metadata: run_metadata: 335 rows where devstage_curation = "Multi-stage" and tissue_curation

335 rows where devstage_curation = "Multi-stage" and tissue_curation_coarse = "Nervous System"

descending

Link	rowid ▼	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.title	sample.alias	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.study_ref	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.r3_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.mapping_rate.mate2	seqdetective.nofeature_rate.mate1	seqdetective.nofeature_rate.mate2	seqdetective.sparsity.mate1	seqdetective.sparsity.mate2	seqdetective.pos_strand_rate.mate1	seqdetective.pos_strand_rate.mate2	seqdetective.readlen.mate1	seqdetective.readlen.mate2	seqdetective.judgement.mate1	seqdetective.judgement.mate2	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
24927	24927	SRR25557778	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant XI	GSM7688794	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-XI_S7_L001_R1_001.fastq.gz	fastq	420092501.0	5668059.0	GSM7688794 r1	0:74.12	A:113006440;C:96725832;G:99320773;T:110915967;N:123489	74			113006440	96725832	99320773	110915967	123489	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94757		0.06229		0.72364		0.46676		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24928	24928	SRR25557779	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant XI	GSM7688794	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-XI_S7_L002_R1_001.fastq.gz	fastq	421869780.0	5690053.0	GSM7688794 r2	0:74.14	A:113530489;C:97144227;G:99697959;T:111388539;N:108566	74			113530489	97144227	99697959	111388539	108566	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94921		0.06226		0.72462		0.4738		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24929	24929	SRR25557780	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant XI	GSM7688794	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-XI_S7_L003_R1_001.fastq.gz	fastq	425064659.0	5734041.0	GSM7688794 r3	0:74.13	A:114342253;C:97873100;G:100532599;T:112196433;N:120274	74			114342253	97873100	100532599	112196433	120274	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94886		0.06112		0.72425		0.47055		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24930	24930	SRR25557781	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant XI	GSM7688794	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-XI_S7_L004_R1_001.fastq.gz	fastq	416990548.0	5624902.0	GSM7688794 r4	0:74.13	A:112153356;C:96009158;G:98613145;T:110097476;N:117413	74			112153356	96009158	98613145	110097476	117413	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94869		0.06229		0.72506		0.47222		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24931	24931	SRR25557782	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant X	GSM7688793	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-X_S6_L001_R1_001.fastq.gz	fastq	434485284.0	5881416.0	GSM7688793 r1	0:73.87	A:116640351;C:100176557;G:102659919;T:114799536;N:208921	73			116640351	100176557	102659919	114799536	208921	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94533		0.07176		0.72464		0.47632		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24932	24932	SRR25557783	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant X	GSM7688793	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-X_S6_L002_R1_001.fastq.gz	fastq	435203869.0	5886556.0	GSM7688793 r2	0:73.93	A:116869356;C:100363580;G:102830644;T:114973504;N:166785	73			116869356	100363580	102830644	114973504	166785	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94542		0.07203		0.72421		0.47733		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24933	24933	SRR25557784	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant X	GSM7688793	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-X_S6_L003_R1_001.fastq.gz	fastq	439897269.0	5951878.0	GSM7688793 r3	0:73.91	A:118101648;C:101426657;G:103990006;T:116184480;N:194478	73			118101648	101426657	103990006	116184480	194478	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94486		0.07224		0.72448		0.47915		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24934	24934	SRR25557785	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant X	GSM7688793	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-X_S6_L004_R1_001.fastq.gz	fastq	431385256.0	5836029.0	GSM7688793 r4	0:73.92	A:115804970;C:99459059;G:101962932;T:113975935;N:182360	73			115804970	99459059	101962932	113975935	182360	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94432		0.07229		0.7261		0.47463		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24935	24935	SRR25557786	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant IX	GSM7688792	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-IX_S16_L001_R1_001.fastq.gz	fastq	513309395.0	6929648.0	GSM7688792 r1	0:74.07	A:137428462;C:118688804;G:122019962;T:134991729;N:180438	74			137428462	118688804	122019962	134991729	180438	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94188		0.07029		0.73772		0.47692		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24936	24936	SRR25557787	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant IX	GSM7688792	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-IX_S16_L002_R1_001.fastq.gz	fastq	517356735.0	6982196.0	GSM7688792 r2	0:74.10	A:138524037;C:119650852;G:122965491;T:136056171;N:160184	74			138524037	119650852	122965491	136056171	160184	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94281		0.06967		0.73963		0.48142		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24937	24937	SRR25557788	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant IX	GSM7688792	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-IX_S16_L003_R1_001.fastq.gz	fastq	519422328.0	7010631.0	GSM7688792 r3	0:74.09	A:139040684;C:120128748;G:123529198;T:136551898;N:171800	74			139040684	120128748	123529198	136551898	171800	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94297		0.06942		0.73726		0.47499		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24938	24938	SRR25557789	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant IX	GSM7688792	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-IX_S16_L004_R1_001.fastq.gz	fastq	511640294.0	6905748.0	GSM7688792 r4	0:74.09	A:136914638;C:118302866;G:121704665;T:134543505;N:174620	74			136914638	118302866	121704665	134543505	174620	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94176		0.07029		0.73868		0.47987		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24939	24939	SRR25557790	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VIII	GSM7688791	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VIII_S14_L001_R1_001.fastq.gz	fastq	429446821.0	5803178.0	GSM7688791 r1	0:74.00	A:114793535;C:99506379;G:102226914;T:112748761;N:171232	74			114793535	99506379	102226914	112748761	171232	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94175		0.06669		0.73673		0.48179		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24940	24940	SRR25557791	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VIII	GSM7688791	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VIII_S14_L002_R1_001.fastq.gz	fastq	434629893.0	5870828.0	GSM7688791 r2	0:74.03	A:116216940;C:100703527;G:103463365;T:114092681;N:153380	74			116216940	100703527	103463365	114092681	153380	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94143		0.0676		0.73791		0.48091		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24941	24941	SRR25557792	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VIII	GSM7688791	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VIII_S14_L003_R1_001.fastq.gz	fastq	435879881.0	5888685.0	GSM7688791 r3	0:74.02	A:116548094;C:100971153;G:103794902;T:114400770;N:164962	74			116548094	100971153	103794902	114400770	164962	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94195		0.06686		0.73785		0.48044		73		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24942	24942	SRR25557793	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VIII	GSM7688791	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VIII_S14_L004_R1_001.fastq.gz	fastq	429478475.0	5801978.0	GSM7688791 r4	0:74.02	A:114799280;C:99474677;G:102302775;T:112737475;N:164268	74			114799280	99474677	102302775	112737475	164268	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94118		0.06706		0.73892		0.47732		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24943	24943	SRR25557794	SRX21286661	SRS18536774	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VII	GSM7688790	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688790	GSM7688790: Morphant VII; Danio rerio; RNA Seq	GSM7688790 r1	GSM7688790	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VII_S15_L001_R1_001.fastq.gz	fastq	459545188.0	6215897.0	GSM7688790 r1	0:73.93	A:121926568;C:107379723;G:110263606;T:119766429;N:208862	73			121926568	107379723	110263606	119766429	208862	SRX21286661	SRS18536774	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94273		0.06072		0.74582		0.47499		73		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24944	24944	SRR25557795	SRX21286661	SRS18536774	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VII	GSM7688790	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688790	GSM7688790: Morphant VII; Danio rerio; RNA Seq	GSM7688790 r1	GSM7688790	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VII_S15_L002_R1_001.fastq.gz	fastq	463143624.0	6261406.0	GSM7688790 r2	0:73.97	A:122917997;C:108229793;G:111099867;T:120713978;N:181989	73			122917997	108229793	111099867	120713978	181989	SRX21286661	SRS18536774	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94387		0.06093		0.74341		0.47351		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24945	24945	SRR25557796	SRX21286661	SRS18536774	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VII	GSM7688790	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688790	GSM7688790: Morphant VII; Danio rerio; RNA Seq	GSM7688790 r1	GSM7688790	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VII_S15_L003_R1_001.fastq.gz	fastq	465959664.0	6300929.0	GSM7688790 r3	0:73.95	A:123689364;C:108847593;G:111847868;T:121377463;N:197376	73			123689364	108847593	111847868	121377463	197376	SRX21286661	SRS18536774	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94322		0.06219		0.74357		0.47977		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24946	24946	SRR25557797	SRX21286661	SRS18536774	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VII	GSM7688790	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688790	GSM7688790: Morphant VII; Danio rerio; RNA Seq	GSM7688790 r1	GSM7688790	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VII_S15_L004_R1_001.fastq.gz	fastq	459075430.0	6207363.0	GSM7688790 r4	0:73.96	A:121797426;C:107221116;G:110209684;T:119657308;N:189896	73			121797426	107221116	110209684	119657308	189896	SRX21286661	SRS18536774	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94313		0.06211		0.74343		0.47801		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24947	24947	SRR25557798	SRX21286660	SRS18536773	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control XI	GSM7688787	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688787	GSM7688787: Control XI; Danio rerio; RNA Seq	GSM7688787 r1	GSM7688787	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-XI_S2_L001_R1_001.fastq.gz	fastq	439719566.0	5947052.0	GSM7688787 r1	0:73.94	A:117482073;C:102083665;G:104685444;T:115272860;N:195524	73			117482073	102083665	104685444	115272860	195524	SRX21286660	SRS18536773	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94829		0.06278		0.72525		0.46494		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24948	24948	SRR25557799	SRX21286660	SRS18536773	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control XI	GSM7688787	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688787	GSM7688787: Control XI; Danio rerio; RNA Seq	GSM7688787 r1	GSM7688787	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-XI_S2_L002_R1_001.fastq.gz	fastq	438533503.0	5927990.0	GSM7688787 r2	0:73.98	A:117199594;C:101810881;G:104402169;T:114946611;N:174248	73			117199594	101810881	104402169	114946611	174248	SRX21286660	SRS18536773	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94887		0.06387		0.72827		0.46616		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24949	24949	SRR25557800	SRX21286660	SRS18536773	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control XI	GSM7688787	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688787	GSM7688787: Control XI; Danio rerio; RNA Seq	GSM7688787 r1	GSM7688787	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-XI_S2_L003_R1_001.fastq.gz	fastq	443995554.0	6003540.0	GSM7688787 r3	0:73.96	A:118663936;C:103031716;G:105723574;T:116387834;N:188494	73			118663936	103031716	105723574	116387834	188494	SRX21286660	SRS18536773	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94788		0.06232		0.72693		0.46653		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24950	24950	SRR25557801	SRX21286660	SRS18536773	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control XI	GSM7688787	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688787	GSM7688787: Control XI; Danio rerio; RNA Seq	GSM7688787 r1	GSM7688787	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-XI_S2_L004_R1_001.fastq.gz	fastq	435088869.0	5882642.0	GSM7688787 r4	0:73.96	A:116261447;C:100986653;G:103615584;T:114042354;N:182831	73			116261447	100986653	103615584	114042354	182831	SRX21286660	SRS18536773	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94914		0.06241		0.72829		0.4546		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24951	24951	SRR25557802	SRX21286659	SRS18536772	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control X	GSM7688785	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688785	GSM7688785: Control X; Danio rerio; RNA Seq	GSM7688785 r1	GSM7688785	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-X_S1_L001_R1_001.fastq.gz	fastq	395130702.0	5338263.0	GSM7688785 r1	0:74.02	A:107005793;C:90183031;G:92316770;T:105476481;N:148627	74			107005793	90183031	92316770	105476481	148627	SRX21286659	SRS18536772	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94534		0.07625		0.73888		0.48135		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24952	24952	SRR25557803	SRX21286659	SRS18536772	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control X	GSM7688785	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688785	GSM7688785: Control X; Danio rerio; RNA Seq	GSM7688785 r1	GSM7688785	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-X_S1_L002_R1_001.fastq.gz	fastq	396764458.0	5358448.0	GSM7688785 r2	0:74.04	A:107513717;C:90540282;G:92658504;T:105917444;N:134511	74			107513717	90540282	92658504	105917444	134511	SRX21286659	SRS18536772	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94374		0.07709		0.73878		0.47615		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24953	24953	SRR25557804	SRX21286659	SRS18536772	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control X	GSM7688785	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688785	GSM7688785: Control X; Danio rerio; RNA Seq	GSM7688785 r1	GSM7688785	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-X_S1_L003_R1_001.fastq.gz	fastq	399623551.0	5397520.0	GSM7688785 r3	0:74.04	A:108230540;C:91192011;G:93388052;T:106665106;N:147842	74			108230540	91192011	93388052	106665106	147842	SRX21286659	SRS18536772	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94399		0.07657		0.73797		0.4794		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24954	24954	SRR25557805	SRX21286659	SRS18536772	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control X	GSM7688785	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688785	GSM7688785: Control X; Danio rerio; RNA Seq	GSM7688785 r1	GSM7688785	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-X_S1_L004_R1_001.fastq.gz	fastq	393298978.0	5312101.0	GSM7688785 r4	0:74.04	A:106518845;C:89734564;G:91901232;T:105004490;N:139847	74			106518845	89734564	91901232	105004490	139847	SRX21286659	SRS18536772	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94423		0.07599		0.73884		0.47905		71		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24955	24955	SRR25557806	SRX21286658	SRS18536771	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control IX	GSM7688783	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688783	GSM7688783: Control IX; Danio rerio; RNA Seq	GSM7688783 r1	GSM7688783	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-IX_S22_L001_R1_001.fastq.gz	fastq	366045799.0	4944832.0	GSM7688783 r1	0:74.03	A:98000119;C:84654222;G:86951226;T:96295351;N:144881	74			98000119	84654222	86951226	96295351	144881	SRX21286658	SRS18536771	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94303		0.07499		0.73085		0.47881		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24956	24956	SRR25557807	SRX21286658	SRS18536771	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control IX	GSM7688783	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688783	GSM7688783: Control IX; Danio rerio; RNA Seq	GSM7688783 r1	GSM7688783	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-IX_S22_L002_R1_001.fastq.gz	fastq	369429068.0	4988719.0	GSM7688783 r2	0:74.05	A:98907882;C:85446993;G:87729593;T:97216477;N:128123	74			98907882	85446993	87729593	97216477	128123	SRX21286658	SRS18536771	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94261		0.07335		0.72969		0.47867		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24957	24957	SRR25557808	SRX21286658	SRS18536771	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control IX	GSM7688783	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688783	GSM7688783: Control IX; Danio rerio; RNA Seq	GSM7688783 r1	GSM7688783	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-IX_S22_L003_R1_001.fastq.gz	fastq	369967330.0	4996710.0	GSM7688783 r3	0:74.04	A:99035743;C:85549878;G:87926587;T:97310812;N:144310	74			99035743	85549878	87926587	97310812	144310	SRX21286658	SRS18536771	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94328		0.0743		0.73034		0.47133		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24958	24958	SRR25557809	SRX21286658	SRS18536771	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control IX	GSM7688783	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688783	GSM7688783: Control IX; Danio rerio; RNA Seq	GSM7688783 r1	GSM7688783	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-IX_S22_L004_R1_001.fastq.gz	fastq	365499176.0	4936305.0	GSM7688783 r4	0:74.04	A:97825658;C:84517732;G:86863655;T:96157429;N:134702	74			97825658	84517732	86863655	96157429	134702	SRX21286658	SRS18536771	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94286		0.07288		0.72999		0.4783		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24959	24959	SRR25557810	SRX21286657	SRS18536770	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VIII	GSM7688782	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688782	GSM7688782: Control VIII; Danio rerio; RNA Seq	GSM7688782 r1	GSM7688782	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VIII_S20_L001_R1_001.fastq.gz	fastq	488585907.0	6585668.0	GSM7688782 r1	0:74.19	A:131727468;C:112349971;G:115189425;T:129203159;N:115884	74			131727468	112349971	115189425	129203159	115884	SRX21286657	SRS18536770	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.93794		0.07381		0.7315		0.47355		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24960	24960	SRR25557811	SRX21286657	SRS18536770	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VIII	GSM7688782	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688782	GSM7688782: Control VIII; Danio rerio; RNA Seq	GSM7688782 r1	GSM7688782	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VIII_S20_L002_R1_001.fastq.gz	fastq	493766544.0	6653820.0	GSM7688782 r2	0:74.21	A:133135166;C:113551418;G:116398455;T:130575771;N:105734	74			133135166	113551418	116398455	130575771	105734	SRX21286657	SRS18536770	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.93729		0.07312		0.7307		0.47966		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24961	24961	SRR25557812	SRX21286657	SRS18536770	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VIII	GSM7688782	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688782	GSM7688782: Control VIII; Danio rerio; RNA Seq	GSM7688782 r1	GSM7688782	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VIII_S20_L003_R1_001.fastq.gz	fastq	494935071.0	6670024.0	GSM7688782 r3	0:74.20	A:133406912;C:113769494;G:116771560;T:130871612;N:115493	74			133406912	113769494	116771560	130871612	115493	SRX21286657	SRS18536770	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.93847		0.07383		0.73194		0.47646		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24962	24962	SRR25557813	SRX21286657	SRS18536770	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VIII	GSM7688782	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688782	GSM7688782: Control VIII; Danio rerio; RNA Seq	GSM7688782 r1	GSM7688782	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VIII_S20_L004_R1_001.fastq.gz	fastq	487644286.0	6572100.0	GSM7688782 r4	0:74.20	A:131423055;C:112092623;G:115067911;T:128945959;N:114738	74			131423055	112092623	115067911	128945959	114738	SRX21286657	SRS18536770	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.93708		0.0732		0.73186		0.4781		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24963	24963	SRR25557814	SRX21286656	SRS18536769	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VII	GSM7688781	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688781	GSM7688781: Control VII; Danio rerio; RNA Seq	GSM7688781 r1	GSM7688781	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VII_S21_L001_R1_001.fastq.gz	fastq	419048369.0	5664168.0	GSM7688781 r1	0:73.98	A:111569757;C:97553687;G:100228004;T:109523480;N:173441	73			111569757	97553687	100228004	109523480	173441	SRX21286656	SRS18536769	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94179		0.06596		0.74499		0.46809		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24964	24964	SRR25557815	SRX21286656	SRS18536769	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VII	GSM7688781	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688781	GSM7688781: Control VII; Danio rerio; RNA Seq	GSM7688781 r1	GSM7688781	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VII_S21_L002_R1_001.fastq.gz	fastq	422419362.0	5707444.0	GSM7688781 r2	0:74.01	A:112476977;C:98366185;G:101046586;T:110369882;N:159732	74			112476977	98366185	101046586	110369882	159732	SRX21286656	SRS18536769	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94275		0.06539		0.74523		0.47247		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24965	24965	SRR25557816	SRX21286656	SRS18536769	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VII	GSM7688781	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688781	GSM7688781: Control VII; Danio rerio; RNA Seq	GSM7688781 r1	GSM7688781	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VII_S21_L003_R1_001.fastq.gz	fastq	424260551.0	5733133.0	GSM7688781 r3	0:74.00	A:112957538;C:98789480;G:101496747;T:110850186;N:166600	74			112957538	98789480	101496747	110850186	166600	SRX21286656	SRS18536769	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94174		0.06482		0.74304		0.46935		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24966	24966	SRR25557817	SRX21286656	SRS18536769	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VII	GSM7688781	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688781	GSM7688781: Control VII; Danio rerio; RNA Seq	GSM7688781 r1	GSM7688781	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VII_S21_L004_R1_001.fastq.gz	fastq	417875320.0	5646817.0	GSM7688781 r4	0:74.00	A:111226895;C:97273168;G:100030641;T:109182520;N:162096	74			111226895	97273168	100030641	109182520	162096	SRX21286656	SRS18536769	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94352		0.06524		0.74442		0.47095		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24967	24967	SRR25557924	SRX21286763	SRS18536876	SRP453891	PRJNA1003032	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq]	GSE240239	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	MUTSU2 AllGFP S5	GSM7688796	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1\|geo loc name:missing\|collection date:missing	MUTSU2 AllGFP S5	We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files.	Spinal Cord		Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size.	tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1	GSM7688796	GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq	GSM7688796 r1	GSM7688796	1	Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP453891	loader:fastq load.py	MUTSU2_AllGFP-S5_S3_L001_I1_001.fastq.gz MUTSU2_AllGFP-S5_S3_L001_R1_001.fastq.gz MUTSU2_AllGFP-S5_S3_L001_R2_001.fastq.gz	fastq fastq fastq	783833459.0	6171917.0	GSM7688796 r1	0:8 1:28 2:91	A:165863131;C:117191802;G:128146802;T:150173329;N:269383	8	28	91	165863131	117191802	128146802	150173329	269383	SRX21286763	SRS18536876	SRA1688438	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.89127		0.221		0.78317		0.52195		91		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24968	24968	SRR25557925	SRX21286763	SRS18536876	SRP453891	PRJNA1003032	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq]	GSE240239	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	MUTSU2 AllGFP S5	GSM7688796	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1\|geo loc name:missing\|collection date:missing	MUTSU2 AllGFP S5	We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files.	Spinal Cord		Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size.	tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1	GSM7688796	GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq	GSM7688796 r1	GSM7688796	1	Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP453891	loader:fastq load.py	MUTSU2_AllGFP-S5-3_S2_L002_I1_001.fastq.gz MUTSU2_AllGFP-S5-3_S2_L002_R1_001.fastq.gz MUTSU2_AllGFP-S5-3_S2_L002_R2_001.fastq.gz	fastq fastq fastq	7208342327.0	56758601.0	GSM7688796 r10	0:8 1:28 2:91	A:1518008610;C:1083228714;G:1190089577;T:1369772782;N:3933008	8	28	91	1518008610	1083228714	1190089577	1369772782	3933008	SRX21286763	SRS18536876	SRA1688438	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.88938		0.21991		0.79088		0.53044		91		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24969	24969	SRR25557926	SRX21286763	SRS18536876	SRP453891	PRJNA1003032	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq]	GSE240239	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	MUTSU2 AllGFP S5	GSM7688796	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1\|geo loc name:missing\|collection date:missing	MUTSU2 AllGFP S5	We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files.	Spinal Cord		Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size.	tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1	GSM7688796	GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq	GSM7688796 r1	GSM7688796	1	Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP453891	loader:fastq load.py	MUTSU2_AllGFP-S5-3_S2_L003_I1_001.fastq.gz MUTSU2_AllGFP-S5-3_S2_L003_R1_001.fastq.gz MUTSU2_AllGFP-S5-3_S2_L003_R2_001.fastq.gz	fastq fastq fastq	7337435414.0	57775082.0	GSM7688796 r11	0:8 1:28 2:91	A:1545051667;C:1103394058;G:1211577972;T:1395133564;N:2375201	8	28	91	1545051667	1103394058	1211577972	1395133564	2375201	SRX21286763	SRS18536876	SRA1688438	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.88966		0.2211		0.78961		0.53156		91		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24970	24970	SRR25557927	SRX21286763	SRS18536876	SRP453891	PRJNA1003032	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq]	GSE240239	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	MUTSU2 AllGFP S5	GSM7688796	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1\|geo loc name:missing\|collection date:missing	MUTSU2 AllGFP S5	We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files.	Spinal Cord		Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size.	tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1	GSM7688796	GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq	GSM7688796 r1	GSM7688796	1	Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP453891	loader:fastq load.py	MUTSU2_AllGFP-S5-3_S2_L004_I1_001.fastq.gz MUTSU2_AllGFP-S5-3_S2_L004_R1_001.fastq.gz MUTSU2_AllGFP-S5-3_S2_L004_R2_001.fastq.gz	fastq fastq fastq	7218240453.0	56836539.0	GSM7688796 r12	0:8 1:28 2:91	A:1521442237;C:1084242714;G:1191469584;T:1372277539;N:2692975	8	28	91	1521442237	1084242714	1191469584	1372277539	2692975	SRX21286763	SRS18536876	SRA1688438	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.8888		0.2174		0.79172		0.53311		91		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24971	24971	SRR25557928	SRX21286763	SRS18536876	SRP453891	PRJNA1003032	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq]	GSE240239	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	MUTSU2 AllGFP S5	GSM7688796	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1\|geo loc name:missing\|collection date:missing	MUTSU2 AllGFP S5	We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files.	Spinal Cord		Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size.	tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1	GSM7688796	GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq	GSM7688796 r1	GSM7688796	1	Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP453891	loader:fastq load.py	MUTSU2_AllGFP-S5_S3_L002_I1_001.fastq.gz MUTSU2_AllGFP-S5_S3_L002_R1_001.fastq.gz MUTSU2_AllGFP-S5_S3_L002_R2_001.fastq.gz	fastq fastq fastq	774302109.0	6096867.0	GSM7688796 r2	0:8 1:28 2:91	A:163989105;C:115793536;G:126358958;T:148430473;N:242825	8	28	91	163989105	115793536	126358958	148430473	242825	SRX21286763	SRS18536876	SRA1688438	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.89371		0.2215		0.78253		0.53282		91		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24972	24972	SRR25557929	SRX21286763	SRS18536876	SRP453891	PRJNA1003032	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq]	GSE240239	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	MUTSU2 AllGFP S5	GSM7688796	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1\|geo loc name:missing\|collection date:missing	MUTSU2 AllGFP S5	We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files.	Spinal Cord		Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size.	tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1	GSM7688796	GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq	GSM7688796 r1	GSM7688796	1	Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP453891	loader:fastq load.py	MUTSU2_AllGFP-S5_S3_L003_I1_001.fastq.gz MUTSU2_AllGFP-S5_S3_L003_R1_001.fastq.gz MUTSU2_AllGFP-S5_S3_L003_R2_001.fastq.gz	fastq fastq fastq	790430093.0	6223859.0	GSM7688796 r3	0:8 1:28 2:91	A:167465790;C:118269595;G:129024496;T:151447225;N:164063	8	28	91	167465790	118269595	129024496	151447225	164063	SRX21286763	SRS18536876	SRA1688438	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.89284		0.21955		0.78356		0.53369		91		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24973	24973	SRR25557930	SRX21286763	SRS18536876	SRP453891	PRJNA1003032	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq]	GSE240239	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	MUTSU2 AllGFP S5	GSM7688796	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1\|geo loc name:missing\|collection date:missing	MUTSU2 AllGFP S5	We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files.	Spinal Cord		Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size.	tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1	GSM7688796	GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq	GSM7688796 r1	GSM7688796	1	Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP453891	loader:fastq load.py	MUTSU2_AllGFP-S5_S3_L004_I1_001.fastq.gz MUTSU2_AllGFP-S5_S3_L004_R1_001.fastq.gz MUTSU2_AllGFP-S5_S3_L004_R2_001.fastq.gz	fastq fastq fastq	778936974.0	6133362.0	GSM7688796 r4	0:8 1:28 2:91	A:165013558;C:116498474;G:127146290;T:149314806;N:162814	8	28	91	165013558	116498474	127146290	149314806	162814	SRX21286763	SRS18536876	SRA1688438	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.89195		0.2209		0.78196		0.53121		91		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24974	24974	SRR25557931	SRX21286763	SRS18536876	SRP453891	PRJNA1003032	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq]	GSE240239	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	MUTSU2 AllGFP S5	GSM7688796	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1\|geo loc name:missing\|collection date:missing	MUTSU2 AllGFP S5	We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files.	Spinal Cord		Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size.	tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1	GSM7688796	GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq	GSM7688796 r1	GSM7688796	1	Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP453891	loader:fastq load.py	MUTSU2_AllGFP-S5-2_S2_L001_I1_001.fastq.gz MUTSU2_AllGFP-S5-2_S2_L001_R1_001.fastq.gz MUTSU2_AllGFP-S5-2_S2_L001_R2_001.fastq.gz	fastq fastq fastq	4174244890.0	32868070.0	GSM7688796 r5	0:8 1:28 2:91	A:882060228;C:627098568;G:684890393;T:795503862;N:1441319	8	28	91	882060228	627098568	684890393	795503862	1441319	SRX21286763	SRS18536876	SRA1688438	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.89137		0.22041		0.77926		0.52991		91		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24975	24975	SRR25557932	SRX21286763	SRS18536876	SRP453891	PRJNA1003032	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq]	GSE240239	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	MUTSU2 AllGFP S5	GSM7688796	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1\|geo loc name:missing\|collection date:missing	MUTSU2 AllGFP S5	We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files.	Spinal Cord		Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size.	tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1	GSM7688796	GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq	GSM7688796 r1	GSM7688796	1	Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP453891	loader:fastq load.py	MUTSU2_AllGFP-S5-2_S2_L002_I1_001.fastq.gz MUTSU2_AllGFP-S5-2_S2_L002_R1_001.fastq.gz MUTSU2_AllGFP-S5-2_S2_L002_R2_001.fastq.gz	fastq fastq fastq	4150210902.0	32678826.0	GSM7688796 r6	0:8 1:28 2:91	A:878218072;C:623662333;G:679977758;T:790589138;N:1325865	8	28	91	878218072	623662333	679977758	790589138	1325865	SRX21286763	SRS18536876	SRA1688438	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.89264		0.22159		0.78121		0.52989		91		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24976	24976	SRR25557933	SRX21286763	SRS18536876	SRP453891	PRJNA1003032	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq]	GSE240239	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	MUTSU2 AllGFP S5	GSM7688796	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1\|geo loc name:missing\|collection date:missing	MUTSU2 AllGFP S5	We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files.	Spinal Cord		Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size.	tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1	GSM7688796	GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq	GSM7688796 r1	GSM7688796	1	Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP453891	loader:fastq load.py	MUTSU2_AllGFP-S5-2_S2_L003_I1_001.fastq.gz MUTSU2_AllGFP-S5-2_S2_L003_R1_001.fastq.gz MUTSU2_AllGFP-S5-2_S2_L003_R2_001.fastq.gz	fastq fastq fastq	4198043547.0	33055461.0	GSM7688796 r7	0:8 1:28 2:91	A:888287475;C:630914324;G:688006958;T:799794077;N:1044117	8	28	91	888287475	630914324	688006958	799794077	1044117	SRX21286763	SRS18536876	SRA1688438	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.8912		0.21889		0.7822		0.52774		91		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24977	24977	SRR25557934	SRX21286763	SRS18536876	SRP453891	PRJNA1003032	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq]	GSE240239	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	MUTSU2 AllGFP S5	GSM7688796	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1\|geo loc name:missing\|collection date:missing	MUTSU2 AllGFP S5	We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files.	Spinal Cord		Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size.	tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1	GSM7688796	GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq	GSM7688796 r1	GSM7688796	1	Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP453891	loader:fastq load.py	MUTSU2_AllGFP-S5-2_S2_L004_I1_001.fastq.gz MUTSU2_AllGFP-S5-2_S2_L004_R1_001.fastq.gz MUTSU2_AllGFP-S5-2_S2_L004_R2_001.fastq.gz	fastq fastq fastq	4154784553.0	32714839.0	GSM7688796 r8	0:8 1:28 2:91	A:880520885;C:624179045;G:680076172;T:791297938;N:976309	8	28	91	880520885	624179045	680076172	791297938	976309	SRX21286763	SRS18536876	SRA1688438	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.8927		0.22063		0.78216		0.5346		91		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24978	24978	SRR25557935	SRX21286763	SRS18536876	SRP453891	PRJNA1003032	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq]	GSE240239	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	MUTSU2 AllGFP S5	GSM7688796	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1\|geo loc name:missing\|collection date:missing	MUTSU2 AllGFP S5	We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files.	Spinal Cord		Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size.	tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1	GSM7688796	GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq	GSM7688796 r1	GSM7688796	1	Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP453891	loader:fastq load.py	MUTSU2_AllGFP-S5-3_S2_L001_I1_001.fastq.gz MUTSU2_AllGFP-S5-3_S2_L001_R1_001.fastq.gz MUTSU2_AllGFP-S5-3_S2_L001_R2_001.fastq.gz	fastq fastq fastq	7231973725.0	56944675.0	GSM7688796 r9	0:8 1:28 2:91	A:1522035629;C:1085783001;G:1195535350;T:1374885853;N:3725592	8	28	91	1522035629	1085783001	1195535350	1374885853	3725592	SRX21286763	SRS18536876	SRA1688438	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.88833		0.22076		0.79056		0.52744		91		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24979	24979	SRR25557936	SRX21286762	SRS18536875	SRP453891	PRJNA1003032	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq]	GSE240239	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	MUTSU2 OtherGFP G8	GSM7688795	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1\|geo loc name:missing\|collection date:missing	MUTSU2 OtherGFP G8	We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files.	Spinal Cord		Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size.	tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1	GSM7688795	GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq	GSM7688795 r1	GSM7688795	1	Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP453891	loader:fastq load.py	MUTSU2_OtherGFP-G8_S2_L001_I1_001.fastq.gz MUTSU2_OtherGFP-G8_S2_L001_R1_001.fastq.gz MUTSU2_OtherGFP-G8_S2_L001_R2_001.fastq.gz	fastq fastq fastq	699161670.0	5505210.0	GSM7688795 r1	0:8 1:28 2:91	A:149927051;C:100829317;G:116075103;T:133908276;N:234363	8	28	91	149927051	100829317	116075103	133908276	234363	SRX21286762	SRS18536875	SRA1688438	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.85081		0.21257		0.80426		0.52779		91		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24980	24980	SRR25557937	SRX21286762	SRS18536875	SRP453891	PRJNA1003032	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq]	GSE240239	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	MUTSU2 OtherGFP G8	GSM7688795	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1\|geo loc name:missing\|collection date:missing	MUTSU2 OtherGFP G8	We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files.	Spinal Cord		Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size.	tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1	GSM7688795	GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq	GSM7688795 r1	GSM7688795	1	Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP453891	loader:fastq load.py	MUTSU2_OtherGFP-G8-3_S1_L002_I1_001.fastq.gz MUTSU2_OtherGFP-G8-3_S1_L002_R1_001.fastq.gz MUTSU2_OtherGFP-G8-3_S1_L002_R2_001.fastq.gz	fastq fastq fastq	8174836330.0	64368790.0	GSM7688795 r10	0:8 1:28 2:91	A:1748532358;C:1187854561;G:1356279755;T:1560491610;N:4401606	8	28	91	1748532358	1187854561	1356279755	1560491610	4401606	SRX21286762	SRS18536875	SRA1688438	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.85069		0.20989		0.81049		0.52069		91		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24981	24981	SRR25557938	SRX21286762	SRS18536875	SRP453891	PRJNA1003032	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq]	GSE240239	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	MUTSU2 OtherGFP G8	GSM7688795	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1\|geo loc name:missing\|collection date:missing	MUTSU2 OtherGFP G8	We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files.	Spinal Cord		Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size.	tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1	GSM7688795	GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq	GSM7688795 r1	GSM7688795	1	Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP453891	loader:fastq load.py	MUTSU2_OtherGFP-G8-3_S1_L003_I1_001.fastq.gz MUTSU2_OtherGFP-G8-3_S1_L003_R1_001.fastq.gz MUTSU2_OtherGFP-G8-3_S1_L003_R2_001.fastq.gz	fastq fastq fastq	8307872640.0	65416320.0	GSM7688795 r11	0:8 1:28 2:91	A:1778112295;C:1207569588;G:1377139686;T:1587359299;N:2704252	8	28	91	1778112295	1207569588	1377139686	1587359299	2704252	SRX21286762	SRS18536875	SRA1688438	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.85151		0.21054		0.80813		0.52675		91		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24982	24982	SRR25557939	SRX21286762	SRS18536875	SRP453891	PRJNA1003032	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq]	GSE240239	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	MUTSU2 OtherGFP G8	GSM7688795	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1\|geo loc name:missing\|collection date:missing	MUTSU2 OtherGFP G8	We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files.	Spinal Cord		Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size.	tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1	GSM7688795	GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq	GSM7688795 r1	GSM7688795	1	Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP453891	loader:fastq load.py	MUTSU2_OtherGFP-G8-3_S1_L004_R2_001.fastq.gz MUTSU2_OtherGFP-G8-3_S1_L004_R1_001.fastq.gz MUTSU2_OtherGFP-G8-3_S1_L004_I1_001.fastq.gz	fastq fastq fastq	8197523483.0	64547429.0	GSM7688795 r12	0:8 1:28 2:91	A:1755321680;C:1190415496;G:1359502433;T:1565500310;N:3076120	8	28	91	1755321680	1190415496	1359502433	1565500310	3076120	SRX21286762	SRS18536875	SRA1688438	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.84956		0.20968		0.81113		0.52382		91		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24983	24983	SRR25557940	SRX21286762	SRS18536875	SRP453891	PRJNA1003032	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq]	GSE240239	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	MUTSU2 OtherGFP G8	GSM7688795	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1\|geo loc name:missing\|collection date:missing	MUTSU2 OtherGFP G8	We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files.	Spinal Cord		Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size.	tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1	GSM7688795	GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq	GSM7688795 r1	GSM7688795	1	Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP453891	loader:fastq load.py	MUTSU2_OtherGFP-G8_S2_L002_R2_001.fastq.gz MUTSU2_OtherGFP-G8_S2_L002_R1_001.fastq.gz MUTSU2_OtherGFP-G8_S2_L002_I1_001.fastq.gz	fastq fastq fastq	690198899.0	5434637.0	GSM7688795 r2	0:8 1:28 2:91	A:147896108;C:99606794;G:114681063;T:132140792;N:227210	8	28	91	147896108	99606794	114681063	132140792	227210	SRX21286762	SRS18536875	SRA1688438	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.85228		0.21261		0.803		0.52382		91		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24984	24984	SRR25557941	SRX21286762	SRS18536875	SRP453891	PRJNA1003032	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq]	GSE240239	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	MUTSU2 OtherGFP G8	GSM7688795	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1\|geo loc name:missing\|collection date:missing	MUTSU2 OtherGFP G8	We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files.	Spinal Cord		Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size.	tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1	GSM7688795	GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq	GSM7688795 r1	GSM7688795	1	Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP453891	loader:fastq load.py	MUTSU2_OtherGFP-G8_S2_L003_I1_001.fastq.gz MUTSU2_OtherGFP-G8_S2_L003_R1_001.fastq.gz MUTSU2_OtherGFP-G8_S2_L003_R2_001.fastq.gz	fastq fastq fastq	702239515.0	5529445.0	GSM7688795 r3	0:8 1:28 2:91	A:150477574;C:101266550;G:116878466;T:134415299;N:141606	8	28	91	150477574	101266550	116878466	134415299	141606	SRX21286762	SRS18536875	SRA1688438	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.85364		0.21344		0.80346		0.52158		91		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24985	24985	SRR25557942	SRX21286762	SRS18536875	SRP453891	PRJNA1003032	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq]	GSE240239	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	MUTSU2 OtherGFP G8	GSM7688795	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1\|geo loc name:missing\|collection date:missing	MUTSU2 OtherGFP G8	We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files.	Spinal Cord		Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size.	tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1	GSM7688795	GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq	GSM7688795 r1	GSM7688795	1	Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP453891	loader:fastq load.py	MUTSU2_OtherGFP-G8_S2_L004_I1_001.fastq.gz MUTSU2_OtherGFP-G8_S2_L004_R1_001.fastq.gz MUTSU2_OtherGFP-G8_S2_L004_R2_001.fastq.gz	fastq fastq fastq	694537346.0	5468798.0	GSM7688795 r4	0:8 1:28 2:91	A:148876263;C:100202441;G:115455212;T:132982029;N:144673	8	28	91	148876263	100202441	115455212	132982029	144673	SRX21286762	SRS18536875	SRA1688438	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.85238		0.2138		0.80379		0.52691		91		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24986	24986	SRR25557943	SRX21286762	SRS18536875	SRP453891	PRJNA1003032	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq]	GSE240239	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	MUTSU2 OtherGFP G8	GSM7688795	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1\|geo loc name:missing\|collection date:missing	MUTSU2 OtherGFP G8	We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files.	Spinal Cord		Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size.	tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1	GSM7688795	GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq	GSM7688795 r1	GSM7688795	1	Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP453891	loader:fastq load.py	MUTSU2_OtherGFP-G8-2_S1_L001_R2_001.fastq.gz MUTSU2_OtherGFP-G8-2_S1_L001_R1_001.fastq.gz MUTSU2_OtherGFP-G8-2_S1_L001_I1_001.fastq.gz	fastq fastq fastq	4324997954.0	34055102.0	GSM7688795 r5	0:8 1:28 2:91	A:924471384;C:626141120;G:722856562;T:824050239;N:1494977	8	28	91	924471384	626141120	722856562	824050239	1494977	SRX21286762	SRS18536875	SRA1688438	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.85083		0.21122		0.80472		0.524		91		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24987	24987	SRR25557944	SRX21286762	SRS18536875	SRP453891	PRJNA1003032	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq]	GSE240239	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	MUTSU2 OtherGFP G8	GSM7688795	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1\|geo loc name:missing\|collection date:missing	MUTSU2 OtherGFP G8	We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files.	Spinal Cord		Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size.	tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1	GSM7688795	GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq	GSM7688795 r1	GSM7688795	1	Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP453891	loader:fastq load.py	MUTSU2_OtherGFP-G8-2_S1_L002_R2_001.fastq.gz MUTSU2_OtherGFP-G8-2_S1_L002_R1_001.fastq.gz MUTSU2_OtherGFP-G8-2_S1_L002_I1_001.fastq.gz	fastq fastq fastq	4306232942.0	33907346.0	GSM7688795 r6	0:8 1:28 2:91	A:920615353;C:623090513;G:721201055;T:819291149;N:1370416	8	28	91	920615353	623090513	721201055	819291149	1370416	SRX21286762	SRS18536875	SRA1688438	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.85335		0.21315		0.80206		0.51508		91		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24988	24988	SRR25557945	SRX21286762	SRS18536875	SRP453891	PRJNA1003032	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq]	GSE240239	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	MUTSU2 OtherGFP G8	GSM7688795	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1\|geo loc name:missing\|collection date:missing	MUTSU2 OtherGFP G8	We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files.	Spinal Cord		Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size.	tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1	GSM7688795	GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq	GSM7688795 r1	GSM7688795	1	Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP453891	loader:fastq load.py	MUTSU2_OtherGFP-G8-2_S1_L003_R2_001.fastq.gz MUTSU2_OtherGFP-G8-2_S1_L003_R1_001.fastq.gz MUTSU2_OtherGFP-G8-2_S1_L003_I1_001.fastq.gz	fastq fastq fastq	4348436312.0	34239656.0	GSM7688795 r7	0:8 1:28 2:91	A:930204208;C:629005094;G:727756813;T:827747478;N:1095103	8	28	91	930204208	629005094	727756813	827747478	1095103	SRX21286762	SRS18536875	SRA1688438	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.85369		0.21216		0.80503		0.52219		91		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24989	24989	SRR25557946	SRX21286762	SRS18536875	SRP453891	PRJNA1003032	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq]	GSE240239	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	MUTSU2 OtherGFP G8	GSM7688795	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1\|geo loc name:missing\|collection date:missing	MUTSU2 OtherGFP G8	We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files.	Spinal Cord		Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size.	tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1	GSM7688795	GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq	GSM7688795 r1	GSM7688795	1	Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP453891	loader:fastq load.py	MUTSU2_OtherGFP-G8-2_S1_L004_R2_001.fastq.gz MUTSU2_OtherGFP-G8-2_S1_L004_R1_001.fastq.gz MUTSU2_OtherGFP-G8-2_S1_L004_I1_001.fastq.gz	fastq fastq fastq	4313915172.0	33967836.0	GSM7688795 r8	0:8 1:28 2:91	A:922742754;C:623127831;G:724345885;T:819819593;N:1037013	8	28	91	922742754	623127831	724345885	819819593	1037013	SRX21286762	SRS18536875	SRA1688438	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.85456		0.21236		0.80223		0.5216		91		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24990	24990	SRR25557947	SRX21286762	SRS18536875	SRP453891	PRJNA1003032	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq]	GSE240239	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	MUTSU2 OtherGFP G8	GSM7688795	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1\|geo loc name:missing\|collection date:missing	MUTSU2 OtherGFP G8	We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files.	Spinal Cord		Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size.	tissue:Spinal Cord\|cell line:Tgevx1:EGFPSU2\|cell type:V0v spinal interneurons\|genotype:evx1i232/+;evx2sa140/+ incross\|treatment:N1	GSM7688795	GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq	GSM7688795 r1	GSM7688795	1	Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant…	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP453891	loader:fastq load.py	MUTSU2_OtherGFP-G8-3_S1_L001_R2_001.fastq.gz MUTSU2_OtherGFP-G8-3_S1_L001_R1_001.fastq.gz MUTSU2_OtherGFP-G8-3_S1_L001_I1_001.fastq.gz	fastq fastq fastq	8184961024.0	64448512.0	GSM7688795 r9	0:8 1:28 2:91	A:1748819280;C:1187802244;G:1360994184;T:1562975470;N:4223414	8	28	91	1748819280	1187802244	1360994184	1562975470	4223414	SRX21286762	SRS18536875	SRA1688438	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.8493		0.21072		0.80967		0.52593		91		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
29047	29047	SRR26990800	SRX22683819	SRS19677533	SRP474986	PRJNA1046526	ITGAV variants are associated with immune dysregulation brain abnormalities and very early onset Inflammatory Bowel Disease	GSE248975	Transcriptome Analysis	Integrin alpha–V ITGAV forms heterodimers with beta subunits to regulate several cellular processes including transforming growth factor ß TGF ß signaling. We examined three unrelated families with common disease features including two children born with congenital brain anomalies and later development of immune dysregulation atopy and colitis and three fetuses with brain and developmental defects. Using whole exome and RNA sequencing and functional studies we demonstrate that biallelic ITGAV variants caused abnormal splicing or mislocalized protein that led to dysregulated TGF ß signaling in these families. Furthermore knockout itgav / zebrafish embryos developed brain defects with loss of microglia and juvenile itgav / zebrafish developed colitis. Together we show the critical role of ITGAV in immune regulation and gut and brain homeostasis and disease pathogenesis. Overall design: To investigate the role of itgav in the development of very early onset inflammatory bowel disease we generated zebrafish itgav knock out line using CRISPR/Cas9 technology. We then perform gene expression profile analysis using data abtained from RNAseq from wild type zebrafish line and itgav / line at two timepoints 8 dpf and 50 dpf. Comparative gene expression profiling analysis between wt and itgavKO zebrafish mutant were performed to examine the transcriptomic alterations caused by itgav deficiency.		pubmed:39526957	WT brain 3	GSM7924152	source name:brain\|tissue:brain\|genotype:wildtype\|time:50dpf\|geo loc name:missing\|collection date:missing	WT brain 3	The raw RNAseq reads were aligned to the zebrafish genome GRCz11 using hisat2. Reads in genes were counted using featureCounts. Differential gene expression was performed in R with the DESeq2 Assembly: zebrafish GRCz11 Supplementary files format and content: tab delimited text files include the count values for each Sample. Rows = genes; Columns = samples.	brain	Wt and itgav KO mutants at 8dpf underwent tailfin clipping genotyping.The wildtype and itgav / mutants were pooled n=15 repectively. Wt and itgav KO mutants at 50dpf underwent tailfin clipping genotyping. The wt and itgav KO mutant were euthanized by a overdose of tricaine and subsequently dissected. The gut brain and heart tissues were collected for RNA extration.	RNA were extracted using RNAeasy mini kitQiagen. 600ng of total RNA were used for the construction of sequencing libraries. RNA library preparation follows the Illumina® Stranded Total RNA Prep with Ribo Zero Plus protocol to generate polyA enriched rRNA depleted libraries.	For wt and itgav KO mutants at 8dpf embryos were obtained via natural mating and cultured in embryo E3 buffer raised in 10cm petridish with E2 embryonic buffer and incubated at 28.5°C. For wt and itgav KO mutants at 50dpf embryos were kept in a circulating system that continuously filters and aerates the system water to maintain the water quality required for a healthy aquatic environment. Temperature ranges from 26 28.5°C and the lighting conditions are 14:10 hr light: dark.	tissue:brain\|genotype:wildtype\|time:50dpf	GSM7924152	GSM7924152: WT brain 3; Danio rerio; RNA Seq	GSM7924152 r1	GSM7924152	1	RNA were extracted using RNAeasy mini kitQiagen. 600ng of total RNA were used for the construction of sequencing libraries. RNA library preparation follows the Illumina® Stranded Total RNA Prep with Ribo Zero Plus protocol to generate polyA enriched rRNA depleted libraries.	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP474986	loader:fastq load.py	6_WT_3B_S21_L001_R2_001.fastq.gz 6_WT_3B_S21_L001_R1_001.fastq.gz	fastq fastq	4461174200.0	14772100.0	GSM7924152 r1	0:151 1:151	A:1278513355;C:956242646;G:972856171;T:1253520960;N:41068	151	151		1278513355	956242646	972856171	1253520960	41068	SRX22683819	SRS19677533	SRA1760061	Muise Lab, Cell Biology, The Hospital for Sick Children	Muise Lab, Cell Biology, The Hospital for Sick Children	2	0.93808	0.93817	0.14984	0.14408	0.70388	0.7035	0.49899	0.49333	151	151	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	ribozero	bulk	unknown	unknown	Canada	2023-11-29	Multi-stage	Multi-stage	Brain	Nervous System
29048	29048	SRR26990801	SRX22683818	SRS19677532	SRP474986	PRJNA1046526	ITGAV variants are associated with immune dysregulation brain abnormalities and very early onset Inflammatory Bowel Disease	GSE248975	Transcriptome Analysis	Integrin alpha–V ITGAV forms heterodimers with beta subunits to regulate several cellular processes including transforming growth factor ß TGF ß signaling. We examined three unrelated families with common disease features including two children born with congenital brain anomalies and later development of immune dysregulation atopy and colitis and three fetuses with brain and developmental defects. Using whole exome and RNA sequencing and functional studies we demonstrate that biallelic ITGAV variants caused abnormal splicing or mislocalized protein that led to dysregulated TGF ß signaling in these families. Furthermore knockout itgav / zebrafish embryos developed brain defects with loss of microglia and juvenile itgav / zebrafish developed colitis. Together we show the critical role of ITGAV in immune regulation and gut and brain homeostasis and disease pathogenesis. Overall design: To investigate the role of itgav in the development of very early onset inflammatory bowel disease we generated zebrafish itgav knock out line using CRISPR/Cas9 technology. We then perform gene expression profile analysis using data abtained from RNAseq from wild type zebrafish line and itgav / line at two timepoints 8 dpf and 50 dpf. Comparative gene expression profiling analysis between wt and itgavKO zebrafish mutant were performed to examine the transcriptomic alterations caused by itgav deficiency.		pubmed:39526957	WT brain 2	GSM7924151	source name:brain\|tissue:brain\|genotype:wildtype\|time:50dpf\|geo loc name:missing\|collection date:missing	WT brain 2	The raw RNAseq reads were aligned to the zebrafish genome GRCz11 using hisat2. Reads in genes were counted using featureCounts. Differential gene expression was performed in R with the DESeq2 Assembly: zebrafish GRCz11 Supplementary files format and content: tab delimited text files include the count values for each Sample. Rows = genes; Columns = samples.	brain	Wt and itgav KO mutants at 8dpf underwent tailfin clipping genotyping.The wildtype and itgav / mutants were pooled n=15 repectively. Wt and itgav KO mutants at 50dpf underwent tailfin clipping genotyping. The wt and itgav KO mutant were euthanized by a overdose of tricaine and subsequently dissected. The gut brain and heart tissues were collected for RNA extration.	RNA were extracted using RNAeasy mini kitQiagen. 600ng of total RNA were used for the construction of sequencing libraries. RNA library preparation follows the Illumina® Stranded Total RNA Prep with Ribo Zero Plus protocol to generate polyA enriched rRNA depleted libraries.	For wt and itgav KO mutants at 8dpf embryos were obtained via natural mating and cultured in embryo E3 buffer raised in 10cm petridish with E2 embryonic buffer and incubated at 28.5°C. For wt and itgav KO mutants at 50dpf embryos were kept in a circulating system that continuously filters and aerates the system water to maintain the water quality required for a healthy aquatic environment. Temperature ranges from 26 28.5°C and the lighting conditions are 14:10 hr light: dark.	tissue:brain\|genotype:wildtype\|time:50dpf	GSM7924151	GSM7924151: WT brain 2; Danio rerio; RNA Seq	GSM7924151 r1	GSM7924151	1	RNA were extracted using RNAeasy mini kitQiagen. 600ng of total RNA were used for the construction of sequencing libraries. RNA library preparation follows the Illumina® Stranded Total RNA Prep with Ribo Zero Plus protocol to generate polyA enriched rRNA depleted libraries.	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP474986	loader:fastq load.py	5_WT_2B_S20_L001_R2_001.fastq.gz 5_WT_2B_S20_L001_R1_001.fastq.gz	fastq fastq	4801957946.0	15900523.0	GSM7924151 r1	0:151 1:151	A:1362644269;C:1038749357;G:1059777543;T:1340744881;N:41896	151	151		1362644269	1038749357	1059777543	1340744881	41896	SRX22683818	SRS19677532	SRA1760061	Muise Lab, Cell Biology, The Hospital for Sick Children	Muise Lab, Cell Biology, The Hospital for Sick Children	2	0.9395	0.94022	0.14136	0.13794	0.70853	0.70845	0.48158	0.51366	151	151	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	ribozero	bulk	unknown	unknown	Canada	2023-11-29	Multi-stage	Multi-stage	Brain	Nervous System
29049	29049	SRR26990802	SRX22683817	SRS19677531	SRP474986	PRJNA1046526	ITGAV variants are associated with immune dysregulation brain abnormalities and very early onset Inflammatory Bowel Disease	GSE248975	Transcriptome Analysis	Integrin alpha–V ITGAV forms heterodimers with beta subunits to regulate several cellular processes including transforming growth factor ß TGF ß signaling. We examined three unrelated families with common disease features including two children born with congenital brain anomalies and later development of immune dysregulation atopy and colitis and three fetuses with brain and developmental defects. Using whole exome and RNA sequencing and functional studies we demonstrate that biallelic ITGAV variants caused abnormal splicing or mislocalized protein that led to dysregulated TGF ß signaling in these families. Furthermore knockout itgav / zebrafish embryos developed brain defects with loss of microglia and juvenile itgav / zebrafish developed colitis. Together we show the critical role of ITGAV in immune regulation and gut and brain homeostasis and disease pathogenesis. Overall design: To investigate the role of itgav in the development of very early onset inflammatory bowel disease we generated zebrafish itgav knock out line using CRISPR/Cas9 technology. We then perform gene expression profile analysis using data abtained from RNAseq from wild type zebrafish line and itgav / line at two timepoints 8 dpf and 50 dpf. Comparative gene expression profiling analysis between wt and itgavKO zebrafish mutant were performed to examine the transcriptomic alterations caused by itgav deficiency.		pubmed:39526957	WT brain 1	GSM7924150	source name:brain\|tissue:brain\|genotype:wildtype\|time:50dpf\|geo loc name:missing\|collection date:missing	WT brain 1	The raw RNAseq reads were aligned to the zebrafish genome GRCz11 using hisat2. Reads in genes were counted using featureCounts. Differential gene expression was performed in R with the DESeq2 Assembly: zebrafish GRCz11 Supplementary files format and content: tab delimited text files include the count values for each Sample. Rows = genes; Columns = samples.	brain	Wt and itgav KO mutants at 8dpf underwent tailfin clipping genotyping.The wildtype and itgav / mutants were pooled n=15 repectively. Wt and itgav KO mutants at 50dpf underwent tailfin clipping genotyping. The wt and itgav KO mutant were euthanized by a overdose of tricaine and subsequently dissected. The gut brain and heart tissues were collected for RNA extration.	RNA were extracted using RNAeasy mini kitQiagen. 600ng of total RNA were used for the construction of sequencing libraries. RNA library preparation follows the Illumina® Stranded Total RNA Prep with Ribo Zero Plus protocol to generate polyA enriched rRNA depleted libraries.	For wt and itgav KO mutants at 8dpf embryos were obtained via natural mating and cultured in embryo E3 buffer raised in 10cm petridish with E2 embryonic buffer and incubated at 28.5°C. For wt and itgav KO mutants at 50dpf embryos were kept in a circulating system that continuously filters and aerates the system water to maintain the water quality required for a healthy aquatic environment. Temperature ranges from 26 28.5°C and the lighting conditions are 14:10 hr light: dark.	tissue:brain\|genotype:wildtype\|time:50dpf	GSM7924150	GSM7924150: WT brain 1; Danio rerio; RNA Seq	GSM7924150 r1	GSM7924150	1	RNA were extracted using RNAeasy mini kitQiagen. 600ng of total RNA were used for the construction of sequencing libraries. RNA library preparation follows the Illumina® Stranded Total RNA Prep with Ribo Zero Plus protocol to generate polyA enriched rRNA depleted libraries.	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP474986	loader:fastq load.py	4_WT_1B_S19_L001_R1_001.fastq.gz 4_WT_1B_S19_L001_R2_001.fastq.gz	fastq fastq	1712568916.0	5670758.0	GSM7924150 r1	0:151 1:151	A:496576572;C:361494257;G:367701092;T:486774148;N:22847	151	151		496576572	361494257	367701092	486774148	22847	SRX22683817	SRS19677531	SRA1760061	Muise Lab, Cell Biology, The Hospital for Sick Children	Muise Lab, Cell Biology, The Hospital for Sick Children	2	0.92654	0.92757	0.14818	0.14172	0.71394	0.7122	0.5011	0.50084	151	151	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	ribozero	bulk	unknown	unknown	Canada	2023-11-29	Multi-stage	Multi-stage	Brain	Nervous System
29050	29050	SRR26990803	SRX22683816	SRS19677530	SRP474986	PRJNA1046526	ITGAV variants are associated with immune dysregulation brain abnormalities and very early onset Inflammatory Bowel Disease	GSE248975	Transcriptome Analysis	Integrin alpha–V ITGAV forms heterodimers with beta subunits to regulate several cellular processes including transforming growth factor ß TGF ß signaling. We examined three unrelated families with common disease features including two children born with congenital brain anomalies and later development of immune dysregulation atopy and colitis and three fetuses with brain and developmental defects. Using whole exome and RNA sequencing and functional studies we demonstrate that biallelic ITGAV variants caused abnormal splicing or mislocalized protein that led to dysregulated TGF ß signaling in these families. Furthermore knockout itgav / zebrafish embryos developed brain defects with loss of microglia and juvenile itgav / zebrafish developed colitis. Together we show the critical role of ITGAV in immune regulation and gut and brain homeostasis and disease pathogenesis. Overall design: To investigate the role of itgav in the development of very early onset inflammatory bowel disease we generated zebrafish itgav knock out line using CRISPR/Cas9 technology. We then perform gene expression profile analysis using data abtained from RNAseq from wild type zebrafish line and itgav / line at two timepoints 8 dpf and 50 dpf. Comparative gene expression profiling analysis between wt and itgavKO zebrafish mutant were performed to examine the transcriptomic alterations caused by itgav deficiency.		pubmed:39526957	itgavKO brain 3	GSM7924149	source name:brain\|tissue:brain\|genotype:itgavKO mutant\|time:50dpf\|geo loc name:missing\|collection date:missing	itgavKO brain 3	The raw RNAseq reads were aligned to the zebrafish genome GRCz11 using hisat2. Reads in genes were counted using featureCounts. Differential gene expression was performed in R with the DESeq2 Assembly: zebrafish GRCz11 Supplementary files format and content: tab delimited text files include the count values for each Sample. Rows = genes; Columns = samples.	brain	Wt and itgav KO mutants at 8dpf underwent tailfin clipping genotyping.The wildtype and itgav / mutants were pooled n=15 repectively. Wt and itgav KO mutants at 50dpf underwent tailfin clipping genotyping. The wt and itgav KO mutant were euthanized by a overdose of tricaine and subsequently dissected. The gut brain and heart tissues were collected for RNA extration.	RNA were extracted using RNAeasy mini kitQiagen. 600ng of total RNA were used for the construction of sequencing libraries. RNA library preparation follows the Illumina® Stranded Total RNA Prep with Ribo Zero Plus protocol to generate polyA enriched rRNA depleted libraries.	For wt and itgav KO mutants at 8dpf embryos were obtained via natural mating and cultured in embryo E3 buffer raised in 10cm petridish with E2 embryonic buffer and incubated at 28.5°C. For wt and itgav KO mutants at 50dpf embryos were kept in a circulating system that continuously filters and aerates the system water to maintain the water quality required for a healthy aquatic environment. Temperature ranges from 26 28.5°C and the lighting conditions are 14:10 hr light: dark.	tissue:brain\|genotype:itgavKO mutant\|time:50dpf	GSM7924149	GSM7924149: itgavKO brain 3; Danio rerio; RNA Seq	GSM7924149 r1	GSM7924149	1	RNA were extracted using RNAeasy mini kitQiagen. 600ng of total RNA were used for the construction of sequencing libraries. RNA library preparation follows the Illumina® Stranded Total RNA Prep with Ribo Zero Plus protocol to generate polyA enriched rRNA depleted libraries.	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP474986	loader:fastq load.py	3_itgavKO_3B_S18_L001_R2_001.fastq.gz 3_itgavKO_3B_S18_L001_R1_001.fastq.gz	fastq fastq	3079420614.0	10196757.0	GSM7924149 r1	0:151 1:151	A:869781292;C:673463468;G:684386550;T:851761331;N:27973	151	151		869781292	673463468	684386550	851761331	27973	SRX22683816	SRS19677530	SRA1760061	Muise Lab, Cell Biology, The Hospital for Sick Children	Muise Lab, Cell Biology, The Hospital for Sick Children	2	0.94057	0.94157	0.13371	0.12847	0.70429	0.70451	0.49726	0.49861	151	151	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	ribozero	bulk	unknown	unknown	Canada	2023-11-29	Multi-stage	Multi-stage	Brain	Nervous System
29051	29051	SRR26990804	SRX22683815	SRS19677529	SRP474986	PRJNA1046526	ITGAV variants are associated with immune dysregulation brain abnormalities and very early onset Inflammatory Bowel Disease	GSE248975	Transcriptome Analysis	Integrin alpha–V ITGAV forms heterodimers with beta subunits to regulate several cellular processes including transforming growth factor ß TGF ß signaling. We examined three unrelated families with common disease features including two children born with congenital brain anomalies and later development of immune dysregulation atopy and colitis and three fetuses with brain and developmental defects. Using whole exome and RNA sequencing and functional studies we demonstrate that biallelic ITGAV variants caused abnormal splicing or mislocalized protein that led to dysregulated TGF ß signaling in these families. Furthermore knockout itgav / zebrafish embryos developed brain defects with loss of microglia and juvenile itgav / zebrafish developed colitis. Together we show the critical role of ITGAV in immune regulation and gut and brain homeostasis and disease pathogenesis. Overall design: To investigate the role of itgav in the development of very early onset inflammatory bowel disease we generated zebrafish itgav knock out line using CRISPR/Cas9 technology. We then perform gene expression profile analysis using data abtained from RNAseq from wild type zebrafish line and itgav / line at two timepoints 8 dpf and 50 dpf. Comparative gene expression profiling analysis between wt and itgavKO zebrafish mutant were performed to examine the transcriptomic alterations caused by itgav deficiency.		pubmed:39526957	itgavKO brain 2	GSM7924148	source name:brain\|tissue:brain\|genotype:itgavKO mutant\|time:50dpf\|geo loc name:missing\|collection date:missing	itgavKO brain 2	The raw RNAseq reads were aligned to the zebrafish genome GRCz11 using hisat2. Reads in genes were counted using featureCounts. Differential gene expression was performed in R with the DESeq2 Assembly: zebrafish GRCz11 Supplementary files format and content: tab delimited text files include the count values for each Sample. Rows = genes; Columns = samples.	brain	Wt and itgav KO mutants at 8dpf underwent tailfin clipping genotyping.The wildtype and itgav / mutants were pooled n=15 repectively. Wt and itgav KO mutants at 50dpf underwent tailfin clipping genotyping. The wt and itgav KO mutant were euthanized by a overdose of tricaine and subsequently dissected. The gut brain and heart tissues were collected for RNA extration.	RNA were extracted using RNAeasy mini kitQiagen. 600ng of total RNA were used for the construction of sequencing libraries. RNA library preparation follows the Illumina® Stranded Total RNA Prep with Ribo Zero Plus protocol to generate polyA enriched rRNA depleted libraries.	For wt and itgav KO mutants at 8dpf embryos were obtained via natural mating and cultured in embryo E3 buffer raised in 10cm petridish with E2 embryonic buffer and incubated at 28.5°C. For wt and itgav KO mutants at 50dpf embryos were kept in a circulating system that continuously filters and aerates the system water to maintain the water quality required for a healthy aquatic environment. Temperature ranges from 26 28.5°C and the lighting conditions are 14:10 hr light: dark.	tissue:brain\|genotype:itgavKO mutant\|time:50dpf	GSM7924148	GSM7924148: itgavKO brain 2; Danio rerio; RNA Seq	GSM7924148 r1	GSM7924148	1	RNA were extracted using RNAeasy mini kitQiagen. 600ng of total RNA were used for the construction of sequencing libraries. RNA library preparation follows the Illumina® Stranded Total RNA Prep with Ribo Zero Plus protocol to generate polyA enriched rRNA depleted libraries.	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP474986	loader:fastq load.py	2_itgavKO_2B_S17_L001_R1_001.fastq.gz 2_itgavKO_2B_S17_L001_R2_001.fastq.gz	fastq fastq	1913701218.0	6336759.0	GSM7924148 r1	0:151 1:151	A:549324781;C:410519448;G:417112515;T:536726028;N:18446	151	151		549324781	410519448	417112515	536726028	18446	SRX22683815	SRS19677529	SRA1760061	Muise Lab, Cell Biology, The Hospital for Sick Children	Muise Lab, Cell Biology, The Hospital for Sick Children	2	0.93075	0.93209	0.15174	0.14613	0.70449	0.70475	0.48199	0.48317	151	151	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	ribozero	bulk	unknown	unknown	Canada	2023-11-29	Multi-stage	Multi-stage	Brain	Nervous System
29052	29052	SRR26990805	SRX22683814	SRS19677528	SRP474986	PRJNA1046526	ITGAV variants are associated with immune dysregulation brain abnormalities and very early onset Inflammatory Bowel Disease	GSE248975	Transcriptome Analysis	Integrin alpha–V ITGAV forms heterodimers with beta subunits to regulate several cellular processes including transforming growth factor ß TGF ß signaling. We examined three unrelated families with common disease features including two children born with congenital brain anomalies and later development of immune dysregulation atopy and colitis and three fetuses with brain and developmental defects. Using whole exome and RNA sequencing and functional studies we demonstrate that biallelic ITGAV variants caused abnormal splicing or mislocalized protein that led to dysregulated TGF ß signaling in these families. Furthermore knockout itgav / zebrafish embryos developed brain defects with loss of microglia and juvenile itgav / zebrafish developed colitis. Together we show the critical role of ITGAV in immune regulation and gut and brain homeostasis and disease pathogenesis. Overall design: To investigate the role of itgav in the development of very early onset inflammatory bowel disease we generated zebrafish itgav knock out line using CRISPR/Cas9 technology. We then perform gene expression profile analysis using data abtained from RNAseq from wild type zebrafish line and itgav / line at two timepoints 8 dpf and 50 dpf. Comparative gene expression profiling analysis between wt and itgavKO zebrafish mutant were performed to examine the transcriptomic alterations caused by itgav deficiency.		pubmed:39526957	itgavKO brain 1	GSM7924147	source name:brain\|tissue:brain\|genotype:itgavKO mutant\|time:50dpf\|geo loc name:missing\|collection date:missing	itgavKO brain 1	The raw RNAseq reads were aligned to the zebrafish genome GRCz11 using hisat2. Reads in genes were counted using featureCounts. Differential gene expression was performed in R with the DESeq2 Assembly: zebrafish GRCz11 Supplementary files format and content: tab delimited text files include the count values for each Sample. Rows = genes; Columns = samples.	brain	Wt and itgav KO mutants at 8dpf underwent tailfin clipping genotyping.The wildtype and itgav / mutants were pooled n=15 repectively. Wt and itgav KO mutants at 50dpf underwent tailfin clipping genotyping. The wt and itgav KO mutant were euthanized by a overdose of tricaine and subsequently dissected. The gut brain and heart tissues were collected for RNA extration.	RNA were extracted using RNAeasy mini kitQiagen. 600ng of total RNA were used for the construction of sequencing libraries. RNA library preparation follows the Illumina® Stranded Total RNA Prep with Ribo Zero Plus protocol to generate polyA enriched rRNA depleted libraries.	For wt and itgav KO mutants at 8dpf embryos were obtained via natural mating and cultured in embryo E3 buffer raised in 10cm petridish with E2 embryonic buffer and incubated at 28.5°C. For wt and itgav KO mutants at 50dpf embryos were kept in a circulating system that continuously filters and aerates the system water to maintain the water quality required for a healthy aquatic environment. Temperature ranges from 26 28.5°C and the lighting conditions are 14:10 hr light: dark.	tissue:brain\|genotype:itgavKO mutant\|time:50dpf	GSM7924147	GSM7924147: itgavKO brain 1; Danio rerio; RNA Seq	GSM7924147 r1	GSM7924147	1	RNA were extracted using RNAeasy mini kitQiagen. 600ng of total RNA were used for the construction of sequencing libraries. RNA library preparation follows the Illumina® Stranded Total RNA Prep with Ribo Zero Plus protocol to generate polyA enriched rRNA depleted libraries.	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP474986	loader:fastq load.py	1_itgavKO_1B_S16_L001_R1_001.fastq.gz 1_itgavKO_1B_S16_L001_R2_001.fastq.gz	fastq fastq	2056389876.0	6809238.0	GSM7924147 r1	0:151 1:151	A:593258034;C:437927433;G:446814957;T:578370581;N:18871	151	151		593258034	437927433	446814957	578370581	18871	SRX22683814	SRS19677528	SRA1760061	Muise Lab, Cell Biology, The Hospital for Sick Children	Muise Lab, Cell Biology, The Hospital for Sick Children	2	0.93156	0.93304	0.1488	0.14352	0.70224	0.70293	0.49609	0.49296	151	151	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	ribozero	bulk	unknown	unknown	Canada	2023-11-29	Multi-stage	Multi-stage	Brain	Nervous System
29059	29059	SRR27010032	SRX22702842	SRS19695451	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			rnaset2 scr sham C3	C3	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:C3\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	C3	C3	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		C3_R2_001.fastq.gz C3_R1_001.fastq.gz	fastq fastq	7226125500.0	24087085.0	C3 R1 001.fastq.gz	0:150 1:150	A:1960622478;C:1648410555;G:1694156766;T:1922924543;N:11158	150	150		1960622478	1648410555	1694156766	1922924543	11158	SRX22702842	SRS19695451	SRA1760882	University of York\|Biology	University of York	2	0.94281	0.94259	0.11548	0.11243	0.666	0.66768	0.4931	0.49197	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29060	29060	SRR27010033	SRX22702841	SRS19695450	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			rnaset2 scr sham C2	C2	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:C2\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	C2	C2	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		C2_R1_001.fastq.gz C2_R2_001.fastq.gz	fastq fastq	5174981700.0	17249939.0	C2 R1 001.fastq.gz	0:150 1:150	A:1397754308;C:1184093732;G:1220417954;T:1372707855;N:7851	150	150		1397754308	1184093732	1220417954	1372707855	7851	SRX22702841	SRS19695450	SRA1760882	University of York\|Biology	University of York	2	0.94447	0.94375	0.11969	0.11666	0.68885	0.68956	0.49127	0.48884	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29061	29061	SRR27010034	SRX22702840	SRS19695449	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			WT irf8 sham B6	B6	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:B6\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	B6	B6	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		B6_R1_001.fastq.gz B6_R2_001.fastq.gz	fastq fastq	6038798100.0	20129327.0	B6 R1 001.fastq.gz	0:150 1:150	A:1644314055;C:1369774666;G:1410590989;T:1614109292;N:9098	150	150		1644314055	1369774666	1410590989	1614109292	9098	SRX22702840	SRS19695449	SRA1760882	University of York\|Biology	University of York	2	0.94338	0.9424	0.12398	0.12103	0.69075	0.69203	0.49627	0.49707	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29062	29062	SRR27010035	SRX22702839	SRS19695448	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			WT irf8 sham B4	B4	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:B4\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	B4	B4	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		B4_R1_001.fastq.gz B4_R2_001.fastq.gz	fastq fastq	4670850600.0	15569502.0	B4 R1 001.fastq.gz	0:150 1:150	A:1265811314;C:1065724201;G:1097798356;T:1241510089;N:6640	150	150		1265811314	1065724201	1097798356	1241510089	6640	SRX22702839	SRS19695448	SRA1760882	University of York\|Biology	University of York	2	0.94547	0.94517	0.11922	0.11549	0.68968	0.69029	0.48585	0.48669	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29063	29063	SRR27010036	SRX22702838	SRS19695446	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			WT irf8 sham B3	B3	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:B3\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	B3	B3	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		B3_R1_001.fastq.gz B3_R2_001.fastq.gz	fastq fastq	5982538500.0	19941795.0	B3 R1 001.fastq.gz	0:150 1:150	A:1606272011;C:1379162914;G:1419047430;T:1578047050;N:9095	150	150		1606272011	1379162914	1419047430	1578047050	9095	SRX22702838	SRS19695446	SRA1760882	University of York\|Biology	University of York	2	0.95017	0.9501	0.09939	0.09688	0.68838	0.68964	0.48756	0.49223	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29064	29064	SRR27010037	SRX22702837	SRS19695447	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			WT irf8 sham B2	B2	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:B2\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	B2	B2	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		B2_R2_001.fastq.gz B2_R1_001.fastq.gz	fastq fastq	5653227300.0	18844091.0	B2 R1 001.fastq.gz	0:150 1:150	A:1525579353;C:1295599509;G:1332714404;T:1499325712;N:8322	150	150		1525579353	1295599509	1332714404	1499325712	8322	SRX22702837	SRS19695447	SRA1760882	University of York\|Biology	University of York	2	0.94379	0.89488	0.12085	0.10989	0.69004	0.69796	0.48877	0.48916	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29065	29065	SRR27010038	SRX22702836	SRS19695445	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			WT scr sham A9	A9	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:A9\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	A9	A9	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		A9_R1_001.fastq.gz A9_R2_001.fastq.gz	fastq fastq	5280286800.0	17600956.0	A9 R1 001.fastq.gz	0:150 1:150	A:1438789477;C:1200820278;G:1228527888;T:1412141110;N:8047	150	150		1438789477	1200820278	1228527888	1412141110	8047	SRX22702836	SRS19695445	SRA1760882	University of York\|Biology	University of York	2	0.93991	0.93997	0.12415	0.11988	0.68043	0.68245	0.49031	0.49263	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29066	29066	SRR27010039	SRX22702835	SRS19695444	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			rnaset2 irf8 transplanted visible cells G8	G8	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:G8\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	G8	G8	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		G8_R1_001.fastq.gz G8_R2_001.fastq.gz	fastq fastq	6258269400.0	20860898.0	G8 R1 001.fastq.gz	0:150 1:150	A:1703536007;C:1424705894;G:1461517358;T:1668500971;N:9170	150	150		1703536007	1424705894	1461517358	1668500971	9170	SRX22702835	SRS19695444	SRA1760882	University of York\|Biology	University of York	2	0.94463	0.94425	0.12179	0.11924	0.68383	0.68574	0.48927	0.49078	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29067	29067	SRR27010040	SRX22702834	SRS19695443	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			rnaset2 irf8 transplanted visible cells G5	G5	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:G5\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	G5	G5	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		G5_R2_001.fastq.gz G5_R1_001.fastq.gz	fastq fastq	8086012500.0	26953375.0	G5 R1 001.fastq.gz	0:150 1:150	A:2209424775;C:1827141351;G:1886144200;T:2163290263;N:11911	150	150		2209424775	1827141351	1886144200	2163290263	11911	SRX22702834	SRS19695443	SRA1760882	University of York\|Biology	University of York	2	0.94005	0.94009	0.13869	0.13535	0.68874	0.68876	0.49518	0.49562	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29068	29068	SRR27010041	SRX22702833	SRS19695442	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			rnaset2 irf8 transplanted visible cells G4	G4	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:G4\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	G4	G4	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		G4_R2_001.fastq.gz G4_R1_001.fastq.gz	fastq fastq	11168836800.0	37229456.0	G4 R1 001.fastq.gz	0:150 1:150	A:3056935929;C:2522420915;G:2603785258;T:2985677785;N:16913	150	150		3056935929	2522420915	2603785258	2985677785	16913	SRX22702833	SRS19695442	SRA1760882	University of York\|Biology	University of York	2	0.94154	0.94245	0.13303	0.12991	0.68298	0.68428	0.49109	0.49258	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29069	29069	SRR27010042	SRX22702832	SRS19695441	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			rnaset2 irf8 transplanted visible cells G1	G1	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:G1\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	G1	G1	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		G1_R1_001.fastq.gz G1_R2_001.fastq.gz	fastq fastq	6745303500.0	22484345.0	G1 R1 001.fastq.gz	0:150 1:150	A:1832990297;C:1535916761;G:1572331210;T:1804054965;N:10267	150	150		1832990297	1535916761	1572331210	1804054965	10267	SRX22702832	SRS19695441	SRA1760882	University of York\|Biology	University of York	2	0.9424	0.94298	0.12822	0.12534	0.68775	0.68854	0.4869	0.48958	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29070	29070	SRR27010043	SRX22702831	SRS19695440	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			rnaset2 scr transplanted non visible cells F5	F5	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:F5\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	F5	F5	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		F5_R1_001.fastq.gz F5_R2_001.fastq.gz	fastq fastq	6464113800.0	21547046.0	F5 R1 001.fastq.gz	0:150 1:150	A:1773652408;C:1452872569;G:1501709404;T:1735869784;N:9635	150	150		1773652408	1452872569	1501709404	1735869784	9635	SRX22702831	SRS19695440	SRA1760882	University of York\|Biology	University of York	2	0.93953	0.93885	0.13889	0.13589	0.68448	0.68568	0.49419	0.49486	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29071	29071	SRR27010044	SRX22702830	SRS19695439	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			rnaset2 scr transplanted non visible cells F4	F4	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:F4\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	F4	F4	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		F4_R1_001.fastq.gz F4_R2_001.fastq.gz	fastq fastq	7547491800.0	25158306.0	F4 R1 001.fastq.gz	0:150 1:150	A:2043215956;C:1726123019;G:1778767478;T:1999373636;N:11711	150	150		2043215956	1726123019	1778767478	1999373636	11711	SRX22702830	SRS19695439	SRA1760882	University of York\|Biology	University of York	2	0.94829	0.94765	0.11775	0.11477	0.68682	0.68783	0.48624	0.49294	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29072	29072	SRR27010045	SRX22702829	SRS19695437	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			rnaset2 scr transplanted non visible cells F3	F3	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:F3\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	F3	F3	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		F3_R1_001.fastq.gz F3_R2_001.fastq.gz	fastq fastq	7796779800.0	25989266.0	F3 R1 001.fastq.gz	0:150 1:150	A:2138759764;C:1759352855;G:1808448742;T:2090206548;N:11891	150	150		2138759764	1759352855	1808448742	2090206548	11891	SRX22702829	SRS19695437	SRA1760882	University of York\|Biology	University of York	2	0.94125	0.9421	0.13575	0.13224	0.69307	0.69469	0.4862	0.48802	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29073	29073	SRR27010046	SRX22702828	SRS19695438	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			WT scr sham A4	A4	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:A4\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	A4	A4	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		A4_R1_001.fastq.gz A4_R2_001.fastq.gz	fastq fastq	6954570300.0	23181901.0	A4 R1 001.fastq.gz	0:150 1:150	A:1888329109;C:1587042583;G:1627429667;T:1851758485;N:10456	150	150		1888329109	1587042583	1627429667	1851758485	10456	SRX22702828	SRS19695438	SRA1760882	University of York\|Biology	University of York	2	0.94568	0.94593	0.11814	0.1154	0.69171	0.69161	0.49417	0.49201	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29074	29074	SRR27010047	SRX22702827	SRS19695436	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			rnaset2 scr transplanted non visible cells F2	F2	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:F2\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	F2	F2	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		F2_R2_001.fastq.gz F2_R1_001.fastq.gz	fastq fastq	7064875200.0	23549584.0	F2 R1 001.fastq.gz	0:150 1:150	A:1909747576;C:1617295332;G:1667877510;T:1869944260;N:10522	150	150		1909747576	1617295332	1667877510	1869944260	10522	SRX22702827	SRS19695436	SRA1760882	University of York\|Biology	University of York	2	0.94737	0.94827	0.10024	0.09772	0.69057	0.69146	0.49402	0.49924	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29075	29075	SRR27010048	SRX22702826	SRS19695435	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			rnaset2 scr transplanted visible cells E5	E5	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:E5\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	E5	E5	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		E5_R1_001.fastq.gz E5_R2_001.fastq.gz	fastq fastq	9245045700.0	30816819.0	E5 R1 001.fastq.gz	0:150 1:150	A:2541240585;C:2078884464;G:2136224399;T:2488682323;N:13929	150	150		2541240585	2078884464	2136224399	2488682323	13929	SRX22702826	SRS19695435	SRA1760882	University of York\|Biology	University of York	2	0.93981	0.93963	0.14018	0.13679	0.68544	0.68647	0.48749	0.49123	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29076	29076	SRR27010049	SRX22702825	SRS19695434	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			rnaset2 scr transplanted visible cells E4	E4	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:E4\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	E4	E4	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		E4_R1_001.fastq.gz E4_R2_001.fastq.gz	fastq fastq	9413066700.0	31376889.0	E4 R1 001.fastq.gz	0:150 1:150	A:2556541599;C:2141951710;G:2209637678;T:2504921319;N:14394	150	150		2556541599	2141951710	2209637678	2504921319	14394	SRX22702825	SRS19695434	SRA1760882	University of York\|Biology	University of York	2	0.93966	0.94056	0.13191	0.13025	0.6845	0.68458	0.48562	0.48775	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29077	29077	SRR27010050	SRX22702824	SRS19695433	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			rnaset2 scr transplanted visible cells E3	E3	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:E3\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	E3	E3	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		E3_R1_001.fastq.gz E3_R2_001.fastq.gz	fastq fastq	7964919000.0	26549730.0	E3 R1 001.fastq.gz	0:150 1:150	A:2160541660;C:1817481684;G:1869600595;T:2117282750;N:12311	150	150		2160541660	1817481684	1869600595	2117282750	12311	SRX22702824	SRS19695433	SRA1760882	University of York\|Biology	University of York	2	0.94418	0.94436	0.12381	0.12155	0.69043	0.69244	0.49578	0.49427	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29078	29078	SRR27010051	SRX22702823	SRS19695432	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			rnaset2 irf8 sham D7	D7	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:D7\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	D7	D7	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		D7_R1_001.fastq.gz D7_R2_001.fastq.gz	fastq fastq	9187165200.0	30623884.0	D7 R1 001.fastq.gz	0:150 1:150	A:2491532789;C:2097618431;G:2151100077;T:2446900236;N:13667	150	150		2491532789	2097618431	2151100077	2446900236	13667	SRX22702823	SRS19695432	SRA1760882	University of York\|Biology	University of York	2	0.94299	0.94212	0.11906	0.11545	0.68306	0.68548	0.49177	0.49121	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29079	29079	SRR27010052	SRX22702822	SRS19695430	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			rnaset2 irf8 sham D6	D6	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:D6\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	D6	D6	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		D6_R1_001.fastq.gz D6_R2_001.fastq.gz	fastq fastq	5879800500.0	19599335.0	D6 R1 001.fastq.gz	0:150 1:150	A:1605109827;C:1329412433;G:1368575434;T:1576693845;N:8961	150	150		1605109827	1329412433	1368575434	1576693845	8961	SRX22702822	SRS19695430	SRA1760882	University of York\|Biology	University of York	2	0.94062	0.94076	0.12643	0.12267	0.67959	0.68079	0.4953	0.49028	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29080	29080	SRR27010053	SRX22702821	SRS19695431	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			rnaset2 irf8 sham D5	D5	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:D5\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	D5	D5	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		D5_R1_001.fastq.gz D5_R2_001.fastq.gz	fastq fastq	6561881400.0	21872938.0	D5 R1 001.fastq.gz	0:150 1:150	A:1784761040;C:1494553700;G:1531680450;T:1750875924;N:10286	150	150		1784761040	1494553700	1531680450	1750875924	10286	SRX22702821	SRS19695431	SRA1760882	University of York\|Biology	University of York	2	0.94309	0.94372	0.12249	0.11939	0.6896	0.69126	0.4916	0.48496	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29081	29081	SRR27010054	SRX22702820	SRS19695429	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			rnaset2 irf8 sham D2	D2	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:D2\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	D2	D2	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		D2_R1_001.fastq.gz D2_R2_001.fastq.gz	fastq fastq	6654501900.0	22181673.0	D2 R1 001.fastq.gz	0:150 1:150	A:1814773421;C:1511191953;G:1552895235;T:1775631113;N:10178	150	150		1814773421	1511191953	1552895235	1775631113	10178	SRX22702820	SRS19695429	SRA1760882	University of York\|Biology	University of York	2	0.94117	0.94183	0.13042	0.12757	0.68578	0.68747	0.49634	0.49724	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29082	29082	SRR27010055	SRX22702819	SRS19695428	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			rnaset2 scr sham C5	C5	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:C5\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	C5	C5	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		C5_R2_001.fastq.gz C5_R1_001.fastq.gz	fastq fastq	6839917500.0	22799725.0	C5 R1 001.fastq.gz	0:150 1:150	A:1862202751;C:1544536021;G:1599909841;T:1833258970;N:9917	150	150		1862202751	1544536021	1599909841	1833258970	9917	SRX22702819	SRS19695428	SRA1760882	University of York\|Biology	University of York	2	0.94311	0.9429	0.12484	0.12074	0.68899	0.69077	0.49108	0.49366	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29083	29083	SRR27010056	SRX22702818	SRS19695427	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			rnaset2 scr sham C4	C4	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:C4\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	C4	C4	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		C4_R1_001.fastq.gz C4_R2_001.fastq.gz	fastq fastq	6814278600.0	22714262.0	C4 R1 001.fastq.gz	0:150 1:150	A:1829280895;C:1574717969;G:1616401528;T:1793867756;N:10452	150	150		1829280895	1574717969	1616401528	1793867756	10452	SRX22702818	SRS19695427	SRA1760882	University of York\|Biology	University of York	2	0.94942	0.95087	0.09719	0.09395	0.69445	0.69507	0.49061	0.49227	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29084	29084	SRR27010057	SRX22702817	SRS19695425	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			WT scr sham A2	A2	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:A2\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	A2	A2	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		A2_R1_001.fastq.gz A2_R2_001.fastq.gz	fastq fastq	9528853800.0	31762846.0	A2 R1 001.fastq.gz	0:150 1:150	A:2597197507;C:2160049241;G:2216864264;T:2554728048;N:14740	150	150		2597197507	2160049241	2216864264	2554728048	14740	SRX22702817	SRS19695425	SRA1760882	University of York\|Biology	University of York	2	0.9445	0.94377	0.12789	0.12443	0.68414	0.68456	0.48493	0.49203	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29085	29085	SRR27010058	SRX22702816	SRS19695426	SRP475263	PRJNA1047321	Effect of microglial replacement on RNAseT2 deficient leukodystrophy in zebrafish	PRJNA1047321	Other	RNA sequencing of zebrafish brains to assess efficiency of macrophage transplantation as a therapy in a zebrafish model of rnaset2 leukodystrophy.			WT scr sham A1	A1	strain:nacre\|isolate:n/a\|breed:n/a\|cultivar:n/a\|ecotype:n/a\|age:4 weeks\|dev stage:juvenile\|collection date:2023 03\|geo loc name:United Kingdom: Sheffield\|sex:unknown\|tissue:brain\|replicate:A1\|BioSampleModel:Model organism or animal									RNA seq of zebrafish: brain	A1	A1	RNA was extracted polyA enriched and libraries prepared with the NEBNext Ultra II Directional RNA Library prep kit for Illumina		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	SRP475263		A1_R1_001.fastq.gz A1_R2_001.fastq.gz	fastq fastq	7478013000.0	24926710.0	A1 R1 001.fastq.gz	0:150 1:150	A:2052485809;C:1681219485;G:1732402686;T:2011893634;N:11386	150	150		2052485809	1681219485	1732402686	2011893634	11386	SRX22702816	SRS19695426	SRA1760882	University of York\|Biology	University of York	2	0.9395	0.93867	0.13153	0.12753	0.68933	0.691	0.4882	0.48774	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2023-12-01	Multi-stage	Multi-stage	Brain	Nervous System
29820	29820	SRR27499202	SRX23170207	SRS20119604	SRP483288	PRJNA1063685	Patch Seq of synchronized and non synchronized neurons in zebrafish dorsal pallium in response to CAS treatment	GSE253039	Transcriptome Analysis	The goals of this study is to compare transcriptome profiles RNA seq of synchronized and non synchronized neurons in zebrafish dorsal pallium in response to CAS treatment.TgHuC:H2B GCaMP6f fish of 4 wpf 5 wpf were were fixed in a recording chamber containing extracellular fluid and neurons with synchronized or non synchronized calcium activity post CAS treatment were identified by two photon imaging and collected separately with glass pipette. Single cells were transferred to the lysis buffer solution. Total RNA was extracted using TRIzol Invitrogen and then purified on RNeasy columns Qiagen. Total RNA quality was assessed on a bioanalyzer Thermofisher. RNA Seq libraries N=10 for each group were prepared using the Illumina TruSeq Strand mRNA Prep Kit according to the manufacturer's instructions. RNA Seq libraries were sequenced using Illumina NextSeq 500 generating 75 bp paired end reads for each sample. RNA Seq reads untrimmed. Differential expression analysis was performed using the CPM counts per million function in the Bioconductor package edgeR v 3.14.0. Low expression genes were excluded to make a simple correction for gene counts. Genes with P value instead of adjusted P value < 0.05 were assigned as differentially expressed. We identified differentially expressed genes DEGs between synchronized and non synchronized neurons in zebrafish dorsal pallium in response to CAS treatment. Synchronized neurons expressed much higher level of glutamate transporter genes slc17a7a slc17a6a while non synchronized neurons showed significantly higher expression of gad1b suggesting that synchronized neurons are primarily glutamatergic while non synchronized neurons are mainly GABAergic. Overall design: To distinguish neurons with synchronized or non synchronized calcium activity post CAS treatment TgHuC:H2B GCaMP6f fish of 4 wpf 5 wpf were fixed in a recording chamber containing extracellular fluid and subjected to two photon imaging and neurons were collected separately with glass pipette. RNA Seq libraries N=10 f…		pubmed:38519480	non syn 19 1	GSM8012748	source name:brain\|tissue:brain\|strain:TgHuC:H2B GCaMP6f\|cell type:neurons in dorsal pallium\|treatment:non synchronized in response to CAS\|geo loc name:missing\|collection date:missing	non syn 19 1	RNA Seq reads untrimmed. Differential expression analysis was performed using the CPM counts per million function in the Bioconductor package edgeR v 3.14.0. Low expression genes were excluded to make a simple correction for gene counts. Genes with P value instead of adjusted P value < 0.05 were assigned as differentially expressed. Assembly: danRer11 Supplementary files format and content: Excel file include readcounts values for each Sample.	brain	TgHuC:H2B GCaMP6f fish of 4 wpf 5 wpf were fixed in a recording chamber containing extracellular fluid and neurons with synchronized or non synchronized calcium activity post CAS treatment were identified by two photon imaging and collected separately with glass pipette.	Single cells were transferred to the lysis buffer solution. Total RNA was extracted using TRIzol Invitrogen and then purified on RNeasy columns Qiagen. Total RNA quality was assessed on a bioanalyzer Thermofisher. RNA Seq libraries N=10 for each group were prepared using the Illumina TruSeq Strand mRNA Prep Kit according to the manufacturer's instructions.	TgHuC:H2B GCaMP6f fish of 4 wpf 5 wpf were used.	tissue:brain\|strain:TgHuC:H2B GCaMP6f\|cell type:neurons in dorsal pallium\|treatment:non synchronized in response to CAS	GSM8012748	GSM8012748: non syn 19 1; Danio rerio; RNA Seq	GSM8012748 r1	GSM8012748	1	Single cells were transferred to the lysis buffer solution. Total RNA was extracted using TRIzol Invitrogen and then purified on RNeasy columns Qiagen. Total RNA quality was assessed on a bioanalyzer Thermofisher. RNA Seq libraries N=10 for each group were prepared using the Illumina TruSeq Strand mRNA Prep Kit according to the manufacturer's instructions.	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 2000	SRP483288		non-syn-19-1_extract_R1.fastq non-syn-19-1_extract_R2.fastq	fastq fastq	3117719100.0	10392397.0	GSM8012748 r1	0:150 1:150	A:895917474;C:489293250;G:641228744;T:1091230120;N:49512	150	150		895917474	489293250	641228744	1091230120	49512	SRX23170207	SRS20119604	SRA1784161	Neuroscience, School of Medcine, Tongji University, 42508444-9	Neuroscience, School of Medcine, Tongji University, 42508444-9												T	B	mate1 technical by mapping diff	illumina	nextseq_v2	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	China	2024-01-11	Multi-stage	Multi-stage	Brain	Nervous System
29821	29821	SRR27499203	SRX23170206	SRS20119603	SRP483288	PRJNA1063685	Patch Seq of synchronized and non synchronized neurons in zebrafish dorsal pallium in response to CAS treatment	GSE253039	Transcriptome Analysis	The goals of this study is to compare transcriptome profiles RNA seq of synchronized and non synchronized neurons in zebrafish dorsal pallium in response to CAS treatment.TgHuC:H2B GCaMP6f fish of 4 wpf 5 wpf were were fixed in a recording chamber containing extracellular fluid and neurons with synchronized or non synchronized calcium activity post CAS treatment were identified by two photon imaging and collected separately with glass pipette. Single cells were transferred to the lysis buffer solution. Total RNA was extracted using TRIzol Invitrogen and then purified on RNeasy columns Qiagen. Total RNA quality was assessed on a bioanalyzer Thermofisher. RNA Seq libraries N=10 for each group were prepared using the Illumina TruSeq Strand mRNA Prep Kit according to the manufacturer's instructions. RNA Seq libraries were sequenced using Illumina NextSeq 500 generating 75 bp paired end reads for each sample. RNA Seq reads untrimmed. Differential expression analysis was performed using the CPM counts per million function in the Bioconductor package edgeR v 3.14.0. Low expression genes were excluded to make a simple correction for gene counts. Genes with P value instead of adjusted P value < 0.05 were assigned as differentially expressed. We identified differentially expressed genes DEGs between synchronized and non synchronized neurons in zebrafish dorsal pallium in response to CAS treatment. Synchronized neurons expressed much higher level of glutamate transporter genes slc17a7a slc17a6a while non synchronized neurons showed significantly higher expression of gad1b suggesting that synchronized neurons are primarily glutamatergic while non synchronized neurons are mainly GABAergic. Overall design: To distinguish neurons with synchronized or non synchronized calcium activity post CAS treatment TgHuC:H2B GCaMP6f fish of 4 wpf 5 wpf were fixed in a recording chamber containing extracellular fluid and subjected to two photon imaging and neurons were collected separately with glass pipette. RNA Seq libraries N=10 f…		pubmed:38519480	non syn 10 1	GSM8012747	source name:brain\|tissue:brain\|strain:TgHuC:H2B GCaMP6f\|cell type:neurons in dorsal pallium\|treatment:non synchronized in response to CAS\|geo loc name:missing\|collection date:missing	non syn 10 1	RNA Seq reads untrimmed. Differential expression analysis was performed using the CPM counts per million function in the Bioconductor package edgeR v 3.14.0. Low expression genes were excluded to make a simple correction for gene counts. Genes with P value instead of adjusted P value < 0.05 were assigned as differentially expressed. Assembly: danRer11 Supplementary files format and content: Excel file include readcounts values for each Sample.	brain	TgHuC:H2B GCaMP6f fish of 4 wpf 5 wpf were fixed in a recording chamber containing extracellular fluid and neurons with synchronized or non synchronized calcium activity post CAS treatment were identified by two photon imaging and collected separately with glass pipette.	Single cells were transferred to the lysis buffer solution. Total RNA was extracted using TRIzol Invitrogen and then purified on RNeasy columns Qiagen. Total RNA quality was assessed on a bioanalyzer Thermofisher. RNA Seq libraries N=10 for each group were prepared using the Illumina TruSeq Strand mRNA Prep Kit according to the manufacturer's instructions.	TgHuC:H2B GCaMP6f fish of 4 wpf 5 wpf were used.	tissue:brain\|strain:TgHuC:H2B GCaMP6f\|cell type:neurons in dorsal pallium\|treatment:non synchronized in response to CAS	GSM8012747	GSM8012747: non syn 10 1; Danio rerio; RNA Seq	GSM8012747 r1	GSM8012747	1	Single cells were transferred to the lysis buffer solution. Total RNA was extracted using TRIzol Invitrogen and then purified on RNeasy columns Qiagen. Total RNA quality was assessed on a bioanalyzer Thermofisher. RNA Seq libraries N=10 for each group were prepared using the Illumina TruSeq Strand mRNA Prep Kit according to the manufacturer's instructions.	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 2000	SRP483288		non-syn-10-1_S16_L003_R1_001.fastq.gz non-syn-10-1_S16_L003_R2_001.fastq.gz	fastq fastq	4498404600.0	14994682.0	GSM8012747 r1	0:150 1:150	A:1317989544;C:684597236;G:860222705;T:1635432063;N:163052	150	150		1317989544	684597236	860222705	1635432063	163052	SRX23170206	SRS20119603	SRA1784161	Neuroscience, School of Medcine, Tongji University, 42508444-9	Neuroscience, School of Medcine, Tongji University, 42508444-9												T	B	mate1 technical by mapping diff	illumina	nextseq_v2	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	China	2024-01-11	Multi-stage	Multi-stage	Brain	Nervous System
29822	29822	SRR27499204	SRX23170205	SRS20119602	SRP483288	PRJNA1063685	Patch Seq of synchronized and non synchronized neurons in zebrafish dorsal pallium in response to CAS treatment	GSE253039	Transcriptome Analysis	The goals of this study is to compare transcriptome profiles RNA seq of synchronized and non synchronized neurons in zebrafish dorsal pallium in response to CAS treatment.TgHuC:H2B GCaMP6f fish of 4 wpf 5 wpf were were fixed in a recording chamber containing extracellular fluid and neurons with synchronized or non synchronized calcium activity post CAS treatment were identified by two photon imaging and collected separately with glass pipette. Single cells were transferred to the lysis buffer solution. Total RNA was extracted using TRIzol Invitrogen and then purified on RNeasy columns Qiagen. Total RNA quality was assessed on a bioanalyzer Thermofisher. RNA Seq libraries N=10 for each group were prepared using the Illumina TruSeq Strand mRNA Prep Kit according to the manufacturer's instructions. RNA Seq libraries were sequenced using Illumina NextSeq 500 generating 75 bp paired end reads for each sample. RNA Seq reads untrimmed. Differential expression analysis was performed using the CPM counts per million function in the Bioconductor package edgeR v 3.14.0. Low expression genes were excluded to make a simple correction for gene counts. Genes with P value instead of adjusted P value < 0.05 were assigned as differentially expressed. We identified differentially expressed genes DEGs between synchronized and non synchronized neurons in zebrafish dorsal pallium in response to CAS treatment. Synchronized neurons expressed much higher level of glutamate transporter genes slc17a7a slc17a6a while non synchronized neurons showed significantly higher expression of gad1b suggesting that synchronized neurons are primarily glutamatergic while non synchronized neurons are mainly GABAergic. Overall design: To distinguish neurons with synchronized or non synchronized calcium activity post CAS treatment TgHuC:H2B GCaMP6f fish of 4 wpf 5 wpf were fixed in a recording chamber containing extracellular fluid and subjected to two photon imaging and neurons were collected separately with glass pipette. RNA Seq libraries N=10 f…		pubmed:38519480	non syn 22	GSM8012746	source name:brain\|tissue:brain\|strain:TgHuC:H2B GCaMP6f\|cell type:neurons in dorsal pallium\|treatment:non synchronized in response to CAS\|geo loc name:missing\|collection date:missing	non syn 22	RNA Seq reads untrimmed. Differential expression analysis was performed using the CPM counts per million function in the Bioconductor package edgeR v 3.14.0. Low expression genes were excluded to make a simple correction for gene counts. Genes with P value instead of adjusted P value < 0.05 were assigned as differentially expressed. Assembly: danRer11 Supplementary files format and content: Excel file include readcounts values for each Sample.	brain	TgHuC:H2B GCaMP6f fish of 4 wpf 5 wpf were fixed in a recording chamber containing extracellular fluid and neurons with synchronized or non synchronized calcium activity post CAS treatment were identified by two photon imaging and collected separately with glass pipette.	Single cells were transferred to the lysis buffer solution. Total RNA was extracted using TRIzol Invitrogen and then purified on RNeasy columns Qiagen. Total RNA quality was assessed on a bioanalyzer Thermofisher. RNA Seq libraries N=10 for each group were prepared using the Illumina TruSeq Strand mRNA Prep Kit according to the manufacturer's instructions.	TgHuC:H2B GCaMP6f fish of 4 wpf 5 wpf were used.	tissue:brain\|strain:TgHuC:H2B GCaMP6f\|cell type:neurons in dorsal pallium\|treatment:non synchronized in response to CAS	GSM8012746	GSM8012746: non syn 22; Danio rerio; RNA Seq	GSM8012746 r1	GSM8012746	1	Single cells were transferred to the lysis buffer solution. Total RNA was extracted using TRIzol Invitrogen and then purified on RNeasy columns Qiagen. Total RNA quality was assessed on a bioanalyzer Thermofisher. RNA Seq libraries N=10 for each group were prepared using the Illumina TruSeq Strand mRNA Prep Kit according to the manufacturer's instructions.	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 2000	SRP483288		non-syn-22_S1_L001_R1_001.fastq.gz non-syn-22_S1_L001_R2_001.fastq.gz	fastq fastq	2450883300.0	8169611.0	GSM8012746 r1	0:150 1:150	A:717072489;C:371259220;G:487966761;T:874532663;N:52167	150	150		717072489	371259220	487966761	874532663	52167	SRX23170205	SRS20119602	SRA1784161	Neuroscience, School of Medcine, Tongji University, 42508444-9	Neuroscience, School of Medcine, Tongji University, 42508444-9												T	B	mate1 technical by mapping diff	illumina	nextseq_v2	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	China	2024-01-11	Multi-stage	Multi-stage	Brain	Nervous System

Advanced export

JSON shape: default, array, newline-delimited

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;