption illumina hiseq_era full_length poly_a unknown sc single_cell_plate smartseq   China 2022-03-02 Pharyngula Embryo Heart Cardiovascular System
68800 68800 SRR18192283 SRX14338888 SRS12152817 SRP362184 PRJNA812001 scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish GSE197757 Transcriptome Analysis In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion and then performed scRNA sequencing. These single ECs were isolated at two different time points 21 hpf and 28 hpf when the lumen of the DA is established and the EHT begins respectively. Overall design: Spatial photoconversion DA roof versus DA floor cell dissociation and mannual picking of photoconverted ECs   pubmed:35333649   dorsal EC 28hpf 2 1 GSM5929607   source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs dorsal EC 28hpf 2 1 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore q 20 phred33 stringency 5 length 20 e 0.1 paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample Trunk DA endothelium   Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs GSM5929607 GSM5929607: dorsal EC 28hpf 2 1; Danio rerio; RNA Seq GSM5929607 r1 GSM5929607 1 Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP362184   loader:fastq load.py s2-1_FRRS190258325-1a_1.fq.gz s2-1_FRRS190258325-1a_2.fq.gz fastq fastq 2604154800.0 8680516.0 GSM5929607 r1 0:150 1:150 A:736307297;C:510001632;G:599495622;T:758291155;N:59094 150 150     736307297 510001632 599495622 758291155 59094 SRX14338888 SRS12152817     Wen's lab, LIFS, HKUST 2 0.84706 0.8645 0.12467 0.12748 0.92021 0.92058 0.57173 0.57155 150 150 B B biological fallback assumption illumina hiseq_era full_length poly_a unknown sc single_cell_plate smartseq   China 2022-03-02 Pharyngula Embryo Heart Cardiovascular System
68801 68801 SRR18192284 SRX14338887 SRS12152816 SRP362184 PRJNA812001 scRNA seq of roof and floor endothelial cells at 21 hpf and 28 hpf in zebrafish GSE197757 Transcriptome Analysis In order to obtain the transcriptomic information about roof/dorsal and floor/ventral endothelial cells ECs of the dorsal aorta DA in zebrafish we isolated single ECs from the DA roof and the floor respectively using the Tgflk1:eGFP;flk1:NLS Eos zebrafish post photoconversion and then performed scRNA sequencing. These single ECs were isolated at two different time points 21 hpf and 28 hpf when the lumen of the DA is established and the EHT begins respectively. Overall design: Spatial photoconversion DA roof versus DA floor cell dissociation and mannual picking of photoconverted ECs   pubmed:35333649   dorsal EC 28hpf 1 6 GSM5929606   source name:Trunk DA endothelium|strain:Tgflk1:eGFP; Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs dorsal EC 28hpf 1 6 Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using TrimGalore with parameters trim galore q 20 phred33 stringency 5 length 20 e 0.1 paired Trimed reads were mapped to GRCz11.94 danRer11 genome using STAR Mapped reads Bam were quantified using Rsubred package Genome build: GRCz11.94 danRer11 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample Trunk DA endothelium   Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   strain:Tgflk1:eGFP;Tgflk1:NLS Eos|developmental stage:28 hpf|tissue:dorsal aorta DA|tissue region:DA roof|cell type:endothelial cells ECs GSM5929606 GSM5929606: dorsal EC 28hpf 1 6; Danio rerio; RNA Seq GSM5929606 r1 GSM5929606 1 Single Red Eos+ cell was manually picked with micromanipulator system NT 88 V3; Nikon under fluorescence microscope then washed with 2% BSA/PBS and finally transferred into 4.4ul lysis buffer. The smart seq2 protocol was used for whole transcriptome amplification. Smart seq2 oligodT captured cDNA libraries were prepared for sequencing using standard Illumina protocols 150bp paired end RNA seq   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP362184   loader:fastq load.py s1-6_FRRS190258324-1a_1.fq.gz s1-6_FRRS190258324-1a_2.fq.gz fastq fastq 2584733400.0 8615778.0 GSM5929606 r1 0:150 1:150 A:744541937;C:491678417;G:564885142;T:783570500;N:57404 150 150     744541937 491678417 564885142 783570500 57404 SRX14338887 SRS12152816     Wen's lab, LIFS, HKUST 2 0.88478 0.88951 0.17027 0.17195 0.91396 0.91514 0.62615 0.6243 150 150 B B biological fallback assumption illumina hiseq_era full_length poly_a unknown sc single_cell_plate smartseq   China 2022-03-02 Pharyngula Embryo Heart Cardiovascular System

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;